CFCI - University of Massachusetts Lowell

COMMITTEE OF 

FEDERATED 

CENTERS AND 

INSTITUTES 

ANNUAL REPORT 2006-2007

COMMITTEE OF FEDERATED CENTERS AND INSTITUTES 

October 18, 2007 

We are pleased to provide the enclosed collection of annual reports from members of 

the Committee of Federated Centers and Institutes (CFCI). The reports describe and 

document the powerful and innovative research and outreach conducted in 2006-2007 by 31 

CFCI centers and institutes. Each report also includes explanation of how annual funding 

from CFCI to the center or institute was used to enhance research and outreach, support 

graduate and undergraduate students, and pursue external funding. 

In addition to the work of individual centers, CFCI held 9 directors meetings where 

7 centers were reviewed in the 2006-2007 school year. We were pleased to find that these 7 

centers continue to develop in positive and collaborative directions. We are also pleased to 

welcome a new center to our ranks. The Center for High-rate Nanomanufacturing applied 

for membership, presented its research, and was approved by the unanimous vote of the 

members. 

The 2006-2007 CFCI course release initiative was targeted to new faculty sponsored 

by CFCI directors to work in their centers. Four applications were reviewed and selected by 

a peer review committee. Recipients of the course releases reported significant involvement 

in the work of their host centers, and the program has been renewed for the 2007-2008 

academic year with a continued focus on new faculty. 

CFCI continues to be vital network of innovative research, funding and service 

activities in support of the University’s mission. We hope you will find this report of CFCI 

work a demonstration of that contribution. Please let us know if you need additional 

information. 

Judith Boccia 

Craig Amiento 

O’Leary Library, 61 Wilder Street, Lowell MA 01854-3047 

Telephone: 978-934-4650 Fax: 978-934-3002

TABLE OF CONTENTS 

1. ADVANCED ELECTRONICS TECHNOLOGY CENTER............................................................ 3 

2. CENTER FOR ADVANCED MATERIALS............................................................................. 11 

3. CENTER FOR ATMOSPHERIC RESEARCH ......................................................................... 28 

4. CENTER FOR BIOGRADABLE POLYMER RESEARCH ........................................................ 46 

5. CENTER FOR BIOMOLECULAR AND MEDICAL INFORMATICS........................................... 50 

6. THE CENTER FOR CELLULAR NEUROBIOLOGY AND NEURODEGENERATION RESEARCH. 55 

7. CENTER FOR COMPLEX ENVIRONMENTAL SYSTEMS....................................................... 61 

8. CENTER FOR COMPUTER MACHINE/HUMAN INTELLIGENCE, NETWORKING & 

DISTRIBUTED SYSTEMS...................................................................................................... 75 

9. CENTER FOR ELECTRIC CAR AND ENERGY CONVERSION............................................... 89 

10. CENTER FOR ELECTROMAGNETIC MATERIALS AND OPTICAL SYSTEMS........................ 97 

11. CENTER FOR FAMILY, WORK, AND COMMUNITY......................................................... 106 

12. CENTER FOR FIELD SERVICES AND STUDIES............................................................... 131 

13. CENTER FOR GREEN CHEMISTRY ............................................................................... 139 

14. CENTER FOR HEALTH AND DISEASE RESEARCH ......................................................... 165 

15. CENTER FOR INDUSTRIAL COMPETITIVNESS............................................................... 171 

16. THE CENTER FOR INTELLIGENT BIOMATERIALS......................................................... 192 

17. CENTER FOR NETWORK AND INFORMATION SECURITY............................................... 207 

18. CENTER FOR PUBLIC HEALTH RESEARCH AND HEALTH PROMOTION ......................... 222 

19. CENTER FOR SUSTAINABLE ENERGY .......................................................................... 238 

1

20. CENTER FOR WOMAN AND WORK.............................................................................. 248 

21. COMBUSTION LABORATORY....................................................................................... 267 

22. INSTITUTE FOR NANOSCIENCE AND ENGINEERING TECHNOLOGY .............................. 272 

23. INSTITUTE FOR PLASTICS INNOVATION....................................................................... 281 

24. INSTITUTE FOR VISUALIZATION AND PERCEPTION RESEARCH .................................... 285 

25. THE KERR ERGONOMICS INSTITUTE........................................................................... 291 

26. LOWELL CENTER FOR SUSTAINABLE PRODUCTION .................................................... 313 

27. BIOMANUFACTURING CENTER AND INSTITUTE FOR PLASTICS INNOVATION................ 335 

28. PHOTONICS CENTER................................................................................................... 367 

29. RADIATION LABORATORY........................................................................................... 380 

30. TOXICS USE REDUCTION INSTITUTE........................................................................... 393 

31. TSONGAS INDUSTRIAL HISTORY CENTER ................................................................... 410 

2

1. ADVANCED ELECTRONICS TECHNOLOGY 

CENTER (AETC) 

Annual report (2006-2007 Academic Year) 

Mission Statement 

The AETC was established in November of 1990 by a seed grant from the MITRE 

Corporation. AETC sees its educational mission in giving an opportunity to all ages of 

school students to try scientific topics, to study engineering. This program, called Young 

Engineers Academy, was initiated in 1988. In spring semester of 1996 for the first time a 

group of 10-12 year old school students joined this Science and Technology Early Reachout 

program. Educational tree developed by our center has at roots elementary and 

middle school students, which will be active later in our Gifted High School program (the 

body of the tree) and then eventually become freshmen and graduate students of UMASS 

(research productive top of the tree). In its educational mission, the Center promotes 

graduate, undergraduate, and high school research. After exposure to a number of years 

in professional training, students are ready to the challenges of a technology-oriented 

workplace. In 2003 and 2004 the first two doctoral degrees were awarded to students 

associated with Young Engineers Academy, namely, Joel Therrien and David Kharas. In 

September 2005 Joel Therrien had joint ECE Department as Assistant Professor. 

Development of reliable manufacturing for giga-scale miniaturization technology is 

the task to be performed in linkage with supporting companies as M/A-COM, Raytheon, 

RFMD, Skyworks, and others. AETC contributes to UMASS technology transfer and 

applied research, yet working at the same time in such fundamental fields as solid-state 

physics and quantum electronics. 

AETC goals during 2006-07 academic year were commercialization of new 

transistor technology and expedited commercialization of IR imaging technology for biomedical 

applications. Renew of the operation of “Young Engineers Academy” outreach 

program was also a very important task during 2006-07 academic year. 

Current research focuses on: 

1. High Electron Mobility Transistors (HFETs) with Tailored Field (TF). 

2. Development of novel quantum well transistors. 

3. Infra Red imaging for medical applications. 

4. Design of completely automated fingerprint equipment. 

4. Polymer based thin film solar cells. 

ADVANCED ELECTRONICS TECHNOLOGY CENTER 

3

Associated Faculty: 

S.Mil’shtein, Professor, ECE Dept., Director of AETC 

A. Elbirt, Assistant Professor, Computer science ECE Dept., Co-Director of Computer Security Lab. 

S. Paikowsky, Professor, ME dept. 

D. Schmidt, Assistant Professor, PE dept. 

V. Kijewski, Associate Professor, College of Management 

B. Nelson, Assstant Professor, College of Management 

Technical Staff of associated companies. (involved part-time in AETC research). 

M. Rosenblum, Ph.D. ASE 

P.Ersland, M.Sc. 

M/A-COM 

C. Formosis, Ph.D M/A-COM 

B. Rizzi, Ph. D. M/A-COM 

F. Rose, M. Sc, Raytheon 

M. Adlerstein, Ph.D. Raytheon 

S. Broadband, M.Sc Silvaco Ltd. 

C.Paludi, M.Sc. 

Telledine Co. 

D. Teeter, Ph.D. RFMD Ltd. 

F. Schindler RFMD Ltd. 

L. Long, M. Sc. Homeland Sec. Cons. 

Student Interaction 

In the reported year 2 doctoral, 11 master degree and 2 undergraduate students have 

been working at AETC. Since most of the financial support comes from local companies, 

all students of the AETC work part time during academic year and full time in summer at 

the research laboratories of the companies, MACOM/Tycoelectronics, Raytheon Co, 

RFMD Co. 

The AETC students are encouraged to participate in conferences and be part of best 

student papers competitions. In these cases, students are asked to do most of the work in 

writing their papers. The following projects were in work: 


4

Graduate Students during 2006-2007 Academic Year 

Ph. D: 

1) C. Liesner “High Frequency Switches and Mixers.” Ph.D. 

2) J. Palma “Quantum Well Transistors with Tailored Field” Ph.D. 

M. Sc: 

1) B. Ortiz, “Reliability of pHEMTs”, M.Sc. 

2) J. Cheasa, “Design of pHEMTs”, M.Sc. 

3) H. Bui, “Daugherty Amplifier”, M.Sc. 

4) A. Cury, “Bipolar Transistor with Quantum Well Base”, M.Sc. 

5) P. Kurwala, “Transistor with Razor Gate”, M. Sc. 

6) A. Pillai, “Line Scanninig and Recognition Algorithm for Fingerprinting” M.Sc. 

7) A. Shendai, “IR Scanner”, M.Sc. 

8) J. Valensuela, “Polymer Based Heterostructured Solar Cells”, M.Sc. 

9) B. Putnam, “Novel Optical Alignment for Fiber Networks”, M.Sc. 

10) F. Rose, “ Tunable RF Matching Based on Micro-machine Components”, M.Sc. 

B.Sc. Students working on graduation design projects 2005-2006 Academic Year 

1) V. Piper, ”Design Principals of Linear Amplifier ”, (2007) 

2) M. Baier, ”Automatic Control of Scanning Equipment”, (2007) 

AETC Interaction with Industrial Companies and UMass Centers 

Joint team of company’s technical staff and university researchers do all of the 

research and development projects. 

1. “High Frequency Circuits Based on Quantum Well Transistors” with M/A-COM. 

2. “Single and Multy-Gate HEMTs with Tailored Field” with M/A-COM. 

3.” Infra Red Scanner for Medical Applications” with Leominster hospital (UMass 

Medical School) 


5

Companies Working with the AETC 

ASE of America 

M/A-COM 

RFMD Ltd. 

Silvaco Ltd 

Skyworks Co 

Raytheon 

2006-2007 Funding 

1) “Initial Phase of Commercialization of New Transistor Technology”, MTTC, $5,000 

(2006). 

This one of five awards in Massachusetts is supervised together with Prof. B. Nelson and 

Mr. P. Wormcer). 

2) “Development of IR Mammography”, UMass CVIP, $20,000 (2006). 

This one of four awards in UMass is supervised together with Mr. P. Wormcer). 

3) “Commercialization of New Transistor Technology”, MTTC, $40,000 (2006). 

This one of seven awards in Massachusetts. 

4) “Design and Fabrication of HEMT with Field Plates”, MACOM, 32,319 (2006) 

7) “Design and Fabrication of HEMT with Field Plates”, MACOM, 33,061 (2007) 

Technology Transfer 

As mentioned in the Mission Statement, the research product of AETC target 

development of novel semiconductor devices, new semiconductor processing and testing 

in such a way, that any semiconductor company willing to implement novel development 

would do so at minimal cost and time. In reported period, AETC generated three patent 

applications (see public. list). Transistor with Tailored Field developed by AETC remains 

to be the central part of a joint program with MA/COM and Skyworks Ltd. 

Publications and Registered Patents (2006 – 2007) 

1) S. Mil’shtein “Infrared Scanning for Biomedical Applications,” Scanning 


6

28, 5, 274-277 (2006) 

2). J. Palma, C. Liessner, and S.Mil’shtein “Contactless Optical Scanning of Fingerprints 

with 180° View”, Scanning, 28, 6, 301-304 (2006) 

3) C. Liessner, J. Barrett, J. Palma, D.Gleason, and S. Mil'shtein“Improving FET Switch 

Linearity” IEEE Trans. Electr. Dev., 54, 3,391-397 (2007) 

4) S. Mil’shtein, N. Luo, “Infra-Red Scanner for Biological Applications”, 

Patent# 14,495351 (2006); International Patent (class A61, B00, 600) 6,028,719/US 

was granted in March 2007 

5) S. Mil’shtein and P. Ersland, “Progress of Quantum Electronics and Future of Wireless 

Technologies”, review paper, accepted,Intern. Conference on Low Dimensional 

Structures and Devices (LDSD-2007), Apr. 17,2007 

6) S. Mil’shtein, A. Churi and J. Palma, “Bipolar Transistor with Quantum Well Base”, 

accepted,Intern. Conference on Low Dimensional Structures and Devices (LDSD-2007), 

Apr. 18, 2007 

7) S. Mil’shtein, J. Palma, C. Liessner, and C. Gil, “Light Emission from Semiconductor 

Triode”, accepted, Intern. Conference on Low Dimensional Structures and Devices 

(LDSD-2007), Apr. 19,2007 

8) S. Mil’shtein, A. Churi and A. Shendye, “Infra-Red Medical Imaging. Like x-rays, 

only better!” 2nd Intern. Bio Convention, May 9, 2007 

Non-refereed Publications and Patent Applications (2005 – 2006) 

1) S. Mil’shtein, A. Pillai, J. Palma, C.Liessner and M. Baier, “Line Scanner for 

Biometric Applications”, IEEE Homeland Security Confer., May 17, 2007 

2) Hien D. Bui, Douglas A. Teeter, David Widay, and Sam Mil’shtein, “The Doherty 

Power Amplifier with Collector Current and Voltage Controls for Handset Application”, 

accepted, IEEE Bipolar/BiCMOS Circuits and Techn. Conference, Aug. 26, 2007 

3) Chris Liessner, “Light Emission from novel Semiconductor Triode”, Ann. UMass 

Res. Confer. p.62, 2007 


7

4) Anup Pillai, “Line Scanner for Biometric Applications”, Ann. UMass Res. Confer, p 

.72, 2007 

5) Ameya Shendye, “Quantization Regime in the emitter and base of HBT”, Ann. 

UMass Res. Confer. p 73, 2007 

6) Amey Churi, “Bipolar Transistor with Quantum Well Base”, Ann. UMass Res. 

Confer. p 74, 2007 

7) Mike Baier, “Linear BJT Amplifier with minimized energy consumption”, Ann. 

UMass Res. Confer. p. 76, 2007 

8) John Palma, “ Novel high breakdown voltage HEMT”, Ann. UMass Res. Confer. p. 

88, 2007 

9) Parag Kurlawala, “Transistor with 0.08μm gate”, Ann. UMass Res. Confer. p. 90, 

2007 

Recognition of AETC 

Prof. S. Mil’shtein continues to serve as a member of the Editorial Board of 

“Scanning” Journal, where he is responsible for publications in the area of electronics, 

nanotechnology and, bio-engineering. The research activities of AETC in the field of 

quantum electronics resulted in continuation of Prof. S Mil’shtein 

work in the organizing committee of several international conferences; the next 

Conference on Low Dimensional Structures and Devices 2008 (LDSD-2008). The 

conference covers design and development of quantum electronics, optoelectronics and 

quantum computing. 

Prof. S. Mil’shtein is selected to serve as a book reviewer for Oxford Press, science 

division; he is also a reviewer of several leading electronic journals. 

Professor S. Mil'shtein was again elected for the coming in December 2007 issue of 

WHO IS WHO AMONG AMERICAN TEACHERS, as a "teacher who made a 

difference". One can be nominated into this prestigious publication only by former and 

current students, who excelled themselves by being on the National Dean's List. Starting 

from year 2000 Prof. S. Mil'shtein is listed in WHO IS WHO AMONG AMERICAN 

TEACHERS as "Multiple Year Honoree". 

New Directions 

Few novel HEMTs with Field Plates were designed, fabricated and tested. New 

Quantum electronic Bipolar Junction Transistors were designed and expected to be 

fabricated during 2007-08 academic year. Last year, the Infrared mammography 

machine was designed to be completely automatic and computerized. However, the 


8

mammography tests are subject of the Critical Board Review of UMass medical school. 

We plan to perform the mammography tests during 2007-08 academic year. 

In Fall of 2006, the outreach “Young Engineers Academy” program was 

revitalized. Nashoba High School students supervised by Prof. S. Mil’shtein and teachers 

of the School build the solar powered car and solar powered commuting bike. This 

activity of “Young Engineers Academy” was highlighted by few local newspapers. 

REPORT FOR THE PROJECT: 

Study and Design of IR System for Mammography Applications 

Performed during Academic year 2006-07, submitted to CFCI 

by 

S. Mil’shtein, AETC, ECE Dept., UMASS 

Samson_Milshtein@uml.edu (978) 934-3310 

The great interested in using infrared imaging for biological and medical applications is 

motivated by harmless interaction of small portions of infrared radiation with biological 

objects. 

The basic infrared imaging setup was designed to have an infrared led sources with 

variable wavelengths; infrared camera and a screen to display the pictures from the 

camera. Initially we designed a machine which had an elevated base to hold the light 

source beneath and a manual rotating arm holding the camera which would rotate about 

180 degrees in a plane perpendicular to the plane of the object. That way we were 

allowed to observe the object under illumination at different angles. The main goal to 

view the object at different angles is to collect all the information that might be otherwise 

lost due to internal scattering of light through the object. In order to change the 

wavelength of the light source, a circular disc was designed. This circular disc holds the 

led’s with different wavelengths where the disc is attached to a servo motor controlled by 

the computer. To scan the biological object, the arm with the camera is rotated by the step 

motor. The movements of the camera are also controlled by the computer. An image 

enhancement and reconstruction algorithm are applied by combining all the pictures 

taken at different wavelengths to display the final enhanced picture. The signal coming 

out from the camera is in analog format. In order to convert it into digital format a 64 bit 

high quality data card is used which provides for high quality images. In order to display 

high quality image from the camera a HDTV is used which has a very high contrast ratio. 


9

The image displayed below is taken by keeping the palm perpendicular to the plane of the 

light source. This image is a snapshot of a 20 second long video. Very Large size of the 

video file does not allow attaching it to the document. Otherwise, the beautiful dynamics 

of moving fingers, bones and tendons is visualized. The position of the palm is not 

exactly on top of the source but slightly away from the source such that the palm is 

between the camera and the source. The camera in this case is about an angle of 80 

degrees from its vertical position. 

The visualization of moving bones and tendons in real time is impossible in X-Ray 

imaging. IR Imaging allows simultaneous visualization of both, soft and hard 

tissues. It should be mentioned that object as tendons are not visible in X-Ray and could 

be visible only in expensive CAT SCAN. 

The Infrared mammography machine was designed to be completely automatic and 

computerized. However, the mammography tests are subject of the Critical Board Review 

of UMass medical school. We plan to perform the mammography tests during 2007-08 

academic year. 


10

2. CENTER FOR ADVANCED MATERIALS 

CFCI Annual Report 

2006/2007 

1. Mission Statement 

Founded in 1992, the Center for Advanced Materials (CAM) has become the focus of 

advanced materials synthesis and characterization at UMass Lowell. CAM is an 

association of scientists, engineers, and technicians encompassing a wide range of 

technical disciplines that overlap UMass Lowell's Colleges of Arts and Sciences and 

Engineering. The Center has been established as a multi-disciplinary research and 

resource center, bringing together state-of-the-art instrumentation, facilities and expert 

personnel. Its goal is the development of a knowledge base in the design, synthesis, 

characterization and intelligent processing of advanced materials, driven by the needs of 

potential technological applications. CAM adds in a significant and fundamental manner 

to the University’s mission in the creation of a sustainable industrial economy. 

Activities in Memory of Sukant Tripathy 

Each year, the Center for Advanced Materials sponsors several activities in memory of 

the late Sukant Tripathy, a founder and Director of CAM and former UMass Lowell 

Provost. Dr. Tripathy died in a swimming accident at North Kohala, Hawaii on 

December 12, 2000. 

Sukant Tripathy Annual Memorial Symposium 

This annual event brings together researchers and colleagues from universities 

and industries, as well as former and present students and associates of the Center 

to discuss latest research activities in materials science. On 12/1/06, a sixth 

anniversary symposium was held. The speakers were: Dr. Zakya Kafafi (Naval 

Research Laboratory), Russell Gaudiana/Dr. Z. Zhu (Konarka Technologies, 

Lowell, MA), Dr. Phillip Westmoreland (University of MA Amherst), Dr. Bal 

Ram Singh (University of MA Dartmouth), Dr. Gregory Sotzing (University of 

Connecticut), Dr. David Kaplan (Tufts University), Dr. Kirpal Bisht (University 

of South Florida), Dr. Randy Holmes-Farley (Genzyme Corporation). 

Tripathy Memorial Summer Graduate Fellowship 

An endowed memorial fund that will lead to graduate research fellowships for 

outstanding graduate students in the last year of a Ph.D. program has been 

established in Dr. Tripathy’s name. This fund, to date, has led to the award of 

eight fellowships for summer support. The winners of this prestigious award in 

2007 were Yanping Wang and Dingsong Feng. 

Center for Advanced Materials 

11

Sukant K. Tripathy Endowed Memorial Lecture 

In addition, an endowment fund for an annual endowed lectureship has been 

established. Each year, near the time of Tripathy’s death, a leading scientist in 

the area of polymer science or related materials science comes to UMass Lowell 

and presents a lecture. The fifth lecture, held on November 2, 2006, was given by 

Professor Edwin L. Thomas, Morris Cohen Professor and Department Head, 

Materials Science and Engineering Dept., Massachusetts Institute of Technology, 

Cambridge, MA. 

Susan Thomson-Tripathy has played an important role in these activities. 

2. General Description and Goals 

The Center for Advanced Materials is an association of approximately 30 faculty, 

research associates, technical specialists, and graduate and undergraduate students 

engaged in research on advanced materials that are primarily polymers, organic dyes, and 

ceramics. CAM has major instrumentation in areas of microscopy, diffraction, 

spectroscopy, including laser sources and nuclear magnetic resonance, and 

electrochemistry. 

CAM is committed to excellence in its programs such that they will bring national and 

international recognition to UMass Lowell. The means to this end involve keeping and 

expanding research support for our programs and our state-of-the-art instrumentation. 

3. Research Focus Areas 

Dr. Jayant Kumar, director of CAM, conducts research in the focus areas of optical and 

electronic properties of materials with emphasis on organic and polymeric materials. He 

has also been involved in processing and characterization of polymeric and organic 

materials and their applications in optical and electronic devices, as well as polymers 

with flame retardant properties. 

Dr. Daniel J. Sandman, associate director, leads a group of researchers involved in the 

synthesis and physico-chemical study of conjugated polymers of interest for electrical 

and optical properties, and the use of sugars for synthesis of conjugated polymers. 

The Dr. James Whitten’s group is performing fundamental research in the areas of surface 

science and surface modification. In particular, we are interested in conjugated polymer 

interfaces, including those between polymers and metals and between polymers and other 

organic layers. The chemistry and electronic structure of these interfaces can dramatically 

affect the efficiency of organic electronic devices, and the research we are performing can 

lead to improvements in devices such as organic field-effect transistors and photovoltaics. 


12

Dr. Ashok Cholli, Director of the Nuclear Magnetic Resonance Center has been on a 

leave of absence since Jan 1, 2004, serving as Chief Technology Officer of Polnox 

Corporation, a company founded and incorporated based on the research work Dr. Cholli 

conducted through the Center for Advanced Materials. The University has an equity 

interest in Polnox. 

Dr. Long Chiang’s focus areas include the design and synthesis of starburst nonlinear 

photonic fullerene derivatives; the design and synthesis of near-infrared absorbing 

emerald green fullerenes for near-infrared sensing and imaging, near-infrared filter, and 

broadband photovoltaic devices; the design and synthesis of multiphoton absorptive 

fullerene-fluorene chromophores for nonlinear photonic sensor protection and optical 

limiting applications. 

4. Associated Personnel 

Director: 

Professor Jayant Kumar, Department of Physics and Applied Physics 

Associate Director 

Professor Daniel J. Sandman, Department of Chemistry 

Associated Faculty and Research Faculty: 

Professor James Whitten, Department of Chemistry 

Dr. Ashok Cholli, NMR Laboratory Director 

Professor Emeritus Arthur Watterson, Department of Chemistry 

Professor Emeritus Alexandre Blumstein, Department of Chemistry 

Professor Long Chiang, Department of Chemistry 

Adjunct: Dr. Lynne A. Samuelson 

Staff: 

Technical Specialists: 

Milton Downey 

Daniel Oblas 

Sandip Sengupta 

Post-Doctoral Research Associates: 

Ravi Mosurkal 

Ke Yang 

Robinson Anandakathir 

Lian Li 

Mukesh Pandey 

Administrative Support: 

Michele Vercellin 


13

Rita Kelleher 

5. New and Temporary Faculty Affiliations: Professor Virinder S. Parmar, Department 

of Chemistry, University of Delhi. Professor George Parodi, St. Anselm College in 

Manchester, NH, worked with the Whitten group and in the Center for Advanced 

Materials as a visiting professor during the summer of 2006. He performed research 

related to near-field scanning optical microscopy. 

6. Student Research Support 

Graduate Students/Research Assistants: 

Xiaoyu Wang (supported by CFCI) 

Yanping Wang 

Fadong Yan 

Subhalakshmi Nagarajan 

Yan Ge 

Seaho Jeon 

Mario Cazeca 

Rahul Tyagi 

Abhishek Kumar 

Pil Ho Huh 

Amol Chandekar 

7. Current Research Projects 

(P.I. Kumar) 

Nanostructured Materials for Photovoltaic Applications 

Sponsor: U.S. Army Natick 

NMR Measurements 

Sponsor: Triton Systems, Inc. 

International Collaborative: Development of Characterization of Conjugated Polymer 

Films Suitable for Photovoltaic Devices 

Sponsor: National Science Foundation 

Polymer Characterization 

Sponsor: Polnox Corporation 

NMR Spectroscopy Measurements 

Sponsor: Konarka Technologies, Inc. 


14

Mobility Measurements on Liquid Crystalline Oligomers 


Animal Testing on Polycatechins 

Sponsor: CIP - University of MA Lowell 

Enzymatically Synthesized Novel Oligomeric Catechins for Breast Cancer Treatment 

Sponsor: U.S. Army Medical Research and Material Command 

Biocatalytic Polymerization of Naturally Occurring “Green Tea” Flavonoids for Anticancer 

Applications 

Sponsor: U.S. Environmental Protection Agency 

A Novel Method of Patterning Substrates Using Photo-Fabricated Surface Relief 

Structures in Azo-Polymer Films 

Sponsor: UMass President’s Office CVIP Grant 

Fabrication of Sub-Micron-Scale Electronic and Photonic Structures Using Direct Photo- 

Patterning Techniques 


Analytic Equipment Use at UML 


(P.I. Sandman) 

Research and Engineering Apprentice Program 

Sponsor: Academy of Applied Sciences 

Approaches to Structurally Ordered Conjugated Macromoleculesvia Solid State Pol. 


Nanocrystals of Thermochromic Polydiacetylenes and Phthalocyanines; 

Electrophilic Sugar Reagents in Conjugated Polymer Synthesis. 

(P.I. Whitten) 

Surface Analysis of ZnO Nanoparticles 

Sponsor: Natick Army Soldier Center Research Laboratory 

Studies of Interfaces between Conjugated Oligomers and Self-Assembled Monolayers 

Sponsor: Sponsor: Petroleum Research Fund 


15

(P.I. Chiang) 

Starburst Nonlinear Photonic Fullerene Derivatives 

Sponsor: Air Force Office of Scientific Research (AFOSR) 

8. Publications 

(Kumar) 

“Polydiacetylene/TiO2 Nanocomposites for Photovolatic Applications” (Y. Wang, L. 

Li, F. Yan, L. A. Samuelson, J. Kumar), Polymeric Materials: Science and Engineering, 

96, pp. 809-810, 2007. 

“Synthesis of Polyaniline Derivatives via Biocatalysis” (S-C. Kim, P. Huh, J. Kumar, B. 

Kim, J-O. Lee, F. Bruno, L. Samuelson), Green Chemistry, 9, pp. 44-48, 2007. 

“Design and Synthesis of Novel Amphilic Polymers for MRI and Selective Targeting in 

Cancer Diagnosis/Therapy” (M. Pandey, R. Tyagi, R. Kumar, V. S. Parmar, A. C. 

Watterson, J. Kumar, M. T. Hardiman, J. Zhou, K. P. Brower, R. J. Fisher, C. K. 

Colton), Polymeric Materials: Science and Engineering, 96, pp. 855-856, 2007. 

“Biocatalytic Sythesis of Organo-Siloxane Copolymers for Flame Retardant 

Applications” (R. Mosurkal, V. Tucci, L. A. Samuelson, F. Bruno. P. R. Westmoreland, 

J. Kumar, A. Watterson), Polymer Preprints, ACS Division of Polymer Chemistry, 

47(2), pp. 1110-1111, 2006. 

“Facile Patterning of Period Arrays of Metal Oxides” (M. Kim, B. Kang, S. Yang, C. 

Drew. L. A. Samuelson, J. Kumar), accepted Advanced Materials, 2006. 

“Spectroscopic and Microscopic Analysis of Photo-Cross-Linked Vinylbenzylthymine 

Copolymers for Photoresist Applications” (S. Trakhtenberg, J. C. Warner, R. Nagarajan, 

F. F. Bruno, L. A. Samuelson, J. Kumar), Chem. Mater., Vol. 18, pp. 2873-2878, 2006. 

“Formation Mechanism of Surface Relief Structures on Amorphous Azopolymer Films” 

(K. Yang, S. Yang, J. Kumar), Physical Review B 73, pp. 1652041-2, 2006. 

“Self-Doped Polyaniline/Poly(diallydimethyl ammonium chloride) Complex: N-Type 

Doping with High Stability” (S-C. Kim, D. Sandman, J. Kumar, F. F. Bruno, L. A. 

Samuelson), Chemistry of Materials, Vol. 18, No. 9, pp. 2201-2204, 2006. 

“Hydrophobic Barrier: Molecular Self-Assembly of Amphiphilic Polyacetylenes within 

Aluminosilicate Nanoplatelets” (D. W. Kim, B-C. Kim, D. Steeves, R. Nagarajan, a. 


16

Blumstein, J. Kumar, P. W. Gibson, J. A. Ratto, L. A. Samuelson), Journal of 

Membrane Science, Vol. 275, pp. 12-16, 2006. 

“Synthesis and Modeling of Acridine Dyes as Potential Photosensitizers for Dye- 

Sensitized Photovoltaic Applications” (R. Mosurkal, L. Hoke, S. A. Fossey, L. A. 

Samuelson, J. Kumar, D. Waller, R. Gaudiana), submitted to Journal of 

Macromolecular Science, Pure and Applied Chemistry, 2006. 

“Formation Mechanism of Surface Relief Structures on Amorphous Azopolymer Films” 

(K. Yang, S. Yang, J. Kumar), Physical Review B, 73, pp. 165204-1 – 165204-14, 2006. 

“Self-Assembly and In-Situ Polymerization of Amphiphilic Diacetylene for Hole 

Transport in Solid State Dye-Sensitized Solar Cells” (Yanping Wang, Ke Yang, Xiaoyu 

Wang, Ramaswamy Nagarajan, Jayant Kumar and Lynne A. Samuelson), Organic 

Electronics, submitted 2006. 

“In-Situ Polymerized Carboxylated Diacetylene as a Hole Conductor in Solid-State 

Dye-Sensitized Solar Cells” (Yanping Wang, Ke Yang, Seong-Cheol Kim, Ramaswamy 

Nagarajan, Lynne A. Samuelson, and Jayant Kumar), Chemistry of Materials, submitted 

2006. 

“Biomimetic Synthesis of Water-Soluble Conducting Copolymers/Homopolymers of 

Pyrrole and 3,4 Ethylenedioxythiophene” (F. Bruno, S. Fossey, S. Nagarajan, R. 

Nagarajan, J. Kumar, L. A. Samuelson), Biomacromolecules, 7(2), pp. 586-589, 2006. 

“Synthesis of a Soluble Pentacene Derivative: 6,13bis(m-trifluoromethyl 

phenylethynl)pentacene” (R. Mosurkal, L. A.Samuelson, J. Kumar, D. Waller, R. 

Gaudiana), submitted to Org. Lett., 2006. 

Biocatalytic Synthesis of Water-Soluble Oligo(Catechins)” (F. Bruno, S. Nagarajan, R. 

Nagarajan, J. Kumar, L. Samuelson), Journal of Macromolecular Science, Part A: Pure 

and Applied Chemistry, A42 (11), pp. 1547-1554, 2006. 

“Photo-Cross-Linked Immobilization of Polyelectrolytes for Enzymatic Construction of 

Conductive Nanocomposites” (S. Trakhtenberg, Y. Hangun-Balkir, J. Warner, F. Bruno, 

J. Kumar, R. Nagarajan, L. A. Samuelson), Journal of the American Chemical Society, 

127 (25), pp. 9100-9104, 2006. 

(Sandman) 

X. Wang, J.E. Whitten, and D.J. Sandman, “Ultraviolet photoelectron spectroscopy 

studies of the thermochromic phase transition in urethane-substituted polydiacetylenes”, 

J. Chem. Phys., 126, 184905-1-5 (2007). 


17

C. Sae-Lim, D.J. Sandman, B.M. Foxman, and M. Sukwattanasinitt, “Synthesis and 

Crystallographic Study of 1,6-bis-(N-phenothiazinyl)-2,4-hexadiyne”, J. Macromol. Sci., 

Pure Appl. Chem., A43, 1929-1936 (2006). 

X. Wang, K. Yang. H. Ye, Y. Wang, J.S. Lee, and D.J. Sandman, “Methods for the 

Prreparation of Micro- and Nanocrystals of Urethane-substituted Polydiacetylenes”, J. 

Macromol. Sci., Pure Appl. Chem., A43, 1937-1943 (2006). 

X. Wang, D.J. Sandman, J. Kumar, J.S. Lee, “Urethane Substituted Polydiacetylene 

Microcrystals: Fabrication, Characterization, and Relation to Thermochromism”, 

Polymer Preprints, 47 (1), 474-475 (2006). 

J.M. Njus, C. Sae-Lim, and D.J. Sandman, “The Interaction of Cinnamic Acids with 60 Co 

Gamma Radiation”, Mol Cryst. Liq. Cryst., 456, 55-61 (2006). 

T. Okuno, K. Yamane, and D.J. Sandman, “Solid State Polymerization of Diacetylenes 

with Amide Groups”, Mol. Cryst. Liq. Cryst., 456, 45-53 (2006). 

T. Okuno, S. Ikeda, N. Kubo, and D.J. Sandman, “Solid State Polymerization of 

Diacetylenes Incorporating Ynamine Moiety”, Mol. Cryst. Liq. Cryst., 456, 35-44 (2006). 

(Whitten) 

X. Wang, J.E. Whitten, D.J. Sandman, ‘Ultraviolet Photoelectron Spectroscopy Study of 

the Thermochromic Phase Transition in Urethane-Substituted Polydiacetylenes” J. Chem. 

Phys., 126, 184905-1-184905-5 (2007). 

A.J. McNeil, P. Mueller, J.E. Whitten, T.M. Swager, “Conjugated Polymers in an Arene 

Sandwich”, J. Am. Chem. Soc., 128, 12426-12427 (2006). 

H. Ahn, M. Zharnikov, J.E. Whitten, “Abnormal Pinning of the Fermi and Vacuum 

Levels in Monomolecular Self-Assembled Films,” Chem. Phys. Lett., 428, 283-287 

(2006). 

A. Chandekar, S.K. Sengupta, C.M.F. Barry, J.L. Mead, J.E. Whitten, “Template-Directed 

Adsorption of Block Copolymers on Alkanethiol-Patterned Gold Surfaces”, Langmuir, 

22, 8071-8077 (2006). 

P.J. Bisson, G. Parodi, D. Rigos, J.E. Whitten, "Low-Cost Raman Spectroscopy using a 

Violet Diode Laser”, The Chemical Educator, 11, 88-92 (2006) 

P.J. Bisson and J.E. Whitten, "Studying Fast Reactions: Construction and Use of a Low- 

Cost Continuous Flow Instrument", J. Chem. Educ., 83, 1860-1863 (2006). 


18

(Chiang) 

Large Concentration-dependent Nonlinear Optical Responses of Starburst 

Diphenylaminofluorenocarbonyl methano[60]fullerene Pentaads, J. Mater. Chem. 2007, 

17, 1826-1838, Elim, H. I.; Anandakathir, R.; Jakubiak, R.; Chiang, L. Y.; Ji, W.; Tan, L. 

S. 

Starburst Encapsulation of C 60 by Multiple Hindered Two-Photon Absorptive 

Diphenylaminodialkylfluorene Arms, J. Macromol. Sci. A, Pure Appl. Chem. 2007, 

Anandakathir, R.; Tan, L.-S.; Chiang, L. Y. (accepted) 

Prolong Photoinduced Charge-Separated States in Starburst 

Tetra(Diphenylaminofluoreno)[60]Fullerene Adducts, El-Khouly, M. E.; Anandakathir, 

R.; Ito, O.; Chiang, L. Y. J. Phys. Chem. A 2007. (accepted, in press) 

Alternative Synthesis of C 60 -diphenylaminofluorene Derivatives for Nonlinear Photonic 

Applications: Method of Preparation and Characterization, J. Macromol. Sci. A, Pure 

Appl. Chem. 2007, Jeon, S. H.; Anandakathir, R.; Chiang,, J.; Chiang, L. Y. (accepted) 

Photoinduced Processes in a Tricomponent Molecule Consisting of 

Diphenylaminofluorene-Dicyanoethylene-Methano[60]fullerene, J. Phys. Chem. A, 2006, 

110, 884-891, El-Khouly, M. E.; Padmawar, P.; Araki, Y.; Verma, S.; Chiang, L. Y.; Ito. O. 

Synthesis and Characaterization of Two-photon Absorbing 

Diphenylaminofluorenocarbonyl-methano[60]fullerenes, J. Mater. Chem. 2006, 16, 1366- 

1378, Padmawar, P. A.; Canteenwala, T.; Tan, L.-S.; Chiang, L. Y. 

Unusual Photophysical Properties of Emerald Green [60]Fullerenes and Its Charge 

Complexes, Chem Lett. 2006, 35, 710-711, El-Khouly, M. E.; Canteenwala, T.; Araki, Y.; 

Ito, O.; Chiang, L. 

Synthesis and Langmuir-Blodgett Monolayer Characterization of Amphiphilic 

Oligo(ethylene glycol)-C 60 -hexadecaaniline Conjugate, Langmuir 2006, 22, 5366-5373, 

Tang, Z.; Padmawar, P. A.; Canteenwala, T.; Gao, Y.; Chiang, L. Y.; Wang, H.-L. 

Low Electron Reduction Potentials of Ethylated Emerald Green [60]Fullerene, Chem 

Lett. 2006, 35, 762-763, Canteenwala, T.; Wang, H.-L.; Chiang, L. Y. 

Comparison of Singlet Oxygen Generation Efficiency between Water-soluble C 60 - 

Diphenylaminofluorene Conjugates and Molecular Micelle-like FC 4 S, J. Macromol. Sci. 

A, Pure Appl. Chem. 2006, 43, 1955-1963, So, G.; Karotki, A.; Verma, S.; Pritzker, K.; 

Wilson, B.; Chiang, L. Y. 


19

Large Cross-section Enhancement and Intramolecular Energy Transfer upon Multiphoton 

Absorption of Hindered Diphenylaminofluorene-C 60 Dyads and Triads, Chem. Mater. 

2006, 18, 4065-4074, Padmawar, P. A.; Rogers, J. O.; He, G. S.; Chiang, L. Y.; 

Canteenwala, T.; Tan, L.-S.; Zheng, Q.; Lu, C.; Slagle, J. E.; Danilov, E.; McLean, D. G.; 

Fleitz, P. A.; Prasad, P. N. 

Synthesis and Characterization of Hexadecaaniline-grafted Comb-like Poly(maleic acidalt-1-octadecene), 

J. Macromol. Sci. A, Pure Appl. Chem. 2006, 43, 1945-1954, 

Anandakathir, R.; Canteenwala, T.; Wang, H. L.; Chiang, L. Y. 

8) Conference Presentations 

(Kumar) 

“Biocatalytic Synthesis of Organo-Siloxane copolymers for flame retardant applications” 

(Ravi Mosurkal, Vincent Tucci, Lynne A. Samuelson, Ferdinando Bruno, Virinder S. 

Parmar, Jayant Kumar, Phillip R. Westmoreland, Arthur Watterson), Poster presentation, 

ACS Conference, San Diego, Sep, 2006. 

“Single-Step Biocatalytic Synthesis of Sexithiophene”, (S. Nagarajan, R. Nagarajan, M. 

Cazeca, J. Kumar, F. Bruno, L. Samuelson), Poster Presentation at the ACS Fall Meeting, 

San Francisco, September 2006. 

“Biocatalytic synthesis of novel polymeric materials useful as flame retardants” (Ravi 

Mosurkal, Vincent Tucci, Lynne A. Samuelson, Jayant Kumar, Virinder S. Parmar, Phillip 

R. Westmoreland, Arthur Watterson), Invited talk presented at CARBO-XXI, Univ. of 

Delhi, Delhi, India, 29 November 2006. 

“Biocatalytic Synthesis of Flame Retardant Polymers” (Ravi Mosurkal, Vincent Tucci, 

Lynne A. Samuelson, Ferdinando Bruno, Jayant Kumar, Phillip R. Westmoreland, Arthur 

Watterson), Poster presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 

December 1, 2006. 

“Study of Thin Polymeric Film Deposited by the PECVD Process for Use at 193 nm” (M. 

Cazeca, R.W. Sabnis, J. Gow, C. Comptois, R. Nagarajan, A. Farnsworth, J-S. Sheu), 

Poster presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 12/1/06. 

“Creation of Gold Nono-Structures with Azopolymer Templates” (L. Li, F. Yan, M. 

Cazeca, L. Samuelson, J. Kumar), Poster presented at Sukant Tripathy Memorial 

Symposium, UMass Lowell, 12/1/06. 


20

“Fabrication of Well-Ordered AnO Arrays Patterning” (P. Huh, F. Yan, J. Kumar. L. 

Samuelson), Poster presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 

12/1/06. 

“Study of Rheology and Ionic Conduction of PEG-PU/Salt Solid Polymer Electrolyte 

(SPE)” (P. Huh, M. Choi, S. Ji, N. Jo, J. Lee), Poster presented at Sukant Tripathy 

Memorial Symposium, UMass Lowell, 12/1/06. 

“Measurement of Electron and Hole Mobility of Regioregular Poly(3-hexylthiophene) by 

the Time of Flight Method” (K. Yang, Y. Wang, A. Jain, L. Samuelson, J. Kumar), Poster 

presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 12/1/06. 

“Characterization of Polydiacetylene TiO2 Nanocomposites and Their Photovoltaic 

Applications” (Y. Wang, L. Li, F. Yan, K. Yang, L. Samuelson, J. Kumar), Poster 


Biocatalytic Modification of Naturally Occurring Iron Porphyrin as a Renewable 

Catalyst” (S. Nagarajan, R. Tyagi, R. Nagarajan, J. Kumar, A. Watterson. F. Bruno, L. 

Samuelson), American Chemical Society (ACS) 233 rd Spring Meeting at Chicago, March 

2007. 

“Polydiacetylene/TiO2 nanocomposites for Photovolatic Applications” (Y. Wang, L. Li, 

F. Yan, L. A. Samuelson, J. Kumar), 233 rd ACS National Meeting, March 25-29, 2007, 

Chicago, IL. 

“Solid State Dye-Sensitized Solar Cells Using Polydiacetylene for Hole Conduction” (Y. 

Wang, L. Li, F. Yan, K. Yang, L. A. Sauelson, J. Kumar), MRS 2007 Spring Meeting, 

April 9-13, 2007, San Fransisco, CA. 

Biocatalytic Polymerization of Naturally Occurring Green Tea Flavonoids for Cancer 

Therapy” (S. Nagarajan), Poster presentation at “National Sustainable Design Expo” 

organized by the EPA , April 2007. 

“Biocatalytic synthesis of organo-siloxane copolymers for flame retardant applications” 

(Ravi Mosurkal, Lynne A. Samuelson, Virinder S. Parmar, Jayant Kumar, Phillip R. 

Westmoreland, Arthur Watterson), CUMIRP Meeting, UMass Amherst, May 15, 2007. 

“Environmentally safe flame retardant polymers”, (Ravi Mosurkal, Lynne A. Samuelson, 

Jayant Kumar, Virinder S. Parmar, Kenneth Smith, Phillip R. Westmoreland, Arthur 

Watterson) Invited talk, AVS/NE Symposium, Burlington, June 4, 2007. 


21

(Sandman) 

“Nanocrystals of PDA and Phthalocyanine” (X. Wang, L. Li, D. Sandman),), Poster 


“Semi-Empirical Calculation of PDA Oligomer Ionization” (S. Wang, J. Kumar, D. 

Sandman), Poster presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 

12/1/06. 

(Whitten) 

“The Interfacial Study of Oligothiophene and 1H,1H,2H,2H-Perfluorodecanethiol Self- 

Assembled Monolayer” (Y. Ge, J. Whitten), Poster presented at Sukant Tripathy 


“A Novel Methodology of Patterning a Wide Variety of Materials” (A. Chandekar, S. 

Sengupta, J. Whitten), Poster presented at Sukant Tripathy Memorial Symposium, UMass 

Lowell, 12/1/06. 

“Interaction of Thermally Deposited God with 3-mercaptopropyltrimethoxysilane 

Modified Silicon Surfaces” (J. Singh, J. Whitten), Poster presented at Sukant Tripathy 


“Surface Analysis using X-ray and Ultraviolet Photoelectron Spectroscopies”, Invited 

seminar by J.E. Whitten at the Natick Army Soldier Center Research Laboratory on 

January 7, 2007. 

“Nanotechnology and Organic Electronic Applications of Self-Assembled Monolayers” 

Invited seminar by J.E. Whitten at the University of New Hampshire (Chemistry 

Department) on April 3, 2007. 

(Chiang) 

“Synthesis and Characterization of Diphenylaminofluorenocarbonyl 

Methano[60]fullerene Pentaads” (R. Anandakathir, L. Chiang, L-S; Tan), Poster 


“Alternative Synthesis of C 60 -diphenylaminofluorene Derivatives for Nonlinear Photonic 

Applications: Method of Preparation and Characterization” (S. Jeon, J. Chiang, L. 

Chiang), Poster presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 

12/1/06. 

“Design, Synthesis, and Electrochemical Characteristics of Highly Near-Infrared 

Absorbing Emerald Green [60]Fullerene Acceptors,” International Conference on 


22

Science and Technology of Synthetic Metals (ICSM 2006), Dublin, Ireland, July 37, 

2006. 

“Sterically Hindered Diphenylaminofluorene-C 60 Dyads and Triads: Synthesis, 

Multiphoton Absorption and Energy-Transfer Studies”, International Conference on 

Science and Technology of Synthetic Metals (ICSM 2006), Dublin, Ireland, July 37, 

2006. 

“Synthesis and Characterization of Single-point Substituted Fullerene Bisadduct: 

C 60 [CMe(CO 2 Et) 2 ] 2 ,” Division of Colloid & Surface Chemistry, The 233rd ACS National 

Meeting, Chicago, Illinois, March 27, 2007. 

“Synthesis and Electrochemical Characteristics of Highly Near-Infrared Absorbing 

Emerald Green [60]Fullerenes,” The 211 th Electrochemical Society Annual Meeting, 

Symposium of Molecular and Supramolecular Chemistry of Fullerenes and Carbon 

Nanotube, Chicago, Illinois, May 8, 2007. 

“Design of Starburst Brushes on Photoresponsive Nanostructures Using C60 Cage as a 

Molecular Core or Dendritic Anchor, R&D and Materials Science,” Dow Chemicals, 

Freeport, Texas, May 24, 2007. 

“Starburst Fullerenyl Chromophores Exhibiting Highly Efficient Nonlinear Optical 

Responses,” Air Force Research Laboratory, Dayton, Ohio, June 29, 2007. 

(Watterson) 

Enzymatically synthesized pegylated polymers as nano-micellar drug and gene delivery 

systems. (Kumar, Rajesh; Tyagi, Rahul; Pandey, Mukesh K.; Parmar, Virinder S.; 

Kumar, Jayant; Watterson, Arthur C.), 232nd ACS National Meeting, San Francisco, CA, 

United States, Sept. 10-14, 2006 (2006) 

“Biocatalytic Modification of Naturally Occurring Iron Porphyrin as a Renewable 

Catalyst” (S. Nagarajan, R. Tyagi, R. Nagarajan, J. Kumar, A. Watterson, F. Bruno, L. 

Samuelson), Poster presented at Sukant Tripathy Memorial Symposium, UMass Lowell, 

12/1/06. 

“Selectivity of Lipase (Novozyme 435) in Pegylated and Siloxane Polymers” (R. Tyagi, 

M. Pandey, V. Tucci, R. Kumar, J. Kumar, V. Parmar, A. Watterson), Poster presented at 

Sukant Tripathy Memorial Symposium, UMass Lowell, 12/1/06. 

“Lipase Catalyzed Synthesis of Novel Pegylated 4-Methylcoumarin Polymers as 

Potential Antioxidant Biomaterials.” (Pandey, Mukesh K.; Tyagi, R.; Kumar, J.; Parmar, 


23

Virinder S.; Watterson, Arthur C.), Sukant Tripathy Annual Memorial 

Symposium,Lowell, MA, United States, December 1, 2006 

“Design and synthesis of novel amphiphilic polymers for MRI and selective targeting in 

cancer diagnosis/therapy.” (Pandey, Mukesh K.; Tyagi, Rahul; Kumar, Rajesh; Parmar, 

Virinder S.; Watterson, Arthur C.; Kumar, Jayant; Hardiman, Michelle T.; Zhou, Jin; 

Brower, Kevin P.; Fisher, Robert J.; Colton, Clark K.), 233rd ACS National Meeting, 

Chicago, IL, United States, March 25-29, 2007. 

“The Chemo selective one pot synthesis of surfactants.” (Farrell, T.; Tyagi, R.; Pandey, 

Mukesh K.; Kumar, J.; Parmar, Virinder S.; Watterson, Arthur C.) Tenth Annual Student 

Research Symposium, Cumnock Hall, Lowell, MA, United States, April 26, 2007. 

“Design and Synthesis of Potential Antioxidant Nano Carrier.” (Pandey, Mukesh K.; 

Tyagi, Rahul; Parmar, Virinder S.; Tucci, V.; Watterson, Arthur C.; Shea, T.; Kumar, J.), 

Tenth Annual Student Research Symposium, Cumnock Hall, Lowell, MA, United States, 

April 26, 2007. 

“Lipase catalyzed selective polymerization of amino diesters with different macromers.” 

(Tyagi, R.; Pandey, Mukesh K.; Kumar,;Tucci, V.; Kumar, J.; Parmar, Virinder S.; 

Watterson, Arthur C.) Tenth Annual Student Research Symposium, Cumnock Hall, 

Lowell, MA, United States, April 26, 2007. 

“Design and synthesis of novel crosslinked polydimethylsiloxanes for use in flame 

retardant applications.” (Tucci, V.; Pandey, Mukesh K.; Tyagi, Rahul; Parmar, Virinder 

S.; Watterson, Arthur C.; Kumar, J.), Tenth Annual Student Research Symposium, 

Cumnock Hall, Lowell, MA, United States, April 26, 2007. 

10. Collaboration with Other Centers/Institutes and/or Departments 

By virtue of its extensive instrumentation capabilities, CAM is involved in intrauniversity 

collaboration with numerous scientists and engineers in the Colleges of 

Science and Engineering. Of particular interest, CAM faculty and staff continue to 

interact significantly with the Institute for Nanoscale Science, Engineering, and 

Technology (INSET), as well as the Center for Green Chemistry, Photonics Center, 

Plastics Engineering Dept., the Center for High-Rate Manufacturing and Physics Dept. . 

We have also assisted graduate students to complete their M.S. and Ph.D. degrees in 

several departments using our instruments at the center. 

11. Regional/Local Outreach 

Through a grant from the Academy of Applied Sciences (U.S. Army Research and 

Engineering apprentice Program), CAM furnishes a tutorial research program for 

minority high school students. This past year’s students were Tito Vann from Lowell 


24

High and Meekerley Sanon from Lawrence High School. This summer’s students are 

Adam Trotta from Andover High School and Ankan Dhal from Westford Academy. 

Summer Opportunities in Science (SOS): CAM provides research experience for the SOS 

students every summer. This summer, Laura DeMeo of Haverhill High School, is in Dr. 

Sandman’s laboratories. 

CAM has also provided research exposure to undergraduate students as part of the NSF- 

REU (Research Experience for Undergraduates) Program. 

The analytical instruments were demonstrated for middle/high school students to show 

microscience and problem solving capability at UMass Lowell. 

With the aid of undergraduate chemistry students, Dr. Whitten has developed 

experimental modules using near UV diode lasers to serve as low-cost spectroscopy 

sources that have been disseminated to the national educational community and have 

been put in place in teaching laboratories at UMass Lowell. Dr. Whitten also has 

educational collaborations with Natick Soldier Center. 

Collaboration with other Institutes of Higher Education: 

Prof. George Parody, St. Anselm College, Manchester, NH 

Northeastern University 

Dr. Sunil Sharma, University of Delhi, India 

Prof. Pramod Bhatnagar, University of Delhi, India 

Prof. Parmatma Mathur, University of Delhi, India 

Prof. Virinder Parmar, University of Delhi, India 

Prof. David Kaplan, Dept. of Chemistry, Tufts University 

Dr. Aloke Jain, Consultant, Delhi, India 

Prof. Samuel Gido, University of MA Amherst Amherst on transmission electron 

microscopy and electron diffraction of polydiacetylene nanocrystals. 

12. Proposals Submitted/ Awarded 2006/2007 

Proposal Title: 

P.I. 

EXP-SA: Ultraviolet Light Regenerated Field-Effect Transistor 

Sensors 

James Whitten 

Sponsor: 

National Science Foundation 

Status: 

Not funded. 

Amount: $384,015 

Period Covered: 10/01/07 to 09/30/10 


25

Proposal Title: MRI: Acquisition of a Powder Diffractometer 

P.I. 

James Whitten 

Sponsor: 


Status: 

Not funded. 

Amount: $513,376 

Period Covered: 09/1/07 to 08/31/10 

Proposal Title: NIRT: Adaptable Ultra-high and Surface Area Sensor Arrays 

with Enhanced Detection Sensitivity and Performance 

P.I. 

James Whitten 

Sponsor: 


Status: 

Not funded. 

Amount: $1,981,030 

Period Covered: 5/1/07 – 4/30/11 

Proposal Title: “Titanium Dioxide Surfaces as Platforms for Light-Driven 

Electronic Devices and Sensors” 

P.I. 

James Whitten 

Sponsor: 


Status: 

Not funded. 

Amount: $331,588 

Covered: 05/01/07 to 04/30/10 

Proposal Title: Acquisition of an X-Ray Powder Diffractometer 

P.I. 

Daniel Sandman 

Sponsor: 


Status: 

Not funded. 

Amount: $513,376.00 

Period: 09/01/06 – 09/01/09 


P.I. 

Sponsor: 

Status: 

Research and Engineering Apprentice Program 


Academy of Applied Sciences (for U.S. Army) 

Funded 

Total Award: $5200 

Period Covered: 06/16/07 – 01/31/08 


26


P.I. 

Sponsor: 

Status: 

IGERT: Sustainable Approaches to Organic Electronic and Optical 

Materials 



Not funded. 

Proposal Title: Isoindoline Molecules and Macromolecules 

P.I. 


Sponsor: 


Status: 

Not funded. 

Amount: $441,450 

Proposal Title: NIRT: Adaptable Ultra-High and Surface Area Sensor Arrays with 

Enhanced Detection Sensitivity and Performance 

P.I. 


Sponsor: 


Status: 

Not funded. 

Amount: $1,981,031 

Proposal Title: Biocatalytic Strategies for Synthesis of Biomaterials with Desired 

Properties 

P.I. 

Jayant Kumar 

Sponsor: 


Status: 

Pending. 

Amount: $339,250.00 

Period Covered: 4/1/07-3/31/2010 

Proposal Title: Investigation of Novel Polymeric Catechins for the Treatment of 

Breast 

Cancer 

P.I. 

Jayant Kumar 

Sponsor: 

U.S. Dept. of Defense 

Status: 

Pending 

Amount: $77,000.00 

Period Covered: 8/1/07-7/31/09 


27

Committee of Federated Centers and Institutes 

University of Massachusetts Lowell 

ANNUAL REPORT FOR 2006-2007 ACADEMIC YEAR 

3. CENTER FOR ATMOSPHERIC RESEARCH 

600 Suffolk St., Lowell MA 01854 

978-934-4900 / http://ulcar.uml.edu 

13 August 2007 

CENTER FOR ATMOSPHERIC RESEARCH 

28


The Center for Atmospheric Research (UMLCAR) was founded in 1975 with the goal of 

conducting experimental and analytical research in the atmospheric and space sciences, to 

provide research opportunities for graduate and undergraduate students, and to 

demonstrate how research and development tie to solving real world problems. Carrying 

out these objectives requires tapping the science and engineering expertise residing at the 

University. Active support of the undergraduate and graduate Atmospheric Sciences 

Program of the Environmental, Earth, and Atmospheric Sciences Department is a key 

objective of the Center. 


The Center conducts experimental and analytical research in the atmospheric and space 

sciences, including hardware and software systems development. One major objective is 

the global mapping and monitoring of the ionosphere, which couples the earth 

environment to the magnetosphere and interplanetary space and affects long distance 

radio communication. The Center developed an advanced digital high-frequency 

Doppler radar system, called the Digisonde, for probing of the ionosphere. The Lowell 

Digisondes are now deployed in a global network of more than 70 stations around the 

world in support of the development of a valid global ionospheric model. The Center 

continues to make Digisonde observations in the polar cap region to measure the flow 

pattern of ionospheric plasma that has velocities of 100m/s to 2,000m/s (360 to 720 

km/h) and is controlled by interplanetary-magnetic-field-induced electric fields. New 

measuring campaigns and analysis programs were developed for the study of the 

equatorial ionosphere and its effect on radio systems and communication in cooperation 

with the Air Force Research Laboratory and NSF-funded groups. The cooperation 

between the National Communications Research Laboratory in Tokyo and UMLCAR in 

leading a multinational project for the investigation of the solar cycle dependence of 

ionospheric irregularities is continuing. 

In recent years, the Center’s objectives expanded into space. In March 2000, NASA’s 

IMAGE satellite with UML’s Radio Plasma Imager (RPI) instrument on board was 

launched at the Boeing launch facilities at Vandenberg, AFB, California. The RPI data 

prove to be a goldmine of exciting new information on Earth’s plasmasphere and 

magnetosphere. The success of the RPI has drawn great attention from the space science 

community. The space applications of our technology and knowledge have proliferated. 

We have been awarded a major grant to develop a prototype instrument for the Jupiter 

Icy Moon Orbiter mission by NASA, which is scheduled to be launched in year 2012 

with a scientific objective to confirm the existence of the water below the ice of Jupiter 

moons. Most recently, we anticipate a major contract from Air Force Research 

Laboratory to develop the instrumentation for wave particle interaction experiments on a 

satellite in the radiation belt. 


29

The Center uses 1,200 m 2 of laboratory and office space in the Wannalancit Mills on 600 

Suffolk Street. The laboratories are equipped with the usual measuring equipment 

required for the development of analog and digital electronic systems: spectrum 

analyzers, circuit analyzers, oscilloscopes, etc. Numerical analysis work is mainly carried 

out on PCs and workstations that are networked together. The UMLCAR data center 

collects data from Digisondes around the globe via the Internet in real time and archives 

them on CDs. 


Ionospheric Physics 

Space Physics 

Planetary Physics 

Space Weather 

Space Instrumentation 

Radio Sciences 

4. Associated Personnel (Faculty, Staff) 

Dr. Bodo W. Reinisch, Director; Professor, Atmospheric Sciences 

Dr. Paul Song, Co-Director; Professor, Atmospheric Sciences 

Prof. George Cheney, Professor, Elec. & Comp. Engineering 

Dr. Yan Luo, Asst. Professor, Elec. & Comp. Engineering 

Dr. Vytenis Vasyliunas, Distinguished Research Professor 

Dr. Gary S. Sales, Senior Scientist 

Dr. Klaus Bibl, Chief Scientist 

Dr. Ivan Galkin, Section Head, Software Applications 

Dr. Vadym Paznukhov, Post Doctoral Research Fellow 

Mr. David Kitrosser, Section Head, Systems Development 

Prof. Xueqin Huang, Research Professor 

Dr. David Altadill, Visiting Researcher 

Dr. Qiugang Zong, Assistant Research Professor 

Dr. Jiannan Tu, Research Associate 

Mr. Walter Jones, Programs Manager 

Mr. Stephen Stelmash, Sr. Systems Engineer 

Mr. Kevin Roche, Project Engineer 

Mr. Grigori Khmyrov, Scientific Data Analyst 

Mr. Igor Lissyssian, Electrical Engineer 

Mr. Alexander Kozlov, Software Engineer 

Mr. Jason Grochmal, Production Manager 

Mr. Ryan Hamel, Computer and Electronics Engineer 

Mr. Steve Mendonca, Scientific Illustrator 

Ms. Lynne Schaufenbil, Admin. Asst. 


30

5. New and temporary faculty affiliations (within the last three years) with CAR 

Dr. Madhu Babu Dhar, Boston College 

Prof. V. Vasyliunas, Max-Planck-Institut für Sonnensystemforschung, Katlenburg- 

Lindau, Germany 

6. Students Supported in 2006-2007 

4 graduate students – S. Shunmugam, P. Nsumei, P. Ozhogin, K. Xiang, X. Zhou 

3 undergraduate students – K. Sorota, J. McElroy, D. Khmyrov 

7. Research Projects during 2006-2007 

1. Project # S13306360000003 

Title: Wave-Induced Precipitation of Electron Radiation (WIPER) 

Sponsor: Air Force Research Lab/Stanford University subcontract 

Amount Awarded: $4,769,037 

Project Period: 6/5/05-3/30/09 

Project Summary: The Wave-Induced Precipitation of Electron Radiation (WIPER) 

payload is proposed as the Radiation Belt Remediation (RBR) instrument set for the DSX 

mission, in response to the PRDA#AFRL/VSB04-01. WIPER is designed to allow the 

conduct of a full range of active and passive wave-particle experiments to: (i) quantify 

the propagation characteristics, amplification, and endurance of naturally occurring 

ELF/VLF signals that populate the inner radiation belt, the slot region and the inner edge 

of the outer belt, in particular lightning-generated whistlers, VLF transmitter signals, and 

plasmaspheric hiss, (ii) determine the efficiency of in-situ injection ELF/VLF waves and 

the propagation characteristics of such waves as well as their effects on the energetic 

particles, and (iii) quantify the pitch angle scattering of energetic electrons by whistlermode 

waves, both naturally present in the belts and injected in-situ or from the ground. 

The overarching objective of the WIPER payload is to facilitate the acquisition of 

simultaneous wave-particle data in heretofore-unavailable detail, as is needed in order to 

quantitatively assess the feasibility of remediation of enhanced radiation belt fluxes via 

artificial injection of ELF/VLF waves. 

2. Project/Grant ID#S210065100000003 

Title: Space Weather 


Amount Awarded: $141,494 

Project Period: 10/1/05-9/30/08 

Project Summary: It is proposed to study the near Earth magnetospheric plasma density 

distribution and dynamics using a newly developed observational technique and density 

inversion algorithm. This new technique is based on active radio sounding measurements 


31

from the radio plasma imager (RPI) on board the IMAGE satellite. This new technique, 

combined with the mathematical density inversion algorithm, measures the plasma 

density in situ at the satellite location and remotely and instantaneously along the 

magnetic field line from one hemisphere to the other down to as low as half an Earth 

radius (Re) in altitude. 


Sponsor: Southwest Research Institute 

Title: Phase E extension 


Project Period: December 1, 1999 to September 30, 2007 

Project Summary: This program provides the operation and maintenance of the RPI 

instrument on NASA’s IMAGE satellite as well as scientific research using the RPI data. 


Sponsor: Boston University 

Title: Analysis of Data from the CLUSTER Mission 


Project Period: 1 May 2006 to 31 March 2008 

Project Summary: This mission is currently investigating three dimensional small-scale 

structures in the Earth's magnetospheric/geospace plasma environment, such as the 

interaction between the solar wind and the magnetosphere, inner magnetospheric 

dynamics, magnetotail dynamics, storm and substorm dynamics. 


Sponsor: ESC/PKR-AFMC 

Title: Equator-High Latitude Ionosphere Magnetosphere 


Project Period: 25 August 2006 to 30 October 2010 

Project Summary: Reliable ionosphere-plasmasphere modeling and nowcasting is of 

great importance for the successful operation of the US Air Force ground and spacebased 

monitoring and communication systems. The proposed research will contribute in 

critical areas toward that goal involving (1) ionospheric effects on DOD systems 

research, (2) ionosphere-magnetosphere coupling, and (3) ionospheric research 

technology. Ground-based data from ionosondes and incoherent scatter radars combined 

with space-born sounding data from the IMAGE and ISIS II satellites will be used to 

develop the basis for a global empirical ionosphere / plasmasphere electron density (N e ) 

model that extends from the E region to the plasmapause. It is generally accepted that any 

ionosphere model needs real time drivers –the most important one being the F2 layer 

peak parameters- and our proposed research will therefore enhance the accuracy of the 

real time drivers coming from the ionosonde network. This work will focus on the 


32

equatorial ionosphere where incoherent scatter radar data can be used to validate the 

ionosonde N e profiles and the plasma drifts measured by the collocated ionosonde 

providing direct support for the planned AF C/NOFS mission. 


Sponsor: USAF 

Title: Investigating RBR with Space-Bourne Whistler Mode Transmitters 


Project Period: 24 June 2005 to 27 September 2008 

Project Summary: The proposed effort is to enhance our understanding of the physical 

processes involved in transmitting whistler mode waves into the radiation belt. The 

enhanced wave-particle interaction stimulated by these waves may artificially reduce the 

lifetime of the sturdily trapped relativistic electrons in the radiation belt. 


Sponsor: NASA/University of Alabama 

Title: Study of Bow Shock Energetic Particles 


Project Period: 1 June 2007 to 31 March 2010 

Project Summary: This project investigates particle acceleration at the Earth’s 

quasi-parallel bow shock and properties of upstream energetic ions. 


Sponsor: NASA 

Title: Investigating Near-Earth Magnetosphere Response Solar Wind/IMF 


Project Period: 1 February 2007 to 31 January 2010 

Project Summary: We propose to study the effects of the solar wind/IMF on the near- 

Earth magnetosphere plasma density distributions using IMAGE RPI measurements 

made in the plasmasphere, the plasma trough, and the polar-latitude magnetosphere. In 

the proposed project we will carry out statistical analyses of electron densities using 

almost six years of IMAGE RPI measurements made under various solar wind/IMF 

conditions. The research will improve the very preliminarily density models, previously 

developed for those plasma regions, by including the dependence on solar wind/IMF and 

other factors, such as latitude, local time, and geomagnetic activity. Detail event analysis, 

using the IMAGE RPI observations in conjunction with other IMAGE instrument 

measurements, and data from other satellites, and TEC observations from global GPS 

receivers, will focus on the effects of severe solar wind/IMF conditions, such as those 

causing intense magnetic storms, on the density distributions. Numeric simulations and 

simulation-observation comparisons will be invoked to provide insight into the physical 

processes that determine the responses of the plasma density distributions to changes in 

the solar wind/IMF. The proposed research work supports the NASA strategic objective 


33

“Understand the Sun and its effects on Earth and the solar system” by significantly 

advancing the understanding of the fundamental physical processes of the space 

environment and the causes of space weather. The empirical density models to be 

developed will provide high-quality specifications of the near-Earth magnetospheric 

density distributions, and will have the potential for wide use in space physics and for 

space weather forecasts. The results of the study on the effects of the severe solar 

wind/IMF conditions on the density distributions are of great importance to NASA’s 

strategic goals and outcomes “developing the capability to predict the extreme and 

dynamic conditions in space…”. 


2007 

Altadill, D., D. Arrazola, E. Blanch, and D. Buresova, Solar activity variations of ionosonde 

measurements, experimental amd modeling results, Adv. Space Res., submitted, 2007. 

Boardsen, S. A., James L. Green, and B. W. Reinisch, Emission cone structure of non-thermal 

continuum radiation, J. Geophys. Res., submitted, 2007. 

Carpenter, D. L., T. F. Bell, D. Chen, D. N. C. Baran, B. W. Reinisch, and I. Galkin, Proton 

cyclotron (PC) echoes and a new resonance observed by the RPI instrument on the 

IMAGE satellite, J. Geophys. Res., in press, 2007. 

Gordienko, G. I., I. N. Fedulina, D. Altadill, and M. G. Shepherd, The upper ionosphere 

variability over Alma-Ata and Observatorio del Ebro using the fof2 data obtained during 

the winter/spring period of 2003-2004, J. Atmos. Solar-Terr. Phys., in press, 2007. 

Jakowski, J., S. M. Stankov, V. Wilken, C. Borries, D. Altadill, J. Chum, D. Buresova, J. 

Boska, P. Sauli, F. Hruska, and L. R. Cander, Ionospheric behaviour over Europe during 

the solar eclipse of 3 October 2005, J. Atmos. Solar-Terr. Phys., submitted, 2007. 

Lui, A. T. Y., M. W. Dunlop, H. Rème, L. M. Kistler, G. Gustafsson, Q.-G. Zong, Internal 

structure of a magnetic flux rope from Cluster observations, Geophys. Res. Lett., 34(7), 

L07102, doi:10.1029/2007GL029263, 2007. 

McNamara, L. F., D. L. Cooke, C. E. Valladares, and B. W. Reinisch, Comparison of CHAMP 

and Digisonde plasma frequencies Jicamarca, Peru, Radio Sci., 42, RS2005, 

doi:10.1029/2006RS003491, 2007. 

Nsumei, P. A., B. W. Reinisch, P. Song, J. Tu, and X. Huang, Polar cap electron density 

distribution from IMAGE/RPI measurements: The relative importance of solar 

illumination and geomagnetic activity, J. Geophys. Res, in review, 2007 

Nsumei, P. A., P. Song, B. W. Reinisch, J. Tu, and X. Huang, Ionospheric electron upflow 

along open field lines: Derived from ISIS 2 measurements, J. Geophys. Res, in review, 

2007. 

Osherovich, V. A., R. F. Benson, J. Fainberg, J. L. Green, L. Garcia, S. Boardsen, N. 

Tsyganenko, and B. W. Reinisch (2007), Enhanced high-altitude polar-cap plasma and 

magnetic-field values in response to the interplanetary magnetic cloud that caused the 


34

great storm of 31 March 2001: A case study for a new magnetospheric index, J. Geophys. Res., 

112(A6), A06247, doi:10.1029/2006JA012105. 

Paznukhov, V. V., B. W. Reinisch, P. Song, X. Huang, T. W. Bullett and O. Veliz, Formation 

of an F3 layer in the equatorial ionosphere: A result from strong IMF changes, J. Atmos. 

Solar-Terr. Phys., 69, 10-11, 1292-1304, 2007. 

Reinisch, B., D. Bilitza, and D. Altadill (Ed.), New satellite and ground data for IRI and 

comparison with regional Models, Adv. Space Res., 39, 5, 639-980 (2007). 

Reinisch, B. W., P. Nsumei, X. Huang, and D. K. Bilitza, Modeling the F2 topside and 

plasmasphere for IRI using IMAGE/RPI, and ISIS data, Adv. Space Res., 39, 731-738, 

2007. 

Reinisch, B. W., X. Huang, I. A. Galkin, V. Paznukhov, A. Kozlov, and P. Nsumei, Recent 

advances in real time analysis of ionograms and ionospheric drift measurements with 

digisondes, Radio Sci., in review, 2007. 

Song, P., B. W. Reinisch, V. Paznukhov, G. Sales, D. Cooke, J.-N. Tu, X. Huang, K. Bibl, and 

I. Galkin, High-voltage antenna-plasma interaction in whistler wave transmission: 

Plasma sheath effects, J. Geophys. Res., 112(A3), A03205, doi:10.1029/2006JA011683, 

2007. 

Triskova, L., I. Galkin, V. Truhlik and B.W. Reinisch, Application of seamless vertical 

profiles for use in the topside electron density modeling, Adv. Space Res., 39, 774-778, 

2007. 

Tu, J., P. Song, B. W. Reinisch, and J. L. Green, Smooth electron density 

transition from plasmasphere to the subauroral region, J. Geophys. Res., 

112(A5), A05227, doi:10.1029/2007JA012298, 2007. 

Tu, J.-N., M. Dhar, P. Song, B. W. Reinisch, J. L. Green, R. F. Benson, and A. J. 

Coster, Extreme polar cap density enhancements along magnetic field 

lines during an intense geomagnetic storm, J. Geophys. Res., 112(A5), 

A05201, doi:10.1029/2006JA012034, 2007. 

Wang, J., M. W. Dunlop, Z. Y. Pu, X. Z. Zhou, X. G. Zhang, Y. Wei, S. Y. Fu, C. J. Xiao, A. 

Fazakerley, H. Laakso, M. G. G. T. Taylor, Y. Bogdanova, F. Pitout, J. Davies, Q. G. 

Zong, C. Shen, Z. X. Liu, C. Carr, C. Perry, H. Rème, I. Dandouras, P. Escoubet, C. J. 

Owen, TC1 and Cluster observation of an FTE on 4 January 2005: A close conjunction, 

Geophys. Res. Lett., 34(3), L03106, doi:10.1029/2006GL028241, 2007. 

Wang, X., R. Eastes, B. W. Reinisch, S. Bailey, C. E. Valladares, T. Woods, Short-term 

relationship between solar irradiances and equatorial peak electron densities, J. Geophys. 

Res.,112(A6), A06310, doi:10.1029/2007JA012128, 2007. 

Xiao, C. J., Z. Y. Pu, X. G. Wang, Z. W. Ma, S. Y. Fu, T. D. Phan, Q. G. Zong, Z. X. Liu, M. 

W. Dunlop, K.-H. Glassmeier, A. Balogh, H. Reme, I. Dandouras, C. P. Escoubet, A 

Cluster measurement of fast magnetic reconnection in the magnetotail, Geophys. Res. 

Lett., 34(1), L01101, doi:10.1029/2006GL028006, 2007 


35

Zhang, H., M. W. Dunlop, Q.-G. Zong, T. A. Fritz, A. Balogh, and Y. Wang, Geometry of the 

high-latitude magnetopause as observed by Cluster, J. Geophys. Res., 112(2), A02204, 

doi:10.1029/2006JA011774, 2007. 

Zhang, H., Z. Y. Pu, X. Cao, S. Y. Fu, Z. X. Liu, Z. W. Ma, M. W. Dunlop, W. Baumjohann, 

C. J. Xiao, M. H. Hong, J. B. Cao, Q. G. Zong, X. G. Wang, C. Carr, H. A. Rème. I. 

Dandouras. A. Fazakerley, H. U. Frey, C. P. Escoubet, TC-1 observations of flux pileup 

and dipolarization-associated expansion in the near-Earth magnetotail during substorms, 

Geophys. Res. Lett., 34(3), L03104, doi:10.1029/2006GL028326., 2007. 

Zhou, X. Y., Z. Y. Pu, Q.-G. Zong, and L. Xie, Energy filter effect for solar wind particle entry 

to the plasma sheet via flank regions during southward IMF, J. Geophys. Res., 112(A6), 

A06233, doi:10.1029/2007J6012180, 2007. 

Zong, Q.-G., S. Y. Fu, D. N. Baker, M. L. Goldstein, P. Song, J. A. Slavin, T. A. Fritz, J. B. 

Cao, O. Amm, H. Frey, A. Korth, P. W. Daly, H. Reme, and A. Pedersen, Earthward 

flowing plasmoid: Structure and its related ionospheric signature, J. Geophys. Res., 

112(A7), A07203, doi:10.1029/2006JA012112, 2007. 

Zong, Q. G., X.-Z. Zhou, X. Li, P. Song, S. Y. Fu, D. N. Baker, Z. Y. Pu, T. A. Fritz, P. Daly, 

A. Balogh, and H. Reme, Ultra-low frequency modulation of energetic particles in the 

dayside magnetosphere, Geophys. Res. Lett., 34(12), L12105, 

doi:10.1029/2007GL029915, 2007. 

2006 

Abdu, M. A., T. K. Ramkumar, I. S. Batista, C. G. M. Brum, H. Takahashi, B. W. Reinisch, 

and J. H.A. Sobral, Planetary wave signatures in the equatorial atmosphere-ionosphere 

system, and mesosphere- E- and F- region coupling, J. Atmos. Solar-Terr. Phys., 68, 

509-522, 2006. 

Abdu, M. A., P. P. Batista, I. S. Batista, C. G. M. Brum, A. J. Carrasco, and B. W. Reinisch, 

Planetary wave oscillations in mesospheric winds, equatorial evening prereversal electric 

field and spread F, Geophys. Res. Lett., 33(7), L07107, doi:10.1029/2005GL024837, 

2006. 

Abdu, M. A., I. S. Batista, B. W. Reinisch, J. H. A. Sobral, and A. J. Carrasco, Equatorial F- 

region evening vertical drift, and peak height, during southern winter months: A 

comparison of observational data with the IRI descriptions, Adv. Space Res., 37, 1007- 

1017, 2006. 

Benson, R. F., P. A. Webb, J. L. Green, D. L. Carpenter, V. S. Sonwalkar, H. G. James, and B. 

W. Reinisch, Active wave experiments in space plasmas: The Z mode, in Geospace 

Electromagnetic Waves and Radiation, Lect. Notes Phys., vol. 687, edited by J. W. 

LaBelle and R. A. Treumann, pp. 3-35, Springer, New York, 2006. 

Bertoni, F., I. S. Batista, M. A. Abdu, B. W. Reinisch, and E. A. Kherani, A Comparison of 

ionospheric drift velocities measured by digisonde and incoherent scatter radar at the 

magnetic equator, J. Atmos. Solar-Terr. Phys., 68, 669-678, 2006. 

Bertoni, F., I. S. Batista, M. A. Abdu, B. W. Reinisch, and E. A. Kherani, Erratum to “A 

comparison of ionospheric vertical drift velocities measured by digisonde and incoherent 

scatter radar at the magnetic equator”: [Journal of Atmospheric and Solar-Terrestrial 

Physics 68 (2006) 669–678], J. Atmos. Solar-Terr. Phys., 68, 1851-1852, 2006. 


36

Bilitza, D., B. W. Reinisch, S. Radicella, S. Pulinets, T. Gulyaeva, and L. Triskova, 

Improvements of the International Reference Ionosphere model for the topside electron 

density profile, Radio Sci., 41(5), RS5S15, 10.1029/2005RS003370, 2006. 

Bilitza, D. and B. Reinisch (ed.), Advances in specifying plasma temperatures and ion 

composition in the ionosphere, Adv. Space Res., 37, 875, 2006. 

Chen, W. S., C. C. Lee, J. Y Liu, F. D. Chu, and B. W. Reinisch, Digisonde spread F and GPS 

phase fluctuations in the equatorial ionosphere during solar maximum, J. Geophys. Res., 

111(A12), A12305, 10.1029/2006JA011688, 2006. 

Denton, R. E., K. Takahashi, I. A. Galkin, P. A. Nsumei, X. Huang, B. W. Reinisch, R. R. 

Anderson, M. K. Sleeper, and W. J. Hughes, The distribution of density along 

magnetospheric field lines, J. Geophys. Res., 11(A4), A04213, 10.1029/2005JA011414, 

2006. 

Djuth, F. T., B. W. Reinisch, D. F. Kitrosser, J. H. Elder, A. Lee Snyder, and G. S. Sales, 

Imaging HF-Induced irregularities above HAARP, Geophys. Res. Lett., 33(4), L04107, 

doi:10.1029/2005GL024536, 2006. 

Duan, S. P., Z. X. Liu, J. B. Cao, J. K. Shi, L. Lu, Z. Y. Li, Q.-G. Zong, H. Reme, N. 

Cornilleau-Wehrlin, A. Balogh, and M. Andre, Analysis of the interaction between lowfrequency 

waves and ions in the high-altitude cusp region observed by satellite cluster, 

Chinese Phys. Lett., 23(5), 1351-1354, 2006. 

Garcia, L. N., J. L. Green, S. A. Boardsen, S. F. Fung, and B. W. Reinisch, Auroral kilometric 

radiation source region variations with season and solar cycle, in Planetary Radio 

Emissions VI, edited by H. O. Rucker, W.S. Kurth, and G. Mann, pp. 231-240, Austrian 

Academy of Sciences, Graz, Austria, 2006. 

Galkin, I. A., G. M. Khmyrov, A. Kozlov, B. W. Reinisch, X. Huang, D. F. Kitrosser, 

Ionosonde networking, databasing, and web serving, Radio Sci., 41(5), RS5S33, 

10.1029/2005RS003384, 2006. 

Huang, X. and B. W. Reinisch, Real time HF raytracing through a tilted 

ionosphere, Radio Sci., 41(5), RS5S47, 10.1029/2005RS003378, 2006. 

Lee, C. C. and B. W. Reinisch, Quiet-condition hmF2, NmF2, and B0 variations at Jicamarca 

and comparison with IRI-2001during solar maximum, J. Atmos. Solar-Terr Phys., 68, 

2138-2146, 2006. 

Li, Xinlin, D. N. Baker, T. P. O'Brien, L. Xie, Q.-G. Zong, Correlation between the inner edge 

of outer radiation belt electrons and the innermost plasmapause location, Geophys. Res. 

Lett., 33(14), L14107, 10.1029/2006GL026294, 2006. 

Lin, N. E. S. Lee, J. McFadden, G. Parks, M. Wilber, M. Maksimovic, N. Cornilleau-Wehrlin, 

A. Fazakarley, E. Lucek, H. Reme, O. Santolik, and Q.-G. Zong, VLF/EFF wave 

activity in the vicinity of the polar cusp: Cluster observations, Ann. Geophys., 24(7), 

1993-2004, 2006. 

Mendillo, M., P. Withers, D. Hinson, H. Rishbeth, and B. W. Reinisch, Effects of solar flares 

upon the ionosphere of Mars, Science, 311(5764), 1135-1138, 2006. 


37

Savin, S., E. Amata, M. Andre, M. Dunlop, Y. Khotyaintsev, P.M.E. Decreau, J.L. Rauch, J.G. 

Trotignon, J. Buechner, Nikutowski, J. Blecki, A. Skalsky, S. Romanov, L. Zelenyi, A. 

M. Buckley, T. D. Carozzi, M. P. Gough, P. Song, H.Reme, A. Volosevich, H. Alleyne, 

and E. Panov, Experimental study of nonlinear interaction of plasma flow with charged 

thin current sheets: 2. Hall dynamics, mass and momentum transfer, in Nonlinear 

Processes in Geophysics, 13, 1-16, 2006. 

Tu, J.-N., P. Song, B. W. Reinisch, J. L. Green, and X. Huang, Empirical specification of fieldaligned 

plasma density profiles for plasmasphere refilling, J. Geophys. Res., 111(A6), 

A06216, doi:10.1029/2005JA011582, 2006. 

Vogiatzis I. I., T. A. Fritz, Q.-G. Zong, and E. T. Sarris, Two distinct energetic electron 

populations of different origin in the Earth's magnetotail: a Cluster case study, Ann. 

Geophys., 24 (8): 1931-1948, 2006 

Xiao, C. J., X. G. Wang, Z. Y. Pu, H. Zhao, J. X. Wang, Z. W. Ma, S. Y. Fu, M. G. Kivelson, 

Z. X. Liu, Q. G. Zong, K. H. Glassmeier, A. Badogh, A. Korth, H. Reme, and C. P. 

Escoubet, In situ evidence for the structure of the magnetic null in a 3D reconnection 

event in the Earth’s magnetotail, Nature Physics, 2(7), 478-483, 2006. 

Xie, L., Z. Y. Pu, X. Z. Zhou, S. Y. Fu, Q.-G. Zong, and M. H. Hong, Energetic ion injection 

and formation of the storm-time symmetric ring current, Ann. Geophys., 24(12), 3547- 

3556, 2006. 

Zeng, W., J. L. Horwitz, and J.-N. Tu, Characteristic ion distributions in the dynamic auroral 

transition region, J. Geophys. Res., 111(A4), A04201, doi:10.1029/2005JA011417, 

2006. 

Zhang, M.-L., B. W. Reinisch, J.-K. Shi, S.-Z. Wu and X. Wang, Diurnal and seasonal 

variation of the ionogram-derived scale height at the F2 peak, Adv. Space Res., 37, 967- 

971, 2006. 

Zhou, X.-Z., Q.-Z. Zong, Z. Y. Pu, T. A. Fritz, M. W. Dunlop, Q. Q. Shi, J. Wang, and Y. Wei, 

Multiple Triangulation Analysis: another approach to determine the orientation of 

magnetic flux rope, Ann. Geophys., 24(7), 1759-1765, 2006. 

Zhou, X.-Z., T. A. Fritz, Q.-G. Zong, Z. Y. Pu, Y.-Q. Hao, and J.-B. Cao, The cusp: a window 

for particle exchange between the radiation belt and the solar wind, Ann. Geophys., 

24(11), 3131-3137, 2006. 

Zhou, X.-Z., Q.-G. Zong, J. Wang, Z. Y. Pu, X. G. Zhang, Q. Q. Shi, and J. B. Cao, Multiple 

triangulation analysis: application to determine the velocity of 2-D structures, Ann. 

Geophys., 24(11), 3173-3177, 2006. 

Zong, Q.-G., T. A. Fritz, H. Zhang, S. Y. Fu, X. Z. Zhou, M. L. Goldstein, P. W. Daly, H. 

Reme, A. Balogh, and A. N. Frazakerley, The magnetospheric cusp: Structure and 

dynamics, Adv. Geophys., 2, 173-189, 2006. 

9. Conference Presentations in 2006-2007 

Asia Oceania Geosciences Society (AOGS) 4th Annual Assembly – 30 July-4 

August 2007 – Bangkok 


38

• Unusually Intense Vertical Plasma Drifts of the Evening Equatorial Ionosphere 

over Brazil during the October 2003 super storm, M. Abdu, I. Batista, J. A. 

Sobral, B. W. Reinisch 

Spring 2007 Joint Assembly (AGU) - 22-25 May 2007, Acapulco Mexico 

• A campaign to study equatorial ionospheric phenomena over Guam, L. Krause, R. 

Balthazar, M. Dearborn, C. L. Enloe, T. Lawrence, M. G. McHarg, D. Petrash, B. 

W. Reinisch, and T. Stuart 

• Ionospheric electron upflow along open field lines: Derived from ISIS 2 

measurements, P. Nsumei, P. Song, B. W. Reinisch, J. Tu, and X. Huang 

• TOPLA: A new empirical representation of the F-region topside and 

plasmasphere for the International Reference Ionosphere, D. Bilitza, B. Reinisch, 

D. Gallagher, X. Huang, V. Truhlik, and P. Nsumei 

Center for Atmospheric Research, Radio Sounding and Plasma Physics Symposium 

29 April 2007 - Lowell, MA 

• Struggle to get RPI on IMAGE and Bodo’s role, J. Green 

• Plasma Physics using space-borne radio sounding, R. Benson 

• Highlights of RPI sounding of the plasmasphere and polar regions at frequencies in the 

whistler and Z-mode domains, D. Carpenter 

• IMAGE RPI reawakens plasmaspheric refilling research 

RPI and Measurement of Magnetospheric Field-Aligned Density, D. Gallagher 

• The Great Promise of Space-Based Sounders in the Earth's Ionosphere, R. Pfaff 

• The importance of topside and bottomside sounding measurements for the development 

and updating of IRI, D. Bilitza 

• A tribute to the ARTIST: ionogram autoscaling research at UMLCAR, I. Galkin 

• From COST 238 to COST 296: four European COST actions on Ionospheric Physics and 

Radio Propagation, B. Zolesi 

• Martian ionosphere, M. Mendillo 

• A random walk in science and engineering: from the Digisonde to the HF 

Communications Modem, P. Cannon 

• The progress of the South African ionosonde network, L. McKinnell 

• Fifty years of ionospheric research at Pruhonice, D. Buresova and J. Boska 

• Frequency-and-angular sounding of the ionosphere (FASI) as applied to the DPS-system, 

V. Galushko 

• The plasma frequency as the boundary between plasma physics and single-particle 

electrodynamics, V. Vasyliunas 

• Global Coupling across the Stormtime Ionosphere, J. Foster 

• Incoherent scatter radar databases and ionospheric modeling, S. Zhang 

• Progress of the Ionospheric Studies in China, R. Liu 

• Ionosphere observation by using the ionosonde and Formosat-3/COSMIC data during 

December 2006 campaign, C. C. Hsiao\ 

• Extracting Ion information from ISIS Topsider-Sounder Electron Density Profiles, P. 

Webb 


39

XI International Digisonde Forum and Hands-on Workshop - April 30 - May 3, 

2007 – Lowell, MA 

• Digisonde network today, B. Reinisch 

• Topside profile modeling, B. Reinisch 

• Major magnetic storms as seen by the digisonde network, V. Paznukhov 

• Digisonde-measured profiles and tilts for real-time ray-tracing, X. Huang 

• D-region absorption studies with digisondes, G. Sales 

• Interplanetary shock event as seen by digisonde network, Q-G. Zong 

• Daily pattern of the F-region vertical drift from DGS measurements at 

• mid-latitudes, D. Altadill 

• E-layer Precision Group Height (PGH) campaign proposal, D. Altadill and V. 

Paznukhov 

• Review of upcoming changes in ionogram analysis and data reports, B. Reinisch 

• ARTIST 5.0 goes operational, I. Galkin 

• ARTIST Uncertainty: scaled characteristics, V. Paznukhov 

• ARTIST Uncertainty: N(h) profile, X. Huang 

• Precision Group Height (PGH) in ARTIST 5, J. McElroy 

• SAO Explorer, flagship ionogram data analysis tool, G. Khmyrov 

• Overview of digisonde data products and formats, I. Galkin 

• SAO.XML 5.0, new format for ionogram-scaled data, G. Khmyrov 

• DIDBase with ADRES: archiving technology for digisonde data, G. Khmyrov 

SECTION 

• Advances in digisonde development, B. Reinisch 

• DPS-4D hardware review, I. Lissyssian 

• RFI mitigation, V. Paznukhov 

• New pre-processor card, G. Cheney 

• Overview of DESC and DCART projects, I. Galkin 

• DESC: Digisonde Embedded System Control software, G. Khmyrov 

• DCART : New face of the digisonde, I. Galkin 

• Under the hood of DCART project, A. Kozlov 

• Concept of operations with DCART-DESC tandem, G. Khmyrov 

• DPS-4D test runs in Millstone Hill, G. Khmyrov 

• DPS-4D Readiness Review, B. Reinisch 

EGU 2007 – 15-20 April 2007 - Vienna, Austria 

• A global plasmasphere electron density database determined from IMAGE RPI 

dynamic spectra, P. Webb, R. Benson, R. Denton, J. Goldstein, L. Garcia, and B. 

W. Reinisch 

• Modeling the Polar Cap Topside Ionosphere, B. W. Reinisch, B., P. Nsumei, P. 

Song, and X. Huang 


40

Sanya, Hainan, China – 17 January 2007 

• Smooth Electron Density Transition from the Plasmasphere to the Sub-Auroral 

Region, J, Tu, P. Song, and B. W. Reinisch 

AGU Chapman Conference – 3-6 January 2007 – Yosemite, CA 

• Study of mid-latitude geomagnetic storms using Digisonde network data, V. V. 

Paznukhov, D. Altadill, B. W. Reinisch, and G. S. Sales 

Fall AGU – 11-15 December 2006 – San Francisco, CA 

• Differences between the response of the equatorial TEC and foF2 to solar soft X- 

ray fluxes, X. Wang, R. Eastes, B. W. Reinisch, S. Bailey, C. Valladares, T. Woods 

• Adaptive Techniques for Intelligent Onboard Magnetospheric/Ionospheric Radar, 

Ivan A. Galkin, Xueqin Huang, Bodo W. Reinisch, Robert F. Benson 

• International Reference Ionosphere: An operational tool for space weather 

applications, Dieter Bilitza and Bodo W. Reinisch 

• The short-term relationship of ionospheric electron density with solar irradiance 

and geomagnetic activity in daily observations, X. Wang, R. Eastes, S. Bailey, B. 

Reinisch, Sun, C. Valladares, T. Woods 

• Relation between electric fields and ionospheric/magnetospheric plasma flows at 

very low latitudes, P. Song and V. M. Vasyliunas 

• Prompt penetration of magnetospheric convection to low latitudes: What is the 

physical mechanism?, V. M. Vasyliunas and P. Song 

• Combining Satellite and Ground Observations for IRI-related Plasmasphere- 

Ionosphere Modeling, Bodo W. Reinisch, Patrick Nsumei, Xueqin Huang, and 

Dieter Bilitza 

• Smooth electron density transition from the plasmasphere to the subauroral 

region, Jiannan Tu, Paul Song, and Bodo W. Reinisch 

"FORMOSAT-3/COSMIC Workshop 2006 – Early Results and IOP Campaigns". 

– Taipei – Nov. 27 -2 Dec 2006 

• Access to Ionospheric Electron Density profiles from the Digisonde network, B. 

W. Reinisch 

IRI Workshop 2006 – Buenos Aires, Argentina – 16-20 October 2006 

• Some problems with the current IRI NE profiles, Bodo W. Reinisch and Xueqin 

Huang 

• International Reference Ionosphere: A Status Report, D. Bilitza and B. W. 

Reinisch 

• Modeling the F layer Topside and Plasmasphere Ne Profile, Bodo W. Reinisch, 

Patrick Nsumei, Xueqin Huang, and Dieter Bilitza 

• Typical behavior of the scale height at the F2 peak from middle latitude ground 

measurements, D. Altadill, E. Blanch, D. Buresova, D. Arrazola, B. Reinisch, and 

X. Huang 


41

Spring AGU Meeting 

• Equatorial Spread F Development/Disruption under Disturbance Electric Fields 

during Some Recent Intense Magnetic Storms, M. Abdu, E. R de Paula, I. S. 

Batista, B. W. Reinisch, C. M. Denardin, and J. H. A. Sobral 

• Transport and Loss of Thermal Plasma From the Plasmasphere, Leonard N. 

Garcia, James L. Green, Robert F. Benson, Bill R. Sandel, Bodo W. Reinisch 

• RPI/IMAGE plasma and magnetic signatures of solar-wind/magnetosphere 

interactions, Robert F. Benson, Vladimir A. Osherovich, Joseph Fainberg, James 

L. Green, Scott Boardsen, Leonard N. Garcia, Nikolai Tsyganenko, Bodo W. 

Reinisch 

• International Reference Ionosphere – 2006, D. Bilitza and B. Reinisch 

• Transport and Loss of Thermal Plasma From the Plasmasphere, L. N. Garcia, J. L. 

Green, R. F. Benson, B. R. Sandel, and B. W. Reinisch 

• Prediction of Dn Resonances in the Solar Corona, V. A. Osherovich, J. Fainberg, 

R. F. Benson, R. MacDowall, and B. W. Reinisch 

• Modeling the Low-Latitude Ionosphere and Scintillation Occurrence during the 

COPEX Campaign, J. M. Retterer, L. McNamara,, K. Groves, Odile de la 

Beaujardiere, B. Reinisch, and M. Abdu 

Polar Research Institute of China, Shanghai - 27 July 2006 

• Inversion of RPI Plasmagrams (2 June), X. Huang 

• Introduction to Ionospheric Sounding, B. W. Reinisch 

• Sounding in the Magnetosphere, B. W. Reinisch 

36 th COSPAR Scientific Assembly – Beijing – 16-23 July 2006 

• Smooth Transition of Plasmasphere to Plasma Trough as Observed by 

IMAGE/RPI, Jiannan Tu, Paul Song, and Bodo W. Reinisch 

• Ionospheric response to the October 2003 geomagnetic superstorm in the South 

American-Atlantic Sector, I. S. Batista, J. R. de Souza, M. A. Abdu, B. W. 

Reinisch, T. W. Bullett, and V. H. Rios 

• TS 16457: International Reference Ionosphere and Extensions to the 

Plasmasphere, D. Bilitza, T. Gulyaeva, B. Reinisch 

• Temporal and spatial discontinuities in the IRI electron density distribution, X. 

Huang and Bodo W. Reinisch 

• The Vary-Chap Function for the IRI Topside Ne Profile, B. Reinisch, P. Nsumei, 

X. Huang, and D. Bilitza 

• Wave-Particle Interactions (WPIx) Active Experiment, Theodore A. Fritz, 

Gregory P. Ginet, Bronislaw K. Dichter, Bodo W. Reinisch, and Umran Inan 

• What drives magnetospheric convection flow on closed field lines, Paul Song and 

Vytenis M. Vasyliunas 


42

10. Collaboration with other Centers/Institutes and/or Departments 

EEAS Department, Graduate Students and Faculty 

Physics Department, Doctoral Students 

Institute for Visualization and Perception 

11. Regional/Local Outreach (Other Institutes of Higher Education, Industries, 

Government Agencies, schools, etc.) 

MIT/BU/BC – joint research and publications 

Air Force Research Laboratory – Hanscom AFB, MA - joint research projects 

Germany International School - Boston, MA 

Codem Systems, Inc. – Merrimack, NH - joint software development 

NASA Goddard Space Flight Center – joint research publications 

Raytheon Corporation – joint research publications 


43

12. Proposals submitted 2006/2007 

Project ID 

Submit 

Date Sponsor PI Title Total 

S58000000004680 11/13/06 

S52000000005802 05/10/07 

S13306850100003 08/30/06 

BALL AEROSPACE & 

TECHNOLOGIES CORP. 

UNIVERSITY OF 

ALABAMA 

NORTHROP GRUMMAN 

CORPORATION 

Reinisch, Bodo 

Zong, Qiugang 


S58300000001046 08/24/06 INTA Reinisch, Bodo 

DEPARTMENT OF 

COMMUNICATIONS (SO 

S58300000001060 09/15/06 AFRICA) 


S90009030000003 09/28/06 LA TROBE UNIVERSITY Kitrosser,David 

S83009170000003 11/21/06 

01/30/07 

01/31/07 

02/05/07 

04/26/07 

05/09/07 

07/06/07 

LEIBNIZ-INSTITUTE OF 

ATMOSPHERIC PHYSICS 

NASA GODDARD SPACE 

FLIGHT CENTER 

NATIONAL AERO AND 

SPACE ADMINISTRATION 

INSTITUT RYL 

METEOROLOGIQUE DE 

BELGIQUE 

INSTITUTE OF SPACE 

SCIENCE MALAYSIA 

UNIVERSITY OF 

CALIFORNIA 

VIKRAM SARABHAI 

SPACE CENTRE 








TIS Mission 

Pursuit $9,991 

Study of Bow 

Shock Energetic 

Particles $79,360 

Proposal for 

DISS Support $452,765. 

ARTIST SW 

Maintenance $15,400. 

Ionospheric 

Observatory for 

South Africa $323,236. 

DPS-4 Crossed 

Receiver Loop 

Pre-amplifier $4,400. 

DPS In 

Juliusruh $20,010. 

Enhanced 

Ionospheric 

Topside- 

Sounder Science 

Return from 

Existing and 

Future Data $638,716 

Distributed 

Intelligent 

Resident 

Archive for 

Expert Imagery 

Data 

Interpretations $2,083,218. 

Proforma-Jan 

2007 Dourbes $189,460 

DSP-4D for 

Malaysia $205,120 

Storm-time 

Plasma 

Redistribution in 

the Coupled 

Plasmasphere- 

Ionsphere 

System $119,192 

Digisonde 

Portable 

Sounder ¿ DPS- 

4D $235,430 


44

07/17/07 SRI INTERNATIONAL Reinisch, Bodo DPS-4D $229,569 

07/17/07 

GEOMAGNETIC 

INSTITUTE IN BELGRADE Reinisch, Bodo 

Ionospheric 

Observatory 

DPS-4D for 

Belgrade $234,959 

08/21/06 

GEOMAGNETIC 

INSTITUTE IN BELGRADE Reinisch, Bodo DPS-4 Belgrade $205,120 

08/22/06 

VIKRAM SARABHAI 

SPACE CENTRE Reinisch, Bodo DPS-4 $200,720 

08/31/06 

UNIVERSITY OF 

CALIFORNIA 


Storm-time 

Magnetosphericionospheric 

Density 

Variations: 

Data-model 

Comparison $58,086 

09/15/06 

NORTHROP GRUMMAN 

CORPORATION 


DISS PKI/PKE 

Effort $42,912 

09/28/06 ERETEC, INC. (Korea) Reinisch, Bodo 

Ionospheric 

Radar 

University - 

DPS-4 System 

for RRL $264,410 

• Standard One: Mission Statement UMass Lowell 

The mission and major purposes of the University of Massachusetts Lowell are to 

provide to students an affordable education of high quality and to focus some of its 

scholarship and public service on assisting sustainable regional economic and social 

development. 


45

4. CENTER FOR BIOGRADABLE POLYMER 

RESEARCH 

AT UML 


The Biodegradable Polymer Research Center (BPRC) functions to carry out exploratory and fundamental 

research for the development of new technologies in degradable plastic materials. The goal of this work is 

to obtain suitable materials, which are inherently degradable in nature as well as being environmentally 

benign. To realize this objective, the BPRC has been organized to merge expertise in microbial production 

of polymeric materials, organic transformations, plastics processing, materials characterization, and 

environmental engineering. The BPRC fosters a broad and active cooperation with industry, which ensures 

a fast transfer of new methods and technologies. The Center activities are expected to be of great 

importance to the future economic as well as environmental health of the commonwealth. 

The mission and major purpose of the University of Massachusetts Lowell are to provide to students an 

affordable education of high quality and to focus some of its scholarship and public service on assisting 

sustainable regional and economic and social development. 

General Description and Goals 

The NSF Biodegradable Polymer Research Center has been transformed over the past few years to a focus 

on industrial partnerships. These partnerships have enabled the BPRC to better serve the individual needs 

of the companies while also protecting the intellectual property that is developed at the BPRC. These 

partnerships are developed around novel technologies which are either developed or enhanced at the 

research center. The Center’s University personnel presents a review of the research progress to each of the 

sponsors individually. These review meetings include oral presentations and written reports. Review 

meetings are held at the University of Massachusetts Lowell and are attended by member companies, 

student affiliates, and Institute professional staff. 

Faculty members recognize the need to assist industry in developing techniques and 

teaching skills required to keep the American plastics industry competitive in future 

decades. To meet this challenge the department has been active in soliciting research 

projects form industry and from the state. 

The University of Massachusetts Lowell is uniquely qualified to produce research results 

and helping member companies gain a competitive edge. 

Research Focus Areas 

MATERIAL SYNTHESIS 

Microbial Synthesis of Biopolymers 

Identification of new microorganisms and fermentation methods to develop novel 

materials derived from renewable resources. Microbial nylons, polyesters and 

polysaccharides are under investigation. 

CENTER FOR BIOGRADABLE POLYMER RESEARCH 

46

Organic Synthesis 

Synthetic analogues of biopolymers are being synthesized as models to establish 

relationships between polymer structure, morphology, properties, and degradability. 

Polysaccharide modification to alter their physical and biological properties. Novel 

degradable polymers by classical chemical approaches. Interfacial agents for 

biodegradable blend systems. 

PROCESSING AND BLENDING 

Polymer Blends 

The blending of biodegradable components to vary properties and biodegradability. 

Science screw extrusion, twin screw extrusion, and solvent mixing are being used to vary 

phase domain size to study the effects on properties and biodegradability. The effect of 

miscibility and blend morphology on biodegradability. 

Processing 

Sheet and blown film extrusion and co-extrusion, extrusion coating, injection molding, 

compression molding, and solvent casting. Reactive processing of blends and hydrogels. 

Processing of polysaccharides. 

DEGRADATION TESTING AND ENVIRONMENTAL ENGINEERING 

In-Lab Accelerated Simulations 

Controlled aerobic (compost conditions) and anaerobic (optimized landfill conditions) 

bioreactors are used to evaluate plastics degradation kinetics. The effect of 

environmental parameters on the biodegradation kinetics. Providing the ASTM with 

Lowell testing procedures for the development of standard methods. Participation with 

other ASTM members in the evaluation of present ASTM degradation testing protocols. 

Microbial Isolates 

Isolation of microorganisms active in environmental polymer degradation. Purification 

and characterization of enzymes active in polymer degradation. Determination of 

polymer degradation kinetics and the products formed using pure cultures and enzymes. 

Environmental Engineering 

A program which seeks to integrate current and experimental methods in solid waste 

management where plastics are viewed as a potentially degradable component of the 

municipal solid waste system. 

CHARACTERIZATION AND MODELING 

Measurements and effects of crystallinity, orientation, and stress on biodegradation. 

Sorption, diffusion, and surface analysis and relationships to biodegradability. Control 

and prediction of molecular weight and effects on biodegradability. 


47

Associated Personnel 

DIRECTOR 

Dr. Stephen McCarthy 

Professor, Plastics Engineering, Univ. of Massachusetts Lowell 

ASSOCIATE DIRECTORS 

Dr. Steven Goodwin Professor Microbiology University of Massachusetts Amherst 

TECHNICAL COLLABORATORS 

Dr. Carl Lawton, Professor, Chemical Engineering 

Dr. Robert Nicolosi, Professor, Clinical Life Sciences, University of Mass. Lowell 

Students Supported 

Current Graduate Student Researchers 

Ms. Qin Li 

Mr. Jinkoo Lee 

Mr. Yanir Shaked 

Mr. Abhishek P. Ambekar 

Mr. Rahul Daga 

Mr. Bryan Fick 

Mr. Pranav P. Kukade 

Mr. Purushotham Padmanabha 

Mr. Hemantkumar Patel 

Mr. John Reynolds 

Mr. Bhavin Shah 

Mr. Dhaval Shah 

Ms. Tatiya Trongsatitkul 

Ms. Sarah Westerdale 

Mr. Peter Riitho 

Current Research 

Metabolix, Development of Novel Blends and Processing Techniques for 

Polhydroxyalkanoates, 560,433. 00 

Metabolix, Novel Blends and Processing Techniques (project 2), $80,000.00 

Metabolix, PHA Bioplastic Packaging Films and Foams (project 3), $45,000.00 

Metabolix, Blow Molded PHA Bioproducts (Project 4), $20,000.00 

Nanospheres/ Microfluidization, $20,000 


48

Publications 

“Derivatization of Polysaccharides Using Microwave Radiation as the Energy 

Source”, Stephen McCarthy, Balint Koroskenyi, pending 

“The Effect of Nanoclays on the Properties of PLLA-modified Polymers: Part I: Mechanical and Thermal 

Properties”, D. Lewitus, A. Ophir, S. Kenig and S. McCarthy, J. Polymers and the Environment, Vol 

14, no. 1, pp. 171-177, (2006). 

“Nanotailoring of Polyurethane Adhesive by Polyhedral Oligomeric Silsesquioxane (POSS), with T. Efrat, 

H. Dodiuk and S. Kenig; J. Adhesion Science Technology, Vol. 20, No, 12, (2006), pp. 1413-1430. 

“The Effect of Nanostructure and Composition on the Hydrophobic Properties of Solid Surfaces”, with P.F. 

Rios, H. Dodiuk, and S. Kenig, J. Adhesion Science Technology, Vol. 20, No. 6, pp. 563-587, 

(2006). 

“Improving the Toughness of Poly(Lactic acid)(PLA) through Co-continuous, 

Immiscible, Biodegradable Blends” with Jinkoo Lee & Robert Whitehouse, SPE 

ANTEC, May 2007 

Conference Presentations 

The 7 th Annual CAMD / CBM 2 Summer Workshop, Louisiana State University 

(LSU), Baton Rouge, Louisiana, May, 2006 

BioEnvironmental Polymer Society Annual Conference, October 2006 

Society of Plastics Engineers Annual Technical Conference, Cleveland, OH, May 

2007. 

Collaboration with other Centers/Institutes and/or Departments 

"Biodegradable Polymers and Blends", Plastics Engineering Industrial Seminars, 

University of Lowell, Continuing Education 

Nanomanufacturing Center of Excellence 

Robert Nicolosi, Clinical Life Sciences, University of Mass. Lowell 

Thomas Shea, Biology Department, University of Massachusetts 

Edwin Jahngen, Department of Chemistry 

Regional/Local Outreach 

Metabolix technology licensing agreement, U S Patent No. 5,883,199 

Proposals submitted 

Biodegradable Hollow Nanospheres 

Massachusetts Institute of Technology, Exploring the Application of Functionalized 

Nanospheres for Pb Removal 


49

5. CENTER FOR BIOMOLECULAR AND MEDICAL 

INFORMATICS 

Annual Report 2006-2007 

Mission Statement of the Center 

The purpose of the Center for Biomolecular and Medical Informatics at the University of 

Massachusetts is to provide a much needed regional and national resource focused on 

Biomedical Computation, which includes Bioinformatics, Cheminformatics, Medical 

Informatics, Computational Biology and Computational Chemistry, for companies in the 

Biotechnology, Genomics, Drug Discovery, Computer Software and Hardware 

development. This focus will enhance the collaborative development of industrial and 

government partnerships with the University of Massachusetts. 

The Mission of this UMass Lowell Center is to provide a scientifically excellent, 

enriched, and practical educational experience for undergraduate and graduate students 

aspiring to work in the area of biomedical computing, computational molecular biology 

and the new fields of bioinformatics and cheminformatics. 


The two major activities of the Center are training a future workforce in the above areas 

at the undergraduate and graduate level and to create and participate in joint 

industry/university research projects. The training of Bioinformatics and 

Cheminformatics graduate students and the research undertaken with industry partners 

will be done in close conjunction and with input from Industrial partners through the 

Center’s Advisory Board. The students will work within the existing UMass Bachelors, 

Masters and Doctoral programs of Bioinformatics and Cheminformatics in Computer 

Science as well as the independent department programs in Bioinformatics (Biology 

Department), Cheminformatics (Chemistry Department), and Computational Sciences 

(Mathematics Department). The research will harness the current strengths of Center 

faculty and students as well as draw from the best personnel from other Universities 

through visiting scholars, post-doctoral students, and external faculty positions. State of 

the Art equipment and software is available for training and research to participants 

(students, faculty and researchers). 

A number of other activities, including formal and informal training of company 

personnel in the area of bioinformatics and the identification and implementation of 

research projects for individual sponsoring companies is also envisioned. 

The Center is also involved in outreach to high schools and community colleges to make 

them aware of the excellent and broad bioinformatics program available at the University. 


The Center’s focus areas are the integrated applications of the various disciplines of 

Biology, Chemistry, Computer Science, and Mathematics to 

Bioinformatics and Cheminformatics (data management, analysis, and exploration) and 

Computational Molecular Biology and Chemistry. This focus has important implications 

Center for Biomolecular and Medical Informatics 

50

in two areas: first for mining the increasingly large databases produced by medical, 

health and drug files; and second for the current and evolving paradigm of drug discovery 

in the pharmaceutical industry which provides a more fundamental molecular view of 

how organisms utilize the information contained in their DNA to carry out biological 

function. The Center’s strengths come from its current faculty and its program that 

currently include the integration of disparate distributed databases, parallel and high 

performance algorithms, computational geometry, high dimensional visualization, and 

data mining. These computational techniques are being applied to large datasets, 

including DNA, gene expression and protein structure databases. The Center provides its 

researchers and students access to the latest collection of hardware and software systems 

in use in the biomedical computation areas. 


Co-Directors 

Dr. Georges Grinstein 

Dr. Ken Marx 

Faculty from the Departments of Biology, Chemistry, Computer Science, and 

Mathematics, along with external collaborators are involved in research problems at the 

Center. Our intent is to increase the participating faculty by identifying individuals whose 

expertise complements our own and who are interested in the various Bioinformatics 

problems. The Center will invite and have on staff both Distinguished Visiting Faculty 

and Postdoctoral Fellows whose expertise lies within areas of interest to our industrial 

partners as expressed through the grants and contracts coming through the Center. 

Currently, the list includes the following personnel 

• Dr. Karen Daniels (computational geometry, data mining) 

• Dr. Georges Grinstein (visualization, data mining) 

• Dr. Haim Levkowitz (visualization, internet and web, color theory) 

• Dr. Gary Livingston (data mining, databases) 

• Dr. Lee Jones (mathematical modeling, statistics) 

• Dr. Alex Gee (visualization and user interfaces) 


• Chi-Hung Chiang (Sc.D. December 2006) Analyzing Patterns in User Interaction 

with Information Visualization Systems (Dr. Chiang has been involved with the 

UVP platform along with the Evident project) 

• Jianping Zhou (Sc.D. August 2007) Bioinformatics Visualization and Data 

Mining (Dr. Zhou has worked with the SensAble project, the UVP platform, and 

microarray data) 

• Howard Goodell (Sc.D. June 2006) Bioinformatics Visualization of Data 

Exploration Processes (Dr. Goodell took a post doc at Inria in Paris, 

• France for the 2007 year and isnow working at InforSense in Massachusetts) 

• MaryBeth Smrtic (Ph.D. expected 2008) Visual Analysis of Microarrays 

(Biomedical Engineering Doctoral Program) (Ms. Smrtic has worked with the 

Umass Medical School and is involved with the development of InfoMaps). 


51

• John Sharko (Sc.D. expected 2008) High dimensional visualizations of 

microarray data (Mr. Sharko has worked with the SensAble project and the MGH 

project) 

• Amr Elbasiony (Sc.D. expected 2008) Human tissue characterization using 

imaging, visualization and vision. 

• Brian Drohan (Ph.D. expected 2008), Architectures for Electronic Health 

Records. (Mr. Drohan has been working on the MGH project and focused on risk 

analysis for breast cancer and visualizations for physicians) 

• Loura Costello (Sc.D. expected 2009), Data Analysis for Breast Cancer Risk 

Assessment (Ms. Costello has been working on using AI and Mathematical tools 

on the MGH project). 

• Shawn Konecni (Ph.D. expected 2010), Concept Maps and Text Processing for 

Electronic Medical Records (Mr. Konecni has been working on automatically 

parsing Electronic Medical Records for Pathology identification to aid Physicians 

in their breast cancer risk assessment determination). 

Several new bioinformatics students have joined the lab (some in the Computer Science 

Sc.D. program, some in the Biochemistry Ph.D. program and some in the BMET Ph.D. 

program). Several high school students have been provided summer research positions. 

Two freshmen (one from Biology and two from Computer Science) and one Senior from 

CS worked in the lab. 

Current Research Projects 

MGH (Funded: 7/06-6/08) 

MGH Avon Breast Cancer Center has awarded Dr. Grinstein funds to explore and mine 

the Avon Breast Cancer patient database, create a new risk model, and develop new 

pedigree visualizations that support both the family physician as well as clinicians in their 

diagnosis and determination of how to proceed with different levels of risk. 

DARPA (Funded to Susan Braunhut and Ken Marx: 7/06-6/08) 

We are working with Dr. Braunhut and Dr. Marx on analyzing initially newt and more 

recently mice gene expression microarray data to identify genes involved in limb 

regeneration. 

Publications 

Chiang C-H, H. Goodell and G. Grinstein (2007), Supporting Visual Exploration: beyond 

just interaction, submitted to InfoVis 2007. 

Plaisant C., Fekete JD, and G. Grinstein (2007), Promoting Insight Based Evaluation of 

Visualizations: From Contest to Benchmark Repository, to appear in IEEE Transactions 

on Visualization and Computer Graphics, 2007. 


52

Dominguez F.J., C. Lawrence, E.F. Halpern., L.M. Salisbury B. Drohan, G. Grinstein, 

D.M. Black., B. L. Smith, M.A. Gadd, M. Specht., D.B. Kopans, R.H. Moore, S.S. 

Hughes, C.A. Roche, K.S. Hughes, (2006), Accuracy of Self-Reported Personal History 

of Cancer in an Outpatient Breast Center, Journal of Genetic Counseling (In Press). 

Grinstein G., C. Plaisant, S. Laskowski, T. O’Connell, J. Scholtz and M. Whiting, VAST 

2006 Contest – A Tale of Alderwood, Proceedings of the IEEE Visual Analytics Systems 

and Technology Symposium, Baltimore, October 29-November 2, 2006 

Goodell H., C-H. Chiang, C. Kelleher., A. Baumann , and G. Grinstein (2006), Collecting 

and Harnessing Rich Session Histories, International Conference on Information 

Visualization (IV06), London, July 5-7, 2006, pp 117-123. 

Yang F, H. Goodell, R. Pickett., R. Bobrow, A. Baumann, A. Gee, and G. Grinstein 

(2006), Data Exploration Combining Kinetic and Static Visualization Displays, 

International Conference on Coordinated Multiple Views in Exploratory Visualization, 

London, July 4 2006. 

Grinstein G., F. Martin, and S. Kuhn, Radical Design: From Pencils to Software to 

Processes to Clothing, DIS2006 Workshop, Exploring Design as a Research Activity, 

Penn State, June 24-26, 2006 

H. Goodell, Chiang C-H., Kelleher C., Baumann A., and G. Grinstein, Metrics for 

Analyzing Rich Session Histories, AVI’06 Workshop on Beyond Time and Errors: Novel 

Evaluation Methods for Information Visualization, (BELIV06), Venice May 23, 2006. 

“A Machine Learning Approach to Pharmacological Profiling of the Quinone Scaffold in 

the NCI Database: Effective Against Melanoma and Leukemia Cell Lines,” (M.L. Ujwal, 

P. Hoffman and K.A. Marx), IEEE Proceedings 7 th Bioinformatics & Biological 

Engineering, (2007) in press. 

“Evidence for Proximal to Distal Limb Amputation Site Effects from Global Gene 

Expression Correlations found in Newt Microarrays,” (K.A. Marx, J. Sharko, G.G. 

Grinstein, S. Odelberg and H.G. Simon), IEEE Proceedings 7 th Bioinformatics & 

Biological Engineering, (2007) in press. 

“Heat Map Visualizations Allow Comparison of Multiple Clustering Results and 

Evaluation of Dataset Quality: Application to Microarray Data,” (J. Sharko, G.G. 

Grinstein K.A. Marx, J. Zhou, C.H. Cheng, S. Odelberg and H.G. Simon), Proceedings 

Euro InfoViz (2007) in press. 

For other CS related publications see the IVPR 2006-2007 report 


53


Numerous presentations at meetings of the IEEE, CBSE, ICDE, CHI, IBC, DDT, BioIT, 

and at Universities and Labs, including a keynote talk at the Pfizer Global Summit in the 

UK 

Tutorials and Workshops: 

Numerous presentations, both tutorials and workshops, at many 

Collaborations 

Institute for Visualization and Perception Research 

Department of Biological Sciences 

Department of Chemistry 

Mass General Hospital 

Newton-Wesley Hospital 


BioIT and are the two groups we have focused on joint presentations through tutorials 

and workshops. These have been fruitful in establishing contacts. The current MGH 

collaboration came from one of these presentations. 

We made numerous presentations to high schools and community colleges on the 

bioinformatics program to help increase the number of students and minorities joining the 

program. 

Proposals Submitted/Awarded 

Awarded 

MGH, 07/06 – 06/07, $65,000 

PI: Dr. Georges Grinstein 

Continued research in breast cancer risk assessment 

Pfizer, 01/08 – 01/10. $75,000 


High-dimensional visualization of drug discovery data 

Submitted 

US Army Medical research and Material Command (USAMRMC) Visualization 

of under and over prediction in Breast Cancer Risk Models, $75,000 

Not funded. 

NIH - Breast Cancer Risk Assessment: Integrating Risk Models, Patient Data and 

Decision Support in a Clinical Setting, $275,000 

Not funded 


54

6. THE CENTER FOR CELLULAR 

NEUROBIOLOGY AND NEURODEGENERATION RESEARCH 


The Center for Cellular Neurobiology and Neurodegeneration Research seeks to 

understand the basic mechanisms that maintain neuronal health, and how errors in these 

processes lead to neuronal degeneration, with particular attention towards delaying or 

preventing the progression of Alzheimer’s disease and motor neuron disease. In addition 

to testing of pharmacological agents effective against Alzheimer’s disease, our efforts 

include the development of inexpensive, vitamin- and nutriceutical-based, consumable 

formulations that can delay the progression of neurodegeneration. 

2. General Description 

The Center consists of laboratories in Olsen and Weed Hall, with its primary location in 605 

Olsen. 

3. Research Groups and Activities Focus Areas 

Our research, along with that of other laboratories, suggests that chronic 

neurodegenerative conditions such as Alzheimer’s disease are the result of several 

factors, including environmental, nutritional and genetic predispositions (and perhaps 

more than one of each category). This renders analyses and developments of treatments 

particularly difficult. We utilize several model systems in efforts to identify various 

enzymes and genes that may contribute to neurodegeneration, including: 

•transgenic mice whose genomic profile mimics that of individuals at risk for 

Alzheimer’s or Parkinson’s disease 

•neurons maintained outside of the brain in culture interfaced with computers for 

stimulation and recording 

•identified neurons within the brain 

We subject these models to defined treatments and/or deficient diets that provoke 

neurodegeneration, and attempt to intervene with this neurodegeneration by vitamin or 

drug supplements. 

Oue more recent University- and CFCI-supported studies have involved clinical 

trials with early- to mid-stage Alzheimer’s disease and normal adults/seniors. We have 

recently extended our approach to include Parkinson’s disease, which will involve animal 

and cell culture model systems 

Affiliated Faculty of the Center each direct their own research programs. As a result 

of our respect diverse expertise and interests, our collaborations bring unique approaches 

to neuroscience. Undergraduate and graduate students are involved in all Center research 

projects, and this is considered a key mission of the Center. 


Director 

Thomas B. Shea, Ph.D. 

Neurodegeneration) 

Associate Directors 

Garth Hall, Ph.D. 

Neurodegeneration) 

(Neurobiology and 

(Neurobiology and 

The Center For Cellular Neurobiology and Neurodegeneration Research 

55

Robert Nicolosi, Ph.D. 

Nutrition) 

Eugene Rogers, Ph.D. 

Nutrition) 

Michael Graves, Ph.D 

Deane Falcone, Ph.D. 

Nutriceuticals) 

(Chronic Diseases, Cardiovascular Disorders, 

(Antioxidants, Toxicology, 

(Genomics, recomb DNA) 

(Genetic Engineering of Plants to produce 

Affiliated Faculty 

Shelia Mihalick (UMass•Worcester) 

Aurea Pimenta (Univ of Vanderbilt Medical School) 

Harish Pant (NIH) 

Nancy Lombardo (Boston University; Bedford VA Hospital) 

Mike McGee (St. Joseph’s Senior Center) 

5. New and Temporary Faculty Affiliations 

James Paskevitz , M.D. UMass Worcester James directs the largest Alzheimer’s 

clinic in the Northeast; Medical Advisor for clinical trials with our “SmartPill” 

Deane Falcone, PhD joined UML Biological Sciences last year. His expertise is 

in plant genetics. We have initiated studies, and already submitted a proposal, in which 

we overexpress key neuroprotective nutrients in plants for human consumption. 

6. Student Research Support 

Shea financially supported 4 doctoral students during 2006-2007, one of which 

(Amy Chan) was supported by CFCI funds. During the coming year, a doctoral 

candidate will continue to be supported by CFCI funds. Nicolosi supported 2 graduate 

students on CFCI-funded research. Rogers supported an undergraduate. Two Master’s 

candidates and 1 undergraduate are conducting research projects in the Center. 


•Determination of intermediates in methionine metabolism and their role in health 

and disease 

•Pharmacological intervention in cytoskeletal abnormalities in Alzheimer’s disease 

•Clinical trials of the SmartPill, a vitamin/nutriceutical formulations which we have 

shown to delay progression of Alzheimer’s disease and to improve cognitive performance 

in normal aging. 

•Production of SmartPill constituents in genetically-engineered plants 

•The interplay of cytoskeletal elements in outgrowth and regeneration of axons. 

• Development of a computer-neuronal interface/biosensor. 

Our research, along with that of other laboratories, suggests that chronic 

neurodegenerative conditions such as Alzheimer’s disease are the result of several 

factors, including environmental, nutritional and genetic predispositions (and 

perhaps more than one of each category). This renders analyses and developments of 


56

treatments particularly difficult. We utilize several 

model systems in efforts to identify various enzymes and genes that may contribute to 

neurodegeneration, including: 

•transgenic mice whose genomic profile mimics that of individuals at risk for 

Alzheimer’s or motor neuron disease (ALS) 

•neurons maintained outside of the brain in culture 

•identified neurons within the brain 

We subject these models to defined treatments and/or deficient diets that provoke 

neurodegeneration, and attempt to intervene with this neurodegeneration by vitamin or 

drug supplements. 

Recent findings from our laboratory and others indicate that deficiencies in folate 

and vitamin E not only promote neurodegeneration, but interact synergistically with other 

conditions known to contribute to neurodegeneration. Variants, or polymorphisms, in 

several enzymes in the metabolic pathway that utilizes folate exist within the human 

population. Some of these polymorphisms display relatively weak activity, resulting in 

reduced folate-dependent metabolism even in the presence of otherwise sufficient dietary 

folate. We are currently examining whether such variants contribute to 

neurodegeneration. Since other studies from our laboratory demonstrate that oxidative 

stress also renders neurons susceptible to neurodegeneration, we are also examining and 

how polymorphisms in folate-dependent enzymes interact with polymorphisms in 

enzymes that reduce our production of antioxidants. 

Our research has culminated in the completion of a year-long clinical trial of our 

formulation, termed the “SmartPill,” with early-stage Alzheimer patients, with funding 

from Chancellor Hogan. The three-month time point in this one-year study shows 

improvement in the majority of patients. We have also completed a year-long study with 

nondemented seniors in the Andover Senior Center and several other regional senior 

centers; poster presentation from these tests are included. These studies will help bring 

the SmartPill (patent pending) to market; two companies have signed term sheets with 

our CVIP office to license the SmartPill. 

Affiliated Faculty of the Center each direct their own research programs. As a result 

of our respect diverse expertise and interests, our collaborations bring unique approaches 

to neuroscience. Undergraduate and graduate students are involved in all Center research 

projects. 

8. Representative Peer-Reviewed Full-Length Publications NOT previously reported to 

the CFCI (2006-2007 only) 

1) Motil J, Dubey M, Chan W K-H and Shea TB (2006) Inhibition of dynein but not 

kinesin induces focal accumulation of neurofilaments in axonal neurites. Brain Res in 

press. 

2) Shea TB (2007) Traffic jams: models for neurofilament accumulation in motor neuron 

disease. Traffic 8:445-447. 


57

3) KuoF, Kotyla T, Wilson T, Kifle L, Panagiotou T, 

Gruverman I, Tagne J-B, Shea, TB and Nicolosi RJ (2007) A nanoemulsion of an 

anti-oxidant synergy formulation reduces tumor growth rate in neuroblastoma-bearing 

nude mice. J Exp Ther Oncol 6: in press. 

4) Chan A and Shea TB. Folate deprivation increases presenilin expression, gammasecretase 

activity and Abeta levels in murine brain: potentiation by Apoe deficiency 

and alleviation by dietary S-adenosyl methionine. J Neurochem: 102:753-760. 

5) Chan A and Shea TB. Improved cognitive performance and decreased aggression in 

normal and ApoE4 mice following dietary supplementation with N-acetyl cysteine, 

acetyl-L-carnitine and S-adenosyl methionine. Neuromol Med: in press. 

6) DeFuria J and Shea TB Arsenic inhibits neurofilament transport and induces 

perikaryal accumulation of phosphorylated neurofilaments: Roles of JNK and GSK- 

3beta. Brain Res: in press. 

7) Dubey M and Shea TB Potentiation of arsenic neurotoxicity by folate deprivation: 

protective role of S-adenosyl methionine. Nutritional Neurosci: in press. 

Review article: 

Sihag RK, Inagaki M, Yamaguchi T, Shea TB and Pant HC (2007) Role of 

phosphorylation on the structural dynamics and function of type III and IV intermediate 

filaments. Experimental Cell Research: in press. 

Manuscripts under consideration for publication 

Chan A and Shea TB S-adenosyl methionine: a natural therapeutic agent effective 

against multiple hallmarks and risk factors associated with Alzheimer’s disease Submitted 

Chan A and Shea TB. Time for a change: the Clock-Drawing test. Submited 

9. Conferences NOT previously reported (includes only those where a presentation 

was made) 

Chan W K-H, Dubey M, Falcone D and Shea TB (2006) Divalent cation-mediated 

“bridging” of phosphorylated neurofilaments (NFs) promotes NF-NF association and 

inhibits NF-microtubule association: a mechanism for selective slowing of axonal 

transport of phospho-NFs. Gordon Gordon Research Conference on Intermediate 

Filaments. Newport RI 

Dubey M and Shea TB (2006) Gordon Neurofilaments prevent tau-mediated axonal 

retraction by stabilizing axonal neurites. Gordon Research Conference on 

Intermediate Filaments. Newport RI 

Chan W K-H, Dubey M, Falcone D and Shea TB (2006) Divalent cation-mediated 

“bridging” of phosphorylated neurofilaments (NFs) promotes NF-NF association and 


58

inhibits NF-microtubule association: a mechanism for selective slowing of axonal 

transport of phospho-NFs. Am Soc Neurosci: in press 

Dubey M and Shea TB (2006) Gordon Neurofilaments prevent tau-mediated axonal 

retraction by stabilizing axonal neurites. Am Soc Neurosci: in press 

Lepore A, Goodrow E, Chan A and Shea TB (2007) Cognitive performance in 

normal seniors is enhanced by a nutriceutical formulation. Exp Biol Ann Meeting: 

FASEB Wash DC 

Chan, W K-H, , Kushkuley J, Leterrrier, J-F Eyer J, TB Shea (2007) Calciummediated 

“bridging” of phosphorylated neurofilaments (NFs) promotes NF-NF 

association and inhibits NF-microtubule association: a mechanism for selective 

slowing of axonal transport of phospho-NFs. Mol Biol Cell: in press. 

Dubey M, Moran C, Chan W K-H, Alsaraby A and Shea TB (2007) GSK-3B 

regulates the transition of neurofilament subunits from punctate to filamentous 

structures. Mol Biol Cell: in press. 

Chan A, Paskvitz J and Shea TB (2007) A novel vitamin/nutriceutical formulation 

that delays cognitive decline and improves mood in early-stage Alzheimer’s disease. 

Alzheimer’s and Dementia.3;S98. 

10. Intra-University Collaboration 

We have ongoing collaborations with investigators from the National Institute of 

Health (Harish Pant), UMass•Worcester (James Paskevitz), Boston University 

(Nancy Lombardo), St. Joseph’s Senior Center (Mike McGee) and the University of 

Pittsburg Medical School (Aurea Pimenta). 

11. Regional/Local Community Technical Outreach 

Shea and associates give annual presentations at the Massachusetts Alzheimer’s 

Association as well as multiple regional presentations to families and caregivers, and 

regional schools. In addition to highlighting the ongoing studies at the Center, the 

purpose of these presentations is to provide an interface between scientists and the 

community, in order to allow the community to understand current developments and 

research areas in neurodegeneration. Our studies on apple juice were featured in over 60 

news articles and two television and two radio appearances. 

Center faculty and graduate students serve as the Judges’ Panel for the annual 

Science Fair at St. Michael’s School (grades 5-8) in Dracut, MA 

Shea was elected to the Board of Directors of The Community Family (an 

Alzheimer’s support and care group in Lowell and other areas around Boston. 

Shea served as the Honorary Chair of the Lowell Alzheimer’s disease Memory Walk 

in Oct 2006, and was the invited speaker for a Research Day for the Alzheimer’s 


59

Association in Oct 2006. He will present a workshop in the upcoming Map Thru the 

Maze (Malboro, MA, 2008) 

12. New Grant Awards for 2006 

2006-2007 Principal Investigator, subcontract from US Army STTR to Infoscitex 

Corp 

“A neuronal co-culture biosensor to monitor signaling and stress” 

Total Direct Cost: $38,500 

2007-2009 Principal Investigator, National Institute on Aging 

“Is S-adenosyl methionine a nutrition:genetic link in Alzheimer’s disease?” 


2007 Principal Investigator, National Institute of Health 

“Gordon Conference on Intermediate Filaments 


Proposals Submitted 

•Neurofilament dynamics and axonal outgrowth 

•The “SmartPill”: a nutriceutical that prevents cognitive decline in aging. 

•Expression of anti-Alzheimer nutriceuticals in plants (Falcone) 


60

7. CENTER FOR COMPLEX ENVIRONMENTAL 

SYSTEMS 

2006-2007 Annual Report 

Associate Director: Jackie Zhang 

Director: Juliette N. Rooney-Varga 


The mission of the Center for Complex Environmental Systems (CCES) is to conduct 

multi-disciplinary research, technical assistance, and training in environmental sciences 

and technologies. CCES’ mission extends to local, regional, and global environmental 

processes and includes both basic and applied environmental science. 

General Description 

The Center for Complex Environmental Systems (CCES) at UMass Lowell is a multidisciplinary 

research, technical assistance, and training organization that focuses on 

environmental science and technologies. 

Areas of research include air pollution modeling and analysis; analytical tools for 

atmospheric, aquatic, and soil chemistry; soil remediation technologies; environmental 

microbiology and microbial ecology; biogeochemistry; and environmental policy and 

impact analysis. 

The Center has several associated laboratories, including analytical and wet chemistry 

laboratories; a biochemistry laboratory; an environmental microbiology laboratory; a site 

remediation laboratory; and a biogeochemistry laboratory. The Center and associated 

faculty are engaged in several research efforts funded by Federal and State agencies and 

private institutions. The Center also provides a forum for exchange of information in the 

form of colloquia and occasional symposia on specific subjects. 

Center for Complex Environmental Systems 

61


Several Research Groups representing diverse disciplines are members of the 

CCES. These include: 

Research Group Faculty Leadership Focus Area 

Analytical and 

Environmental Chemistry 

David K. Ryan and 

Eugene Barry 

Development of new methods to 

analyze metal ions, synthetic 

organic compounds, and humic 

and fulvic acids in 

environmental samples. 

Atmospheric Chemistry Robert Gamache Modeling of tropospheric 

pollutant gases. 

Biogeochemistry Mark Hines Analysis of anaerobic 

biogeochemical processes in 

wetlands and sediments. 

Environmental 

Engineering 

Clifford Bruell 

Development of remediation 

technologies for soils 

contaminated with hazardous 

pollutants. 

Meteorology Frank Colby Modeling of regional wind 

patterns. 

Microbial Ecology 

Juliette Rooney- 

Varga 

Molecular and cultivation-based 

analysis of bacteria in marine, 

wetland, and wastewater 

treatment microbial 

communities. 

Modeling Stephen Pennell Mathematical modeling of 

hydrological and other 

environmental processes. 

Wastewater Treatment Jackie Zhang Analysis of bioreactor-based 

wastewater treatment processes. 


62


Faculty and Staff Associated with the CCES: 

Name Title Research Area 

Antony, Bobby Post-Doctoral Atmospheric Chemistry 

Associate 

Barry, Eugene Professor Analytical Chemistry 

Bruell, Clifford Professor Remediation Technologies 

Colby, Frank Professor Meteorology 

Eby, Nelson Professor Geochemistry 

Gamache, Robert Professor Atmospheric Chemistry 

Hines, Mark Professor Biogeochemistry 

Jahngen, Edwin Professor Biochemistry 

Liang, Chenju 

Assistant Professor, 

National Chung 

Hsing University 

Remediation Technologies 

O’Brien, Arnold Professor Groundwater Quality 

Pennell, Stephen Professor Modeling 

Rooney-Varga, 

Juliette 

Center Director, 

Associate Professor 

Microbial Ecology 

Ryan, David Professor Analytical and Environmental 

Chemistry 

Zhang, Xiaoqi Jackie 

Associate Director, 

Associate Professor 

Biological Wastewater Treatment 

Student Research Support 

CCES faculty members have mentored undergraduate, graduate, and post-doctoral 

students 

Name Mentor Degree 

Adatto, Isaac Hines M.S. 

Agrawal, Nikunj Rooney-Varga M.S. 

Bansal, Shweta Zhang M.S. 

Chen, Dongxu Zhang Ph.D. 

Fonseca, Cindy Hines B.S. 


63

Gamache, Peter Gamache B.S. 

Graham, Joe Zhang B.S. 

Hoell, Andrew Gamache B.S. 

Humphrey, Kaitlin Gamache B.S. 

Hussain, Mack Rooney-Varga High School 

Joyner, Dan Hines B.S. 

Jayaradu, Praveen Zhang M.S. 

Klimas, Lisa Hines M.S. 

Laraia, Anne Gamache B.S. 

Lynch, Andrea Hines B.S. 

Manmode, Rahul Ryan M.S. 

Metje, Stephanie Hines B.S. 

Mohanty, Nihar Bruell Ph.D. 

Musgrave, Amy Bruell B.S. 

Pande, Nilesh Rooney-Varga M.S. 

Swett, Peter Ryan Ph.D. 

Vannela, Gangadher Ryan M.S. 

Wadden, Andrew Bruell M.S. 

Woods, Mike Ryan M.S. 

Yin, Yexin Zhang M.S. 

Current and Recent Research Projects 

Investigator Sponsor Project Title Amount 

Awarded 

Colby (Not yet funded) Source of Instability Which 

Causes Banded Precipitation 

Colby (Not yet funded) Tornadoes from Elevated 

Convection 

Colby (Not yet funded) Snow Squalls -- Origin and 

Dynamics 

Colby (Not yet funded) Structure and Dynamics of 

Northers 

Colby (Not yet funded) Effect of Deforestation on Heat 

Waves in New England 


64

Gamache 

National Science 

Foundation 

Line shape parameters for 

water vapor and other 

atmospheric asymmetric rotor 

molecules 

$218,821 

Hines, Co-I National Science 

Foundation 

Hines, Co-I National Science 

Foundation 

Atmospheric Deposition, $1,800,000 

Transport, Transformations 

and Bioavailability of Mercury 

across a Northern Forest 

Landscape 

Project EXCEL $343,862 

Hines, PI 


Foundation 

Mercury transformations in 

the Idrija River System, 

Slovenia 

Hines, PI USGS Denver Mercury, Methylmercury, and 

Mercury (II) Analysis, Salmon 

Creek Reservoir, Idaho. 

$68,877 

$13,279 

Mohanty 

(advisor: 

Bruell) 

Rooney- 

Varga 

Environmental 

Protection Agency 


Foundation 

Doctoral Fellowship $97,347 

Phytoplankton Interactions: 

The Influence of Marine 

Bacteria on Alexandrium spp. 

Blooms in the Gulf of Maine 

$317,883 

Ryan, 

Golomb 

Massachusetts 

Technology Transfer 

Center 

Carbon Dioxide and Water 

Emulsions Stabilized by Fine 

Particles for Enhanced Oil 

Recovery 

$25,000 

Ryan, 

Golomb, 

Barry, 

Pennell 

Department of Energy 

Ocean sequestration of carbon 

dioxide. 

$750,000 

Xiaoqi 

(Jackie) 

Zhang (PI), 

UIUC/CICEET 

Kinetics and extent of Fe(III) 

reduction-dependent 

phosphorus removal using 

anaerobic sequencing batch 

reactors. 

$113,196 


65

Zhang, 

Bruell, 

Hines, 

Watterson, 

Barry 


Foundation 

NUE: Laboratory Modules on 

Environmental Impacts of 

Nanotechnology 

$200,000 

Publications by members of the CCES during the last Academic Year 

Antony, B. K., and Robert Gamache, “Self-broadened half-widths and self-induced 

line shifts for water vapor transitions in the 3.2-17.76 mm spectral region via 

complex Robert-Bonamy theory,” J. Mol. Spectrosc. 243, 149-159 (2007). 

Antony, B. K., Steven Neshyba, Robert Gamache, “Self-broadening of water vapor 

transitions via the complex Robert-Bonamy theory,” J. Quant. Spectrosc. 

Radiat. Transfer 105, 148-163, 2006. 

Antony, B., Peter Gamache, Carlos Szembek, Danielle Niles, and Robert R. 

Gamache, “Modified complex Robert-Bonamy formalism calculations for 

strong to weak interacting systems,” Molecular Physics 104, 2791-2799, 2006. 

Bandyopadhyay, A., Biswajit Ray, Pradip N. Ghosh, Danielle L. Niles and Robert R. 

Gamache, “Diode laser spectroscopic measurements and theoretical 

calculations of line parameters of nitrogen broadened water vapor overtone 

transitions in the 818-834 nm wavelength region”, J. Mol. Spectrosc. 242, 10- 

16, (2007). 

Barlow, M., A. Hoell, and F. Colby (2007). Examining the wintertime response to 

tropical convection over the Indian Ocean by modifying convective heating in 

a full atmospheric model, Geophys. Res. Lett., in press. 

Brown, L. R., C. M. Humphrey and R. R. Gamache, “CO2-broadened water in the 

pure rotation and n2 fundamental regions,” in press, J. Mol. Spectrosc. 2007. 

Chanton, J. P., D. Fields, and M. E. Hines. 2006. Controls on the hydrogen isotopic 

composition of biogenic methane from high latitude terrestrial wetlands, J. 

Geophys. Res., 111, G04004, doi:04010.01029/02005JG000134. 

Gamache, R. R., and Bobby K. Antony, “Half-widths and Line Shifts of Water 

Vapor for Atmospheric Applications: Measurement and Theory,” 203-220, 

2006, in Remote Sensing of the Atmosphere for Environmental Security, ed. 

By Agnès Perrin, Najate Ben Sari-Zizi, Jean Demaison, Springer, 

Netherlands. 

Gamache, R. R., Bobby K. Antony, Peter R. Gamache, and Jean-Michel Hartmann, 

“The roles of the S1 and S2 scattering matrix terms on half-widths and their 

temperature dependence for the water vapor – nitrogen system,” p. 351-354, 


66

in Spectral Line Shapes, ed. E. Oks and M. Pindzola, AIP Conference Proceedings, 

Vol. 874, Melville, NY, 2006. 

Golomb, D., E. Barry, D. Ryan, P. Swett, and H. Duan. 2006. Macroemulsions of 

Liquid and Supercritical CO2-in-Water and Water-in-Liquid CO2 Stabilized 

by Fine ParticlesInd. Eng. Chem. Res. 45, 2728. 

Golomb, D., Pennell, S., Ryan, D., Barry, E., and Swett, P., 2007, “Releasing a Dense 

Emulsion of Liquid CO2 in Water Stabilized by Pulverized Limestone in the 

Deep Ocean,” to appear in Environmental Science and Technology. 

Golomb, D., S. Pennell, D. Ryan, E. Barry, and P. Swett. 2007. Ocean sequestration 

of carbon dioxide: modeling the deep ocean release of a dense emulsion of 

liquid CO2-in-water stabilized by pulverized limestone particles. Environ. 

Sci. Technol. 41: 4698 

Gray, J.E. and M.E. Hines. 2006. Preface: Mercury: Distribution, Transport, and 

Geochemical and Microbial Transformations from Natural and 

Anthropogenic Sources. Appl. Geochem. 1819-1920. 

Gray, J.E., M.E. Hines and H. Biester. 2006. Mercury cycling and methylation in 

mine wastes from the Terlingua and Mariscal mercury mines, southwest 

Texas. Appl. Geochem. 21:1924-1939. 

Hasegawa, Y., J. L. Martin, M. W. Giewat, and J. N. Rooney-Varga. In press. 

Microbial community diversity in the phycosphere of natural populations of 

the toxic alga, Alexandrium fundyense. Environ. Microbiol. 

Hines, M.E. 2006. Microbially mediated redox cycling at the oxic-anoxic boundary 

in sediments: Comparisons of animal and plant habitats. Water Air Soil 

Pollution: Focus, 6: 523-536 

Hines, M.E., J. Faganeli, I Adatto, and M. Horvat. 2006. Microbial mercury 

transformations in marine, estuarine and freshwater sediments downstream 

of the Idrija Mercury Mine, Slovenia. Appl. Geochem. 21:1940-1954. 

Hines, M.E., P.T. Visscher, A. Teske and R. Devereux. 2007. Sulfur cycling. p. 497- 

510. In: C.J. Hurst, R.L.Crawford, J.L. Garland, D.A. Lipson, A.L. Mills, 

L.D. Stetzenbach (eds.) . Manual for Environmental Microbiology, 3nd 

Edition, American Society for Microbiology Press. 

Inyang, H. I., Rossi, L., Graham-Eagle, J. and Pennell, S., 2007, “Modelling smectite 

illitization in earthen barriers of buried radioactive wastes,” to appear in 

Geomechanics and Geoengineering: An International Journal. 


67

Iouli E. Gordon , Laurence S. Rothman, Robert R. Gamache, David Jacquemart, C. 

Boone , P. F. Bernath, M. Shephard, J. S. Delamere, S. A. Clough, “Current 

updates of water vapor linelist in HITRAN2004: A new “Diet” for airbroadened 

half-widths,” submitted to J. Quant. Spectrosc. Radiat. Transfer 

2007. 

Killian, P.F., Bruell, C.J. Laing, C., and Marley, M.C., “Iron (II) Activated 

Persulfate Oxidation of MGP Contaminated Soil”, Soil and Sediment 

Contamination, An International Journal, Accepted for Publication, 

January/February, 2008 issue, vol 17, no. 1. 

Liang, C. , Bruell, C.J., “Thermally Activated Persulfate Oxidation of TCE: 

Experimental Investigation of Reaction Orders”, Submitted to Industrial & 

Engineering Chemistry Research 2007. 

Liang, C., C. J. Bruell, M. F. Albert, P. E. Cross, D. K. Ryan. 2007. Evaluation of 

reverse osmosis and nanofiltration for in situ persulfate remediated 

groundwater. Desalination, 208, 238-259. 

Liang, C., Z-S Wang, C.J. Bruell, “Influence of pH on Persulfate Oxidation of TCE 

at Ambient Temperatures”, Chemosphere 66 (2007) 106-113. 

Payne, V. H. , J. S. Delamere, K. E. Cady-Pereira, R. R. Gamache, J-L. Moncet, E. 

Mlawer, S. A. Clough, “Air-broadened half-widths of the 22 GHz and183 

GHz water vapor lines,” submitted to IEEE Transactions in Geoscience and 

Remote Sensing, 2007. 

Pennell, S., Golomb, D., Ryan, D., Barry, E., and Swett, P., 2006, “Modeling a Dense 

CO2/H2O/CaCO3 Emulsion Released in the Open Ocean or on the 

Continental Shelf,” Proceedings of the 8th International Conference on 

Greenhouse Gas Control Technologies, Trondheim, Norway. 

Rooney-Varga, J. N., M. W. Giewat, K. N. Duddleston, J. P. Chanton, and M. E. 

Hines. 2007. Links between archaeal community structure, vegetation type, 

and methanogenic pathway in Alaskan peatlands. FEMS Microbiol Ecol. 60: 

240-251. 

Shimecková, M., David Jacquemart, Laurence S. Rothman, Robert R. Gamache, 

and Aaron Goldman, “Einstein A-coefficients and statistical weights for 

molecular absorption transitions in the HITRAN database,” J. Quant. 

Spectrosc. Radiat. Transfer 98, 130-155, 2006. 

Swett, P., Golomb, D., Ryan, D., Barry, E., Pennell, S., Warzinski, R., and Lynn, R., 

2006, “Testing and evaluation of a static mixer for creation of a CO2-in-water 

emulsion stabilized by pulverized limestone,” Proceedings of the 8th 


68

International Conference on Greenhouse Gas Control Technologies, Trondheim, 

Norway. 

Tran, H., D. Bermejo, J.-L. Domenech, P. Joubert, R. R. Gamache, and J.-M. 

Hartmann, “Collisional parameters of H2O lines: velocity effects on the lineshape,” 

in press J. Quant. Spectrosc. Radiat. Transfer 2007. 

Wang, J., Burken, J. G. and Zhang, X. and Surampalli, R. (2006) Effects of Seeding 

Materials and Mixing Strength on Struvite Precipitation. Water Environment 

Research 78(2), 125-132. 

Yu, T., Lin, W., McSwain, B.S., Yu, M. and Zhang, X. (2006) Biological Fixed Film 

Systems – Review. Water Environment Research 78(10), 1324-1362. 

Zhang, X. and Lulla, M. (2006) Evaluation of Pathogenic Indicator Bacteria in 

Structural BMPs. Journal of Environmental Science and Health. A41(11), 

2483-2493. 

Zhang, X., K. Brussee, C. Coutinho, and J. Rooney-Varga. 2006. Chemical Stress 

Induced by Copper: Examination of a Biofilm System. Wat. Sci. and Tech. 

54:191-199. 

Zhang, X., Lulla, M. (2006) Distribution of Pathogenic Indicator Bacteria in 

Structural BMPs. Journal of Environmental Science and Health A41(8), 

1421-1436. 

Conferences 

Center PIs and graduate students attended and gave presentations at several 

national and regional conferences. These included: 

Adatto, I. and M.E. Hines. 2006. Factors Controlling Mercury Methylation and 

Demethylation in Wetlands and Soils at an Adirondack Lake. 8th 

International Conference on Mercury as a Global Pollutant. Madison, WI. 

Antony, B. Peter Gamache, Robert R. Gamache, and Jean-Michel Hartmann, “The 

roles of the S1 and S2 scattering matrix terms on half-widths and their 

temperature dependence for the water vapor-nitrogen system,” 18th 

International Conference on Spectral Line Shapes, Auburn University, 

Auburn, Alabama, June 4-9, 2006. 


69

BOBBY ANTONY and ROBERT GAMACHE, “CALCULATION OF LINESHAPE 

PARAMETERS FOR SELF-BROADENING OF WATER VAPOR 

TRANSITIONS VIA COMPLEX ROBERT-BONAMY THEORY”,paper 

TC07, International Symposium on Molecular Spectroscopy, 61st Meeting, 

June 19-23,2006, The Ohio State University, Columbus, OH. 

Brown, L. R., Caitlin M. Humphrey, Robert R. Gamache, “CO2-Broadened H2O in 

the Pure Rotation and n2 Fundamental Regions,” paper RD01, International 

Symposium on Molecular Spectroscopy, 62nd Meeting, June 18-22 ,2007, The 

Ohio State University, Columbus, OH. 

Chanton, J., P. Glaser, L. Chasar and M. Hines, M. 2007. Radiocarbon partitioning 

in wetland DOC, DIC, CH4 and Peat. Carbon in Peatlands Symposium. 

Wageningen, the Netherlands. 

Colby, Frank P., Jr. and B. E. Walker: Tornadoes from elevated convection. 22nd 

Conference on Weather Analysis and Forecasting/18th Conference on 

Numerical Weather Prediction, June 25-29, 2007, Park City, UT. 

Colby, Frank P., Jr.. Mesoscale analysis of nor'easter of December 9, 2005. 12th 

Conference on Mesoscale Processes, August 6-9, 2007, Waterville Valley, NH. 

Colby, Frank P., Jr.: Weather Models 100: What are they and how do they work? 

Seventh Southern New England Weather Conference, October 28, 2006, 

Brookline, MA 

Drouin, B. and Robert R. Gamache, “Air Broadened Ozone Linewidths in the 

Submillimeter Wavelengths,” The 9th HITRAN Database Conference, June 

26-28, 2006, Harvard-Smithsonian Center for Astrophysics, Cambridge, MA. 

Gamache, R. R., B. Antony, P. R. Gamache, , G. Wagner, and M. Birk, 

“Temperature dependence of N2-, O2-, and air-broadened half-widths of 

water vapor transitions: insight from theory and comparison with 

measurement,” The 9th HITRAN Database Conference, June 26-28, 2006, 

Harvard-Smithsonian Center for Astrophysics, Cambridge, MA. 

GAMACHE, R. R., B. K. ANTONY AND P. R. GAMACHE, “TEMPERATURE 

DEPENDENCE OF N2-, O2-, AND AIR-BROADENED HALF-WIDTHS OF 

WATER VAPOR TRANSITIONS”,paper TC09, International Symposium on 

Molecular Spectroscopy, 61st Meeting, June 19-23,2006, The Ohio State 

University, Columbus, OH. 

Gamache, R. R., Peter R. Gamache and Bobby Antony, “NON-LINEAR LEAST- 

SQUARES ADJUSTMENT OF THE INTERMOLECULAR POTENTIAL 

PARAMETER FOR THE H2O-N2 SYSTEM”, paper L6, The 19th 


70

International Conference on High Resolution Molecular Spectroscopy, Prague, 

Czech Republic, August 29 - September 2, 2006 

Gordon, I. E., L. S. Rothman, D. Jacquemart, and R. R. Gamache, “CURRENT 

UPDATES FOR THE HITRAN2004 COMPILATION”, paper L6, The 19th 

International Conference on High Resolution Molecular Spectroscopy, 

Prague, Czech Republic, August 29 - September 2, 2006 

GORDON, I.E., L. S. ROTHMAN, D. JACQUEMART, and R. R. GAMACHE, “A 

NEW ``DIET'' FOR AIR-BROADENED HALF-WIDTHS OF WATER 

VAPOR IN THE HITRAN2004 COMPILATION”,paper MG08, 

International Symposium on Molecular Spectroscopy, 61st Meeting, June 19- 

23,2006, The Ohio State University, Columbus, OH. 

Hines, M., K. Duddleston and J. Chanton. 2006. Uncoupling of the Pathway of 

Methanogenesis in Northern Wetlands: Connection to Vegetation, and 

Implications for Variability and Predictability. Fall Meeting of the American 

Geophysical Union, San Francisco. 

Hines, M., K. Duddleston, J. Rooney-Varga and J. Chanton. 2007. Connections 

between the pathway and rate of methanogenesis and vegetation in 

peatlands: Implications for a changing climate. Carbon in Peatlands 

Symposium. Wageningen, the Netherlands. 

Hines, M.E. 2006. Dynamics of bacterially-mediated formation, degradation, and 

potential accumulation of methylmercury. 8th International Conference on 

Mercury as a Global Pollutant. Madison, WI. 

Hines, M.E. and I. Adatto. 2007. Methylmercury accumulation in northern 

wetlands may be due to the lack of degradation by methanogenic bacteria. 

Aquatic Sciences Meeting (ASLO), Santa Fe. 

Humphrey, C. and Robert R. Gamache, “LINE SHAPE OF H2O BROADENED BY 

CO2 FOR APPLICATIONS TO THE ATMOSPHERES OF MARS AND 

VENUS,” The Tenth Annual Student Research Symposium, University of 

Massachusetts Lowell, Lowell, MA. April 26, 2007 

Pande, N. N., N. K. Agrawal, J. N. Rooney-Varga. Interactions Between the Toxic 

Alga, Alexandrium fundyense, and Its Bacterial Associates: Stimulation, 

Inhibition, and Specificity of Bacterial Effects on Alexandrium Growth. 

Submitted to American Society for Microbiology General Meeting, Toronto 

CA, May 2007. 

Rindsland, C. P., V. Malathy Devi, D. Chris Benner, Thomas A. Blake, Tony 

Masiello, Robert L. Sams, Linda R. Brown, Isabelle Kleimer, A. Dehayem 

Kamadjeu, Holger S. P. Müller, Robert R. Gamache, Danielle L. Niles, 


71

“Spectral Line Parameters in the n4 Band of CH3CN,” paper TC04, International 

Symposium on Molecular Spectroscopy, 62nd Meeting, June 18-22 ,2007, The 

Ohio State University, Columbus, OH. 

Szembek, C., Bobby Antony, and Robert Gamache, “A Semi-Empirical Adjustment 

of the Polarizability of Ozone for ues in Line Shift Calcualtions,” The 9th 

HITRAN Database Conference, June 26-28, 2006, Harvard-Smithsonian 

Center for Astrophysics, Cambridge, MA. 

Yu, R.-Q., T. Barkay, J. K. Schaefer, C. DiPasquale, I. Adatto, M. E. Hines. 2007. 

Molecular Characterization of microbial communities in a methylmercurycontaminated 

Adirondack Lake wetland. Amer. Soc. Microbiol. General 

Meeting, Toronto. 

Zhang, J., C. Bruell, M. Hines, A.C. Watterson and C. Barry,”Laboratory modules 

on environmental impacts of nanotechnology”, Presented at the 2007 ACS 

233rd National Meeting& Exposition, Chicago, IL, March 25_29, 2007. 

Zhang, X., Brussee, K., and Rooney-Varga, J. Impacts of Chemical Stress Induced 

by Copper- Examination of a Biofilm System. International Water 

Association Biennial Conference. Beijing, China. Sept. 2006. 

Zhang, X., C, Bruell, Yin, Y., Jayaradu, P. and M. Hines. 2007. Introducing 

nanotechnology into environmental engineering curriculum. National 

Conference on Engineering Education. Honolulu, HI. 

Zhang, X., C.Bruell, Y.Yin,P.Jayaradu, M.Hines,” Introducing Nanotechnology into 

the Environmental Engineering Curriculum, Presented at the ASEE Annual 

Conference & Exposition, Hilton Hawaiian Village and Hawaii Convention 

Center, Honolulu, HI, June 24-27, 2007. 

Intra-University Collaboration 

Center PIs are engaged in a wide range of collaborations with members of other 

departments and centers. These include: 

- CCES members Zhang, Hines, and Bruell are collaborating with the 

Chemistry and Plastics Engineering Departments in their NSF-funded 

“Laboratory Modules on Environmental Impacts of Nanotechnology” 

project. 

- CCES Associate Director Zhang has ongoing funded collaborations with 

John Duffy (Mechanical), Donn Clark (Electrical) and Arthur Watterson 

(Institute for Nano Science and Engineering Technology). 


72

- CCES member Hines is collaborating with Arthur Watterson Watterson 

(Institute for Nano Science and Engineering Technology) to study the effects 

of nanospheres on bacterial viability 

- CCES Director Rooney-Varga has co-advised graduate students with 

Michael Graves and has submitted a join proposal with him to the 

International Census of Marine Microbes (Biological Sciences). 

Regional/Local Community Technical Outreach 

Center PIs have been involved in a diverse range of outreach activities, 

including: 

- CCES Associate Director Zhang gave an invited lecture to the Annual K-12 

Nanotechnology Teacher Conference at the University of New Hampshire. 

- CCES member Pennell is serving on the Vertical Teaming Task Force 

(collaboration with Middlesex CC, Lowell HS, and Lowell middle schools to 

align math curricula). 


PI Project Title Sponsor 

Hines 

Quantifying Mercury National Science 

Bioavailability in Wetland Foundation 

Soils: Impact on Hg Transport. 

Amount 

Requested 

$557,000 

Hines 

Quantifying Mercury 

Bioavailability in Wetland 

Soils: Impact on Hg Transport 


Foundation 

$482,000 

Colby 

Mesoscale structure of the 

Texas norther 


Foundation 

$140,079 

Rooney-Varga 

Microeukaryote diversity in 

the Gulf of Maine: Underexplored 

microbial diversity in 

a well-studied coastal marine 

ecosystem 

International 

Census of 

Marine 

Microbes 

In kind 

contribution 

(400,000 

DNA 

Sequences) 

Rooney-Varga 

STTR Phase I: Anti-MDR 

Leads from Marine Microbial 

Communities 


Foundation 

$99,999.99 


73

Zhang (PI) and 

Rooney-Varga 

(co-PI) 

Impact of Carbon Nanotubes 

(CNTs) on the Activity and 

Microbial Communities 

of Activated Sludge Used in 

Wastewater Treatment 

UMass Water 

Resources 

Research Center 

$50,000 

Zhang 

Kinetics and extent of Fe(III) 

reduction-dependent 

phosphorus removal using 

anaerobic sequencing batch 

reactors 

UIUC/CICEET $113,196 

Proposals Awarded 

PI Project Title Sponsor Awarded 

Hines 

Hines 

Mercury transformations in the 

Idrija River System, Slovenia. 

Analysis of mercury methylation 

and demethylation in Salmon Falls 

Creek Reservoir, Idaho 

National Science Foundation $68,877 

United States Geological 

Survey 

$13,280 

Ryan, 

Golomb 

Zhang 

Carbon Dioxide and Water 

Emulsions Stabilized by Fine 

Particles for Enhanced Oil 

Recovery 

Amount 

PI, Environmental impacts of 

CNTs: assessment of CNTs on 

wastewater treatment processes 

Massachusetts Technology 

Transfer Center 

$25,000 

NSEC/NSF $44,000 


74

8. CENTER FOR COMPUTER MACHINE/HUMAN INTELLIGENCE, NETWORKING 

& DISTRIBUTED SYSTEMS (CMINDS) 

Annual Report: 2006- 2007 

I. Mission Statement 

The aim of the multi-disciplinary CMINDS research Center, in partnership with some 

leading corporations in the computer fields and the 128 High tech industries, is to 

advance the analytical, experimental, and operational aspect of Computer Engineering 

and Information Technologies that have potential influence on the Acquisition, 

Management, Processing and Storage of Knowledge and Data Engineering and Services 

(AMPSKDES). In particular, within the CMINDS research Center four equipped research 

laboratories have been established, namely: 

a. The Networking & Distributed Networks and Applications Laboratory; 

b. The Machine Vision and Multi-Media Signal & Image Processing and 

Applications Laboratory; 

c. The Artificial & Machine Intelligence, Knowledge & Data Engineering and 

Applications Laboratory; 

d. The Embedded Real-Time Systems & Architectures, HDL/VLSI and 

Applications Laboratory. 

The ultimate goal of the CMINDS activities is to develop the enabling technologies that 

lead to new products and methodologies that have potential impact on the AMPSKDES. 

Using advances in the four main areas mentioned above makes this possible. The 

mission of the Center is also to undertake undergraduate and graduate basic research 

training in the above mentioned areas. 

II. 1 General Description 

The Center was founded in May 2001 with far-reaching and cutting edge interdisciplinary 

research activities to attract high-quality graduate students and researchers, and to 

advance Computer Engineering technologies to support the new Computer Engineering 

programs at UML. It is currently comprised of more than 40 faculty, research & industry 

affiliates, one senior personnel, one engineer, and graduate and undergraduate students. It 

includes faculty from Mathematics, Mechanical, and Electrical and Computer 

Engineering as well as corporate representatives in computer and high-tech areas. The 

Center is located in Ball 434 on One University Avenue. The Center is equipped, among 

other things, with hardware and software equipment, embedded systems, and a state-ofthe-art 

High Performance Distributed Computing Engine (HDPC) consisting of a cluster 

of several 64-bit-Ultra-Sparc-III-Processor dual SUN Blade 1000 advanced workstations, 

a powerful multiprocessor SUN 450 server, and several high end Intel- 

CENTER FOR COMPUTER MACHINE/HUMAN INTELLIGENCE, NETWORKING & 

DISTRIBUTED SYSTEMS 

75

ased advanced workstations, all connected by a 4 

gigabits per second switch (fiber). The system is scalable to up to 128 computer nodes. 

II-2. Current Strategic Goals 

1. Development of strong and sustainable funding/technology ties with industry, 

local, and federal agencies, consistent with the UML mission. 

2. Performing and promoting basic and applied research in key areas in Computer 

Engineering mentioned above, and facilitating Technology Transfer to industry in 

key strategic technical areas supported by the Center. 

3. Support innovative curriculum development by incorporating the research aspects 

supported by the Center into the Computer Engineering curriculum in order to (a) 

facilitate research/research training, (b) continually improve the evolving and 

fast changing Computer Engineering program, (c) to attract quality 

undergraduate and graduate students and (d) support a strong new doctoral 

program in Computer Engineering at UML. 

4. Active support and involvement of undergraduate and graduate students in the 

Center. 

III. Research Groups and Activities Focus Areas 

There are four research groups within the Center associated within the four research 

laboratories mentioned in section I above. The Center associated personnel and its 

affiliation to the respective four research groups is further depicted in section IV. The 

specific key research areas and topics include but are not limited to: 

Networking & Distributed Systems and Applications(G1) 

Parallel, Distributed Processing Networks. 

High-speed Networks/Networking. 

Switching/Routing 

Mobile Internet 

Storage Area Networks and Algorithms for Data and Knowledge 

Management; 

Network Security 

Integrity, Security and Fault-Tolerant Systems 

Real-Time Systems and Distributed Systems 

High Performance and Distributed Computing and applications 

Artificial Intelligence & Machine Intelligence, Knowledge and data Engineering and 

Applications (G2) 

Artificial Intelligence Algorithms 

Knowledge-based Systems 



76

Knowledge and Data Engineering Tools 

and Techniques 

Advanced Robotics 

Machine Vision 

Bio-Engineering and Informatics. 

Machine Vision & Multi-Media Digital Signal Processing and Applications(G3) 

Computer and Machine Vision 

Multi-Media DSP 

Image Processing 

Medical Imaging 

Embedded Systems Architectures, and VLSI and Applications(G4) 

Real-Time Embedded Systems 

Advanced System Architecture 

Cache Design, Pipelining 

VLSI 

HDL (Hardware Descriptive Languages) 

IV. Associated Personnel 

Center Director 

Professor Dalila B. Megherbi, Department of Electrical and Computer 

Engineering (G1,G2,G3,G4) 

Associate Directors 

Professor Charles Byrne, Department of Mathematics (G4) 

Dr. Dennis Martinez, Director of Research and Development, M/A-COM, Inc (G1, G3) 

Professor Kanti Prasad, Department of Electrical and Computer Engineering (G4) 

Professor Michael Fiddy, Director, Optoelectronics and optical Communications Center, 

the University of North Carolina at Charlotte (G1, G2, G3) 

Associated Faculty/Members and External Collaborators 

Professor George Cheney, Electrical and Computer Engineering (G4) 

Professor Anh Tran, Electrical and Computer Engineering (G4) 

Professor Jay Weitzen, Electrical and Computer Engineering (G1) 

Professor Dick Kalluri, Electrical and Computer Engineering (G1) 

Professor Julie Chen, Mechanical Engineering (G1) 

Professor James Sherwood, Mechanical Engineering (G1) 

Professor John McKelliget, Mechanical Engineering (G1) 

Dr. Jon Arvik, Chief Scientist, NASA Remote Sensing Technologies Center, Mississippi 

(G1, G2, G3) 

Mr. Norbet Kaula, Chief Scientist and Research Professor, Colorado Health Sciences 

Center (G2, G3, G4) 

Mr. Chris Gantz, Lead Corporate Engineer, Storage Area Networks and IO performance, 

SUN Microsystems (G1, G2, G4) 

Mr. Thomas V. McNamura, Draper Laboratory. (G1, G2, G3) 



77

Mr. David Killelea, SUN Microsystems (G1, G4) 

Professor Adam Elbirt, Computer Science (G1, G4) 

Professor Alkim Akyurtlu, Electrical and Computer Engineering (G1) 

Dr. P. Deb, Raytheon Co.(G1, G2, G3) 

Professor Oliver Ibe Prof., Associate Professor of Electrical and Computer Engineering 

(G1, G3) 

Prof. Joel Therrien, Assistant Professor of Electrical and Computer Engineering (G1, 

G3) 

Prof. Yan Luo, Assistant Professor of Electrical and Computer Engineering (G1, G4) 

Prof. Young-Kyun Kwon, Assistant Professor of Physics and Applied Physics (G1) 

Prof. Judith E. Gold, Assistant Professor, Department of Public Health, Temple 

University. (G2, G3). 

Dr. N. Nagel, Grid Institute 

V. New Faculty/External Affiliation and Personnel 

Sandip Sengupta, Senior Personnel 

Prof. Joel Therrien, Assistant Professor of Electrical and Computer Engineering 

Prof. Young-Kyun Kwon, Assistant Professor of Electrical and Computer Engineering 

Prof. Yan Luo, Assistant Professor of Electrical and Computer Engineering. 

Prof. Judith E. Gold, Assistant Professor, Department of Public Health, Temple 

University 

Prof. Oliver Ibe, Associate Professor of Electrical and Computer Engineering. 

Dr. N. Nagel, Grid Institute. 

VI. Student Research Support 

Doctoral Students supported in 2006-2007 

Carlos Bejar 

Helal Saghir 

Suzan El-Shoura 

Michael Serra 

Master’s Students supported in 2006-2007 

Dana Pyburn 

Long Hong 

Tony Sivarit_sultornsanee 

Amir Dindar 

Sean O’Melia 

Undergraduate Students in 2006-2007 

J. Manual Madera 

Voynichka, Iliana 

Ian Sebanja 



78

Earned Doctoral Degrees in 2006-2007. 

Carlos Bejar, Ph.D in Computer Engineering, June 2007, Advisor, D.B. Megherbi 

Earned Graduate (MS) and Undergraduate (BS) Degrees in 2006-2007 

Long Dong, MS in Computer Engineering, June 2007, Advisor D. B. Megherbi. 

Tony Sivarit_sultornsanee, MS in Computer Engineering, June 2007, Advisor D. B. 

Megherbi. 

Manual Madera, BS in Computer Engineering, June 2007, Advisor D. B. Megherbi 

Illiana Voynichka, BS in Computer Engineering, June 2007, Advisor D. B. Megherbi 

Ian Sebanja, BS in Electrical Engineering, June 2007, Advisor D. B. Megherbi 

VII. Current and Recent Research Projects 

A Distributed machine Learning Technique for Multi-agent Autonomous Path 

Planning 

A Distributed Architecture-Based Self Learning System for Object Representation, 

Recognition and Authentication 

A Client-Server based Methodology for Medical Imaging Retrieval in a Distributed 

Computing Environment Based on Combinational Image Primitives 

Non-uniform link weights and Time-Delay Stability and Convergence Analysis for 

Interconnected Dynamical Systems and Complex Systems 

SOPC Solution for 3D Imaging 

An Embedded Multi-processor FPGA Applications technique for System Integration and 

verification in Image Retrieval 

A Middleware Architecture and Protocol Design For Geographically Distributed 

Battlefield 

A Novel Technique for Index and Shape Based Image Data Retrieval and Knowledge 

Representation from Large Data sets in Distributed Networks 



79

A Distributed Behavioral-Based Technique For Multi-Agent Event-Driven Autonomous 

Navigation 

Distributed Real-Time Autonomous Agent Path Planning for Synthetic Environment 

and Battlefield 

Computational Methods For Characterizing Genomic Sequences 

Biometrics and Fingerprint Representation & Recognition Systems 

An Extended Correlation Method of Content Based Image Retrieval within a Distributed 

System 

Distributed FPGA-based Systems for 3-D multi-sensors and multi-spectral imaging 

3-D Registration Algorithms for Ladar Imaging 

FPGA-Based Embedded system for Ladar x-scanning real-time image correction and 

enhancement 

Ladar Image Range and Intensity Data Fusion at the FPGA Hardware level 

Facial Recognition with varying pose and expression 

Biometrics for home land security 

A Novel Computational Method For Mutation Detection and Characterizing for the HIV virus. 

An Investigative Study and Analysis of Crystal Structure Classification Using 3-D 

Image Reconstruction Techniques 

VIII. Refereed Publications Generated During Year 2006-2007 

1. D. B. Megherbi, H. Aldaya , D. B. Megherbi, “A Lyapunov-Stability-Based System Hardware 

Architecture for a Real-Time Multiple-Look-Ahead-Levels Reinforcement Learning”, Proceedings 

of The International Conference on Machine Learning; Models, Technologies & Applications , Las 

Vegas, June 2007. 

2. D. B. Megherbi, Vikram Malayia, “An Autonomous Hybrid Cognitive/Reactive Agent Path 

Planning Technique in a Networked Distributed Unstructured Environment for Reinforcement 

Learning. ” Proceedings of The International Conference on Parallel and Distributed Processing 

Techniques and Applications, Las Vegas, June 2007. 

3. Suzan Al-Shoura, D. B. Megherbi, “Higher Transparency Digital Image Watermarking By 

Tchebichef Moments”, Proceedings of the International Conference on Computer Vision, Pattern 

Recognition & Image Processing, (CVPRIP), Salt lake City, July 2007. 



80

4. Hani Aldaya, D. B. Megherbi, “A Fast Reinforcement Learning Techniques 

Distance and Agent Sate Occurrence Frequency”, Proceedings of The International 

Conference on Machine Learning; Models, Technologies & Applications , Las 

Vegas, June 2006. 

5. H. Aldaya , D. B. Megherbi, “A Fast Reinforcement Learning Techniques Via 

Multiple Look-ahead levels”, Proceedings of the 2006 International Conference on 

Machine Learning; Models, Technologies & Applications , June 2006. 

6. Charles Byrne, with M. Shieh and Mike Fiddy, “Image reconstruction: a unifying 

model for resolution enhancement and data extrapolation”, Journal of the Optical 

Society of America, A, (2006) 

7. Charles Byrne with M. Shieh, M. Testorf, and Mike Fiddy, “Iterative image 

reconstruction using prior knowledge”, Journal of the Optical Society of America, 

A, (2006). 

8. Charles Byrne and M. Shieh, “Image reconstruction from limited Fourier data”, J. 

Opt. Soc. Am. A} Nov. 2006. 

9. Charles Byrne with S. Vandenberghe, S. Staelens, E. Soares, I. Lemahieu, S. Glick, 

“Reconstruction of 2D PET data with Monte Carlo generated system matrix for 

generalized natural pixels, Physics in Medicine and Biology, July 2006. 

10. “Optically Isotropic Negative Index of Refraction Metamaterial,” A. G. Kussow 

and A. Akyurtlu, submitted to Phys. Rev. B, July, 2007. 

11. MgB2-based negative refraction index metamaterial at visible frequencies,” A. G. 

Kussow, A. Akyurtlu, A. Semichaevsky, and N. Angkawatissipan, submitted to 

Phys. Rev. B, July, 2007. 

12. “Development of Negative Refractive Index Chiral Metamaterials in the Optical 

Frequency Regime,” N. Wongkasem, A. Akyurtlu, K. A. Marx, Q. Dong, J. Li, and 

W. D. Goodhue, Special Issue on Optical and THz Antenna Technology, IEEE 

Transactions on Antennas and Propagation, accepted, to appear November 2007. 

13. “Fabrication of a Novel Micron Scale Y-structure-Based Chiral Metamaterial: 

Simulation and Experimental Analysis of its Chiral and Negative Index Properties 

in the Terahertz and Microwave Regimes,” Nantakan Wongkasem, Alkim Akyurtlu, 

Kenneth A. Marx, William D. Goodhue, Jin Li, Qi Dong, and Earl T. Ada, Special 

Issue on Nanomanufacturing, Microscopy Research and Technique, January 2007. 

14. N. Wongkasem, A. Akyurtlu, and K. A. Marx, “Development of Chiral and Achiral 

Double Negative Metamaterials in the THz Regime,” 2006 SPIE Symposium on 

Optics East: Terahertz Physics, Devices and Systems Conference 1-4 October 2006 

Boston, MA, Invited Paper. 

15. A. G. Kussow and A. Akyurtlu, “Isotropic optical negative index of refraction 

metamaterials composed of randomly arranged nanoparticles,” accepted for 2007 

APS March Meeting, Denver, CO, March 5- 9, 2007, Invited Paper. 

16. A. G. Kussow, A. Akyurtlu, and A. Semichaevsky, “First-principle studies of the 

optical properties of MgB2 and its applications in optics,” North American Radio 

Science Meeting, URSI 2007, Ottowa, ON, Canada, July 23-27, 2007. 

17. A. G. Kussow, A. Akyurtlu, A. Semichaevsky, and N. Angkawatissipan, “ Novel 

optically isotropic negative refraction index metamaterial at visible frequencies 

based on superconductors (MgB2),” North American Radio Science Meeting, URSI 

2007, Ottowa, ON, Canada, July 23-27, 2007. 



81

18. N. Wongkasem, A. Akyurtlu, and K. Marx, 

“Identification and Classification of Chiral and Bi-anisotropic Metamaterials,” 

North American Radio Science Meeting, URSI 2007, Ottowa, ON, Canada, July 23- 

27, 2007. 

19. N. Wongkasem, A. Akyurtlu, and K. Marx, “Gammadion Structures with Negative 

Refractive Index: Analysis and Experiment,” North American Radio Science 

Meeting, URSI 2007, Ottowa, ON, Canada, July 23-27, 2007. 

20. N. Limberopoulos, G.S. Banks, A. Akyurtlu, A.S. Karakashian, W.D. Goodhue, V. 

Limberopoulos “Surface Plasmon Resonance Test Bench Device for the Validation 

of Optical Metamaterials,” North American Radio Science Meeting, URSI 2007, 

Ottowa, ON, Canada, July 23-27, 2007. 

21. A. Semichaevsky, A. Akyurtlu, D. Kern, D. Werner, M. Bray, “Novel BI-FDTD 

Approach for the Analysis of Chiral Cylinders and Spheres,” IEEE Trans. on 

Antennas and Propagation, vol. 54, no. 3, pp. 925-932, March 2006. 

22. N. Wongkasem, A. Akyurtlu, J. Li, A. Tibolt, Z. Kang, W. D. Goodhue, “Novel 

Broadband THz Negative Refractive Index Metamaterials: Analysis and 

Experiment,” accepted, will appear in Progress in Electromagnetics Research 

(PIER). 

23. N. Wongkasem, A. Akyurtlu, and K. A. Marx, “Group Theory Based Design of 

Isotropic Negative Refractive index Metamaterials,” accepted, will appear in 

Progress in Electromagnetics Research (PIER). 

24. A. Akyurtlu, A-G. Kussow, A. Semichaevsky, A.S. Karakashian, “Metamaterial for 

the visible frequency range,” IEEE APS/URSI, Albuquerque, NM, July 9-14, 2006. 

25. A. Semichaevsky, A. Akyurtlu, “Homogenization of metamaterial-loaded 

substrates for antenna applications,” IEEE APS/URSI, Albuquerque, NM, July 9- 

14, 2006. 

26. N. Wongkasem, A. Akyurtlu, “Broadband THz DNG Metamaterials for Simplified 

Fabrication,” in Proc. IEEE AP-S Int. Symp. and USNC/URSI National Radio 

Science Meeting, Albuquerque, NM, Jul. 10-15, 2006. 

27. N. Wongkasem, A. Akyurtlu, and K. A. Marx, “Development of Double Negative 

Chiral Metamaterials in the Visible Regime,” in Proc. IEEE AP-S Int. Symp. and 

USNC/URSI National Radio Science Meeting, Albuquerque, NM, Jul. 10-15, 2006. 

28. Nicholaos Limberopoulos, Vasilios Limberopoulos, Alkim Akyurtlu, Aram S. 

Karakashian, and William D. Goodhue, “A Test Bench Device for the 

Characterization of Metamaterials in the Optical Regime,” in Proc. IEEE AP-S Int. 

Symp. and USNC/URSI National Radio Science Meeting, Albuquerque, NM, Jul. 

10-15, 2006. 

29. Gorczyca-Cole, J., Sherwood, J. and Chen, J., 2006, "Development of a Friction 

Model for Use in the Thermostamping of Commingled Glass-Polypropylene 

Woven Fabrics," Composites Part A, (in press). 

30. Gorczyca, J., Sherwood, J. and Chen, J., 2007, "Development of a Friction Model 

for Use in the Thermostamping of Commingled Glass-Polypropylene Woven 

Fabrics," Composites Part A, Vol. 38, p. 393-406. 

31. G Larcom and AJ Elbirt, "Gone Phishing", to appear in IEEE Technology and 

Society Magazine, 2006. 



82

32. P. Gamache, A. Galante, G. Seben, and A. J. Elbirt, "Validating Baseball Bat 

Compliance", Submitted to Sports Engineering. 

33. A. J. Elbirt, "Accelerated AES Implementations Via Generalized Instruction Set 

Extensions", Submitted to Journal of Computer Security. 

34. AJ Elbirt and C Paar, "Efficient Implementation of Galois Field Fixed Field 

Constant Multiplication", Proceedings of the International Conference on 

Information Technology: New Generation (ITNG’06), Track on Embedded 

Cryptographic Systems (CRYPTO’06), pp. 172-177, April 10-12 2006, Las Vegas, 

Nevada, USA. 

35. A. J. Elbirt, L. Abdallah, K. Fisher, A. Koren, and P. Scollin, "Tablets At the 

Bedside: Accuracy Testing of Secure Wireless-Based Data Entry in a Nursing 

Education Laboratory", 2007 University of Massachusetts Instructional Technology 

Conference, April 5 2007, Springfield, Massachusetts USA. 

36. . A. J. Elbirt, "Fast and Efficient Implementation of AES Via Instruction Set 

Extensions", to be presented at the IEEE 21st International Conference on 

Advanced Information Networking and Applications (AINA-07), Third IEEE 

International Symposium on Security in Networks and Distributed Systems, May 

21-23 2007, Niagara Falls, Canada. 

37. P. Scollin, A. J. Elbirt, A. Koren, and K. Fisher, "Tablets At the Bedside: Accuracy 

Testing of Secure Wireless-Based Data Entry in a Nursing Education Laboratory", 

to be presented at the Twenty-Fifth International Nursing Computer and 

Technology Conference, June 14-17 2007, San Francisco, California, USA. 

38. A. J. Elbirt and C. Paar, "Efficient Implementation of Galois Field Fixed Field 

Constant Multiplication", Proceedings of the International Conference on 

Information Technology: New Generation (ITNG'06), Track on Embedded 

Cryptographic Systems (CRYPTO'06), pp. 172-177, April 10-12 2006, Las Vegas, 

Nevada, USA. 

39. Joel Therrien, “Using Accumulated Charge to Monitor Nanoparticle Deposition 

Rates Via Electrospray Ionization”, American Physical Society 2006 March 

Meeting 

40. Joel Therrien, “ Electrostatic Actuation of CNT Cantilevers”, 4th Annual Molecular 

Conduction and Sensors Workshop: Electrostatic Actuation of CNT Cantilevers 

41. Prasad, K., “An Exemplary Curricula With Proper Mix Of Engineering 

Fundamentals And Training Students At State-Of-Art Technology.” ASEE’s 

National Conference June 2006. 

42. Imparting Consummate Instructions in Microelectronivs Engineering and 

VLSI Technology at the University of Massachusetts Lowell, ASEE National 

Conference, May 2007. ASEE National Conference May 2007. 

43. Motivating Students through Industrial leaders By Providing State-Of-The-Art 

Technology and Successfully Spreading the Mission of the ASEE at UMASS 

Lowell, ASEE National Conference, May 2007. 

44. Alex Raj and Oliver C. Ibe, "A Survey of IP and Multiprotocol Label 

Switching Fast Reroute Schemes," Computer Networks, volume 51, 2007, pp. 

1882-1907. 



83

45. Oliver C. Ibe, "Analysis and Optimization of M/G/1 Vacation Queueing 

Systems with Server Timeout," Electronic Modeling, volume 29, 2007. 

XI. Conferences 

Dalila B. Megherbi 

(Conference International Program Technical Committee and Organizer) 

Visualization, Imaging and Image Processing International Conference (VIIP 2007), 

Marbella, Spain 

International Conference on Robotics & Automation, Tampa (Florida); November 

2007 

Conference International Technical Program Committee and Organizer 

Computer Graphics and Imaging , IASTED Conference, Hawaii, August 2007 

Attendence: 

International Conference on Machine Learning; Models, Technologies & 

Applications , Las Vegas Nevada, June 2007. 

International Conference on Computer Vision, Pattern Recognition & Image 

Processing, (CVPRIP), July 2007. 

Kanti Prasad 

Annual ASEE Regional Conference, May 2007. 

Alkim Akyurtlu 

North American Radio Science Meeting, Ottawa July 2007. 

IEEE Antennas and Propagation Magazine, Editor 

Joel Therrien 

American Physical Society 2006 March Meeting: Using Accumulated Charge to 

Monitor Nanoparticle Deposition Rates Via Electrospray Ionization. 

X. Intra-and inter- University Collaboration 

Professor Charles Byrne, Department of Mathematics 

Dr. Dennis Martinez, Director of Research and Development, M/A-COM, Inc 

Professor Michael Fiddy, Director, Optoelectronics and optical 

Communications Center, the University of North Carolina at Charlotte 

Professor Julie Chen, Mechanical Engineering, Center for High rate 

anufacturing 

Professor James Sherwood, Mechanical Engineering 

Dr. Jon Arvik, Chief Scientist, NASA Remote Sensing Technologies Center, 

Mississippi 

Mr. Norbet Kaula, Chief Scientist and Research Professor, Colorado Health 

Sciences Center 



84

Mr.Chris Gantz, Senior Engineer, Storage Area 

Networks and IO performance, SUN Microsystems 

Mr. Thomas V. McNamura, Draper Laboratory. 

Mr. David Killelea, SUN Microsystems 

Dr. P. Deb, Raytheon Co. 

Dr. Jody Gold, Department of Public Health, Temple University, 

Prof. Bannister, Chemistry Department (UML). 

Prof. Young-Kyun Kwon, Assistant Professor of Physics and Applied Physics 

XI. Regional/Local Community Technical Outreach 

Through the Center, which is part of a public university, we have been rigorously working in 

creating collaboration/partnership with local/national Industry, research labs, and government 

agencies in basic research, applied research, and technology transfer, to strengthen the local and 

national economy . Those include MA- COM Co, Raytheon Air and Missiles Defense Systems, 

Altera, Xilinx, Draper Laboratory, TRW Joint Synthetic Battle-space, SDRC Inc, Cisco Inc, 

Lucent Technologies, Nortel Networks, SUN Microsystems, NASA Remote Sensing Center, 

Colorado Health Sciences, Altova Inc, and the Grid Computing consortium. 

The Center supports the newly developed Computer Engineering programs at 

UML stimulating researchers to place renewed value on quality education, 

research training, and curriculum innovation in the context that education and 

research are of equal value and complementary parts of an integral whole. 

XII. FUNDING 

There are 10 research grants and contracts awarded/active during this reporting 

period in the respective amounts of: one from Skyworks Solutions Inc, ($60,000), 

one from Analog Devices ($30,000), one from Intel corporation ($10,000), one 

from Intel corporation ($10,000), one from Army Research lab (ARL) ($150,000), 

one from NSF ($300,000), one from NSF ($360,000), one from UMASS 

Strategic Initiative ($24,064), one from Sky-computers Inc ($144,800), one from 

HP Higher Technology ($68,000). 

Submitted proposals: 

• Knowledge Representation-based Computational Method for Arbitrarily 

Sized Genomic Sequences and Data, NSF. ($400,000). 

• REU site: University of Massachusetts Lowell Undergraduate Research 

and Training in Computer Engineering and Related Fields, NSF, 

$350,000. 

• Analog Encryption and Frequency Mixing Using Tri-Gate HEMT, 

AFRL/IF Information Warfare: Offensive and Defensive Counterinformation, 

$705,841 



85

• Homeland Security Defense and Education-Secure, DHS SAFECOM, 

$1,500,000. 

• Enabling the Use of Any Computer Virus-Immune, Without-A-Trace, 

DHS-BAA0709, Cyber Security Research and Development (CSRD), 

$139,044 

Snap Shots of Some Recent Research Results at CMINDS: 

Sector 1 Obstacl Sector 2 

Node 5 

INVOKER 

Node 1 Node 2 

Goal 

Node 3 

Sector 3 Sector 4 

2 

Node 4 

Report Table Manager 

Start 

SECTOR I 

New position 

SECTOR III 

Node 1 Node 2 

Node 3 Node 4 

FIGURE SHOWING THE EXPERIMENTAL SETUP 

THE ENVIRONMENT 

FIGURE SHOWING THE ARCHITECTURE AND SETUP OF 



86

140 

120 

Number of steps 

100 

80 

60 

40 

20 

0 

1 2 3 4 5 6 7 8 9 10 11 12 13 14 

Runs 

FIGURE SHOWING CONVERGENCE RESULTS OF THE PROPOSED DISTRIBUTED ALGORITHM AT TRIAL 

Figure-1: Examples of Results from the work going on at CMINDS in the field of Distributed Machine 

Intelligence: The agent starts from a known starting state and progresses to a desired but unknown destination 

state ( to be learned by the agent ) using the proposed scheme. Results of the proposed algorithm are 

illustrated above showing the number of steps per learning path versus the learning path number. The plot of 

the actual experimental data (the figure in the bottom) shows that the number of steps per learning path 

decreases as the agent does more learning paths. They also show that the number of runs does not have to be 

large to achieve optimal learning with ; cases of number of runs of 2,3, to 4 show how faster the number of 

steps per learning path reaches the minimum (optimal path). There are many applications to the proposed 

techniques. One of them, targeted here, is an agent in a battlefield filled with land mines (that act like barriers) 

trying to find a goal which is either to destroy land mines or reach a certain geographic point. These distributed 

techniques show potential results in fast learning and optimal-result finding processes. 

10 

20 

30 

40 

50 

60 

70 

20 40 60 

(a) 

(b) 

(c) 

(d) 



87

Figure-2: Example of Results from the work going on 

in CMINDS in the field of information securing, watermarking and recovery against nonauthorized 

tampering. Fig.2a: Original image, (b, c, d) Watermarked face images obtained using 4x4 block 

size, moments up to order 1, and watermark strength of 1 using b) proposed method, c) existing method-1 , d) existing 

method-2 . 

RMS Error 

120 

100 

80 

60 

40 

20 

0 

0 1 2 3 

Moment Order 

proposed method method-1 method-2 

Figure showing RMS Error between watermarked and original face images versus Moment Order for 4x4 

block size and watermark strength of 1. The proposed method shows its superiority over existing popular 

methods (method-1 and method-2) in the literature, in terms of watermark transparency and the quality of the 

watermarked images obtained (with the same constant strength of 1). 



88

9. CENTER FOR ELECTRIC CAR AND ENERGY CONVERSION (EC&EC) 

I Mission Statement 

To promote a clean environment and less dependent on foreign oil the EC&EC center is 

dedicated to the promotion of the use of electric cars as a mean for transportation and the 

use of alternative energy resources a s a mean of generating electricity. To do that the 

center is doing the following: 

1. Carry out basic and applied research with a goal of achieving national and 

international recognition for excellence. This goal will be implemented by 

external grant funding to evaluate emerging technologies and to develop the most 

promising electric-vehicle (EV) technology and the supporting technology 

including batteries, battery chargers and battery-charging stations using renewable 

energy sources. 

2. Transfer the most promising technologies to industry, initially targeting local 

high-tech/electric-vehicle companies and energy-conversion companies 

3. Providing state-of-the-art resources to local high-tech/electric-vehicle companies 

and energy-conversion companies that make electric cars and hybrid cars and to 

power-supply companies. This center will encourage and promote 

Industry/UMass-Lowell Collaboration. 

4. Constructing prototypes projects of alternative energy sources (AES), such as; 

wind-turbines, Photovoltaic and fuel cells to generate electricity, solve the 

problems associated with the use of AES, show the public the prototypes of AES 

in action to encourage their use and finally through courses and education 

contribute to the understanding of the importance of these sources to the 

economy. 

5. Train graduate and undergraduate students in electric-car and energy-conversion 

technologies for the local and national workforces. 

II General Description 

The center has the following advanced research laboratories: 

Renewable Energy Laboratory. 

This lab consists of three wind mills (1.5KW, 300 Watts, 500 Watts ) , two Photovoltaic 

systems (three arrays of Photovoltaic panels totaling of 2500 

Watts, four arrays of Photovoltaic panels totaling of 10,500 Watts) and 1.2 kw Ballard 

PEM Fuel cell). These renewable sources of power feed two huge banks of batteries (24 

CENTER FOR ELECTRIC CAR AND ENERGY CONVERSION 

89

Volts battery bank consists of 24 batteries 305 AH 

each, and 48 volts battery bank consists of 16 batteries 305 Ah each). 

In Addition research is done on super capacitors evaluation and applications to fast 

charging batteries and as energy storage units. The lab has four super capacitor modules 

each consists of 18 super capacitors cells and a 48 v output 

Battery Evaluation Lab Ball 308 

The Battery Evaluation Lab at the University of Massachusetts Lowell (UML) has 

three complete battery test systems. The systems are computer controlled and are 

designed to test batteries ranging from 0.1mV to 20 volts at 1mA to 320 amps. The 

current regulators are capable of current sinking or sourcing and can change from charge 

to discharge mode instantaneously . The data acquisition and control systems provide 

current control and data acquisition including voltage, current, time, and temperature. 

Each tester is controlled via A/D and D/A interfaces. 

Power Electronics Lab Ball 310 

The lab has all kinds of equipment that allows a researcher to build, test, and evaluate the 

inverters and choppers. 

Electric Car Evaluation Lab Pinanski 100 and 102 

The Lab has a fleet of eleven Solectria electric cars, and six level 2 battery charging 

stations (208 volts). 

The cars are equipped with data acquisition systems and different types of batteries, with 

different ranges. 

Advanced Composite Materials and Kitson 104 

Textile research Lab 

III Research Groups and Activities Focus Areas 

There are four research groups: 

1. Electric Vehicle Group 

This group is engaged in the following activities: 

a) Evaluate the suitability of a battery for electric vehicle application.The heating 

and cooling demands, the road evaluation test. 

b) Evaluating electric vehicles battery chargers and designing new generation of 

battery chargers, modular type of battery chargers. 

c) Evaluating Electric vehicle batteries charging algorithms 

d) Doing research on heating and cooling electric vehicles 

e) Doing research on battery management systems in the electric vehicles 


90

2. Renewable Energy Group 

a) Evaluating and solving problems of Wind Energy Conversion Systems 

b) Evaluating and solving the problems of Photovoltaic Systems 

c) Evaluating and solving problems of Fuel Cells 

d) Evaluating the distributed generation system operation that consists of of 

Wind/Photovoltaic/Fuel cells 

e) Evaluating super capacitors 

3 Modeling and Characterization of Baseball Bats group 

4. Composite Materials group 

IV-Associate Personnel: 

Primary 

Dr. Ziyad Salameh, Center Co-director / Electrical Engineering 

Dr. James Sherwood, Center Co-director / Mechanical Engineering 

Dr. Julie Chen, Center Co-director / Mechanical Engineering 

Secondary 

Dr. Robert Parkin / Mechanical Engineering 

Dr. Gene Niemi / Mechanical Engineering 

Dr. Mufeed Mah’d, ElectricalEngineering 

Dr. Fahad Wakim / Electrical Engineering 

Mr. Alan Rux / Electrical Engineering 


91

V-Student Research Support 

Funding 06/07 

Title Funding Source PIs Period Amount 

9.2kw Photovoltaic Design and 

operation 

Enhancing the Understanding of the 

Fundamental Mechanisms 

of Thermo stamping Woven 

Composites 

MTC 


Foundation 

Ziyad Salameh 05/06 $50,000 

Jim Sherwood 

Julie Chen 

03/06 $158000 

Distributed Energy 

Neural Network Integration 

System 

DOE/Orion Ziyad Salameh 06 $157000 

LNHP Photovoltaic System 

Commissioning 

NREL National Renewable 

Energy Laboratory 

Ziyad Salameh 

Amanda Davis 

06 $5000 

Evaluation of super capacitors 

and advanced lithium batteries for 

EV application 

National Grid Ziyad Salameh 07 $26,000 

Installation of PV System 

on the roof of Ball 

building contribution 

. 

Executive Office of 

Massachusetts 

Environmental Affairs 

Ziyad 

Salameh 

06 $10,000 

Modeling and Characterization of 

Baseball Bats 

Major League Baseball & 

Rawlings 

Jim Sherwood 06 $93,000 

Linking Process- 

Induce Properties to 

Thermoplastic-Matrix 

Woven Fabric 

Evaluation of 1.8 Sky stream 

wind turbine, 

NSF 

Jim Sherwood 

Julie Chen 

Larissa Gorbatikh 

- 08 $360,000 

National Grid Ziyad Salameh $16,000 

Evaluation of Lithium Ion 

Batteries 

International Battery Inc Ziyad Salameh 2007 $27,612 


92

Students Interaction: 

Current Doctoral Students 

Student 

Dissetation 

1. Frank Tredeau/ ECE Lithium ion batteries evaluation for EV 

3. Bong Fon Kim /ECE Evaluation of lithium Polymer Batteries 

for EV 

4. Cultura Balladares / ECE Distributed generation performance 

Evaluation 

5 Jennifer Gorczyca/ ME A Constitutive Model for Woven Composites 

6. Xiang Li /ME Finite element analysis of woven 

composites and the stamping process: 

modeling, prediction and optimization 

Current Master Students: 

Student 

Macancela Jhonny / ECE 

Thesis 

Energy Storage in Fly-wheels 

Nathan P. Gravelle /ME 

Using the Finite Element Method to Investigate the 

Potential Replacement of a Steel Side-Impact 

Beam with a Composite 

Ching-Pei Liang/ME 

Kari White /ME 

Determination of Material Constants for 

Viscoplastic Constitutive 

Composite Ply Shear Test and Model 

Recent graduates 

2006 . Buasri Panhatha, DE. Distributed Generation Using 

Wind/Photovoltaic/fuel Cell 


93

VI Current and Recent Research Projects 

1) Evaluation of Lithium ion batteries for the use in electric vehicles. 

2) Modular EV battery charger and management system 

3) Evaluation of Lithium polymer batteries for the use in electric vehicles 

4) Evaluation of sky stream 1.8 kw wind turbines 

5) EV Battery Charging Station Using Super Capacitor 

6) Linking Process-Induce Properties to Thermoplastic-Matrix 

Woven-Fabric Composites Performance 

VII Most Recent Publications 06/07 

Alaoui Z. Salameh, “Electric Vehicle Diagnostic and Rejuvenation System (EVDRS)”, 

International Journal of Power & Energy Systems, Vol. 27, No 2, pp. 151-156, 2007. 

F. Giraud and Z. Salameh , “Combined Effects of Passing Clouds and Wind Gusts on an 

Interactive Wind-PV System With Battery Storage Using Neural networks,” Electric 

Power Components and Systems Journal, Vol. , 35, No. 7, pp. 823-836, July 2007. 

F. Giraud and Z. Salameh, “Harmonics Generated by a Grid-Linked Residential 

Wind/Photovoltaic Hybrid System With Battery Storage,” Electric Power 

Components and Systems Journal, Vol. , 35, No. 7, pp. 757-768, July, 2007. 

P. Buasri and Z. Salameh,” An Electrical Circuit Model for a Proton Exchange 

Membrane Fuel Cell (PEMFC),” Annual IEEE_PES, PP. NO, 06GM0394 , Montreal 

, Canada ,2006. 

W. Lynch and Z. Salameh,”Electrical Component Model for a Nickel Cadmium Elecrtic 

Vehicle Traction Battery,” Annual IEEE_PES , PP. NO, 06GM1201, Montreal , 

Canada ,2006. 

A. Cultura and Z. Salameh,” Design Of A Distributed Wind/PV Hybrid Systems For 

Rural Electrification Of An Island In The Philippines”, Proceeding of the Solar 2006 

conference, Denver CO, July 2006 

A. Davis and Z. Salameh, “ Compatibility of Small-Scale Wind and Photovoltaic 

Systems Used as Distributed Generation”, IASTED Asia PES, Phuket, Thailand 

April ,2007, 

F. Tradeau and Z. Salameh, “Characterization of the M100–12 NiZn Battery” IASTED, 

Jan. Orlando, Fl. 2007. 

P. Buasri and Z. Salameh,” Harmonics generated by a distributed generation system using 

Wind/Photovoltaic/Fuel cell with battery storage”, IASTED Asia_PES07,Phuket 

,Thailand, April ,2007 . 

A. Cultura and Z. Salameh,” Design and installation of 10.56KW Photovoltaic power 

system at UML,” Power Gen. Renewable and Fuels, Las Vegas. NV, March 2007. 

P. Buasri and Z. Salameh,” Modeling of a Distributed Generation System using 

Adaptive Neuro Fuzzy Inference Approach, “Annual IEEE_PES , PP. NO, 

07GM0715, Fl ,2007. 

W. Lynch and Z. Salameh,” Taper Charge Method for a Nickel-Cadmium Electric Vehicle 

Traction Battery,” Annual IEEE_PES , PP. NO, 07GM1503, Fl ,2007. 


94

Gorczyca, J. A “ Study of the Frictional Behavior of a Plain-Weave Fabric during the 

Thermo stamping Process, Doctoral Dissertation, Department of Mechanical 

Engineering, University of Massachusetts Lowell. In Press. 

Gorczyca-Cole, J., Sherwood, J. and Chen, J., 2006, "Development of a Friction Model for Use in 

the Thermostamping of Commingled Glass-Polypropylene Woven Fabrics," Composites Part 

A, (in press). 

Gorczyca, J., Sherwood, J. and Chen, J., 2005, "A Friction Model for use with a Commingled 

Fiberglass-Polypropylene Plain-Weave Fabric and the Metal Tool during Thermo stamping", 

European Finite Element Revue, Vol. 14, No. 6-7, p. 729-751. 

16 Li, X., Sherwood, J., Liu, L. and Chen, J., 2004, "A material model for woven commingled 

glass-polypropylene composite fabrics using a hybrid finite element approach", International 

Journal of Materials and Product Technology, Vol. 21, p. 59-70. 

VIII Conferences: 

Members of the EC&EC center attended the following conferences: 

1. IASTED Asia_PES 07, Phuket, Thiland 

2. Power Gen. Renewable and Fuels, Las Vegas. NV, March 2007 

3. Annual IEEE_PES, Florida , 2007 

4. Annual IEEE_PES, Montreal , Canada ,2006 

5. Solar 2006 conference, Denver CO, July 2006. 

6. 19th Annual American Society for Composites Conference. 

7. 7th ESA Form Conference 

8. 8th ESA Form Conference 

IX Journal Editorial Boards: 

Professor Salameh is an associate editor of the following two International Journals: 

1. International Journal of Renewable Energy Engineering 

ISSN 1442-133X . 

2. International Journal of Power & Energy Systems 

ISSN-1078-3466 

X Intra_University Colaboration 

• The EC&EC is offering three cars to the Parking Services at UML the last year to 

be used for intercampus travel. 

• Generating electricity for the University for the facility department, installed 

capacity of 15.4 kw. 


95

XI Regional/Local Community Technical Outreach 

The primary focus of the center is industrial extension work. The center is aiming at 

solving problems facing the electric-car industry as well as developing new methods of 

efficiently utilizing energy-conversion devices and improving the power quality. EC&EC 

has developed good working relations with the following Massachusetts based companies 

and agencies: 

o New England Power Service/NEES , National Grid 

o Division of Energy Resources/DOER 

o Boston Edison Company 

o Cambridge Electric Light Company 

o E-Vermont 

o Commonwealth Electric Company/COM-EL of 3D 

o Production Fixture Composite 

o Solectria Corp./ electric-car manufacturer 

o DOE 

o Evercell 

o Specialty Material 

o MTC 

o Ford Motor Co. 

o I-TEK 

o Major League Baseball 

o Electrastor 

o Eagle Picher 

o Plug Power 

o Ballard 

o International Battery Inc. 

Community Outreach 

The center has a cooperative agreement with Lowell Historic National Park 

(LHNP),and through DOE acquired three grants to help the LHNP. 

XII Strategic Goals of the Center 

Promote clean environment and reduce dependent on foreign oil. This is done by Solving 

the problems facing the electric-car commuters as they arise, and solving the problems of 

the use of alternative energy sources. 

Expand the activities of the center to other cars like the hybrid and the fuel cell cars. 

Educate the public about the use of renewable energy sources 

and help transferring the renewable energy technologies to the public in Massachusetts 

and help Massachusetts companies exporting it. 


96

10. CENTER FOR ELECTROMAGNETIC MATERIALS AND OPTICAL SYSTEMS 

(CEMOS) 



The mission of the Center for Electromagnetic Materials and Optical Systems 

(CEMOS) is to support government research, regional industries, and train 

undergraduate and graduate students. The center is committed to remain a 

resource in photonics, electromagnetics, and the study of electromagnetic materials. 

Applying this expertise and expanding collaboration with industry is a primary 

element of the center’s mission via materials and system analysis and design. 

General Description 

The research underway in CEMOS comprises a number of different scientific disciplines 

and involves projects at the overlap of these different disciplines. These disciplines (1) 

electromagnetic wave propagation studies, and novel metamaterial investigations; (2) 

optical systems and component design and 3) nanotechnology and 4) biophotonics. In 

the first discipline, rigorous computational electromagnetics codes are developed to study 

electromagnetic wave interactions with complex media, wave propagation, and device 

design. The second disciplines involves research on the design, fabrication and 

characterization of photonic devices such as long wavelength Avalanche Photodiodes 

(APDs) and quantum dot structures as well as optical subsystems such as tunable fiber 

lasers. The third discipline is directed at the development of nanomaterials, such as 

carbon nanotubes (CNT), and their use in optical and electronic devices. The fourth 

discipline involves research on the design and development of biosensors such as 

miniature in-cell sensing probes and simultaneous multianalyte sensing systems with high 

resolution and sensitivity. 


The following is a short summary of the research of the four faculty members currently 

active in CEMOS. There are also projects that involve two or more faculty working on a 

common project, often working at the overlap of two or more disciplines. 

Professor Akyurtlu’s research involves the investigations of electromagnetic waves with 

novel metamaterials, which possess material properties not found in naturally occurring 

materials. Specifically, the work involves the design of novel metamaterials at GHz and 

THz regimes, development of material property extraction methodologies, and novel 

designs including patch antennas using these metamaterials are studied. Prof. Akyurtlu’s 

research group has collaborated with researchers at NASA Langley Research Center and 

at AFRL Antennas Technology Branch at Hanscom Air Force Base. Fabrication of these 

materials at the GHz frequency regime has been accomplished at AFRL. A novel 

metamaterial design constructed to perform at the THz frequency regime will be 

CENTER FOR ELECTROMAGNETIC MATERIALS AND OPTICAL SYSTEMS 

97

fabricated in collaboration with Prof. Goodhue from the Photonics Center. Furthermore, 

collaborations are ongoing with the Plastics Engineering Department for 

nanomanufacturing of nano-scale metamaterials, as well as deformable metamaterials 

based on novel fabrication techniques. 

Professor Armiento’s primary activities involve development of optoelectronic 

components and optical networks based on Wavelength Division Multiplexing (DWDM). 

He has been working with Prof. Goodhue (UML Physics Dept) on two AFRL grants 

involving the development of long wavelength (2-4 micron) InGaAsSb/InGaAsSb 

avalanche photodiodes (APDs) and an integrated photodetector/deformable mirror array 

for wavefront correction. 

Professor Lu’s work includes developing quantum dot infrared photodetectors, 

wavelength tunable fiber-lasers, and flexible nano-transistors. Prof. Lu has been 

collaborating with industry, including Crystal research Inc. and Polaronyx Inc. in 

investigations of optical interconnects and optical filters. Professor Lu is also working 

with Raytheon in high-performance infrared photodetectors, and Brewer science in 

carbon nanotube based flexible transistors. 

Prof Joel Therrien’s work includes developing devices based on nanoscale stuctures such 

as quantum dots and carbon nanotubes for applications in sensors. He is also working on 

methods for high speed Atomic Force Microscopy including the design of novel 

cantilevers for faster readout. This effort is geared towards measuring nanoscale 

components in manufacturing lines as well as the fabrication and application of 

metamaterials (with Prof. Akyurtlu). He is also working on methods to synthesize 

graphene. 

Prof Xingwei Wang joined CEMOS this year during her first year in the ECE department. 

Her work includes developing versatile sensing system for detection of chemical and 

biological interactions, miniature in-cell sensing probes, and some sensors for harsh 

environments, such as acoustic sensors. She is collaborating with the Chemistry 

Department, the Plastics Engineering Department, and the Mechanical Engineering 

Department on sensor fabrication and testing. She is also working with Talos Tech LLC 

on sensor development for physiological monitoring. 

Personnel 

Active Faculty Members 

Prof. Craig Armiento, Director 

Prof. Alkim Akyurtlu, Deputy Director 

Prof. Xuejun Lu 

Prof Joel Therrien 

Prof. Xingwei Wang 


98

Affiliated Faculty 

Professor William Goodhue (Physics Department) 

Prof. Dikshitulu Kalluri (ECE) 

New and Temporary Faculty Affiliations 

Prof Wang joined the ECE Department in September 2006 and became a member of 

CEMOS during the academic year. Professor Goodhue of the Physics Department 

has become an active collaborator with Professors Armiento, Akyurtlu and Lu on 

the aforementioned projects. 

Students Currently Supported 

Funded RAs: 

Nantakan Wongkasem, Andrey Semichaevsky, Nicholaos Limberiopoulos, 

Niwat Angkwattisipan., Ravi Bhatia, Rohit Samarth, Jared Vallancourt, Amir Dindar, 

Samba Siva Karthik Bollam, Vivek Angiras 

Doctoral Students: 

Vasilios Limberiopoulos, Nantakan Wongkasem, Andrey Semichaevsky, Nicholaos 

Limberiopoulos, Niwat Angkwattisipan, Aaron Bandremer Ph.D. Student 

(Bioengineering) 

Post Doctoral Fellow 

Wenhui Wang 

Degrees Granted 

Nantakan Wongkasem, DEng. 

Andrey Semichaevsky, DEng. 

Ravi Bhatia, M.S. in Electrical Engineering 

Lei Zheng, M.S. in Electrical Engineering 

Current and Recent Research Projects 

There are a number of current research projects in metamaterials, electromagnetic 

modeling and photonic devices and nanomaterials that have been described in Section 3. 

1. Publications (Most Recent/ School Year of this report) 

“Optically Isotropic Negative Index of Refraction Metamaterial,” A. G. Kussow and A. 

Akyurtlu, submitted to Phys. Rev. B, July, 2007. 

“MgB2-based negative refraction index metamaterial at visible frequencies,” A. G. 


99

Kussow, A. Akyurtlu, A. Semichaevsky, and N. Angkawatissipan, submitted to Phys. Rev. 

B, July, 2007. 

“Development of Negative Refractive Index Chiral Metamaterials in the Optical 

Frequency Regime,” N. Wongkasem, A. Akyurtlu, K. A. Marx, Q. Dong, J. Li, and W. D. 

Goodhue, Special Issue on Optical and THz Antenna Technology, IEEE Transactions on 

Antennas and Propagation, accepted, to appear November 2007. 

“Fabrication of a Novel Micron Scale Y-structure-Based Chiral Metamaterial: 

Simulation and Experimental Analysis of its Chiral and Negative Index Properties in the 

Terahertz and Microwave Regimes,” Nantakan Wongkasem, Alkim Akyurtlu, Kenneth A. 

Marx, William D. Goodhue, Jin Li, Qi Dong, and Earl T. Ada, Special Issue on 

Nanomanufacturing, Microscopy Research and Technique, January 2007. 

“Temperature-dependent photoresponsivity and high-temperature (190 K) operation of a 

quantum dot infrared photodetector,” Xuejun Lu, Jarrod Vaillancourt and Mark J. 

Meisner, Applied Physics Letters, Vol. 91, No. 5, pp. 051115 (2007). 

“A modulation-doped longwave infrared quantum dot photodetector with high 

photoresponsivity,” Xuejun Lu, Jarrod Vaillancourt, and Mark J. Meisner, Semiconductor 

Science and Technology, vol. 22, pp. 993-996, (2007). 

“Longwave-infrared InAs-InGaAs quantum-dot infrared photodetector with high 

operating temperature over 170 K”. Xuejun Lu, Jarrod Vaillancourt, Mark J. Meisner, and 

Andreas Stintz’s Accepted for publication, Journal of Physics D (2007). 

“Modulation-doped InAs-InGaAs quantum dot longwave infrared photodetector with 

high quantum efficiency,” Xuejun Lu, Mark J. Meisner, Jarrod Vaillancourt, Jin Li, 

Xifeng Qian, and William D. Goodhue, IEE Electronics Letters, Vol. 43, Issue 10, p. 589- 

590 (2007). 

“An Electro-optic Tunable Band-pass Filter Based on Long –period-grating Assisted 

Asymmetric Waveguide Coupling,” Xuejun Lu, Miao Li, Rohit Samarth and Lei Zheng, 

Optical Engineering Letters, Vol. 46, No. 4, p. 040508 (2007). 

"Label-free DNA detection on the surface of silica optical fiber tip". X. Wang, K. Cooper, 

A. Wang, J. Xu, Z. Wang, Y. Zhang, and Z. Tu, Appl. Phys. Lett. Vol. 89, 

163901 (October 2006). 

“AFM studies of nanoparticle deposition via electrospray ionization” Therrien, J, Dindar, 

A, and Smith, D, MICROSC RES TECHNIQ, 70(6), 530 (2007) 

2. Conference Presentations 

“Development of Chiral and Achiral Double Negative Metamaterials in the THz 

Regime,” N. Wongkasem, A. Akyurtlu, and K. A. Marx, 2006 SPIE Symposium on Optics 


100

East: Terahertz Physics, Devices and Systems Conference 1-4 October 2006 Boston, MA, 

Invited Paper. 

“Isotropic optical negative index of refraction metamaterials composed of randomly 

arranged nanoparticles,” A. G. Kussow and A. Akyurtlu, accepted for 2007 APS March 

Meeting, Denver, CO, March 5- 9, 2007, Invited Paper. 

“First-principle studies of the optical properties of MgB2 and its applications in optics,” 

A. G. Kussow, A. Akyurtlu, and A. Semichaevsky, North American Radio Science 

Meeting, URSI 2007, Ottowa, ON, Canada, July 23-27, 2007. 

“ Novel optically isotropic negative refraction index metamaterial at visible frequencies 

based on superconductors (MgB2),” A. G. Kussow, A. Akyurtlu, A. Semichaevsky, and N. 

Angkawatissipan, North American Radio Science Meeting, URSI 2007, Ottowa, ON, 

Canada, July 23-27, 2007. 

“Identification and Classification of Chiral and Bi-anisotropic Metamaterials,” N. 

Wongkasem, A. Akyurtlu, and K. Marx, North American Radio Science Meeting, URSI 

2007, Ottowa, ON, Canada, July 23-27, 2007. 

“Gammadion Structures with Negative Refractive Index: Analysis and Experiment,” N. 

Wongkasem, A. Akyurtlu, and K. Marx North American Radio Science Meeting, URSI 

2007, Ottawa, ON, Canada, July 23-27, 2007. 

“Surface Plasmon Resonance Test Bench Device for the Validation of Optical 

Metamaterials,” N. Limberopoulos, G.S. Banks, A. Akyurtlu, A.S. Karakashian, W.D. 

Goodhue, V. Limberopoulos, North American Radio Science Meeting, URSI 2007, 

Ottowa, ON, Canada, July 23-27, 2007. 

“Avalanche Photodetector Design for the Mid-Infrared using GaSb-Based Alloys”, R. 

Bhatia, M. Grzesik, S. Vangala, K. Vaccaro, W. Goodhue and C. Armiento, Progress in 

Electromagnetics Research Symposium (PIERS); Beijing, China, March 25-29, 2007 

"A Longwave Infrared (LWIR) Photodetector Based on Nonlinear Absorption in 

InAs/GaAs Quantum Dots,” X. Lu, C. Armiento, J. Li, and W. Goodhue, IEEE 

Proceedings of the International Symposium on Biophotonics, Nanophotonics and 

Metamaterials,” Hanhzhou, China, Oct. 16-18, p. 333, 2006. 

"Optically Addressed MEMS Deformable Mirrors Driven via an Array of 

Photodetectors", J. Khoury, K. Vaccaro, C. Woods, B. Haji-saeed, S. Sengupta, C. 

Armiento, W. Goodhue, J. Kierstead, A. Davis and W. Clark, SPIE Optics East, Boston, 

MA, October 2006 

"Optically Addressed MEMS Deformable Mirrors Driven via an Array of 

Photodetectors", B. Haji-saeed, S. Sengupta, C. Armiento, W. Goodhue, J. Khoury, K. 


101

Vaccaro, C. Woods, J. Kierstead, A. Davis and W. Clark, Optical Society of America 

(OSA) Annual Meeting, Rochester, NY, October 2006 

“Oligonucleotide Functionalized Intrinsic Fabry-Perot Interferometric Probe for DNA 

Sequence Detection", X. Wang, J. Xu, Z. Wang, K. L. Cooper, A. Wang, and C. Cao, 

"Photonics West - Biomedical Optics (BIOS), San Jose, CA, January, 2007. 

"Study on the Layer-by-layer Electrostatic Self Assembly Method for Biomolecule 

Immobilization onto Biosensor Surface", X. Wang, K. Cooper, and A. Wang, Optics & 

Photonics, San Diego, CA, August 2007. (Accepted) 

"Nanoscale and Manufacturable Sensing Tip for Biomedical Applications", X. Wang, 

SPIE OpticsEast, Boston, MA, October, 2007. (Accepted) 

"A Label-free DNA Optical Fiber Sensor for Detection of Bacteria – F. tularensis", X. 

Wang, K. L. Cooper, and A. Wang, Frontiers in Optics 2007 Laser Science XXIII, 

Fairmont Hotel, San Jose, California, USA, September 16–20, 2007. (Accepted). 

"Novel Automated Nutrient Incorporation (NANI)", M. McDonald, X. Wang, E. 

Reynaud, D. Schmidt, 2007 BIO Innovation Corridor Poster Session, BIO International 

Convention, Boston, MA, May 9, 2007. 

"Intrinsic Fabry-Perot Interferometer with a Micrometric Tip for Biomedical 

Applications", X. Wang, J. Xu, Z. Wang, K. L. Cooper, and A. Wang, SPIE OpticsEast, 

Proc. SPIE 5998, Boston, MA, October, 2006. 

"Miniature optical fiber sensor for dynamic pressure measurements under high 

background pressure", X. Wang, J. Xu, K. L. Cooper, and A. Wang, Optics & Photonics, 

San Diego, CA, August 2006. 

"A novel fiber optic Fabry-Perot (FP) structure with a micrometric diameter tip", X. 

Wang, J. Xu, Z. Wang, K. L. Cooper, and A. Wang, Optics & Photonics, San Diego, CA, 

August 2006. 

“An electrically-controllable multi-spectral quantum dot infrared photodetector with 

high photodetectivity,” Xuejun Lu, Jarrod Vaillancourt, and Mark J. Meisner, Proc. SPIE 

6542, pp. 65420Q (2007). 

“High-quality Ultra-uniform Quantum Dot (QD) Fabrication Techniques for Highperformance 

Terahertz Quantum Cascaded Laser,” Xuejun Lu PIERS Proceedings, 2103 - 

2108, March 26-30, Beijing, China (2007). 

“A miniature electro-optic switch array,” Xuejun Lu and Miao Li, Proc. SPIE 6469, 

64691A (2007). 


102

“An all-optical nonlinear threshold gate based on high-order weakly coupled microring 

resonators with a low switching threshold,” Xuejun Lu, Miao Li, Lei Zheng, and Jarrod 

Vaillancourt Proc. SPIE 6478, 64780S (2007). 

“A two-photon sequential absorption photocurrent generation process in modulation 

doped InAs/GaAs quantum dots,” Xuejun Lu and Mark Meisner, Proc. SPIE 6481, 

64810K (2007). 

“A resonant tunneling CdSe quantum dot photodetector for spectral resolution in the 

visible region,” Therrien, J, and Dindar, A, SPIE Quantum Sensing and Nanophotonic 

Devices IV conference proceedings, Paper Number: 6479-29 (2007) 

3. Collaboration with Other Centers 

Our research activities continue to overlap with, and benefit from, close ties with Prof 

William Goodhue in the Photonics Center. Our interactions include topics such as: 

nanoscale metamaterials, long wavelength APDs in Sb-based materials, integrated 

MEMS devices and applications of quantum dots. The long term goal remains that of 

increasing collaboration between these Centers and expanding our interaction with the 

personnel at the Air Force Research Laboratories at Hanscom Air Force Base and NASA 

Langley. We also anticipate increased activity in collaborations on new electromagnetic 

materials, in particular with the Plastics Engineering and Physics departments. 


We have opened our facility to local schools through the U Mass Design Camp that is 

conducted in the summer months. We have had groups of junior high and high schools in 

the local community. Students have been exposed to concepts such as fiber optics and 

laser physics. 

We have been able to maintain and establish new contacts with industry partners through 

our research activities. The reorganization of the CEMOS labs, which we have been 

continuing throughout the last years, will help to make our facilities increasingly 

attractive for short term as well as long term industry collaborations. 

CEMOS has a long standing history of supporting local industry by conducting 

exploratory studies which can be carried out at the center at relatively low cost and with 

the support and expertise of center personnel CEMOS is committed to continue these 

collaborations. We believe that we can meet our responsibilities in supporting local 

industry with higher efficiency by maintaining a high level of federal funding. Given the 

constraint of an academic research institution, this can be better addressed in terms of 

resources and personnel if these projects can be embedded and complemented by long 

term research. To maintain a healthy blend of external funding is a major emphasis of the 

center strategy. 

5. Proposals Submitted/Awarded 


103

New Awards 

Nanostructured Sensing Elements for Structural Health Surveillance, Army Research 

Laboratory (ARL), $150,000, 5/07 – 12/07, Akyurtlu PI. 

Novel Homogenous, Low-loss, and Tunable Magnetic Semiconductor-based 

Metamaterials, National Science Foundation (NSF), $300,000, 4/07-3 Akyurtlu PI 

Fluorescence/ Optical Detection, Army Sensor Nanomanufacturing program, 8/07 – 

12/08, $ 78,500, Wang PI 

UBAD: Antibody Bioagent Detection, Army Sensor Nanomanufacturing program, 

8/07 – 12/08, $112,420, Wang, co-PI. 

Acoustic-optical Sensors, Army Sensor Nanomanufacturing program, 8/07 – 12/08, 

$46,200, Wang, co-PI. 

Versatile optical sensing platform for detection of chemical and biological interactions, 

Application for the University Seed Funding Program to Advance Research and 

Scholarship, 6/07 – 5/08, $10,000, Wang, PI. 

Fabrication and Characterization of Nanostructures on Optical Fiber Tips for Biosensing 

Applications using Layer-by-Layer Electrostatic Self-assembly Method, 2007-2008 

Faculty-Student Collaborative Research Grant, 07/07– 03/08, $1,500, Wang, PI. 

Novel Automated Nutrient Incorporation (NANI), NCOE, $36,000, 02/07 -05/07, Wang 

co-PI. 

Soft nanolithography for manufacturing chips for biosensing and chemical sensing, 03/07 

– 03/08, $27,000, Wang, co-PI. 

LWIR and FIR Infrared Focal Plane Array, Raytheon, 04/2007-03/2008, $208,540, 

Xuejun Lu, PI 

LWIR and FIR Infrared Quantum Dot Photodetector with High Sensitivity and Large 

Field-of-View, Air Force, SBIR Phase II, 04/2007-12/2008, $184,950, Xuejun Lu, PI 

Development of High-Speed Infrared-Transparent Flexible Electronics based on Carbon 

Nanotube Solutions, NSF STTR Phase I, 08/2007-07/2008, $83,000, Xuejun Lu, PI 

Investigation of Optical Transparent Electrodes, Crystal Research, 07/2007-12/2007, 

$15,555, Xuejun Lu, PI. 

Existing Contracts 

Investigation and Applications of Metamaterials in the Visible Regime, Air Force Office 

of Scientific Research (AFOSR), $374,756, 5/05 - 4/08, Akyurtlu PI. 

Electromagnetic Metamaterials for Advanced Antenna Applications, AFOSR, 

$49,855.00, 6/05 - 8/06, Akyurtlu (PI). 


104

Investigation of Chiral Metamaterials for Drug Characterization, Intellectual Property 

Advancement Grant, UML, $132,800, 10/1/04 – 10/1/05, Akyurtlu (Co-PI). 

Development of Long Wavelength Technologies and Devices, AFRL/SNHC, $487,000, 

7/04-7/07. Craig Armiento (Co-PI) with Prof Goodhue 

NSEC: New England Nanomanufacturing Center for Enabling Tools, National Science 

Foundation, $ 5,030,017, 8/1/04 – 7/31/09, Akyurtlu (Senior Personnel). 

Research Training in Numerical Electromagnetics for Microwave Applications, 

Technical Training Trust, $ 220,032, Kalluri(PI) 

Submitted Proposals 

Novel Optical Metamaterials and approaches for Fabrication, Air Force Research 

Laboratory (AFRL), $100,459, 9/1/07 – 11/30/08, Akyurtlu, PI and Therrien, Co-PI. 

A wireless system for monitoring the cardiac status of firefighters, Department of 

Homeland Security, $18,000, 1/1/08 – 6/30/08, Wang, co-PI. 

Border Agent Security and Immigration Center (BASIC), Department of Homeland 

Security, 9/30/2007 - 9/29/2013, Wang, co-PI. 

Manufacturable nanoprobe biosensors for label free in-cell measurements, NIH, 

$1,500,000.00, 09/01/2007- 08/31/2012, Wang, PI. 

Manufacturing a Nano Future, NSF, $479,979, 01/01/08 – 12/30/10, Wang, co-PI. 

Service 

Prof.Akyurtlu ; Editor, IEEE Antennas and Propagation Magazine 

Prof. Wang; Reviewer, Applied Physics Letters. 


105

11. CENTER FOR FAMILY, WORK, AND 

COMMUNITY 

Annual Report 

2006-2007 

1. Mission 

The Center is an interdisciplinary program of community-focused activities and research 

that emphasize sustainable economic and social development, leadership development, 

family enrichment, capacity building, and empowerment in areas such as environmental 

quality, community-based economic development, and the connection between work and 

family life. The Center places particular emphasis on expanding the capacity of 

organizations and community groups to address cultural diversity and changing family 

and community leadership roles. All activities of the Center are based on a multicultural 

approach to human problems. In all of its efforts, the Center for Family, Work and 

Community strives to: 

Demonstrate innovative ways that faculty can carry out collaborative projects with the 

community 

Demonstrate ways that social science research can contribute to regional economic 

development 

Build application capacity among faculty, staff, graduate, and undergraduate students 

throughout the University 

2. General Description 

During the 2006-2007 academic year, the Center for Family, Work, and Community 

continued to develop programs that bring university faculty, staff, and students together 

with external partners to address long-standing regional issues in economic and social 

development. All of the initiatives of the Center are intended to: 

• Assist UML in achieving its mission of regional economic and social development 

• Strengthen UML’s commitment to working in collaboration with multiple partners 

• Create opportunities for undergraduate and graduate students to work in 

interdisciplinary teams to address community problems 

• Develop research programs that have strong application potential 

• Develop and test innovative interdisciplinary approaches to problem solving 

• Draw on the strengths of the diverse leaders in the region 

3. Research Focus Area 

CFWC’s research focuses on “translational” research: that is, on ways that basic research 

can be carried out so as to lead directly to application. The topic areas of our 

translational research include environmental sustainability, healthy homes, affordable 

housing, health care for immigrant groups, educational inclusion, the built environment, 

environmental justice, and health and environmental impacts of urban living. During the 

Center for Family, Work, and Community 

106

2006-2007 academic year, CFWC has involved 

faculty, staff, and students in research in each of the above areas. 

4. Associated Personnel (Faculty and Staff) 

Dr. Linda Silka- Director 

Robin Toof- Assistant Director, CCH 2010, MAPA, Strengthening Couples 

Bowa George Tucker- Program Manager, GEARUP Educational Partnership 

David Turcotte- Senior Program Manager, Strengthening the Capacity of Health 

Professionals, US Housing and Urban Development Fellows Program, Non-Profit 

Alliance, Sustainable Urban Redevelopment Program’s Lowell Green Building Initiative. 

Dan Toomey- Program Manager, Community Outreach Partnership Center, Community 

Connections Information Clearinghouse 

Melissa Wall- Program Evaluator, CCH 2010, MAPA, Strengthening Couples 

Julie Villareal- Program Manager – River Ambassador Program (RAP); Protecting 

Children’s Health from Environmental Risks, Collaborative Problem-Solving, 

Sustainable Urban Redevelopment Program’s Lowell Green Building Initiative 

Leticia Porter- Associate Program Manager, Gear-Up Educational Partnership 

Leonor Daley- Associate Program Manager, Gear-Up Educational Partnership 

Shawn Barry- Associate Program Manager, Gear-Up Educational Partnership 

Elaine Donnelly- Program Manager, Lowell High School-UMass Lowell Partnership 

Jason Carter- Program Associate, Lowell High School-UMass Lowell Partnership 

Craig Thomas- MA Campus Compact Americorps VISTA Volunteer 

Patty Coffey- CITA Summer Research Manager 

Melissa Nemon- Community Development Consultant 

Tim O’Connor- Youth Outreach Educator, River Ambassador Program 

5. New and Temporary Faculty Affiliations (within last 3 years) 

CFWC continues to support the development of faculty involvement in community 

outreach that links teaching and research. Dr. Silka, as CFWC Director, has continued to 

work with faculty to develop their skills in community outreach and research. The 

faculty worked with during the current academic year include Dr. Lenore Azaroff (Work 

Environment Research Faculty), Dr. Stephanie Chalupka (Nursing), Dr. Michaela 

Colombo (Education), Dr. Judith Davidson (Education), Dr. Khanh Dinh (Psychology), 

Dr. Mignon Duffy (Sociology), Dr. Robert Forrant (Regional Economic and Social 

Development), and Dr. Fred Martin (Computer Science), Dr. Deirdra Murphy (Physical 

Therapy), Dr. Susan Reece (Nursing), Dr. Marina Ruths (Chemistry), Dr. Charlotte Ryan 

(Sociology), Dr. Mansoureh Tajik (Health Education), Dr Holly Yanco (Computer 

Science). 

Other work with new faculty included two new faculty workshops. The first, on Service 

Learning, was held May 21. Nicole Champagne, Craig Thomas, and Linda Silka led new 

faculty through the steps that are needed for successful service 

learning. The second, on Grant Writing, was offered May 22 nd . Linda Silka and Robin 

Toof led new faculty through the process of writing successful grants. 


107

6. Students Supported-last year 

Heather Derby- RESD 

John Drinkwater- RESD 

May Elewa-RESD 

Rosemary Vasquez- CSP 

Saoran Roeuth- Business 

Amanda Trudel- Cmnty Health 

Christina Birmingham- RESD 

Gerald Byaruhanga- RESD 

Ravi Shankar- Engineering 

Bianca Ramirez- Criminal Justice 

Mary Suttie- RESD 

Ray Spinazola- RESD 

Sandra Usher- Nursing 

CITA Summer Research Project high schoolers (Raksa, Tina, Patrick, Peter and Beatrice) 

and Graduate Students: Shaun McCarthy-RESD, Eika Hunt-RESD, Rob Moreau-RESD, 

Ekaterina Konovalova-CSP, Allegra Williams- CSP 

7. Current Research and Outreach Projects 

University Community Engagement, Community Voice 

Community University Advisory Board 

The Community/University Advisory Board brings together an active group of more than 

twenty community and university members who meet monthly. In the past year the 

COPC Advisory Board has addressed the issue of community/university partnerships, 

youth gang activity, and college radio. Outcomes include a community/university 

partnership task force set up by the Chancellor, the creation of a part-time position of 

community connections clearinghouse director, inclusion in a Lowell Police Department 

task force on youth crime and a research study on the bicultural influences on 

delinquency. 

During this academic year, the UML Transformation Team on Community Outreach and 

Engagement (working closely with the Center for Family, Work, and Community and 

facilitated by CFWC Director Linda Silka) made a number of recommendations that 

relate directly to the Community University Advisory Board. Two are highlighted below. 

Recommendation 3: The UML Community-University Advisory Board should 

continue to be developed and expanded to include cities and towns beyond Lowell 

and to report regularly to the UML Provost’s Office or the UML Chancellor about 

engagement and partnership opportunities and needs. 

Recommendation 9: The model (see below) should be used to guide how the 

various community partnership and engagement activities will be coordinated at 

UML. 


108

Enabling Structure for UML Community Engagement and Partnership 

Assistant Vice Chancellor for Engagement 

(Administration) together with 

Special Assistant for Partnership and Engagement 

Community- 

University Advisory 

Council on 

Community 

Staffed Partnership and 

Engagement Office with 

Clearinghouse, Resource 

Lib 

Description of Model Components 

Community-University Advisory Board: Already in place. Reports to UML Provost. 

Members represent diverse constituencies in community and university. Meets 

monthly. Provost attends meetings. 

Council on Partnership and Engagement: Not yet in place. Roles, responsibilities, and 

budget would parallel those of other UML councils (e.g., Research, Teaching and 

Scholarship) and would be faculty-directed as are the other councils. With 

allocated budget, Council would select small seed grants through competitive 

process, oversee community course buyouts, identify needs for professional 

development workshops, speakers series, sponsor community-university events, and 

oversee publication (journal or edited volume). 

Partnership and Engagement Office: Staffed Office would carry out administrative 

and engagement tasks such as maintaining the Clearinghouse, overseeing 


109

professional development workshops, communityuniversity 

partnership events, and seed grant administrative tasks. 

All of the work described above is intended to strengthen the community’s voice. 

Below we describe in more detail the work that CFWC has led in this direction. 

This section is taken from the presentation in Alice Springs, Australia at the 

Australian Universities Community Engagement Association (July, 2007). 

The Strengthening of the Community’s Voice. If community outreach is to prosper, then 

regular input is needed about community perspectives. Many universities struggle with 

the question of how to strengthen the community’s voice. Finding ways to hear from the 

community is made all the more challenging by the fact that universities are typically not 

organized to take advice from outsiders. When efforts to gather community input do 

exist, they are often piecemeal. For example, some U.S. funders mandate community 

input for specific grant-funded projects. The resulting boards often have a narrow focus 

and are rarely equipped to deal with broad, overarching issues. How then can a 

university create a board to provide advice on many different elements of community 

engagement? 

To meet the need for community input, UML created a community-university advisory 

board that over the last four years has provided advice on UML’s efforts to strengthen its 

engagement. The location of the Board in the institutional chart is shown in the Enabling 

Structure described above. While the impetus for the start of the Advisory Board came 

from a multi-year grant from US Housing and Urban Development, the Board now has a 

broad mandate to advise the university on all elements of engagement. The Board meets 

monthly and has been charged with advising the UML Administration on engagement 

strategies. Administrative leaders are invited each month (e.g., college deans and vice 

chancellors). 

The UML approach to board composition differs from that of other universities. What is 

distinctive about UML’s board is that it includes community and university members. 

Key community constituencies are represented (e.g., the schools and various community 

agencies), but board members also include university members such as faculty from 

various departments and staff that have some link with the community. One of the key 

factors contributing to the Board’s success is that the board reports to the top academic 

officers rather than to an outreach office. This access has created unparalleled 

opportunities to impact the university. 

Consider just a few of the Board’s successes, successes that speak directly to the role a 

board can play in ensuring effective engagement. In developing an infrastructure, for 

example, the Board has been instrumental in creating the UML Community 

Clearinghouse, a website of engagement opportunities and resources. With the help of 

the Board, this site has become a major way of publicizing partnership opportunities. 

The Board has also become a presence in university searches. The most important search 

in recent years—that for a new head of UML—included board input on community 

engagement and its importance to the university’s future. Or, consider how the university 

responds to rapid change in the region. Change is always difficult for universities to 

respond to and universities struggle to keep track of changes taking place in their region 


110

and here too the Board has demonstrated its 

importance. The Board has been important not only in keeping track of the changes, but 

in analyzing the partnership opportunities 

created by these changes. The Board has also been important to UML’s national and 

international leadership. For example, as UML looked for ways to strengthen the theory 

underlying engagement work, the Board’s involvement in UML international conference: 

‘Community-University Partnerships: How Do We Achieve the Promise?’ helped to 

produce a conference program that incorporated the perspectives of community leaders. 

In short, this Board—which meets regularly, is broad-based in its membership, and has 

access to top university leadership—has become an important building block in UML 

structures to support community engagement. 

Community Engagement throughout the University of Massachusetts System 

Silka and Toof are part of a leadership team for the University of Massachusetts System 

(convened by Dr. Motley) to develop a unified plan for community engagement 

throughout the University of Massachusetts System. The team has developed and 

presented a plan at the International Conference “Community-University Partnerships: 

How Do We Achieve the Promise”, April, 2007, and has received feedback on the plan 

from Dr. Barbara Holland, international expert on university community engagement. 

Environmental and Health Outreach 

Sustainable Urban Redevelopment Program: Lowell Green Building Initiative 

As a result of interest from the city of Lowell’s Division of Planning and Development 

and several stakeholders to establish programs and incentives to encourage more 

sustainable and greener construction and redevelopment practices, the UMass Lowell’s 

Sustainable Urban Redevelopment Program identified 21 municipalities in the U.S. that 

have established sustainable building and development programs (Arlington, 

Massachusetts; Arlington County, Virginia; Aspen, Colorado; Austin, Texas; Battery Park 

City Authority, New York City; Berkeley, California; Boston, Massachusetts; Boulder, 

Colorado; Calabasas, California; Chicago, Illinois; Frisco, Texas; Gaithersburg, 

Maryland; Memphis, Tennessee; New Jersey; Portland, Oregon; San Diego, California; 

Santa Barbara, California; Santa Monica, California; Scottsdale, Arizona; Seattle, 

Washington). We initially conducted an internet analysis of sustainable building programs 

websites of these municipalities. We then conducted follow-up telephone interviews with 

the managers of these sustainable building programs to ascertain pertinent information 

that was missing from the websites, but was necessary to our analysis and evaluation. The 

above-mentioned programs were selected to represent a cross-section of existing 

programs around the country. In order to determine which program components and 

economic incentives would be most useful is Lowell, we 

also conducted surveys of homeowners and building professionals. Based on the findings 

of this research, we developed recommendations on what kind of programs 


111

and incentives should be offered by the City of 

Lowell to encourage more sustainable and greener construction and redevelopment 

practices in the city. We presented a report with these recommendations “The Benefits of 

Building Green: Recommendations for Green Programs and Incentives for the City of 

Lowell” at a community forum in December, 

2006. Subsequently, the City of Lowell’s Environmental Subcommittee has reviewed 

these recommendations, leading to the City of Lowell to pass a resolution supporting US 

Mayors Climate Protection Agreement, which includes a focus on green buildings. In 

addition, the city joined the U.S. EPA’s England's Community Energy Challenge, 

committing to become an EPA ENERGY STAR partner and reducing municipal 

emissions by 10%. We are also working with the City of Lowell’s Division of Planning 

and Development and City Council Environmental Subcommittee to identify prospective 

members for a proposed green building commission to help develop and promote the 

city’s green building program. 

Strengthening the Capacity of Health Professionals (EPA funded) 

This project is a partnership between the Nursing Department, Lowell Center for 

Sustainable Production and the Center for Family, Work, and Community to prevent 

environmental health risks facing children. To accomplish this, we focus on health 

professionals who serve low-income, immigrant/refugee and minority children in small 

cities and rural areas in New England, a population that is generally underserved by 

children’s environmental health capacity building efforts although it suffers 

disproportionately from the impacts of environmental contaminants. 

Our objectives are to: 1) work closely, and increase knowledge through training and 

education, with the primary health care providers for such communities, including 

Community Health Centers, School Nurses, Public Health Nurses, Emergency 

Department Nurses, and Nurse Educators in order to build health professional capacity to 

address children’s environmental health in low-income and minority populations to 

understand, diagnose, and conduct prevention activities for a full spectrum of 

environmental health issues encountered by children in a culturally relevant manner; 2) 

create positive change in the practices of healthcare professionals, parents and children 

that contribute to the minimizing and/or eliminating environmental health hazards for 

children; 3) establish a training and evaluation model to build health professional 

capacity to address children’s environmental health that can be replicated; and 4) promote 

that model and continued networking of regional health professionals working on 

children’s environmental health through websites, professional listserves, conference 

presentations, and the publication of articles. To date, we conducted seven workshops in 

all the New England states (New Hampshire, Connecticut, Rhode Island, Vermont, 

Maine, and two in Massachusetts) training over 300 healthcare professionals in 

prevention of environmental health risks facing children. 

Initiatives with Schools and Youth 


112

UML –LHS Partnership for College Success 

The University of Massachusetts Lowell (UML) and Lowell High School (LHS) are 

collaborating through a ‘Partnership for College Success’ grant. This project focuses on 

increasing the number of Lowell High School students who enroll and earn postsecondary 

degrees at UMass Lowell and other four-year institutions. Now finishing its 

third year, Partnership for College Success is funded by the Nellie Mae Education 

Foundation and receives technical assistance from the Woodrow Wilson National 

Fellowship Foundation. The regional grant program is aimed at strengthening 

collaborations between universities and high schools to improve college preparation and 

success for all students. 

PCS is building on existing resources at LHS and UML, creating new collaborative 

opportunities, and working to align systems within the two institutions to draw on 

corresponding strengths and assets. This includes the following actions: 

1. Develop a transition process for LHS seniors into their first-year at UML: 

• Early Introduction and Lunch: On May 30 th , fifteen UML faculty members and 

administrators spent the afternoon with LHS seniors at the high school to discuss 

college expectations, answer questions about classes and majors, and to initiate a 

relationship between incoming students and UML professors and classmates. 

• Alumni Club: Beginning with recruitment of incoming and current UML students 

who are LHS grads, the LHS Alumni Club has been holding initial meetings in 

the summer 2007 to plan a welcome event in late August. This student-driven club 

is being developed to address issues of social integration, peer support, and oncampus 

engagement for Lowell students, many of whom are low-income, firstgeneration-to-college, 

and commuters. 

• Fall 2007 events: PCS and it stakeholders are currently planning events for the 

first semester of 2007 that will help bridge the high school-to-university transition 

for Lowell youth. These include a LHS reception at UML and regular assistive 

communications, among others. 

2. Enhance college information resources at LHS: 

• Collaboration with the LHS College and Career Center: 

The College and Career Center (CCC) has been very involved with the PCS 

project since the center’s inception in 2005. For example, the two guidance 

counselors who staff the CCC have been active participants planning sessions, 

developing effective strategies with PCS support and contributors in the tri-annual 

PCS cluster meetings. For 2007-08, PCS has collaborated with and supported the 

efforts of the CCC to (a) develop a comprehensive professional development 

series for LHS faculty that is focused on college advising, (b) institute an annual 

College Week at the high school that includes a college fair, speakers, and 

promotes a college going culture, and (c) support school-wide administration of 

the PSAT to all 10 th and 11 th grade students which includes enhancing score 

dissemination and accompanying information for students and families. 


113

• Campus visits: 

PCS is working with departments at LHS and UML to develop a unique campus 

visit strategy that is tailored specifically for LHS students. This strategy will 

involve no or low-cost transportation, UML students who are themselves LHS 

alums, and easy-to-implement logistics tied to the Admissions office. 

• Enhanced college communications within the school: 

Over the past year, PCS utilized six LED screens, located in strategic points 

within Lowell High School buildings, to communicate priority college messages 

such as deadlines for scholarships and updated information for college 

representative visits. PCS also hosts a bulletin board near the main office that 

highlights student biographies and offers an ongoing series of televised SAT 

questions in the cafeteria. 

• You Too! TV: 

New to both UML and LHS, faculty at both institutions are working together on a 

new television series that is dedicated to promoting college awareness within the 

Lowell community. This program will be a magazine style show that is coproduced 

by mixed teams of LHS and UML students. Associated with UML 

coursework, the production teams will start their work this fall during after school 

hours at LHS. 

3. Expand connections between LHS and UML: 

• Guidance and Admissions: 

PCS is facilitating meetings between guidance and admissions offices to plan a 

series of workshops in the 2007-08 school year. These workshops will be 

opportunities for mutual learning around admissions, Lowell student concerns, 

and similar topics. 

• Chemistry vertical teaming: 

Beginning with meetings in April and June 2007, faculty and administrators from 

LHS and UML are partnering around the chemistry coursework and departments 

at both institutions. The next step of this vertical teaming initiative is a larger 

inter-faculty meeting in early September so that syllabi, course expectations, and 

state standards can be shared and discussed. 

• Spring 2007 Convening: 

On June 12, 2007, nearly 400 faculty and staff at Lowell High School participated 

in the Headmaster Luncheon sponsored by PCS. This meeting highlighted the 

ongoing partnership work between the two institutions and included the following 

speakers: Headmaster William Samaras, Student Services Coordinator Kerry 

Lynch, Provost John Wooding, Interim Vice Chancellor Joyce Gibson, and 

Deputy Provost Kristin Esterberg. A second convening is currently being planned 

for Fall 2007 that will include the Lowell Public Schools Superintendent and 

other UML leadership. 


114

4. Build access to college information resources 

within the community and for families of LHS students: 

• You Too TV 

• Parent strategy: 

During June, July and August 2007, PCS staff are meeting with local individuals 

and community based organizations who work with Lowell’s families in order to 

• build strategic partners and increase access to college related information. These 

links will be connected to key departments at LHS and UML to provide 

sustainability and a more integrated communication system. 

• Website: 

PCS is looking to potentially use the front page of the LHS website (which is the 

default home page for every computer at LHS) to link to college information at 

UML and other locations. This will build upon the 50 pages already developed 

and will incorporate a campaign that utilizes other communication vehicles at 

LHS, UML and PCS disposal to spread the message about this resource. 

5. Enhanced data collection and assessment to connect both institutions and 

inform decision making: 

• New database: 

With technical assistance from Woodrow Wilson, PCS has been building a 

database that tracks information about LHS and UML students to assess their 

academic performance, course taking patterns, college status and graduation rates. 

This data is useful to both institutions to inform effective practices that increase 

college success. 

• Qualitative data: 

PCS has been tracking data from current students to better inform access and 

retention practices and to make available college resources more effective. This 

includes discussion groups, enhancing the high school senior survey vehicle for 

improved data quality, and interviews with faculty. 

• Student Tracker: 

PCS has supported LHS subscription to Student Tracker, a nationwide 

clearinghouse that follows student progress at universities throughout the US and 

monitors who is still enrolled, their current status, and graduation rates. 

GEAR UP Opportunity Lowell 

GEAR UP (Gaining Early Awareness and Readiness for Undergraduate Programs) is a 

national college preparatory program funded by the U.S. Department of Education. The 

mission of the GEAR UP Opportunity Lowell program is to significantly increase the 

number of low-income students who are prepared to enter and succeed in postsecondary 

education. The program is focused on increasing math literacy among families and 

raising the level of mathematical understanding and performance among students, and 

has well established partnerships among schools, colleges, local arts and youth-serving 

organizations, and coordinated activities with adult education and other programs to 


115

support parents in the schools and the community. 

The partnership includes the University of Massachusetts Lowell, the Lowell School 

Department, Middlesex Community College, the Revolving Museum, the Greater Lowell 

Boys & Girls Club, Lowell Telecommunications Corporation, and the Merrimack Valley 

Housing Partnership. Below are key successes and concerns in each of our major areas 

of programming this year. 

1) Securing Success in Mathematics through Tutoring, Mentoring, and Enrichment. 

Ongoing academic enrichment programs in mathematics have been developed in 

cooperation with each of five partner middle schools. Now these programs are about 

to be incorporated at Lowell High School. At the start of every program year, school 

principals, faculty and GEAR UP staff work together to develop strategies to leverage 

tutoring resources provided by GEAR UP. 

Direct efforts to improve academic performance include in-school and after school 

mathematics tutoring with programs designed by each partner school in conjunction 

with an outside facilitator who began by assessing curriculum alignment with the 

Massachusetts Comprehensive Assessment System (MCAS). Last school year all five 

schools immediately began employing one or more tutors during the school day; by 

January, all five schools had developed after school programs incorporating math 

tutoring. These programs have ranged from comprehensive after school programs 

integrating athletics and other activities, to more narrowly focused supplemental 

instruction. Examples include: “Math and Basketball” which linked MCAS 

preparation sessions with Basketball games played after the Math instruction. This 

after school program ran weekly for two hours and was very successful as students 

loved the fun activities combined with academic ones. 

In a collaboration with the Boston-based Young People’s Project 12 high school and 

college students have been trained as “math literacy workers” in order to work with 

middle school students on engaging, real-world math-based activities. The trained 

literacy workers now serve as Math tutors and mentors to students in the Partnership’s 

after school and other projects. They also serve as role models and resources to help 

middle school kids in their transition to High School. These mentors have a positive 

impact in the younger students’ lives, working with them in after school programs 

andweekend family activities. Gear Up now has a group of 8 YPP mentors who are 

juniors and seniors at Lowell High School. 

2) Developing College and Career Awareness. At the same time that we are working 

to increase students’ academic success, we are providing students and their families 

with opportunities to see college as an accessible and desirable opportunity. Both 

students and their parents are participating in college visits 

this year. GEAR UP brought over 500 8 th grade students to Umass Lowell South for a 

campus tour/scavenger hunt and information session. 


116

GEAR UP also provided in-class career awareness 

workshops that consist of an interest inventory and a follow-up activity that connects 

careers to personal interests, skills and strengths. This is a two-part activity that is 

linked to already existing career exploration curricula at GEAR UP middle schools. 

Students also learned about college preparation through the College Board’s College 

Ed curriculum. 

GEAR UP offered the UML Adventures in Technology summer program, which 

capitalized on UML’s science and research assets, including the Nuclear reactor, Wind 

Tunnel, Baseball Research Center, Characterization Lab, Computer Robotics and 

Nursing facilities. Students also participated in activities led by UML admissions and 

visited several colleges in the region. 

Information about preparation and financing higher education is provided through 

GEAR UP in the context of student and parent workshops and other events. For 

students, these are focused on career awareness and academic enrichment; for 

parents, on personal capacity building, including personal finance workshops, as well 

as campus visits. 

3) Fostering Parent Involvement. GEAR UP offers parents the opportunity to broaden 

their knowledge by providing computer training programs and partnering with Lowell 

Adult Education to offer ESL (English as a Second Language) and GED programs. 

Parents are also given the chance to participate in school activities with their children 

by attending GEAR UP sponsored family nights and parent/child workshops. GEAR 

UP has also coordinated a monthly parent group called “G.A.P.-Gearing Up with 

Active Parents”. Included in this group are parents of eighth grade students. They 

meet monthly to discuss ways to involve more parents with GEAR UP, plan 

upcoming parent events, and brainstorm creative marketing tools. 

Personal finance workshops are engaging and empowering parents of eighth graders, 

building on and expanding the mathematical “funds of knowledge” in students’ 

homes (Gonzalez, Andrade, Civil & Moll, 2001). Offered by GEAR UP in 

collaboration with the Merrimack Valley Housing Partnership, these workshops 

address debt consolidation and other issues of financial planning which are precursors 

to preparation for home-buying. 

Game nights, family campus visits and other family field trips help us to engage 

whole families in GEAR UP, increasing the depth of our connection to students, our 

ability to engage both parents and students, and bridging students’ home and school 

worlds. More than 125 parents participated in these activities this year. Parents 

continue to value the services GEAR UP offers and this has allowed us to establish 

extended contact and trusting relationships, and to begin to build networks of 

connection among parents. Through GEAR UP, these networks also link to the 

schools, especially important within immigrant communities. 


117

4) Supporting Faculty and Staff Development. 

Particularly important to the mathematics focus of this project, all math teachers in 

the five GU schools have become involved in the program’s “vertical team.” This 

team includes UMass Lowell faculty, Middlesex Community College faculty, GU 

staff, Lowell High School’s Curriculum Director, math faculty, and an instructional 

specialist at the high school. These monthly six-hour meetings will have a lasting 

impact on the five GU 

participant schools not only through curriculum adaptations, but also through the 

greater mathematical understanding teachers have gained through the process. 

Careers through College 

Careers through College is a Workforce Investment Act funded program that works with 

a small group of Lowell High School 11 th and 12 th grade students. During the second year 

of programming, Careers through College staff provided programming in the areas of 

goal setting, college awareness, career awareness, resume writing, interview skills, SAT 

preparation, and team building. Participants received services as a group and individually 

to enhance the scope of services. 

Health Curriculum Evaluation 

We continue to work with Lowell Public Schools to evaluate the health curriculum being 

implemented in some elementary and middle schools. This pre-test post-test model 

provides information to program coordinators and teachers on the effectiveness of the 

program. 

The River Ambassador Program 

The River Ambassador Program (RAP) is a volunteer youth program supported 

by the Center for Family, Work and Community. It is now in its ninth year of 

bringing youth together with the University and community groups to address 

environmental health concerns in Lowell. Over 250 high school students have 

participated throughout the years. The program not only provides project-based 

hands-on activities on environmental justice, but also gives students opportunities 

to develop and create their own environmental activities. In addition, the students 

participate in local community events to promote and exchange ideas about the 

environment. 

Our mission is to learn more about environmental issues in our region, educate others in 

our community about those issues, and to take action wherever possible to improve our 

environment. We believe that we can make a difference in Lowell and abroad, by 

drawing on the positive energy of youth to serve the community and by providing 

worthwhile activities for teens. RAP strives to build a strong relationship to the 

community through interactions that increase the community's recognition of, and respect 

for youth as role models. Our goals are to study environmental topics impacting our 


118

health and well being; to share what we learn with 

fellow RAP members, other teens, and the community; to develop an understanding of 

and a relationship to the political process by which environmental decisions are made; to 

plan and perform community service that improves our environment; to plan and carry 

out environmental events with immigrant & refugee communities of Lowell; to establish 

RAP's image and mission in the public mind; and to seek funding for on going group 

activities and for special projects and programs. 

For the 2006-2007 academic year, we hired a Youth Outreach Educator and a 

work-study student. During this past year, the RAP students researched the 

environmental impact of iPods. For their work in the community, the RAP 

students received the “Youth Environmental Heritage Award” from the Lowell 

National Historical Park and the “2007 Secretary’s Award for Excellence in 

Environmental Education” from the Commonwealth of Massachusetts’ Executive 

Office of Energy and Environmental Affairs. The students are currently working 

on a Public Service Announcement on the effects of e-waste. 

Community Involvement. One of the integral components of the program is 

to be involved with community events. By supporting and volunteering in various 

events, the program and its members are recognized in the community as an 

important resource. The teens also feel a sense of pride and accomplishment in 

participating in these civic activities. 

• Winterfest 

• Canal Clean-up 

• Thanksgiving Volunteering at the 

Eliot Church 

• Earth Day 

• UML’s CITA conference 

• Grassroots Radio Conference 

• Destination Cambodia: 

showing the environment 

in Lowell and in 

Cambodia 

• Walk for Hunger in Boston 

• Destination Cambodia 

• Lowell Folk Festival 

Recycling Team 

Promoting College Awareness. In 2006, the RAP program organized a 

college workshop for the students. We helped them with their college and 

financial aid application and essays. Additional topics included the involvements 

in extracurricular activities and making connections with their professors and 

advisors, college life experience, time management, class selection and 

scheduling 

RAP Website Revisions. This RAP website offers youth and the general 

audience a glimpse of the program. It includes environmental resources, 

opportunities for youth, additional links, program highlights, photos and much 

more. http://www.lowellrap.org 


119

RAP- Lowell National Historical Park- 

Internship RAP students continue their involvement with the Lowell National Historical 

Park (LNHP). One of the LNHP rangers attends the weekly RAP meetings. The RAP 

students also continue their experience as summer interns in the Interpretation and 

Education Division of LNHP. The internship will give them the opportunity to build 

leadership and interpersonal skills. They will continue to give park tours, operate the 

exhibits and interpret the industrial and environmental history of the Merrimack River 

Watershed. This year at the Lowell 

Southeast Asian Water Festival they will give the special boat tours that they 

developed for last year’s festival. 

Capacity Building with Refugee and Immigrant Groups 

Cambodian Community Health 2010 

We are partners with the Lowell Community Health Center, the Cambodian Mutual 

Assistance Association, and many other organizations in Lowell in a program designed to 

build community resources for addressing the rapid increase in cases of cardiovascular 

disease and disease among Cambodian elders. CFWC evaluates the breadth and depth of 

the initiatives and their success in reaching the needs of Cambodian elders. 

Family Service, Inc. Lawrence MA 

We are currently the evaluators on the Family Service, Inc. project, Mujeres en Accion 

Protegiendose Ahora (MAPA) an HIV/AIDS prevention curriculum specifically designed 

for the Latina community and Strengthening Families program for Lawrence couples. 

The evaluations provide program coordinators feedback on the effectiveness of the 

programs’ implementation and outcomes. 

Research Ethics with Underserved Groups: New National Institute of Health guidelines 

for addressing health disparities call for greater research with minority populations. 

Important as such research is, it also poses challenges to carrying out ethical, equitable 

research in which participants have opportunity to help set the research agenda. The 

CFWC is working with faculty and community partners at University of North Carolina, 

Tufts, and Syracuse University to develop national models for carrying out ethical 

research in collaboration with minorities. At CFWC we have worked with community 

groups to develop new courses, workshops, and written materials for community leaders, 

researchers and researchers in training in how to apply a research cycle approach to 

carrying out ethical research. During the year CFWC hosted workshops and trainings for 

individuals and groups on research ethics with underserved groups, developed a book 

prospectus, and wrote three articles related to this work. 

Building Ethical Research Partnerships: The Lawrence Research Initiative: CFWC 

continued to participate and help to facilitate the development of the Lawrence Research 

Initiative, an academic-community collaborative project. The project aims to build a 


120

esearch infrastructure to assure that research 

conducted in Lawrence will provide a clear benefit to the community by including 

community members in all research phases. Established in the fall of 2006, the Initiative 

was created by individuals from Lawrence organizations and is being led by a working 

group from the Lawrence Mayor’s Health Task Force. It includes representatives from the 

City of Lawrence, UML and other universities, and community organizations. Many 

local community organizations have been approached over the years and asked to 

facilitate research in Lawrence. However, the researchers making these requests have 

had varying levels of sensitivity to community concerns and varying abilities to form 

collaborative relationships with 

community groups. The Initiative has developed a set of core principles for research 

partnerships, a list of criteria for agreements between partners, and a model to help guide 

researchers and community members toward an equitable and mutually-beneficial 

research process and result. 

Other Outreach 

CITA Summer Research Project 

This is the tenth year that the Committee on Industrial Theory and Assessment (CITA) 

has sponsor the CITA Summer Research Team. For this landmark year, the team will 

collect oral histories and build on work undertaken last summer to enhance current 

partnerships with the city focusing on arts and economic development. The team will 

learn more about the factors that caused various groups to come to Lowell in the late 

nineteenth and then again in the late twentieth centuries. Some immigration history has 

already been collected, but we know there is more to learn. We are after what has not yet 

been captured in history books. We want to have conversations with people from age six 

to 100, to hear stories, for example, about: what it was like coming to Lowell from a 

warm climate and experiencing a snowy winter for the first time; how hard it was to find 

work; how young people adjusted to being in Lowell? 

Building on work undertaken last year, the team will identify downtown business owners 

willing to host a space for classes or meetings, and discuss options for partnership with 

the University. A Best Practices Guide revealing strategies for more student involvement 

downtown will be produced, based on findings from visits to three universities in the 

area. In addition to the guide, the team will create a website highlighting their work, a 

Lowell Sun newspaper article, digital photo stories portraying oral histories of 

immigrants, and presentations to various university and city leaders. 

Community Connections Information Clearinghouse 

Many in the Merrimack Valley continue to report that UML is still a “black box” to them. 

People struggle to identify who they can contact within UML in order to build 

partnerships with students, staff, and faculty. The UML Community Connections 

Clearinghouse serves as a “gateway” through which groups and individuals outside of 

UML can learn of partnership opportunities with UML students, staff, and faculty, while 

at the same time UML students, staff and faculty can learn from the community of 

partnerships in which they may wish to participate. 


121

The Focus of the Clearinghouse is: 

• To assist outside partners in identifying which UML courses have projects, 

service learning, practicum, or internship possibilities. 

• To assist UML students, staff, and faculty in identifying community partners 

who have projects that provide interesting growth opportunities for our students, 

staff, and faculty. 

The site, www.clearinghouse.uml.edu, is designed to be used by community partners, 

faculty and staff, and students as a classified message board to list opportunities for 

service learning, practicum, internship and work study opportunities. 

The clearinghouse has already helped place students and volunteers in nearly twenty 

community organizations over the past two years including: The Lowell Housing 

Authority, Casey Family Services, Girls Incorporated, the Revolving Museum, 

Merrimack River Watershed Council, WUML, Junior Achievement, International 

Institute, Community Software Lab, Caleb Foundation, Work Opportunities, Lowell 

Canalwaters Cleaners, National Park Service, Lawrence Community Works, Lawrence 

YWCA,GEARUP, and others. 

Nonprofit Alliance of Greater Lowell 

In the past many of the over 70 nonprofit organizations in Lowell have struggled to 

maintain their infrastructures and build programs. The CFWC facilitates the Nonprofit 

Alliance in order to expand the capacity and resources of groups and organizations. We 

lead monthly meetings, facilitate retreats, and carry out training to strengthen programs in 

the area. 

MA Campus Compact Americorps VISTA Volunteer 

During this past year CFWC supervised an Americorps VISTA Volunteer placed through 

Massachusetts Campus Compact. Craig Thomas, a graduate of Wesleyan University, has 

filled this role. Accomplishments include: (1) visited community based organizations to 

establish new relationships and build on existing ones, (2) documented current UML 

partnerships with the City of Lawrence and disseminated information throughout the 

university about them, (3) helped coordinate the Lawrence Teen Summit designed in part 

to uncover service learning and community partnership opportunities, (4) facilitated the 

creation of a UML and Lawrence Mayor’s Health Task Force community research review 

and infrastructure process (requested by the community partners to ensure the service 

learning and partnerships meet the needs of the community), (5) presented to various 

community organizations and UML students about service learning, (6) worked with Dan 

Toomey on the UML Clearinghouse and in placing students in service learning projects, 

(7) promoted opportunities to engage students through co-creating the Alternative Spring 

Break Club and coursework in partnerships with SLICE, and (8) supported service 


122

learning courses through technical assistance to 

faculty and students. 

Thinking Out Loud 

Thinking Out Loud is a public affairs radio show that airs from 10 a.m., until noon, every 

Monday through Friday on WJUL 91.5 FM, the university’s radio station. The focus of 

the show is the community, the workplace and the environment. The show brings 

community news, live interviews and commentary with segments in five language 

segments: English, Spanish, Khmer (Cambodian), Portuguese (Brazilian) and Laotian, to 

a potential audience of over two million listeners in the Merrimack Valley of 

Massachusetts and New Hampshire. The show currently provides ten hours of 

programming, utilizing 25 regular volunteer hosts each week and their guests. 

Nationwide public affairs features such as “Between the Lines”, “Workers Independent 

News Service”, the Maryknoll’s “Voices of Our World”, and Democracy Now’s Spanish 

Language news segment are aired as part of the shows varied format. Locally produced 

weekly segments include Julie Villareal’s “Environmental Corner” Isa Cann’s “Long 

View on Sustainability” and Grace Ross’ Commonwealth Report. 

Conference Convened 

CFWC was centrally involved in implementing and overseeing the International Conference “Community- 

University Partnerships: How Do We Achieve the Promise?” held April 25-28 Lowell, Massachusetts (see 

attached announcement). 

International Consultations 

From June 23 to July 26, 2007, Linda Silka, CFWC Director, was asked by universities in 

Australia and their national organization Australian Universities Community Engagement 

Association to provide consultation on how to build interdisciplinary communityuniversity 

partnerships that focus on engaged research. Australian universities are 

currently undergoing a shift in emphasis that will greatly increase the community 

engagement expected of their researchers, teachers, and students. During her time in 

Australia, Silka worked with leaders at Edith Cowan University (Perth), Queensland 

University of Technology (Brisbane) Swinburne University (Melbourne), and University 

of Western Sydney (Sydney) and made presentations to faculty that included 

representatives from an additional 10 other universities (Australia has 38 universities in 

all). As a result of these consultations, the faculty at various universities in Australia 

have expressed an eagerness to pursue joint initiatives that would bring together research 

and community engagement and lead to combined proposals for funding. They are 

interested in (1) collaborating around the common interest areas identified during the trip 

(these include environmental health, environment and sustainability, 

regional economic development, nanotechnology, immigrants and refugees, and schooluniversity 

partnerships), (2) finalizing plans for a special issue of the Metropolitan 

Universities peer-reviewed journal (discussions have already been begun with the 

editor/founding editor Barbara Holland about this possibility) that would focus on 

interdisciplinary approaches to engaged research in the US and Australia, and (3) writing 

joint research proposals on community-based participatory research. 


123

8. Publications (Most Recent) 

Books (in press) 

Geigis, P., Hamin, E., & Silka, L. (Eds.). (2007). Preserving and enhancing 

communities: A guide for citizens, planners and policymakers. Amherst, MA: 

University of Massachusetts Press. 

Articles and Book Chapters 

Geigis, P, Silka, L, & Hamin, E. (2007). Community Preservation: Residents, 

Municipalities, and the State: Collaborating for Smarter Growth. In Preserving and 

Enhancing Communities: A Guide for Citizens, Planners and Policymakers. 

Amherst: University of Massachusetts Press. 

Grigg-Saito, D.; Och, S.; Liang, S.; Toof, R.; & Silka, L. (2007, May 7). Building on 

strengths of a Cambodian refugee community through community based research”, 

Journal of Health Promotion Practice, 0, 1524839906292176v1. 

Hall, T. C. & Silka, L. (2007). Housing and Community Preservation: A Home for All. 

In Preserving and Enhancing Communities: A Guide for Citizens, Planners and 

Policymakers. Amherst: University of Massachusetts Press. 

Silka, L. (in press). Transforming Experiences: When Host Communities Become 

Home Communities. In L. Pho & J. Gerson (Eds), Learning from Diverse Voices: 

Southeast Asian Refugees in the Mill City: Changing Families, Communities, 

Institutions. 

Silka, L. Partnership Ethics. (under review). In P. Ginsberg & D. Merten (Eds.). 

Handbook of Social Science Research Ethics. Sage Publications. 

Silka, L., & Eady, V. (2007). Diversity: Multiple Cultures Forming One Community. 

In Preserving and Enhancing Communities: A Guide for Citizens, Planners and 

Policymakers. Amherst: University of Massachusetts Press. 

Silka, L., Forrant, R., Bond, B., Coffey, P., Toof, R., Toomey, D., Turcotte, D., & West, 

C. (under review). Achieving Continuity in the Face of Change in Community- 

University Partnerships. Gateways Journal. 

Silka, L. & Renault-Caragianes, P. (2006). Community-university research partnerships: 

Devising a model for ethical engagement. Journal of Higher Education Outreach and 

Engagement, 11(2), 171-183. 

Silka, L.; Toof, R.; & Grigg-Saito, D. (2007) Eight Americas: Differences in asian 

communities are important. PLoS Med 4(1): e41 

doi:10.1371/journal.pmed.0040041 

Turcotte, D. & Silka, L.(in press) Reflections on the concept of social capital. 

Chapter to appear in L. Pho, J. Gerson, S. Cowan (Eds) , Southeast Asian 

refugees and immigrants in the mill city: Changing families, communities, 

institutions –Thirty years afterwards. Durham: The University Press of New 

England. 


124

Turcotte, D. (2006). Sustainable Development: A 

Better Holistic View. New Solutions: A Journal of Environmental and 

Occupational Health Policy 16 (4), 398-401. 

Turcotte, D. (2007) A Framework for Sustainable Housing Development in the United 

States, Doctoral Dissertation, University of Massachusetts Lowell. 

Turcotte, D. (2007). Developing Sustainable Housing: Moving Beyond Green. 

Progressive Planning 172, 34-37. 

Turcotte, D.& Silka, L. (2007) Social Capital in Refugee and Immigrant 

Communities. In J. Jennings (Ed.), Race, Neighborhoods, and the Misuse of 

Social Capital. New York: Palgrave Macmillan. 

Journal Editorial Boards 

Dr. Linda Silka is on the editorial board of New Solutions, journal of the Work 

Environment Department and has reviewed this year for various journals, 

including Science. 


Allen, A. & Silka, L. (2006). Invited workshop on community-based participatory 

research. Workshop presented to MAConnect Coalitions, Dana Farber Cancer 

Researchers and Researchers from Harvard School of Public Health, Framingham, 

Massachusetts, October 19, 2006. 

Beck, J.; Kim, H. J.; Martin, M.; Silka, L.; Testa, D.; & Yanco, H. (2007) Artbotics: 

The challenge of new partnerships. Presented at International CITA Conference: 

Community-University Partnerships: How Do We Achieve The Promise?, Lowell, 

Massachusetts, April 27, 2007. 

Cleghorn, D., Grullon, M., Koch-Weser, S., Roelofs, C., Siemons, R., Silka, L., and 

Thomas, C. (2007). A community and universities working together to change the 

approach to research partnerships. Presented at International CITA Conference: 

Community-University Partnerships: How Do We Achieve The Promise?, 

Lowell, Massachusetts, April 27, 2007. 

Kim, H. J., Martin, F., Silka, L. ,Yanco, H., Beck, J., Coluntino, D., and Testa, D. 

(2007). Artbotics: The challenge of new partnerships. Presented at International 

CITA Conference: Community-University Partnerships: How Do We Achieve The 

Promise?, Lowell, Massachusetts, April 26, 2007. 

Liang, S; Pot, M; Toof, R.; & Laskey, A (2006). Cambodian community health 2010: 

Community approaches to eliminating health disparities. Presentation at Fifth 

biennial conference of the international Society of Critical health Psychology, July 

20, 2007. 

Porter, L.; Sim, S.; Addae, A. M.; Phan, H.; Chan, N.; Kham, K.; Perez, J.; Sannoh, 

A.; & Tivey, M. (2006). Using high school students as tutors and mentors. 


125

Workshop presented at the New England GEAR 

UP Conference, Leominster, MA, October 27 th , 2006. 

Silka, L. (2007). Strengthening community-university engagement: The UML 

experience. Presentation at Australian Universities Community Engagement 

Association (AUCEA) Annual Conference, Alice Spring, Northern Territories, 

Australia. 

Silka, L.; Grigg-Saito, D.; Liang, S.; & Toof, R. (2007). Cambodian Community 

Health 2010: Seven Years, Seven Lessons. Workshop presented at the 10 th Annual 

Community-Campus Partnerships for Health. Toronto, Canada, April 11, 2007. 

Silka, L. et al. (2007) When the community is a school: Strategies for partnership 

success. Presented at International CITA Conference: Community-University 

Partnerships: How Do We Achieve The Promise?, Lowell, Massachusetts, April 26, 

2007. 

Silka, L., Grigg-Saito, D., Laskey, A., Liang, S., Och, S., Toof, R., and Wall, M. 

(2007). From Data to Policy and Practice: The Cambodian Community Health 

2010 Experience. Presented at Active Living Research Conference, San Diego, 

California, February 23. 2007. 

Silka, L., Turcotte, D., Boyer, D., Buxbaum, L., Renault-Caragianes, P. & Villareal, J. 

(2007). Community university partnerships: Achieving the promise in the face of 

changing goals, changing funding patterns, and competing priorities. Paper presented 

at the International CITA Conference: Community-University 

Partnerships: How Do We Achieve The Promise? Lowell, Massachusetts, April 27, 

2007. 

Tucker, B.; & Barry, S. (2006). Making Use of Community Partners to Enhance GEAR 

UP Efforts. Presentation at GEAR UP New England Regional Conference, 

Leominster, MA, October 2006. 

Turcotte, D. (2007). Case studies in sustainable housing. Paper presented at UMass 

Lowell Qualitative Research Network’s Research Sharing Day, Lowell, MA, May 9, 

2007. 

Turcotte, D. (2007). Cases in sustainable housing. Paper presented at the Sustainable 

Urbanism Conference, Texas A & M, College Station, Texas, April 2, 2007. 

Turcotte, D. (2007). Sustainable housing. Invited presentation at El Colegio de Tlaxcala, 

Tlaxcala, Mexico, January 18, 2007. 

Turcotte, D., Villareal, J., & Bermingham C. (2006). The benefits of building green: 

Recommendations for green programs and incentives for the city of Lowell. Green 

Building Forum, Lowell, MA. December, 2006. 


126

Yanco, H. A., Kim, H. J., Martin, F. G., & Silka, L. 

(2007): Artbotics: Combining art and robotics to broaden participation in computer 

science. Presented at American Association for Artificial Intelligence 

Conference. 


We work to involve faculty, staff and students from throughout the university in 

developing new collaborations that will strengthen links between UML and region. 

During the year we collaborated with the following Departments and Centers at the 

University: 

• Center for Industrial Competitiveness 

• Center for Industrial Theory and 

Assessment 

• Center for Sustainable Production 

• Center for Women and Work 

• College of Arts and Sciences, 

Psychology, Regional Economic and 

Social Development, Sociology, 

English, Computer Science 

• College of Engineering 

• Environmental Management Services 

Program 

• Graduate School of Education 

• Office of Admissions 

• Office of Residential Life 

• School of Health and Environment 

• Student Financial Services Center 

• Student Activities and Multicultural 

Affairs 


Our community partners this year included: 

• African Assistance Center 

• Boys and Girls Club Greater Lowell 

• Brew’d Awakening Coffeehaus 

• Cambodian Mutual Assistance 

Association 

• The Career Center Lowell 

• Casey Family Services 

• Clean Water Action 

• Coalition for a Better Acre 

• Community Software Lab 

• Community Teamwork Inc. 

• Cultural Organization of Lowell, 

COOL 

• Fair Housing Center of Greater 

Boston 

• Family Service, Inc. 

• International Institute 

• Keep Lowell Beautiful 

• Lao Family Mutual Association 

• Lawrence Department of Planning 

and Development 

• Lowell Adult Education 

• Lowell Division of Planning and 

Development 

• Lowell Health Department 

• Lowell High School 

• Lowell Housing Authority 

• Lowell National Historic Park 

• Lowell Police Department 

• Lowell School Department 

• Lowell Telecommunications Corp. 

• Mambo Grille 

• Massachusetts Alliance of 

Portuguese Speakers 

• Merrimack Valley Housing 

Partnership 

• Merrimack Valley Project 

• Middlesex Community College 

• National Park Service 

• Northeast Assn of Realtors 

• North East Builders Assn 

• Parent Information Center 

• The Revolving Museum 

• United Teen Equality Center 


127

• Lowell Canalcleaners 

• Lowell Community Health Center 

• Lowell Community Technology 

Consortium 

• Visiting Nurses Assoc. 

12. Proposals Submitted/Awarded 2005/2006 

Proposals Submitted/Awarded/Pending 

Awarded 

• Massachusetts Campus Compact “Building Our Partnerships with Lawrence, MA” 

• Committee for Industrial Theory and Assessment “Summer Research Project” 

• City of Lowell “Lowell Schools Health Curriculum Evaluation” 

• National Park Service Lowell Initiative 

• Department of Heath and Human Services “Fostering Healthy Marriages” with 

Family Service Inc. 

• National Park Service “An Ethnographic Study of Lowell, MA: Immigration, 

Globalization and Enterprise in the ‘All-American City’” with Robert Forrant and 

Christoph Strobel 

• Massachusetts Campus Compact “College Access Fellow Grant” with Joyce Gibson 

Pending 

• National Science Foundation “The Science of Small Things” 

• US Housing and Urban Development “Healthy Homes” 

• Nellie Mae Educational Foundation “Project Compass” with Joyce Gibson 

• Ford Foundation “Collaboration between RESD and Janaagraha Centre for 

Citizenship and Democracy” with RESD faculty 

• Centers for Disease Control and Prevention “REACH US CEED Evaluation and 

Training” with Lowell Community Health Center 

• Centers for Disease Control and Prevention “REACH US Action Community 

Evaluation” with Lowell Community Health Center 

• Campus Community Partnerships for Health “Host Site” with UMass Boston and 

Worcester 


128

2007 Conference Announcement 

Community-University Partnerships: 

How Do We Achieve the Promise? 


April 26 – April 28 , 2007 

Around the world, universities are developing community partnership to advance their 

research, teaching, and outreach goals. Among other goals, these partnerships address 

problems of health disparities, sustainable job creation, and equitable development. 

Universities are expanding their classrooms through partnerships in which students and 

faculty learn from and with those who can create new knowledge. Such collaborations 

shorten the time between the development of innovations and their application. The phrase 

“the engaged institution” is increasingly being used to describe universities that 

purposefully seek out interdisciplinary research and more integrated forms of knowledge 

generation and dissemination. 

We invite community partners and faculty, staff, administrators and students from U.S. 

and foreign universities to submit abstracts for an international “Achieving the Promise” 

conference in Lowell, Massachusetts in April, 2007. 

Conference goals are to: 

1. Highlight the successes and discuss the barriers that community-university 

partnerships face. 

2. Understand the needs, and challenges of different kinds of partnerships, 

including those that focus locally, regionally, nationally, or internationally. 

3. Understand the needs and challenges of involving different types of partners, 

including nongovernmental organizations, schools, labor unions, businesses, 

immigrant populations, faith-based organizations, and local, state, and 

national government. 

4. Identify strategies for evaluating the impact of partnerships on university 

and partner objectives such as regional economic and social development. 

5. Identify the strategies being used to build sustainable partnerships. 

6. Identify strategies for involving diverse disciplines and diverse communities 

into partnerships. 

7. Identify strategies for integrating research, teaching and outreach into 

partnerships. 

8. Identify strategies by which faculty partners are able to meet tenure and 

promotion requirements through community-university partnerships. 


129

We invite one page abstracts on the above topics. Abstracts are due by September 30, 

2006. Acceptance information will be available by October 31, 2006. If accepted, your 

paper is due February 1, 2007 for posting on the conference website. Video presentations 

and poster sessions are welcome. 

Papers accepted for the conference will be considered for inclusion in an edited volume that 

is to be produced after the conference. Edited books resulting from previous conferences 

include Inside and Out: Universities and Education for Sustainable Development (Baywood, 

2006),Globalization, Universities and Issues of Sustainable Human Development (Edward 

Elgar, 2002), and Approaches to Sustainable Development: The Public University in Regional 

Economic Development (UMass Press, 2001). 

For more information, contact CITA Co-Chairs Robert Forrant 

(rforrant@external.umass.edu) or Linda Silka (Linda_Silka@uml.edu). For information 

on CITA: http://www.uml.edu/com/CITA/. 


130

12. CENTER FOR FIELD SERVICES AND STUDIES 

Annual Report 

2006-2007 

1. Mission Statement of Center 

The mission of the Center for Field Services and Studies is to assist public elementary 

and secondary schools in the improvement of teaching and learning. A critical 

component of this assistance is brokering of University resources, staff and facilities, 

on behalf of schools. During its twenty-three years of service to schools in the 

region, the Center has established relationships of mutual respect and trust with more 

than twenty school districts in the northeast region of Massachusetts. The Center 

takes a proactive stance in collaboration with these districts, helping schools clarify 

issues and develop solutions to persistent concerns, as well as identifying promising 

practices and resources for educators. 


The Center for Field Services and Studies (CFSS), now in its twenty-third year of 

operation, serves public elementary and secondary schools in the northeast region of 

Massachusetts, and increasingly throughout the state. The Center, an initiative within 

the University of Massachusetts Lowell, Graduate School of Education, reflects the 

University’s commitment to excellence in public education. A direct outgrowth of the 

Lowell Model for Educational Excellence, a comprehensive study of a local public 

school system, the Center was formed in 1984 to improve PreK-12 education in local 

elementary and secondary schools and to create and foster viable educational 

partnerships among university faculty, professional groups, community agencies and 

the private sector to respond to the needs of public schools. Our strategic goals are: 

a. To assist elementary and secondary schools in the improvement of PreK-12 

education 

b. To broker resources from the university, community agencies and the private 

sector on behalf of public schools 

c. To enhance local school district capacity to assess educational needs, identify 

appropriate responses, access resources, implement change, and incorporate 

successful programs into regular operation of the schools 

d. To provide school leaders and teachers with information and training based on 

best research and practice in education 

e. To build advocacy and marshal support for public education in community, 

parent and business groups 

Center for Field Services and Studies 

131


Current research topics include: 

• School/college/industry partnerships 

• School leadership development 

• Small Schools 

• Professional development in history, science, math, technology and engineering 

• Student support programs for college preparation 

• Distance learning 

• K-16 education 

• Technology applications for teaching and learning 


Center Director: 

Judith Boccia 

Associated University Faculty: 

Dean Bergeron, College of Arts and Sciences, Professor Emeritus 

Charles Christensen, Graduate School of Education, Visiting Assistant 

Professor 

Michaela Colombo, Graduate School of Education, Assistant Professor 

Patricia Fontaine, Graduate School of Education, Visiting Assistant 


John Hodgman, Howard Foley Professor of Workforce Development, 

School of Engineering 

Jill Lohmeier, Graduate School of Education, Assistant Professor 

James Nehring, Graduate School of Education, Assistant Professor 

Vera Ossen, Director of Educator Licensure 

Regina Panasuk, Graduate School of Education, Professor 

Melissa Pennell, College of Arts and Sciences, Professor 

Donald Pierson, Graduate School of Education, Dean 

Michelle Scribner-MacLean, Graduate School of Education, Visiting 

Assistant Professor 

Mitch Shuldman, Media Services, Director 

CFSS Staff: 

Andrew Alfano, Systems Analyst, Instructional Network 

Cynthia Bent, Assistant Director College Prep 

Marjorie Dennis, Project Manager 

Robin Hall, New Horizons Program Coordinator 

Michael Lucas, Coordinator of the Instructional Network 

Nancy Pitkin, Coordinator Partnership Projects 

William Suppa, Systems Analyst, Instructional Network 


132

David Tennyson, Video Technician, Instructional Network 

Hector Torres, Director of College Prep and Lawrence Outreach 

John Wren, Technology Support Specialist 

5. New Associated Faculty and Staff 

6. Students Supported 

Lisa Abdallah, School of Health and Environment, Assistant Professor 

Carol Barry, College of Engineering, Professor 

Kavitha Chandra, College of Engineering, Professor 

Fred Martin, Computer Science, Assistant Professor 

Allyssa McCabe, College of Arts and Sciences, Professor 

Li Xu, Computer Science, Assistant Professor 

Graduate Students: 

Mari Beth Bennett, Research Assistant, Bartlett Literacy Study 

Undergraduate Students: 

Nefertiti Borders, Student Assistant 

Joseph Mullaney, Student Assistant, Distance Learning 

Lauren Sicard, Student Assistant, College Prep 

7. Current Research and Regional/Local Outreach Projects 

Lowell Public Schools Collaborative 

The Center has a long history of collaboration with the Lowell Public Schools. Targeted 

collaboration with the Murkland Elementary School, Stoklosa Middle School, Bartlett 

Community Partnership School, and Lowell High School includes provision of tutoring, 

student teachers, enrichment programs, and other resources to these downtown 

neighborhood Lowell schools. At the Bartlett Community Partnership School, five week 

extended day enrichment programs were offered to the students in grades 5-8 two times 

during the school year. UMass Lowell faculty, staff, graduate and undergraduate students 

developed and ran workshops, such as topics in Digital Photography, Exercise/Athletics, 

Cricket Science, and Nanotechnology. 

Bartlett Partnership School Literacy Study, Allyssa McCabe (Psychology) and Judith 

Boccia (Education). This project was funded initially by CFCI Collaborative Grants, and 

currently by the Parker Foundation. The project aims to improve the literacy-related oral 

language skills of eighty (80) 4-year-old children enrolled in a Lowell Public School 

preschool by providing individual or small-group experiences run by trained volunteer 

students from UMass Lowell. Children are tested in fall and spring to determine their 

progress. Scores from intervention children are compared to those of the comparison 

school. First year results are extremely encouraging in support of this intervention for 


133

preschool children. It demonstrates that it is possible to increase the vocabulary, 

narrative, and other oral language abilities of at-risk preschoolers so that they will enter 

kindergarten with a reasonable chance of acquiring literacy and achieving educational 

success rather than starting from behind and falling into the spiral of failure. Aggressive 

fundraising efforts are now underway to expand this project to another school and sustain 

it in the Bartlett. 

Instructional Network 

The Instructional Network offers University of Massachusetts Lowell programming to 

Lowell High School via an infrastructure which utilizes microwave, satellite, broadband, 

and fiber optic transmission methods. An investment in interactive video equipment has 

created a state-of-the-art distance-learning environment in 12 electronic classrooms on 

the University campuses. The Instructional Network also maintains streaming video and 

classroom lecture capture services throughout the UML campus. Additionally, the 

Instructional Network coordinates all videoconferences, teleconferences and satellite 

downlink programming for all departments within the campus and for our outreach 

partners. 

HAWKi is a dynamic messaging system managed by the UML Instructional 

Network which provides timely information via LCD displays located throughout the 

university campus. Each display contains general university content on the left hand 

portion of the screen and local departmental or college information on the right side. The 

content is added to the displays via an easy to use web interface and is updated by each 

college or department. Currently 20 displays are located on both North and South 

campuses and include the following colleges and departments: Management, Health and 

Work Environment, Arts & Sciences, Education, Continuing Education, Student Services, 

Recreation Center, and Centers for Learning, and Engineering. 

The Apreso Classroom Capture systems, located in Ball Hall 214, Weed Lecture Hall 1 

and Weed Lecture Hall 3 allows course lectures to be captured and archived for review 

and playback. Each recorded session captures the presenters video and audio, computer 

images including PowerPoint and whiteboarding, and the digital graphics camera and 

combines these sources into an integrated, indexed web page. Users can choose to view 

the entire presentation, or navigate through the session to a desired point via a 

thumbnailed table of contents. All of the content is stored on the Instructional Network's 

Riverhawk Video Server. 

College Prep 

The College Prep Program is a partnership between the University of Massachusetts 

Lowell and Lawrence Public Schools District to provide academic instruction and 

enrichment programs for 170 Lawrence middle and high school students. In its twentysecond 

year, the program brings together high achievers and at-risk youth, native English 

speakers and English language learners. Almost all of the students who participated in 


134

the program during the 2006-2007 academic year come from economically disadvantaged 

families and have not thought seriously about the possibility of continuing on to higher 

education. The College Prep Program concentrates on developing participants' academic 

confidence and competence so that post-secondary school admission is a reality for 

Lawrence High School students. For the 2007/2008 school year, eight College Prep 

students will matriculate at UML. 

New Horizons 

This twenty year old student support and college preparatory program is funded by 

UMass Lowell and federal Ronald McNair funds through the state’s Massachusetts 

Educational Opportunity Program. Housed at Lowell High School, New Horizons 

provides daily academic support services to 100 underrepresented, economically 

disadvantaged, first generation college-bound high school students. The program is 

designed to ensure successful transition from high school to college. In recent years, 97 

% of the senior students enrolled in this program gain admission to two and four colleges 

and universities. For the 2007/2008 school year, eight New Horizon students will 

matriculate at UML and three will join the Connections Program. 

Northeast Network STEM Pipeline Fund Project 

The Northeast Network STEM (Science, Technology, Engineering and Mathematics) 

Pipeline Fund Project is a collaboration of higher education institutions, PreK-12 

schools and school districts, workforce development groups and private industry in the 

northeast region of the state committed to addressing the challenge of teacher and student 

knowledge and skill in STEM subjects and the shortage of young people choosing careers 

in STEM fields. The University of Massachusetts Lowell, Graduate School of Education 

is the lead partner in the consortium which was awarded $238,000 in 2004, and $322,000 

in 2007, from the Massachusetts Board of Higher Education for the development and 

implementation of the STEM fellows program. Seven school districts and one charter 

school have nominated 43 middle school teachers to be STEM fellows and six continuing 

districts have chosen 15 middle and high school teachers to be STEM leaders. Each 

fellow fulfills 30 hours of individual professional development in STEM disciplines, four 

full day STEM fellow workshops and 20 hours of district team time. Each district group 

works together to produce a capstone plan focused on the needs of the individual district. 

They are supported in this effort by STEM leaders, former STEM fellows who are trained 

to be peer coaches, and will assist the new fellows in their planning. STEM leaders also 

work to implement capstone plans in their own districts. 

Pipeline Fund Steering Committee 

This group of 25 educators, industry leaders and workforce development specialists from 

the Northeast region of the state was convened by CFSS (Center for Field Services and 

Studies) to plan and oversee a regional network in support of science, technology, 

engineering and math (STEM) initiatives in P-12 schools. The group’s efficacy was 


135

demonstrated in a successful proposal to renew STEM funding in the region for the 2007- 

2009 academic period. Quarterly meetings of the committee assess the existing project 

and plan for the next phase of the network and the STEM fellows’ project. 

WIKI Citi 

A grant from the Commonwealth Information Technology Initiative supported training of 

19 high school STEM teachers in use of Web 2.0 technologies to provide career 

information to students in their classes. Teachers worked with Computer Science faculty 

member Li Xu to develop wikis and will implement them in their classes in Fall 2007. 

The Superintendents’ Forum 

The Superintendents’ Forum is a ten year old program of bi-monthly meetings hosted by 

CFSS for area superintendents to share ideas and concerns on topics of interest to school 

leaders. Convened by a sitting school superintendent, the Forum offers district leaders a 

chance to tap into UML resources, as well as receive briefings on matters of importance 

to them. 


Boccia, J. Characteristics of successful local blended programs in the context of the 

Sloan-C Pillars (2007), With J. Moloney, C. Hickey, A. Bergin, K. Polley and J. 

Riley. Journal of Asynchronous Learning Networks 11 (1): pp. 29-47. 


Colombo, M., Boccia, J., Laboy, WT., Nehring, J, and Torres, HT. (April, 2007). The 

Lawrence Public Schools Transformation Project: Cultivating University and 

School District Partnerships. Presentation to CITA International Conference, 

Lowell, MA. 

Colombo, M. & Nehring, J. (2006, November). The Urban School Transformation 

Project Study (Lawrence High School and the University of Massachusetts 

Lowell), Presentation to the Association of Latino Administrators (ALAS)), 

Austin, TX. 

Cruz, D. D. &Torres, H. N., (November 2006) Developing Instructional Leaders 

Through the Leadership in Educational Advancement Program, Presentation to 

the Association of Latino Administrators (ALAS), Austin, TX. 

10. Collaboration with Other Centers/Institutes/Departments 


136

The Center’s primary work in the university is linking university faculty and facilities to 

public schools. In this role, we build collaborations with all colleges and support crosscampus 

initiatives, such as TEAMS Academy, STEM outreach work to schools, 

American history projects, and other programs that may be developed. In addition, the 

Instructional Network supports many departments and centers seeking technology 

support for distance learning, video streaming, and digitizing media for instruction. 

Continuing Education, Bioinformatics, the inter-campus Marine Science program, and 

Media Services were active users of IN services in 2006-2007. 

Among the major partnership projects CFSS has forged in the past year are: 

Lawrence Small Schools Initiative 

CFSS facilitates a partnership between Lawrence Public Schools educators and 

university faculty and staff in support of the new Lawrence High School thematic 

curriculum. Currently 45 university faculty and staff from across campus work with 

teams of Lawrence High School educators to design the academic programs at the six 

small schools. In 2007-2008, the University will have a designated room in the new high 

school to provide admissions counseling, dual enrollment courses, and professional 

development for teachers. 

Teaching American History 

The collaborative group of six school districts, a charter school, ten university faculty, 

and eight cultural organizations that developed this million dollar grant to the Andover 

Public Schools was convened and facilitated by CFSS. We will provide operational 

support to the project over the next three years. 

National Science Foundation GK-12 Fellows Proposal 

A group of university faculty asked CFSS to identify and recruit urban school districts to 

partner in a five year, $3,000,000 proposal to NSF. We brought together leaders of the 

Lowell and Lawrence School Districts with faculty and helped develop a proposal of 

mutual benefit to both sides. Funding decision to be announced in January 2008. 

Lowell Public School Collaborative and Wider Horizons 

Wider Horizons brings Irish teachers in training to Lowell to learn about working with 

diverse cultures in school settings. CFSS, in collaboration with the Center for Family 

Work and Community, provides leadership and team building experiences for the visiting 

teachers in preparation for their work in Lowell summer schools. 


137

12. Proposals Awarded/Submitted 2006/2007 

CFCI Collaborative Grant, Bartlett Literacy Study $25,000 

CFCI Annual Innovation Enhancement Grant $6,129 

College Prep/Young Scholars Program 

$175,000.00 

(District Grant Lawrence Public Schools) 

Greater Lawrence Technical High School 

(Leadership Development Program) 

$15,000 

Wider Horizons $1,485 

Board of Higher Education, McNair Funding for New Horizons $59,000 

Board of Higher Education, Northeast Network STEM Pipeline Fund $322,000 

Wiki - Commonwealth Information Technology Initiative(CITI) $30,000 

Teaching American History U.S. Dept of Education; subcontract $317,273 

NSF GK-12 Proposal, with Electrical Engineering and Computer Science $ 3,000,000 

pending 

Theodore Edson Parker Foundation, Support for Bartlett Literary Study 

Sovereign Bank, Support for Bartlett Literacy Study 

Mailman Foundation, Support for Bartlett Literacy Study 

$10,000 

pending 

pending 


138

13. CENTER FOR GREEN CHEMISTRY 

ANNUAL REPORT 

JULY 2006 – JUNE 2007 

CENTER FOR GREEN CHEMISTRY MISSION STATEMENT 

The UML Center for Green Chemistry serves to focus activities across the University 

that are engaged in the synthesis and design of materials and products that reduce or 

eliminate the use and/or generation of hazardous materials. The UML CGC promotes 

cross-disciplinary collaborations across various centers and colleges through research, 

teaching and community outreach. The center provides a meeting ground for groups 

within academia, industry and government to work together for creation and 

dissemination of the principles and practice of Green Chemistry. 

CENTER FOR GREEN CHEMISTRY GOALS AND OBJECTIVES 

The current goals of the Center for Green Chemistry can be divided into three 

categories: Research, Education and Outreach. 

Research: We aim to have a minimum of $500K [direct, plus $265K overhead] of 

sponsored project support per year by the end of 2007. Our hope is to have our funding 

sources be split 60% from industry and 40% by government. It is our aim to publish a 

minimum of 15 papers in peer reviewed journals per year. 

Center for Greem Chemistry 

139

Education: We feel that we need a critical mass of 20 fully funded, active, full time 

researchers working to have an appropriate. We aim therefore to have 5 full time 

teaching/research faculty, 16 doctoral students, and 4 postdoctoral students active in the 

center by 2007. 

Outreach: We hope to maintain an active core of undergraduate researchers at the 

center. Our goal is to have 15 undergraduate researchers working part time to full time in 

the lab by 2007. We also plan to become integrated more into the university community, 

the Lowell community and the state communities by performing outreach service and 

workshops. We hope to sponsor and do a minimum of 25 such events per year and 

engage a minimum of 1000 individuals per year. 

RESEARCH FOCUS AREAS 

RESEARCH OVERVIEW 

For a technology to be considered green chemistry it must accomplish three things. It 

must be more environmentally benign than the alternatives. It must also be more 

economically viable than the alternatives. Finally, it must outperform the alternatives. A 

technology that is missing any of these three will not be successful in the marketplace, 

and a technology that is not put into practice does not accomplish the goals of pollution 

prevention. 

With this in mind, the research at the Center for Green Chemistry primarily focuses 

on finding solutions. Whether it is the pursuit of a new material with a particular 

application in mind, the modification of a current synthetic pathway to make it more 

environmentally benign or the evaluation of how a new or improved technology might be 

applied to other situations, all of our research has an end in mind. Even our most 

“esoteric” and “analytical” research will improve either our own technologies or the 

technology of another with the expectation that society will benefit in some direct, 

measurable way. 

In this respect, each of our research focus areas contains two overlapping 

components: research geared toward understanding and improving our own technologies 

and the application of our technologies to solve real world problems. 

NONCOVALENT DERIVATIVIZATION OVERVIEW 

Noncovalent Derivatization, NCD, bridges the intellectual space between molecular 

synthesis and nanotechnology. Noncovalent derivatization focuses on the role of 

intermolecular forces (hydrogen bonding, pi-stacking, van der Waals interactions and 

electrostatics) in the construction of multi-molecular structures in the solid and other 

condensed states. By understanding a set of molecules "inherent" tendencies one can 

design, manipulate and synthesize materials under more environmentally benign 

conditions. Environmentally benign conditions are generally considered to be ambient 


140

conditions like room temperature and atmospheric pressure and without solvents. 

Some of the applications of noncovalent derivatization we are investigating are: drug 

delivery technologies, thin film coating technologies, industrial synthetic processes, water 

purification technologies and electro-optical materials. 

METAL OXIDE OVERVIEW 

By mimicking the process of mineralization that occurs in bones and seashells under 

ambient conditions, a novel low energy process for the construction of titanium dioxide 

films has been developed. These processes avoid harsh reagents and can be used in the 

construction of metal oxide semiconductors. The applications we are currently 

investigating include: water purification systems, industrial oxidation catalysis, solar 

energy devices and self-cleaning pigments. 

BIOINSPIRED PHOTOPOLYMERS OVERVIEW 

Thymine in DNA, under harsh UV irradiation from the sun, undergoes a 

photoreaction that leads to mutagenesis and other cytotoxic processes that can lead to the 

formation of cancer cells. When thymine is incorporated into synthetic polymers, this 

same photoreaction enables a platform of novel environmentally benign photoresist 

material. Water soluble systems have been developed that operate with high efficiency 

using nontoxic materials and conditions. A few of the applications currently being 

investigated are: agriculture and pharmaceutical controlled release, printed circuit and 

wire board technologies, organic conductive polymer systems, hair and fabric curl and 

color controlling technologies, surface coatings for buildings and environmental sensors. 

ALTERNATIVE PROCESSES OVERVIEW 

Some classical reactions are not being used for industrial applications due to associated 

hazards to workers or the environment, technical difficulties or energy requirements. 

Redesigning these reactions using safer reagents and/or auxiliaries, novel catalysts or 

modern techniques such as microwave synthesis is an important part of the Center for 

Green Chemistry's research mission. Some of the processes currently under investigation 

include: designing a catalytic Wittig reaction, replacing aluminum chloride in the 

Friedel-Crafts Reaction, evaluating alternative blowing agents for expandable 

polystyrene and the removal of color from waste water with hydrogen peroxide and 

a catalyst. 

ASSOCIATED PERSONNEL AND FACULTY 

At this time the only faculty fully dedicated full time to the center is Professor John 

Warner, who is a Professor of the departments of Plastics Engineering and Community 

Health & Sustainability. Professor Warner’s research grants support two full-time 

research professors, Sofia Trakhtenberg & Roger Boggs, and a post-doc, Kei Saito. 

Other faculty who have been supportive and helpful include Jayant Kumar from the 


141

Physics and Applied Physics department, Stephen McCarthy of the Plastics 

Engineering Department, Daniel Sandman from the Chemistry Department, Robert 

Nicolosi from Laboratory and Clinical Sciences, Ken Geiser from Work Environment 

and Carl Lawton from Chemical Engineering. 

In August 2005 we brought on board John Pyers as a full time administrative 

assistant. And in the spring of 2006 three full time faculty positions were filled that will 

be starting Fall 2006. 

STUDENTS SUPPORTED BY THE CENTER 

PHD GRADUATE STUDENTS: 

Taylor Balin [2008] Majdi Haddad [PhD 2008] 

Jason Bianchini [2008] Laura Ingalls [2009] 

Benjamín Bowers [2008] Abby Johnson [2008] 

Timothy Cain [2008] Ted Mendum [2008] 

Vineet Dua [2008] Reshma Pal [2007] 

Kevin Dye [2009] Justin Whitfied [2007] 

Rami El-Hayek [2007] Cecelia Kiarie [2007] 

MASTERS STUDENTS: 

Dipak Goyal 

Sivashankari Alagvsundaram 

Gayatri Munshi 

UNDERGRADUATE STUDENTS: 

Kristen Sebasky [2007] 

Megan Sebasky [2007] 

Timothy Connelly [2005] 

Ryan Giantassio [2003-] 

Joshua Pezet [2003-] 

Catherine Yu [2004-2005] 

HIGH SCHOOL SUMMER INTERNS: 

Juliana Estrada [2006] Kanika Pheng [2006] 

Sarann Kong [2007] Johana Jimenez-Ruiz [2006] 

Ramya Kumar [2007] Savin Thor [2007] 

Linh Lu [2006] Toan Tran [2006] 

Emmanuelle Paiva [2007] 

CURRENT RESEARCH PROJECTS 


142

NONCOVALENT DERIVATIZATION 

Traditional covalent derivatization alters the properties of a molecule by altering its structure, 

adding components to or removing components from a molecule. Changing a molecule in this manner 

requires the making and breaking of chemical bonds which is often an energy intensive and toxic 

process that results in additional waste and undesired by-products. 

The rational design of binary organic solids, or noncovalent derivatization (NCD), 

holds the potential to provide a vast array of new materials with tunable physical and 

chemical properties without the generation of waste, the use of toxics and the 

consumption of energy. The general strategy of noncovalent derivatization is to 

manipulate the physical behaviour of a molecule by trapping it into a nano-crystalline 

lattice. Noncovalent derivatization utilizes intermolecular forces (hydrogen bonding, pistacking, 

van der Waals interactions and electrostatics) in order to form ordered cocrystals. 

Their physical properties can be altered simply by the selection of appropriate 

starting materials rather than by the covalent modification of one or more molecules. 

Real-Time Analysis, Characterization & Structure-Activity Relationships 

Noncovalent derivatization poses a unique set of challenges in the area of analytical 

quantification. Since the changes within the system do not depend on changes to the 

actual molecules involved it is difficult to analyze the purity of a noncovalently 

derivatized cocrystal by standard methods. High performance liquid chromatography and 

nuclear magnetic resonance spectroscopy can help determine relative abundance of each 

constituent of a cocrystal system, but can not determine the difference between a mixture 

of the two components and a true non-covalently derivatized system which would have a 

well defined and consistent structure. Differential scanning calorimetry may be used, 

though the apparatus for such determinations is non-standard in most laboratories. 

Benjamin Bowers’ research is addressing this issue by correlating x-ray 

crystallographic data with infrared spectroscopic analysis of cocrystals consisting of 

different terephthalamides and hydroquinone. Mr. Bowers makes his cocrystals in either 

a ball-mill grinder or an amalgamator. Both of these methods physically grind and mix 

the two or more starting materials. During the solid state grind of terephthalamides with 

hydroquinone the carbonyl group of the terephthalamide forms a hydrogen bond with the 

alcohol group on the hydroquinone, forming the finished product, the noncovalent 

derivative. Mr. Bowers has demonstrated a correlation specifically between the degree of 

the carbonyl shift determined by solid state infrared spectroscopy and the physical 

properties determined by x-ray crystallography like bond length and inter-atomic 

distances. Solid state infrared spectroscopy can be used to determine not only how the 

carbonyl peak shifts when the hydrogen bonds form, but also the relative abundance of 

noncovalently derivatized (incorporated into the cocrystal product) versus “free” 

terephthalamide. 

Thus solid state infrared spectroscopy can be used to quickly and easily measure how 

close to completion a physical grind of the component molecules is. This allows us to 

identify and halt a reaction that has gone to completion, thus refraining from wasting 

energy on unnecessary grinding. Consequently, this analysis also determines if the 


143

physical grind has resulted in a homogeneous cocrystal product. Since the grinding 

process of noncovalent derivatization is a solid state process there is no waste from the 

use of hazardous solvents. The ease with which the infrared analysis can be performed 

allows for much quicker real time analysis of the reaction. 

Benjamin Bowers, along with Abby Johnson and Majdi Haddad is also investigating 

properties of cocrystals, such as solubility, and correlating cocrystal structure with 

behavior, known as the structure-activity relationship. We are establishing a set of 

structure-activity relationships that allow us to match up the geometric-interatomic 

parameters of a co-crystal with its physical properties. 

Mr. Bowers is investigating the contribution of each intermolecular force to the 

overall stability of the noncovalent derivative. One method is by generating “disruptions” 

in hydrogen bond patterns to create hydrogen bond “defects”. These “defects” can then 

serve to trigger a transition between equilibrium states. He has discovered that ternary 

systems of hydroquinone, benzoquinone and various bis[N,N-dialkyl]terephthalamides 

display metastable properties in solution. Sonication of these systems destabilizes and 

causes them to ultimately dissociate at varying rates. Ben's research analyzes how various 

alkyl groups on the terephthalamides affect the stability of the noncovalent derivative and 

the effect of the ratio of individual components on the dynamic behavior of the overall 

system. 

Abby Johnson’s research project in the field of noncovalent derivatization has been to 

study the differences in the solubility of cocrystals using high performance liquid 

chromatography. The molecules of study are the Warner Group’s model system of 

terephthalamides cocrystallized with hydroquinone. A series of terephthalamides were 

synthesized with differing lengths of alkyl chains: methyl, ethyl, propyl, butyl, and 5-7 

membered rings. Each of these molecules was then cocrystallized with hydroquinone. For 

each cocrystal, a saturated solution was prepared using water as a solvent. High 

performance liquid chromatography is being used to examine structure-activity 

relationships of the cocrystals by analyzing the difference in the amount of hydroquinone 

present in each saturated solution. In one study, the solubility of these molecular 

complexes in both water and a water/ethanol mixture was investigated by Abby via 

reverse-phase liquid chromatography. This method of analysis results in a wide variety of 

complexes without long and complicated individual synthetic schemes and applies 

several principles of Green Chemistry by using less solvent and requiring less energy 

input. 

Similarly, Majdi Haddad has been working on profiling the dissolution kinetics of 

another class of terephthalamide crystals to compare their individual dissolution rates 

with each other and to those of our standard terephthalamide hydroquinone cocrystal 

systems. Using laser diffractometry particle sizing, Mr. Haddad found that 

terephthalamides cocrystallized with hydroquinone have a higher solubility than the 

terephthalamide crystals alone. These findings are a perfect example of the use of 

noncovalent instead of covalent derivatization to alter specific physical properties, which 


144

means fewer synthesis steps. 

These studies are particularly important because of their implications in medicinal 

chemistry. Solubility of potential drug candidates in biological systems is important to 

the pharmaceutical industry because it relates to drug bioavailability and absorption in the 

body as well as unabsorbed pharmaceuticals in the waste stream that eventually may 

contaminate the environment. One of the goals in pharmaceutical science is to control 

these considerations and minimize potential waste. Crystal engineering is a prospective 

new way to synthesize and manufacture drug products and control the release of active 

ingredients. It also has several benefits over conventional methods of drug delivery 

including reduced solvent and energy use. 

Selected Applied Research 

One of the applications of noncovalent derivatization that is currently under 

investigation is its use in the pharmaceutical industry. Another of Abby Johnson's 

research projects explores the structure activity relationships that correlate intermolecular 

distances and angles within a crystal packing matrix to dissolution kinetics. This research 

demonstrates that by constructing binary and ternary self assembled systems, one can 

specifically tailor the solubility and release profile of an active compound. Thus 

noncovalently derived systems can be used to control the physical properties of a 

pharmaceutical's active ingredient. The use of noncovalently derived systems to 

manipulate a material’s bioavailability complies with the principles of green chemistry by 

minimizing the total amount of energy required to create the pharmacutical as well as 

significantly reducing the use and generation of auxiliary materials in the manufacturing 

process. 

Another application of noncovalent derivatization under investigation seeks to 

improve upon the often used Diels-Alder reaction. Mr. Justin Whitfield is testing this 

concept by cocrystallizing a Diels-Alder diene and dienophile. The expectation is that in 

some instances the cocrystal structure may facilitate the overlapping of the HOMO and 

LUMO of the reactants in the solid-state, thus coaxing the reaction to fruition by merely 

heating the cocrystal. This type of chemistry can be used to create Diels-Alder 

cycloadducts without using solvents or the high energies required by a traditional Diels- 

Alder synthesis. 

AMBIENT CONDITION SEMICONDUCTOR FILMS 

Applications of titanium dioxide (TiO2) films include dye-sensitized solar cells, lightemitting 

devices, self-cleaning surfaces, photocatalysts and water purification systems. 

The preparation of nanostructured TiO2 films generally requires high temperatures (in 

excess of 450C) and harsh conditions. This places serious limitations on the choice of 

substrate and manufacturing conditions. A low-temperature processing alternative for 

nanostructured films has been developed by the researchers at the Center for Green 

Chemistry. When considering these processes in relationship to the principles of green 


145

chemistry, it is often found that energy use and requirements can have significant 

environmental and economic implications. We have found that the use of certain 

nontoxic aromatic carboxylic acids can allow for significantly lower temperature 

processing. There are a number of methods for preparing TiO2 nanostructured films, 

including the sol-gel process and via a solid-grind of pre-formed TiO2. Both methods 

have been investigated by Dr. Amy Cannon, reported in the literature and have resulted in 

a patent. 

Building on this success, Mr. Vineet Dua and Dr. Sofia Trakhtenberg's research 

investigates the design of dye-sensitized solar cells on alternative substrates. At present 

the working solar cells on alternative substrates are constructed. The future goal is to 

improve their efficiency using different electrolyte system and determine the effect of 

various TiO2 dispersions on current and voltage of these samples. 

Mr. Tim Cain is also addressing the challenge of efficacy of dye-sensitized solar 

cells. The dyes commonly used in this type of cell only utilize a small window of the total 

energy spectrum available from the sun. Recent advances in light-harvesting dendrite 

technology address this issue by the incorporation of several chromophores that absorb a 

wide range of energy and subsequently transmit that energy to a central core. 

More than ever it is apparent that renewable sources of energy are needed if the world 

populace continues its current pattern of growth and consumption of energy. Solar energy 

is one of the most attractive, yet under-exploited, alternatives available today. The goal of 

Mr. Cain’s research is to develop innovative techniques for increasing the use of solar 

energy in environmentally friendly ways. Our hypothesis is that building on our current 

solar cell technology by using light-harvesting dendrimers for use as a panchromatic dye 

sensitizer for titanium dioxide solar cells is an economically viable way to accomplish 

this goal. Dendritic light-harvesting complexes can absorb a large spectrum of solar 

energy and enable efficient energy transfer between the chromophores in the dendrimer. 

The chromophores will be self-assembled into the dendrimer macromolecule via 

noncovalent interactions. Construction of a light-harvesting complex in this manner 

should require a low energy input for large-scale production and minimize the use of 

toxic chemicals. Near term applications include not only their use in solar cells but also 

have potential applications in enhancing photochemical degradation, hydrogen 

production for fuel cells and water treatment processes. 

Ted Mendum’s Environmental Protection Agency funded research leverages 

emerging oxidative and adsorptive technologies to ameliorate exposure to arsenic 

contaminated water supplies in rural communities worldwide. His investigation of using a 

titanium dioxide photocatalyst, prepared by a novel low-temperature method and newly 

available ultraviolet light emitting diodes hopes to bring arsenic levels in drinking water 

below the World Health Organization recommended level of 0.01 mg/l. preliminary 

research has demonstrated the stability of the catalytic coatings, the effectiveness of the 

arsenic oxide sink and has begun to characterize the overall effectiveness of an 

engineered prototype on proxy contaminants. 


146

BIOINSPIRED PHOTOPOLYMERS 

Photoreactive polymers have become increasingly interesting due to the possibility of 

their application as photoresists. Commercially available photoresists often contain 

potentially toxic monomers such as acrylates. They are coated from solution in organic 

solvents such as 1-methoxy-2-propyl acetate and are developed with organic solvents or 

strong bases, all of which pose both health and environmental issues. The ideal approach, 

from a green chemical perspective, is a one-component photoresist system which is 

completely water-processable. Using bioinspired mechanisms, we are creating 

environmentally benign alternatives to traditional materials. 

Bioinspiration 

In biological systems, when thymine is irradiated with short ultraviolet light it 

undergoes a dimerization reaction where it couples with a neighboring thymine in the 

DNA chain through a 2pi + 2pi cycloaddition reaction. This reaction causes a kink in the 

helical structure of DNA, which renders it nonviable, leading to mutations and other 

carcinogenic events. We have taken advantage of this photodimerization reaction by 

incorporating thymine into synthetic polymers. 

These materials function as water-soluble, crosslinkable photoresists. An advantage 

of these thymine-based polymers is that they do not undergo insolubilization through a 

polymerization reaction. These water soluble, non-toxic polymers are already 

polymerized. This photoreaction initiates a cross-linking mechanism, where neighboring 

strands are "tied" together. 

There are many opportunities to exploit this technology. We have been able to "tune" 

the photoreactivity of these polymers to precisely control the reaction extent and 

sensitivity. We have synthesized systems with sensitivities as low as 150 micro 

joules/cm2. We have been able to extend the range of light wavelengths that cross-link 

our polymer system from 250nm through 650nm by spectral sensitization. One of the 

advantages of this technology is the ability to convert a polymer with inferior physical 

properties (e.g. tensile strength, film formation, etc.) into a more robust and controllable 

material. This is especially important within various families of biodegradable materials. 

In addition to pursuing the environmentally benign creation of a new material, as 

conscientious scientists we must pursue the environmentally benign degradation of our 

new material. It must not persist in the envirionment and it cannot degrade into harmfull 

or bioaccumulative pieces. We have found that the enzyme DNA Photolyase can be used 

to reverse this photoreaction. Using this enzyme, materials that have undergone prior 

photocrosslinking can be reverted to their non-crosslinked state, either through site 

specific application or within bulk processing. This offers a truly recyclable material. 

Applications include electronics industry photoresists, delivery systems and various 

immobilized supports. 


147

Understanding Mechanisms & Constant and Never-ending Improvement 

One of the main goals of conducting any research is to push the frontiers of 

knowledge. With this in mind, several research projects focus on gaining a better 

understanding of how and why our polymer system works and what we can do to 

improve upon it. Some of these research projects analyze particular steps of our 

polymerization processes or our monomer synthesis and look for ways to optimize our 

current methods. Other projects seek alternatives that are even more environmentally 

benign and more efficient or atom economical than our current methods. Typically a 

scientist does this by first understanding what all the variables are in a given reaction and 

then by holding everything constant except for one single variable -which is slightly 

changed in each of a succession of experiments. Several of our research students and 

summer interns are doing exactly that. 

Ramya Kumar is investigating the effect of pH of solution (amount of added acid or 

base) on photocrosslinking efficiency of bioinspired thymine-based resist. In general the 

pH of the solution is expected to have an effect on polymer (in this case, polyelectrolyte) 

geometry as well as on the degree of dissociation of the ionizable pendant groups, while 

the photocrosslinking efficiency depends on intermolecular interactions between the 

polymer chains. This study will allow us to further optimize the efficiency of the 

synthesis of our environmentally benign fully water-processable polymers and 

photoresist material. 

Another research project that is geared toward improving our method of coating our 

environmentally benign polymers and photoresists is being investigated by Savin Thor. 

She seeks to understand the effect of ionic strength of solution (amount of added salt) on 

photocrosslinking efficiency of bioinspired thymine-based polymers. In general, the ionic 

strength of the solution has an effect on polymer geometry. Since the photocrosslinking 

efficiency depends on intermolecular interactions between the polymer chains, their 

geometry or orientation in three dimensions is important. This study hopes to correlate 

the ionic strength of solution with optimal photocrosslinking geometry. 

The quantum efficiency of thymine functionalized photopolymers is also being 

investigated. The photosensitivity of aqueous soluble thymine bearing modified 

polystyrene polymers is being investigated by Cecilia Kiarie. These environmentally 

benign polymers are immobilized on non-reactive substrates following low doses of ultra 

violet light irradiation which induces dimerization of the thymine moiety. The resulting 

immobilized polymer films were evaluated using ultra-violet-visible spectroscopy, 

Fourier-transform infra-red spectroscopy and atomic force microscopy. The effects of 

irradiation dose, molecular weight and co-monomer ratio on photosensitivity of the 

polymer have been studied. Spectroscopic data from this study supports a proposed crosslinking 

mechanism and is being verified. 

In related research, Vineet Dua and Dr. Trakhtenberg are optimizing the coating and 

irradiation conditions for photoresist polymers by utilizing various compositions and 

molecular weights. Mr. Dua is also currently optimizing spin coatings of thymine based 


148

polymers of vinylbenzyl thymine and VPS (Vinylphenyl sulfonate) on various non 

reactive substrates like glass, PET and quartz. These films are then studied with the help 

of ultraviolet and infrared spectroscopy and Atomic Force Microscopy. 

The goal of another study was to determine whether the presence of ultra-violet light 

absorbing dye additives would interfere with the photocrosslinking process used to 

immobilize our environmentally benign polymers. The effect of dye additives on 

photodimerization of thymine based polymers was conducted by Tim Cain, Catherine Yu 

and Sofia Trakhtenberg. The short wavelength ultra-violet light induced 

photocrosslinking of vinylbenzylthymine (VBT) based photoresist polymers was 

investigated in a polymer-dye water soluble system. It was found that the photoreactivity 

of the VBT polymer was not hindered significantly even when the amount of dye additive 

was comparable to the amount of thymine. Further, adding dyes to the photoresist 

allowed obtaining good quality images in one step. This study may provide a basis for 

testing VBT containing polymers for use in controlled release applications. 

In collaboration with Center for Advanced Materials at UMASS Lowell, Sofia 

Trakhtenberg has demonstrated that the vinyl benzyl thymine containing photoresist 

surface can be used as template for enzymatic surface patterning with conductive 

polyaniline which may have further implications for environmentally benign electronics 

manufacturing. 

Taylor Balin’s research also focuses on photoresist coatings, but with substituted 

vinyl benzyl thymine monomers. She is investigating their photocrosslinking properties, 

specifically how the position of substituted groups affects their interactions. 

In another project Ms. Balin is investigating alternatives to surfactants containing 

perfluoro octanyl sulfonates, a class of compounds recently recognized as toxic, 

bioaccumulative and environmentally persistent. The task is to develop a surfactant that 

not only improves upon coating uniformity, but does not interfere with the processes that 

define the photoresist system, which would result in defects. 

Selected Related Research and Applications 

Laura Ingalls is investigating a thymine based system of water soluble 

phototripolymers. Tripolymers of vinylbenzylthymine, vinylbenzyltriethylammonium 

chloride and N-butyl-N,N-dimethyl-(4-vinylbenzyl)ammonium chloride with differing 

monomer ratios have been prepared. Laura has demonstrated that some properties of this 

system can be controlled by manipulating the monomer ratio. These tripolymers are 

water soluble and like our other polymer systems, undergo a 2p + 2p photodimerization 

reaction of thymine when irradiated with low levels of ultraviolet light. This new system 

shows promise as an alternative water soluble photoresist. Ms. Ingalls’ research is 

providing useful data for the development of applications of photoresist polymers that 

have adjustable hydrophobic properties. Presently Ms. Ingalls and Jason Bianchini are 

looking at compression molding the polymers and testing their physical properties. 


149

The technology behind the bioinspired photopolymers is being expanded in another 

way. Dr. Kei Saito is applying our proven technology to core-bound polymer nano 

micelles that are synthesized with amphiphilic block copolymers. By designing selfassembly 

mechanisms based on reversible hydrogen bonding and irreversible 

photocrosslinking, we have been able to control the stability, size and other properties of 

such micellular systems. A series of thymine functionalized amphiphilic block 

copolymers of vinylbenzylthymine and vinylphenylsufonate were synthesized by 2,2- 

tetramethylpiperidin-1-oxyl (TEMPO)mediated living radical polymerization in 

water/ethylene glycol solution. Block copolymer micelles formed in aqueous 

solution. The micelle characterization and the critical micelle concentration measurement 

demonstrate that the thymine functionalized amphiphilic block copolymers can form 

stability enhanced self-assembling micelles based on hydrogen bonding of the attached 

thymines. The stability can be further controlled by core-photocrosslinking of the 

attached thymines. This technology provides a novel approach of designing stable and 

controllable nano micelles based on the principles of green chemistry. 

In a related research project, Laura Ingalls is synthesizing 1-(2’-chloroethyl)thymine. 

The goal of this project is to collaborate with Dr. Watterson’s research group, who are 

focusing on a series of polymers capable of forming micelles suitable for drug-delivery 

purposes. It is our belief that incorporating thymine residues into these polymers and thus 

introducing the possibility of crosslinking will increase the stability of these micelles (just 

as in Dr. Saito’s micelles above), resulting in a better performing drug delivery system. 

Bioinspired Polymers: Built with the End in Mind 

The tenth principle of the "Twelve Principles of Green Chemistry" states that 

"chemical products should be designed so that at the end of their function they do not 

persist in the environment and break down into innocuous degradation products." Perhaps 

the greatest benefit and advantage that our polymers have over other polymer systems is 

that we are fulfilling the requirements of this principle. Whereas most plastics can not be 

decomposed into any useful components, our bioinspired polymers can be decomposed 

into their original water soluble, pre-crosslinked starting materials using the enzyme 

DNA Photolyase. Mr. Justin Whitfield's research project is focusing on the large scale 

fermentation and purification of DNA photolyase from thermophilic bacteria for large 

scale testing. This enzyme has proved viable after months of storage under only normal 

refrigeration and works excellent at ambient and elevated temperatures. 

To further enhance the degradability of our polymer system, Ms. Laura Ingalls is 

investigating the replacement of styrene in our polymer backbone. One of the problems 

with using styrene backbones in our polymers is that it is not biodegradable beyond the 

pre-crosslinked state. By polymerizing thymine with adipoyl chloride or diisocyanates 


150

into the backbone of the polymer, we can create a 

polymer that allows us to utilize the photodimerization properties of thymine at the same 

time having it incorparated into a biodegradable backbone. The ester linkage within the 

backbone of the polymer present points in which specific bacteria and enzymes are able 

break the polymer and degrade it naturally. 

ALTERNATIVE PROCESSES 

Some classical reactions are not being used for industrial applications due to associated 

hazards, technical difficulties or energy requirements. Redesigning these reactions using safer 

reagents and/or auxiliaries, novel catalysts or modern techniques such as microwave 

synthesis is an important part of the Center for Green Chemistry at the University of 

Massachusetts Lowell’s mission. 

In addition to working on bioinspired polymers, Jason Bianchini is investigating 

replacements for aluminum chloride and hydrogen fluoride with a greener bismuth salt 

catalyst for Friedel-Crafts acylation. Hydrogen fluoride poses a threat to worker safety as a 

highly toxic and dangerous reagent. Friedel-Crafts acylation using aluminum chloride as a 

Lewis acid requires stoichiometric amounts of reagent, necessitates a large aqueous solvation 

at the conclusion of the reaction to dissolve and remove the resultant aluminum salts which 

creates a voluminous acidic waste stream that produces hydrogen chloride gas and presents a 

considerable worker safety issue. Bismuth is the least toxic of the heavy metals, is 

commercially available at a low cost and is easy to handle in many salt forms. For these 

reasons, bismuth presents itself as a potential green reagent upon comparison with 

aluminum chloride or hydrogen fluoride. 

The optimization and greening of pericyclic reactions, which are naturally atom 

economical, are being investigated by Reshma Pal. In her project, arylnitrile oxides are 

used as dipoles to do 1,3-dipolar cycloaddition (pericyclic reaction) with styrene and 

Narylcinnamamides. Arylnitrile oxides are among the most reactive dipoles. It is 

generated by dehydrochlorinating oximoyl chloride with a base, such as triethylamine. 

Oximoyl chlorides are prepared from the reaction of substituted benzaldoximes with n- 

chlorosuccinimide. The benzaldoximes are synthesized from their corresponding 

benzaldehyde and hydroxylamine. N-arylcinnamamides are prepared from their 

corresponding acid chlorides and aniline derivatives. The reactions are carried out 

solventless in the presence of silica and alumina. Conventional synthetic routes are 

compared to microwave heating. 

The Wittig reaction is an attractive synthetic tool in making olefins because of the 

good yields and the unambiguous position of the double bond. From the green chemistry 

perspective, Wittig reactions are not atom economical. The Wittig reaction generates 1 

equivalent of triphenylphosphine oxide per equivalent of double bond formed, such that 

the atom economy gets worse as the carbonyl group gets smaller. If the 

triphenylphosphine can be generated from triphenlyphosphine oxide then catalytic cycle 

can be formed for Wittig reaction. Ms. Pal’s project seeks to design an experiment to 

convert triphenylphosphine oxide to triphenylphosphine and possibly use it to make the 

cycle catalytic such that less than stoichiometric amount of triphenylphosphine is needed 

to form the double bond. 


151

In another alternative processes research project JustinWhitfield is investigating 

alternative blowing agents for polystyrene expansion. Pentane is the most common 

blowing agent in use by this industry sector today. The initial phase of this research was 

completed using a non-ideal blowing agent, hexane (a Hazardous Air Pollutant or HAP) 

as the model. This permitted experimental conditions to be established and optimized, as 

well as important parameters to be identified. Further investigation is needed to optimize 

the selection of the key parameters as determined by their effect on the resultant quality 

of the expanded bead produced, as well as the quantity of blowing agent required, in 

order to achieve desirable results. Discussions with an industry representative resulted in 

sufficient interest and encouragement for the continuation of this effort. In addition, this 

representative made raw material stock available for research. This next phase of research 

could result in useful information that could assist with the optimization of key process 

variables, resulting in reduced emissions from these facilities. The ultimate goal which 

could not be achieved during this early stage of research is to find an environmentally 

and commercially acceptable replacement for the pentane currently used in the process. 

In collaboration with Terry Collins from Carnegie Mellon University Kevin Dye is 

helping design, build and test a delivery system to remove color from effluents of textile 

and paper mills. The process involves the use of hydrogen peroxide activated with a 

patented catalyst developed at the Institute for Green Oxidation Chemistry at CMU. The 

catalyst is known by its trademarked name TAML, which is an acronym for tetraamido 

macrocyclic ligand. It is claimed that the TAML group of activators which are 

synthesized from the biochemical elements, C, H, N, O and Fe are non-toxic and can be 

customized for selective oxidation of various chemicals through the iron-oxo reactive 

intermediates. 

Formaldehyde is a toxic chemical extensively used in industrial applications. 

Products that are made from or contain formaldehyde include many resins, permanent 

press fabric treatments, lawn fertilizers, cosmetics and disinfectants. Wood adhesives 

used to make plywood, particleboard and other manufactured wood products are the 

dominant end use for this chemical. The plastics industry also uses formaldehyde-based 

resins extensively. Formaldehyde is also used as a sterilant and tissue preservative. It is 

used to preserve animal specimens used in secondary school and college biology classes. 

It is also used to preserve human and animal tissue in medical and scientific laboratory 

settings. Embalmers use formaldehyde to preserve human remains for burial. Kevin Dye, 

in collaboration with the Toxics Use Reduction Institute is assessing the use of 

environmentally benign photopolymers as an alternative to the use of formaldehyde 

based textile finishing agents. 

RESEARCH AND OUTREACH: THE INSEPPARABLE PAIR 

The fundamental research behind many of these projects has lent itself nicely to 

creating environmentally benign and non-hazardous mini experiments that can be 

reproduced by children as young as elementary school age and elevated to a level suitable 

for high school and college students. In one such experiment students make a coating on 


152

plastic film that changes color simply by shining light on it, and then watch the color 

disappear when heat is applied. Students also harvest light from the sun by constructing 

solar energy devices using blackberries, and construct photoresists using PET and food 

coloring dyes. 

In fact, outreach has even lead to new research. For instance, some of the food-color 

messiness associated with the photoresist experiment prompted undergraduate research 

assistant Katherine Yu to ask “is there some way we can incorporate the dye earlier in the 

polymerization process so that the kids don’t color themselves?” As a result, she and Dr. 

Trakhtenberg tested the effect of dye additives on the thymine photocrosslinking in the 

polymers. This altered process allows for one-step surface patterning and may have 

implications for possible photolithographic applications and also as a model of other 

processes involving controlled release of various materials trapped in polymer matrices. 

Ten years of teaching and researching in the University of Massachusetts system has 

brought Warner to the White House as a recipient of the Presidential Award for 

Excellence in Science, Math and Engineering Mentoring. Professor Warner is known for 

his ability to excite and motivate students, but he humbly deflects credit for students’ 

enthusiasm to the ideas and principles behind Green Chemistry. Students have called it 

“chemistry without guilt,” and many cite the potential to change the world as a reason for 

pursuing it. Yet there is no question in anyone’s mind that it is Warner’s own brilliance, 

attitude and excitement that engages, encompasses and encourages new students to 

pursue careers in science. 

PUBLICATIONS 

93. “Incentives for Using Green Chemistry and the Presentation of an Approach for 

Green Chemical Design” Anastas, Nicholas D.; Warner, John C. In “Green Chemistry 

Metrics” Ed. by Lapkin, A.; Constable, D. Blackwell xxx 2007. 

92. Trakhtenberg, Sofia; Kumar, Ramya; Bianchini, Jason; Thor, Savin; Martino, 

Deborah; Warner, John C. J. Macr. Sci. 2007, In Press. 

91. "The Effect of pH on the Viscosity of Titanium Dioxide Aqueous Dispersions 

with Dicarboxylic Acids", Johnson ; Abby M., Trakhtenberg , Sofia; Cannon, Amy S.; 

Warner, John C. J. Phys. Chem. 2007, 111 8139-8146. 

90. “Entropic Control of Processes and Materials” Trakhtenberg, Sofia; Warner, John 

C. Chem. Reviews 2007, 107(6) 2174-2182. 

89. “Core-bound Polymeric Micellar System Based on Photocrosslinking of 

Thymine” Saito, Kei; Ingalls, Laura; Lee, Jun; Warner, John C. Chem. Commun. 2007 

2503-2505. 

88. “Thymine Based Water Soluble Phototripolymers: Their Preparation and 


153

Synthesis” Bianchini, Jason R.; Saito, Kei; Balin, Taylor B.; Dua, Vineet; Warner, 

John 

C. J. Polymer Sci., Part A: Polymer Chem. 2007 45, 1296-1303. 

87. "Non-Catalytic Photoinduced Immobilization Processes in Polymer Films" 

Trakhtenberg, S.; Cannon, A. S.; Warner, J. C. in "Thin Films and Nanostructures: Physico- 

Chemical Phenomena in Thin Films and at Solid Surfaces" Ed. by L.I. Trakhtenberg, S.H. 

Lin and O.J. Ilegbusi, Elsevier 2007 34, 665-695. 

86. “The Effects of Irradiation Dose and of Photopolymer Composition on the 

Dissolution of Entrapped Dyes” Kiarie, Cecilia; Jimenez-Ruiz, Johana; Pheng, Kanika; 

Trakhtenberg, Sofia; Warner, John C. J. Macr. Sci. 2006 43(12), 1965-1974. 

85. “Entropic Control in Green Chemistry and Materials Design” Warner, John C. 

2006 Pure and Appl. Chem. 2006 78(11), 2035-2041. 

84. “Bacteriostatic Polymer Film Immobilization” El-Hayek, Rami; Warner, John C. 

J. Bio. Mat. Res. 2006 79A(4), 874-881. 

83. “Green Chemistry and Sustainable Materials Design” Warner, John C. Society of 

Cosmetic Chemists Annual Scientific Seminar Proceedings, Boston, MA 2006, 44-45 

82. “Water Soluble Photocrosslinking Materials in Cosmetics” Cannon, Amy S.; 

Warner, John C.; Saito, Kei; Trakhtenberg, Sofia; Whitfield, Justin. Society of Cosmetic 

Chemists Annual Scientific Seminar Proceedings, Boston, MA 2006, 46-47. 

81. “Inducing and controlling the stability of amphiphilic coplolymer micelles having 

pendant thymine” Saito, Kei; Warner, John C. PCT Appl. Serial No.60/839,852 

December 22, 2006 

80. “Core-bound nano micelles based on hydrogen bonding and photocrosslinking of 

thymine.” Saito, Kei; Ingalls, Laura; Warner, John C. Polymer Preprints 2006, 47, 829 

830. 

79. "Effect of Dye Additives on Photodimerization of Thymine Pendant Groups in 

Water-Soluble Photoresist Polymers" Yu, Catherine; Trakhtenberg, Sofia; Cain, Timothy 

E.; Warner, John C. Journal of Polymers and the Environment. 2006 14(2), 131-134. 

78. “Unintended Consequences” Warner, John C. Chem. Eng. News, 2006, 28, 5. 

CONFERENCE PRESENTATIONS 

1 “Core-bound polymer nano micelles based on hydrogen bonding and 

photocrosslinking of thymine” Ingalls, Laura R.; Saito, Kei; Warner, John C. 10th Annual 

Green Chemistry & Engineering Conference, Washington D.C., June 26-30, 2006. 

2 “DNA Photolyase for the Enzymatic Degradation of Bioinspired Photopolymers.” 

Whitfield, Justin R.; Ingalls, Laura R.; Warner, John C. 10th Annual Green Chemistry 


154

&Engineering Conference, Washington D.C., June 26-30, 2006. 

3 “Non-Covalent Forces in Dendrimer-Structured Dye-Sensitized Solar Cells” Cain, 

Timothy; Boggs, Roger; Warner, John C. 10th Annual Green Chemistry & Engineering 

Conference, Washington D.C., June 26-30, 2006. 

4 “Entropic Control in Meta-Stable Noncovalent Derivatives” Bowers, Benjamin; 

Dahl, Ankan; Boggs, Roger; Warner, John C. 10th Annual Green Chemistry & 

Engineering Conference, Washington D.C., June 26-30, 2006. 

5 "Green Chemistry and the Competitive Edge ," Warner, John C. Great Lakes ACS 

Regional Meeting on Industrial Applications of Green Chemistry, Milwaukee, WI, May 

31 -June 2, 2006. 

6 "Noncovalent Derivatization in Pharmaceutical Dissolution Control" Johnson, 

Abby; Warner, John C. Great Lakes ACS Regional Meeting on Industrial Applications of 

Green Chemistry, Milwaukee, WI, May 31 -June 2, 2006. 

7 “Bioinspired Materials for Commercial Applications” Cannon, Amy; 

Trakhtenberg, Sofia; Warner, John C., New England Green Chemistry Consortium 

Annual Meeting, Orono, ME, May 31, 2006. 

8 "Green Chemistry and the Cosmetics Industry" Warner, John C. Society of 

Cosmetic Chemists Annual Scientific Seminar, Boston, MA, May 12, 2006. 

9 "Green Chemistry and Engineering Nanotechnologies" Warner, John C. 

International Nanotechnology & Forestry Products Conference, Atlanta, GA, April 26, 

2006. 

10 "Green Chemistry: Doing Nanotechnology Right the First Time" Warner, John 

C., Nanotoxicology Conference, Boston, MA, April 24-25, 2006. 

11 "Emerging Chemicals and Materials Policies and Practices" Cannon, Amy; 

Boggs, Roger; Warner, John C. TUR Planners Continuing Education Conference, 

Worcester, MA, April 5th, 2006. 

12. “Synthesis of thymine-functionalized nano core-crosslinked micelles by 

poly(vinylbenzylthymine)-b-poly(styrene sulfonic acid sodium salt)” Saito, Kei; Warner, 

John C. 231st ACS National Meeting, Atlanta, GA, March 26-30, 2006 IEC 

268. 

12 Chemical Management Forum, Las Vegas, NV, February 28, 2006. 

13 “Green Chemistry and Entropic Control in Materials Design” Warner, John C. 

IUPAC Second International Symposium on Green/Sustainable Chemistry, Delhi, India, 

January 10-13, 2006. 

14 “Bioinspired Nanotechnology,” Warner, John C., International Society of 

Forestry Industries Conference, Pretoria, South Africa; December 12, 2005. 

15 “Synthesis of Thymine Functionalized Core Crosslinked Micelles of 

Poly(vinylbenzylthymine)-b-poly(styrene sulfonic acid sodium salt). ” Saito, Kei; 

Warner, John C. Sukant Tripathy Annual Memorial Symposium, Lowell, MA, December 

2, 2005. 

16 “Isolation of Thermus thermophilus DNA Photolyase for the Enzymatic 

Degradation of Bioinspired Photopolymers” Whitfield, Justin R.; Ingalls, Laura; Warner, 

John C. Sukant Tripathy Annual Memorial Symposium, Lowell, MA, December 2, 2005. 

17 “Infrared Spectroscopy Utilized to Analyze Terephthalamide: Hydroquinone 

Cocrystals. ” Bowers, Benjamin; Trakhtenberg, Sofia; Warner, John C. Sukant Tripathy 


155

18 Annual Memorial Symposium, Lowell, MA, December 2, 2005. 

19 “Solubility Studies of Molecular Complexes,” Johnson, Abby; Warner, John C. 

Bridgewater State College Undergraduate Environmental Research Symposium, 

Bridgewater, MA, November 12 th , 2005. 

20 "Green Chemistry" Warner, John C. 2005 NEWMOA & EPA Northeast 

Environmental Summit: Promoting Environmental Responsibility, Providence, RI, 

September 28-29th, 2005. 

21 “Photoreversible polymerization of thymine functionalized monomers based on 

noncovalent interaction,” Kiarie, Cecilia; Saito, Kei; Warner, John C. 230 th ACS National 

Meeting, Washington, D.C., August 28 – September 1, 2005. “Core-bound nano micelles 

based on hydrogen bonding and photocrosslinking of thymine,” Ingalls, Laura; Saito, 

Kei; Warner, John C. 230 th ACS National Meeting, Washington, D.C., August 28 – 

September 1, 2005. 

DEPARTMENT & CENTER COLLABORATIONS 

UMASS Boston, UMASS Amherst, UMASS Dartmouth, Boston University, 

Simmons College, Bradford College, Bridgewater State, Gordon College, Salem State, 

Wentworth and Worchester Polytechnic Institute. Advanced Electronics Technology 

Center 


Center for Health and Disease Research Committee of Federated Centers and 

Institutes Institute for Nano Science and Engineering Technolgy Institute for Plastics 

Innovation Lowell Center for Sustainable Production Massachusetts Bioprocess 

Development Center Toxics Use Reduction Institute Tsongas Industrial History 

Center 

INDUSTRIAL COLLABORA TIONS 

Above Board Technologies, Blue Ridge Paper, ChemMotif, Dolphin Software, 

Foster-Miller, Genzyme, Microfluidics Inc., Pfizer, Procter and Gamble, Rohm and Haas, 

Sappi Fine Papers N.A., Seldon Laboratories, Tiaxx L.L.C. 

STATE & FEDERAL GOVERNMENT COLLABORATIONS 

LANL, US Environmental Protection Agency, EPA Cincinnati Office, US 

Department of Energy, Massachusetts Executive Office of Environmental Affairs Office 


156

of Technical Assistance, Massachusetts Department of Environmental Protection, 

National Science Foundation, National Institutes of Health. 

REGIONAL & LOCAL OUTREACH 

The Center for Green Chemistry is dedicated to the education and encouragement of 

the next generations of scientists. This year saw a large expansion of our outreach 

programs to all of our target groups: K-12, Community, Higher Education, the UMass 

Lowell Community, Educators, Government and Industry. 

EMPHASIS ON OUTREACH 

As an adjunct to its research and teaching mission, the Center for Green Chemistry 

has an active outreach program, premised on the idea that a fundamental understanding of 

chemistry is an emerging requirement for all members of society. All students at the 

Center are expected to be able to communicate their research objectives clearly to the 

non-scientific community. Staff and graduate students within the Center for Green 

Chemistry have developed a suite of educational resources, including curriculum 

materials and hands-on experiments that illustrate the practice of green chemistry, and 

they frequently present these materials in secondary school classrooms. In addition, the 

Center hosts visits by school and community groups and provides summer programs for 

Lowell’s inner city youth. 

The Center for Green Chemistry ran an active outreach program over the 2006-2007 

school year, interacting with over 1300 K-12 students. The outreach activities included 

hands-on experiments such as the construction of solar energy devices using titanium 

dioxide and blackberries as the dye. This experiment, developed by Dr. John Warner in 

2002 (ref: Warner, John C. “Construction of Solar Energy Devices with Natural Dyes” in 

Greener Approaches to Undergraduate Chemistry Experiments, American Chemical 

Society, 2002, p. 42-44), has had tremendous success in exciting K-12 students and 

teaching them about the methods of green chemistry. The success of this experiment is 

reflected in the adoption of this experiment as a standard outreach activity by other 

faculty at the University, including Dr. Sanjeev Manohar of Chemical Engineering. The 

various other outreach activities include the preparation of a non-toxic aqueous 

photoresist and the development of a UV light indicator; both experiments were 

developed by research within the Warner Research Group. 

The Center for Green Chemistry’s approach has also been extended to larger 

audiences over the last year. In particular, the Center has held major events at the Boston 

Museum of Science, the Revolving Museum in Lowell for Earth Day, and participated in 

Lecture Series targeting communities in and around Lowell. Each of these events has 

allowed us to reach out to hundreds of students, their parents and their teachers. 


157

The Center’s staff has also been called upon by the Massachusetts Executive Office 

for Environmental Affairs to support the agency’s Office for Technology Assistance in 

addressing educational goals in the area of environmental awareness. 

K-12 OUTREACH EVENTS: 1800 STUDENTS REACHED IN TEN 

MONTHS 

Cleveland Elementary School, Norwood, MA – 6/8/2007 

On our visit to Cleveland Elementary, over 200 fifth graders learned the basic 

concepts behind Green Chemistry. Within an hour forty solar cells were being 

constructed by the young students using benign materials -“the whitener in powdered 

donuts, blackberries, a number 2 pencil, and that orange stuff your Mom puts on your 

cuts.” 

Lowell Community Charter Public School, Lowell, MA – 6/5/2007 

Construction of environmentally benign photoresists with a focus on renewable and 

sustainable materials design was the order our first day at Lowell Community Charter 

Public School in Lowell, MA. Over 200 eighth grade students took part over four 

separate class periods in the activities, with mentoring and supervision provided by six 

members of the Center for Green Chemistry. 

Waldorf High School, Lexington, MA – 5/10/2007 

Justin Whitfield led this outreach event presented to twenty high school students 

considering higher education in the sciences. He started off with "An Introduction to 

Green Chemistry," a 45 minute window into the world of Green Chemistry and some of 

the research going on at UMass Lowell to Waldorf High School's Science Club. The 

event was organized by biology teacher Mr. Dan Raizen, who is also the director of the 

Science Club. The club has been involved in many of their own Outreach activities, as 

well as setting up the school's first paper recycling program. 

Jackson Street School, Lowell, MA – 5/3/2007 

On our day at the Jackson Street School, 6 graduate students from the Center for 

Green Chemistry introduced another 100 third graders to Green Chemistry. The kids had 

time to make their own solar cells out of environmentally benign materials and coated 

their own photoresists. 

Burbank Middle School, Lancaster, MA – 3/9/2007 


158

Construction of environmentally benign solar cells with a focus on renewable and 

sustainable materials design was the order our second day at Burbanck Middle School in 

Lancaster, MA. Over 100 eighth grade students took part over four separate class periods 

in the activities, with mentoring and supervision provided by eight members of the Center 

for Green Chemistry. 

Atkinson School, North Andover, MA – 2/13/2007 

The Center for Green Chemistry was invited to teach special Green Chemistry 

modules to just over 30 fifth graders at Atkinson School in Bedford Massachusetts. The 

invitation was at the behest of the Parent Teacher Organization. 

Wakefield Middle School, Wakefield, MA – 1/8/2007 


sustainable materials design was the order our first day at Wakefield Middle School in 

Wakefield, MA. Over 40 eighth grade students took part over two separate class periods 

in the activities, with mentoring and supervision provided by three members of the Center 

for Green Chemistry. 

Parker Middle School, Reading, MA – 12/19/2006 

On our first day at the Parker Middle School, 6 graduate students from the Center for 

Green Chemistry introduced another 100 third graders to Green Chemistry. The kids had 

time to make their own solar cells out of environmentally benign materials and coated 

their own photoresists. 

Pollard School, Plaistow, NH – 11/20/2006 

The Pollard School welcomed us to introduce 25 elementary school students to Green 

Chemistry. The students made solar cells, environmentally benign photoresists and 

coated PET film with color changing light sensitive molecules. 

Madison Park High School, Roxbury, MA – 10/24/2006 


sustainable materials design was the order our first day at Madison Park High School in 

Roxbury, MA. Over 150 eleventh grade students took part over this full day of activities, 

with mentoring and supervision provided by eight members of the Center for Green 

Chemistry. 


159

Read Across America – 3/3/2007 

AFTER SCHOOL & SPECIAL 

PROGRAMS FOR K-12 STUDENTS 

In honor of Dr. Suess' birthday, members of the Center for Green Chemistry joined 

with local news celebrities, law enforcementment officers and political figures to 

participate in the “Read Across America” program at Jackson Street School in Lowell, 

MA. Students listened intently as volunteers read aloud some children's literature 

classics, as well as some lesser known gems they might have been less familiar with to 

broaden their horizons. 

Charter School, Lowell MA 12/5/2006 

Roughly 100 2nd graders learned about the planets of our solar system from the 

“astronauts” of UMass Lowell. While Taylor Balin, Jason Bianchini and Justin Whitfield 

had to convince the students that they were not in fact astronauts, their enthusiasm did not 

wane. Using a computer multimedia presentation along with an activity that cast 10 lucky 

volunteers as the 9 planets and the sun, the presenters illustrated the basics of the solar 

system and inspired numerous additional inquiries from the students during the 45 minute 

session. What are shooting stars? Is there life on other planets? How big is the Universe? 

While some of these questions have answers, the realization that there are still many 

things to learn was the inspirational theme. Hopefully that group of 100 2nd graders now 

includes future astronomers, engineers and even astronauts. 

EXTENDED SUMMER PROGRAMS FOR HIGH SCHOOL STUDENTS [TEN 

STUDENTS] 

American Chemical Society Project SEED & Seldon Fund Fellowship 7/2/2006 – 

8/26/2006, 4 long-term students 

We welcomed four students from Lowell High School to the Center for Green 

Chemistry for eight weeks for a summer internship during the summer of 2006. 

This summer four students from Lowell High School have been selected to do 

chemical research at the Center for Green Chemistry. Ramya Kumar, Emmanuelle Paiva, 

Sarann Kong and Savin Thor worked under the direction of Professor John Warner and 

will investigate the phase behavior of binary organic solids. 

The American Chemical Society's (ACS) Project SEED summer program 

provides funding for each student to participate in summer research at an academic, 

government or industrial laboratory. The Center for Green Chemistry is matching the 

ACS' contributions with its Seldon Fund which is named after Harry Seldon, a character 

in Isaac Asimov's Foundation series of novels. The Seldon Fund depends solely on 

donations and supports the Center for Green Chemistry's mission to increase public 

awareness and interest in chemistry and encourage the next generations of students. 


160

Likewise, an important feature of the Project SEED program is its emphasis on 

career development and its motivation of students to pursue higher education in the 

natural sciences. 

Professor Warner has served as a mentor for Project SEED students for the past 

two years. Although the American Chemical Society provides no monetary compensation 

for the researchers who work with SEED students, John Warner feels the program is 

worth the extra effort. "We need a new generation of chemists with new ideas and ideals 

to solve society's problems," stated Warner. The students were nominated to do research 

with the Center for Green Chemistry and Project SEED by their Lowell High chemistry 

teachers. 

David Turcotte, project manager at the Center for Family, Work and Community helped 

to coordinate the student application and selection process. 

“This is an excellent opportunity for students in the summer of their junior year of 

High School, to gain direct experience in live research. Since the students are doing ‘real 

work’ it’s a nice addition to my research team.” says mentor Ben Bower, a graduate 

student in the Green Chemistry program at UMASS Lowell. “I was suitably impressed 

with the focus and attention to detail of the students I am mentoring this summer. This 

program has also given me a chance to extend our research.” says Rand mentor, Sofia 

Trakhtenberg. 

The student teams are pursuing projects in two major technologies of the Center for 

Green Chemistry – photopolymers and crystal engineering. One team is studying 

“Cationic and Anionic Thymine Photopolymers.” In this work, the students work with 

polymers which are engineered to form solid coatings when exposed to ultraviolet 

radiation. The students develop skills in setting up controlled experiments, handling 

laboratory equipment, and using analytic instruments such as Ultraviolet Visible 

Spectroscopy. They will summarize their work using numerical analysis software and 

present their findings at summer’s end. 

The second team is studying the “Phase Behavior of Binary Organic Solids.” An 

emerging arena of research is “designer materials” and employing solid state synthesis of 

materials. This field is also known as Crystal Engineering. In contrast to the classic 

crystal work, which is based on inorganic materials, Crystal Engineering is based on 

organic molecules which result in much more complex patterns. In order to detect the 

formation of a new material, based on a combination of two different organic molecules, 

the students are constructing phase diagrams using Differential Scanning Calorimetry, 

and Fourier Transform Infrared Spectroscopy. Final characterization of the X-Ray 

Crystal Structure of these new materials will be confirmed through a partnership with 

Bruce Foxman, of Brandeis University. 

The ACS SEED program, now in its 36th year, has placed more than 7,500 high 

school students in research labs for 8–10 weeks each summer. The program was the 2001 


161

Winner of the Presidential Awards for Excellence in Science, Mathematics, and 

Engineering Mentoring. 

Professor Warner, a 2005 winner of the Presidential Awards for Excellence in 

Science, Mathematics, and Engineering Mentoring, chose to use the awarded funds to 

leverage the 2005 ACS SEED program in order to double the number of students 

sponsored. In its second year, the Seldon Fund has served this task. “I am pleased to be 

able to offer this opportunity on behalf of the Center for Green Chemistry and UMASS 

Lowell’s School of Health and the Environment and College of Engineering. Its at the 

heart of our outreach mission in engaging the local community, fostering early career 

development in the sciences, and conducting work in the service of sustainability.” 

WORKSHOPS FOR EDUCATORS: 

ADDRESSING SCIENCE EDUCATION IN K-12 [10 EDUCATORS] 

One of the core problems we are trying to address at the public school K-12 level is 

that teachers, science teachers especially, are overworked, underpaid and not given the 

support materials or the information that they need to maintain the students’ interest. 

Current outreach efforts are being expanded to include the development of green 

chemistry modules that could be integrated into area high school or even into middle 

school curriculum. To accomplish this, we are soliciting the input of the K-12 teachers 

and following the MCAS guidelines. We have already begun developing and hosting 

workshops during which a group of interested teachers come onto campus during the 

summer to learn the experiments. Together we will be able to develop the curriculum 

around which they can teach these concepts in their classroom. These types of workshops 

can be targeted at any level of education, from elementary schools up to two-year 

colleges. 

In addition to creating new and interesting science modules that motivate and 

encourage K-12 students to enjoy while they learn, the Center for Green Chemistry also 

holds and participates in outreach geared for educators. At these events we introduce K- 

12 teachers to the principles of Green Chemistry and then perform the same experiments 

with them that we normally perform with K-12 kids. This gives the teachers an 

opportunity to experience our outreach program first-hand. It demonstrates how easy it is 

to explain Green Chemistry to young kids and how beneficial and straight-forward the 

experiments are. Our “Teach the Teachers” events have resulted in several new K-12 

outreach opportunities. More importantly it has resulted in K-12 teachers spending a day 

or two at our research facilities learning how to prepare the experiments and present them 

to their own students. 

Science, Technology, And Engineering For A Sustainable Planet -8/2007 

The Center for Green Chemistry conducted a workshop for area school teachers on a 

“Green Chemistry Component to Educating for a Sustainable Society.” The workshop 


162

was conducted as part of the Science, Technology, and Engineering for a Sustainable 

Planet program of the Massachusetts Department of Education Content Institute. This 

program was hosted at the Tsongas Industrial History Center, a partnership of the Lowell 

National Historical Park and the University Of Massachusetts Lowell Graduate School 

Of Education. Teachers participated via the Greater Lawrence Educational Collaborative 

and the Dracut & Lowell school systems. 

New England Groundwater Institute Program – 7/2007 

The Center for Green Chemistry presented a workshop for area school teachers 

entitled “The Chemistry of Ground Water – A Green Chemistry Perspective” at the 

annual New England Groundwater Institute Program. At this program, Green Chemistry 

solutions are introduced to teachers and key experiments that target groundwater 

contamination are performed. 

Natick High School Teacher Training in Green Chemistry – 11/16/2006 

PROPOSALS AWARDED 

FUNDING JULY 2006 – JUNE 2007 

Industrial Grants [Annual Funding Total] 

Dolphin Software $40,000.00 

Microfluidics (+University Match) $12,000.00 

Above Board Technologies $35,000.00 

Tiaxx L. L. C. $12,000.00 

Rohm & Haas PFOS Alternatives $40,000.00 

Sappi Paper Enhancement $110,000.00 

Sappi TiO2 $150,000.00 

Government Grants 

New England Green Chemistry Consortium $65,259.00 

NSF Graduate Research Fellowship $135,000.00 

NSF International Planning Visit & Workshops $12,500.00 

MA OTA High Speed Digital Printing $40,000.00 

TURI Biobased Plasticizers $20,000.00 

URST Formaldehyde Alternatives $20,000.00 

Collaborative Grants 

President’s Science & Technology Grant $100,000.00 

ACS SEED 2005 $5,000.00 

ACS SEED 2006 $5,000.00 

Nanotechnology Bridge $12,000.00 


163

NIH STTR with ChemMotif $35,000.00 

NGO Funding 

Kendeda Fund $40,000.00 

Merck $10,000.00 


164

14. CENTER FOR HEALTH AND DISEASE RESEARCH 

at the 


CFCI Report 

2006-2007 


The primary role of the Center for Health and Disease Research (CHDR) is to promote 

its’ basic and applied research activities in disease prevention and treatment in order to 

maintain a healthy population that will support and enhance the development of a 

sustainable industrial economic sector. The Center is comprised of the following 

divisions – The Division of Nutrition and Metabolic Disorders, the Division of 

Preventative Medicine, and the Division of Aging. 


The Center for Health and Disease Research is involved in research, education, and 

public service as it relates to the prevention and treatment of chronic illnesses such as 

cardiovascular disease, cancer, diabetes and eye disease. One of the major goals is to 

establish a revenue stream that will continue to support the creation of an environment 

which fosters education and training of students, staff and junior faculty in the pursuit of 

an innovative research agenda. In support of this goal, the Center for Health and Disease 

Research will continue to pursue cutting edge research interests and approaches. 

Included in these goals will be our continued attempt to translate our research 

accomplishments to real world quality of life improvements for the general public. Since 

research is an integral component of the educational experience of a student, and is 

considered a scholarly activity, the mission and purpose of the Center for Health and 

Disease Research has a strong research emphasis which is closely aligned with the 

University Mission. Also, since our research interests foster training of students who go 

on to occupy positions in the biomedical industry and since our research interests have 

generated intellectual property for the University and the State, the Center for Health and 

Disease Research also assists in supporting sustainable regional economic and social 

development. 


- Pharmaceutical and nutraceutical interventions in cardiovascular disease, 

diabetes, cancer and age-related macular degeneration. 

- Nanoemulsion delivery of pharmaceuticals, nutraceuticals and cosmeceuticals. 

- Nanoemulsion technology as it relates to formulation of films and coatings. 

Center for Health and Disease Research 

165


Faculty: 

Dr. Thomas Wilson 

Dr. John Warner 

Dr. Stephen McCarthy 

Dr. Thomas Shea 

Dr. Susan Houde 

Dr. Sean Collins 

Dr. Cynthia Ferrara 

Dr. Garry J. Handelman 

Dr. Thomas L. Foxall 

Ira Ockene, M.D. 

MA 

John Dagianis, MD 

Jack T. Evjy, MD 


Department of Clinical Laboratory and Nutritional Sciences 


Department of Community Health and Sustainability 


Department of Plastics Engineering 


Department of Biology 


Department of Nursing 


Department of Exercise Physiology 



University of Massachusetts, Lowell 


University of New Hampshire, Durham, NH 

University of Massachusetts Medical Center, Worcester, 

Opthalmologist, Nashua Eye Associates 

Past President, Massachusetts Medical Society 

Staff: 

Margaret Martin 

Elizabeth Goodrow 

Maureen Faul 







New and Temporary Faculty Affiliations 

Dr. Susan Houde 

Dr. Sean Collins 

Dr. Cynthia Ferrara 


Department of Nursing 






166

John Dagianis, MD 

Jack T. Evjy, MD 

Tara McHugh 

Nihan Dogan 

Opthalmologist, Nashua Eye Associates 

Past President, Massachusetts Medical Society 

Research Leader 

United States Department of Agriculture 

Research Leader 

United States Department of Agriculture 


Graduate Students: 

- Fonghsu Kuo 

- Jean-Bosco Tagne 

- Rohini Vishwanathan 

- Balaji Subramanian 

- Srikanth Kakumanu 

- Mukta Bagul 


- Influence of Egg on Serum Carotinoids in Prevention of Age Related Macular 

Degeneration (ARMD) in the Elderly 

- Influence of Egg on Macular Pigment Density in the Elderly 

- Nanospheres as Vehicles for Treatment of Neuroblastoma 

- Reducing Risk Factors in Peripheral Arterial Disease (Northwestern) 

- Hypercholesterolemic Effects of Test Fiber Preparations versus Psyllium in 

Hamsters 

- Rice Bran Extract: Cholesterol-Lowering Potential and Mechanism of Action 

- Cholesterol and PK Effects of Three Different Doses of a Novel Drug in 

Hamsters 

- Lawrence Latino Diabetes Prevention Program 

- Efficacy of a Nanoemulsion Preparation of ASF (Antioxidant Synergy 

Formulation) on Inflammation in Mice. 

- Efficacy of a Nanoemulsion Preparation of Aspirin on Inflammation in Mice. 

Publications 

Tighe DA, Ockene IS, Reed G, Nicolosi RJ. Calculated Low Density Lipoprotein- 

Cholesterol Levels Frequently Underestimate Directly- Measured Low Density 

Lipoprotein-Cholesterol Determinations in Patients with Serum Triglyceride Levels ≤ 

4.52 mmol/L. Clinica Chimica Acta (2006) 365, 1-2: 236-242. 


167

Wenzel AJ, Gerweck C, Barbato D, Nicolosi RJ, Handelman GJ, Curran- 

Celentano J. A 12-wk Egg Intervention Increases Serum Zeaxanthin and Macular 

Pigment Optical Density in Women. J Nutr. (2006)136:2568-2573. 

Goodrow EF, Wilson TA, Crocker Houde S, Vishwanathan R, Scollin P, 

Handelman G, Nicolosi RJ. Consumption of One Egg per Day Increases Serum 

Lutein and Zeaxanthin Concentrations in Older Adults without Altering Serum Lipid 

and Lipoprotein Cholesterol Concentrations. J Nutr (2006) 136:2519-2526. 

Wilson T, Nicolosi RJ, Woolfrey B, Kritchevsky D. Rice Bran Oil and Oryzanol 

Reduce Plasma Lipid and Lipoprotein Cholesterol Concentrations and Aortic 

Cholesterol ester 

J Nutr Bio (2007)18,105-112. 

Fongshu K, Kotyla T, Wilson T, Kifle L, Ortiz D, Panagiotou T, Gruverman I, 

Tagne, JB, Shea T, Nicolosi RJ. A Nanoemulsion Encapsulated Anti-Oxidant 

Synergy Formulation Reduces Neuroblastoma-Induced Tumors in Mice. J. Exp. 

Theraputics & Oncology (2007) 6,2:129-135. 

Wilson TA, Orthoefer F, Nicolosi RJ. Soy Protein Concentrate Lowers HDL- 

Cholesterol Concentrations Compared To Casein in Ovariectomized Rats Fed a Low- 

Fat, Cholesterol-Free Diet. Nutr. Res (2007) 27, 417-422.. 

Wilson TA, Nicolosi RJ, Kotyla T, Fleckinger. Soy Protein Without Isoflavins 

Reduces Aortic Total and Cholesterol Ester Concentrations Greater Than Soy Protein 

with Isoflavones Compare to Casein in Hypercholerolemic Hamsters. Nutr. Res.( In 

Press 2007) 

Manuscripts Submitted 

Fongshu K, Karthick B, Kotyla T, Wilson T, Nicolosi RJ. A Nanoemulsion of 

Antioxidant Formulation Enhances Its Effect on CD-1 Inflammatory mice Model. 

International J of Pharm (Submitted May 2007) 

Kotyla T, Kuo F, Moolchandani V, Wilson T, Nicolosi RJ. Increased 

Bioavailability of a Transdermal Application of a Nano0sized Emulsion 

Preparation. International J of Pharm (Submitted May 2007) 

Tagne JB, Kakumanu S, Ortiz D, Shea T, Nicolosi RJ. A Nano-emulsion 

Formulation of Tamoxifen Increases Its Efficacy in Breast Cancer Cell Line. 

Molecular Pharmaceutics (Submitted July 2007). 

Tagne JB, Kakumanu S, Nicolosi RJ. Nanoemulsion Preparations of the Anti- 

Cancer Drug Dacarbazine Significantly Increases its Efficacy in a Xenograft 

Mouse Melanoma Model. Cancer Research (Submitted July 2007) 


168


• Nanoemulsion Delivery of Pharmaceuticals. Atrium, Hudson, New Hampshire 

• Statins Prevent the Expected Rise in Serum Total and Lipoprotein Cholesterol Levels 

While Consuming Up To 1000 mg per day of Cholesterol As Egg Yolk. 

Experimental Biology (FASEB) Annual Meeting, Washington, DC 

• Nanoemulsion Delivery of Anti-inflammatory Agents Using Microfluidization, 

Microfluidics, Newton, Massachusetts 

• Application of Nanoemulsion Technology to the Delivery of Nutraceuticals, 

P&G,Cincinnati, OH 

• NuSun Sunflower: Rationale for Use and Dietary Guidelines, Frito Lay, Dallas, Texas 

Collaboration with other Centers/Institutes and/or Departments 

Center for Cellular Neurobiology & Neurodegeneration Research Tom Shea, Ph.D. 

Center for Green Chemistry 

John Warner, Ph.D. 

Institute of Nanotechnology 

Arthur Watterson, 

Ph.D. 

Institute for Plastics Innovations 

Stephen McCarthy, 

Ph.D. 

Regional/ Local Outreach 

- Nutrition related staff inservice programs at D’Youville Senior Care Center 

- Presented Healthy Eating Seminars at the Andover Senior Center. 

- Lecture on “The Science of Nutrition and Healthy Eating” at the Bartlett 

School, Lowell 

Proposals Awarded for 2006/2007 

• University of Massachusetts Medical School /NIH $35,155.00 

• Egg Nutrition Center $204,180.00 

• Egg Nutrition Center $99,271.00 

• Massachusetts Lions Eye Research Fund $15,000.00 


169

• Hoffman LaRoche Pharmaceuticals $43,078.00 

• HCI Research Center – Proctor & Gamble $42,000.00 

• Microfluidics $6,000.00 

• NatuRi $60,398.00 

• Northwestern $18,480.00 


170

15. CENTER FOR INDUSTRIAL COMPETITIVNESS 


I. MISSION STATEMENT 

The Center for Industrial Competitiveness conducts path-breaking research on industrial 

innovation, regional development, corporate governance, and sustainable prosperity. 

Through an accumulation of detailed studies of industrial sectors, we strive to develop a 

profound understanding of the inner workings of the Massachusetts economy. At the 

same time, we are engaged in research and on industrial competitiveness throughout the 

world; for example, Britain, France, India, Japan, Malaysia, Mexico, Northern Ireland, 

Norway, Slovenia, South Korea, and Sweden. The Center also analyzes the impacts of 

industrial restructuring and innovation on skill formation, work organization, 

employment opportunities, and economic development. The Center is engaged in 

research and outreach in direct support of regional, state and local partners, including 

facilitating student participation and internships. We bring a truly global perspective and 

unique analytical capabilities to the problems of regional development. 

II. GENERAL DESCRIPTION AND GOALS 

CIC faculty, staff, students and allied researchers utilize and develop competencies across 

program areas that integrate quantitative and qualitative data collection and analysis, 

comparative and historical case study methodologies, and network development and 

support among sponsoring and stakeholder communities. The skills and techniques 

include survey administration and analysis; conducting in-depth interviews and content 

analysis, industry cluster identification and analysis; integrated analysis at the firm and 

industry level of technology and organizational development, strategy and performance; 

and assessment of workforce training needs and training program development. These 

CIC activities are funded by federal and state agencies, as well as by foundations that 

support social science research and policy analysis and training programs. The results of 

CIC activities are provided in reports, books and publications in the popular media and 

peer reviewed journals as well as project activities with partnered organizations. 

III. RESEARCH FOCUS AREAS 

The activities of the Center for Industrial Competitiveness are in nine areas of research, 

analysis, policy and program development, and performance evaluation. While the 

project descriptions of the first 5 are largely unchanged, new presentations, reports, and 

publications are listed in sections below. Notable changes are described in areas 6 and 7 

and he last two program areas are new. 

1) Anticipating Technology Trends - vTHREAD 

2) Innovation and competition in the global communications technology 

industry 

3) The US stock market and the governance of innovative enterprise 

Center for Industrial Competitiveness 

171

4) The evolution of the US biotech industry 

5) Employment and Regional Development in the United States and Mexico 

6) Renewable Energy in New England: Technology, Industry and Workforce 

Policies 

7) New England Initiative 

8) Community Development & Work Study Program 

9) The Retail Workforce in a Changing Competitive Landscape: The 

University of Massachusetts Retail Study 

10) Industrial Restructuring and Regional Development in Massachusetts 

IV. ASSOCIATED PERSONNEL 

UNIVERSITY OF MASSACHUSETTS LOWELL 

Directors: (Name and Department) 

Michael Best 

COM 

William Lazonick 

CASH 

Edward March 

UML 

William Mass 

CASH 

University Professor Emeritus 

Regional Economic & Social Development 

Office of Regional Development 


Senior Research Fellows: 

Robert Forrant 

CASH 

Laurence Gross 

CASH 

Philip Moss 

CASH 

David Soule 

CIC 

Chris Tilly 

CASH 

Donald Zizzi 

CIC 




Senior Research Fellow 


Senior Fellow 

Research Associates: (Name and University) 

Takeshi Abe 

Osaka University, Japan 

Beth Almeida 

International Association of Machinists 

Mercedes Arce 

Colegio de Tlaxcala, Mexico 

José Luis Álvarez Galván London School of Economics 

Henrik Glimstedt 

Stockholm School of EconomicsJulia Lane 

American University and Bureau of the Census 


172

Steven McCarthy 

COEg 

Mary O’Sullivan 

Steve Quimby 

Kazuo Wada 

Sara White 

Plastics Engineering 

University of Pennsylvania 

University of Massachusetts Boston 

Tokyo University 

Cambridge College 

V. New and Temporary Faculty Affiliations (last 3 years) 

Mercedes Arce 

Colegio de Tlaxcala, Mexico 

Marie Carpenter University of Bordeaux 

José Luis Álvarez Galván London School of Economics 

Henrik Glimstedt Stockholm School of Economics 

Ulrich Jürgens 

Science Center Berlin 

Yannick Lung 

University of Bordeaux 

Sara White 

Cambridge College 

VI. Graduate Student Research Assistants: 

Iraida Elena Blanco 

Anne Chalupka 

Heather Derby 

Amanda Enrico 

James Giddings 

Gao He 

Marc Horne 

Jonathan Latner 

Tom Merrill 

Rob Moreau 

Jasmine Mutuku 

Demetra Paparounas 

Amy Provencal 

Oner Tulum 

Yue Zhang 
















VII. CURRENT RESEARCH PROJECTS 

Anticipating Technology Trends - vTHREAD 

Economic policymaking increasingly involves technology-based initiatives. vTHREAD 

(Techno-Historical Regional Economic Analysis Database) is a historical database of 

high tech companies and research tools to deepen our understandings of regional 

industrial specialization, growth, decline, and reinvention. vTHREAD includes 

approximately 60,000 public and private, nationally located high tech producers 

classified by a finely granulated taxonomy (licensed from CorpTech which also supplies 


173

the major company directory) in which 18 industry 

codes explode to 300 major product codes, and to 3000 minor product codes. THREAD 

is a database tool to ‘discover’ a region’s competitive advantage and to characterize a 

region’s underlying technology capabilities, deep craft skills, and cluster dynamics. It is a 

firm specific, bottom-up approach to conduct technology audits and technology roadmap 

exercises, to research skill needs, and to anticipate technology trends. 

The unique 15 year historical feature combined with 147 fields of the database also offers 

the capability to generate reports on company growth rates in employment and sales, 

evolution of product profile, technology capabilities, executives, and changes in company 

ownership (public/private, domestic/foreign). A mapping feature is a tool to identify 

technology mini-clusters and to characterize technology genealogy, industry churn 

measured by the entry and exit of firms in specific technologies and locations. 

Innovation and competition in the global communications technology industry 

This project analyzes the role of business organization in the ongoing evolution of 

employment opportunities in the US information and communications technology (ICT) 

industries. By delving into changes in the investment strategies and employment 

practices of high-technology enterprises that operate in the United States, we are 

identifying structural changes in the availability of remunerative, stable, and creative jobs 

for well-educated and well-trained members of the US labor force. This research helps 

policy makers understand trends in the demand for and supply of high-tech labor in the 

United States, including the structural components of the recent “jobless recovery”. 

The basic thesis underlying this project is that the prevalence of the “New Economy” 

business model in the US ICT industries has dramatically changed the ways that firms 

employ labor and invest capital. Historically, the emergence and diffusion of the New 

Economy business model have fostered significant innovation, generating large numbers 

of well-paid and creative jobs in a set of industries that has been central to the growth of 

the US economy. Relative to the “Old Economy” model that was dominant in the post- 

World War II decades, however, the New Economy model has been characterized by 

highly mobile labor and capital markets that have eroded the commitment of companies 

to their employees, and vice versa. With the increasing globalization of capital and labor 

flows, the regeneration of US high-tech employment opportunities is, even in a period of 

economic growth, in jeopardy. Our research documents and analyzes what might be 

termed the “end of organization man” as it has occurred in the United States over the past 

two decades, and considers the employment implications of the new ways that US hightech 

companies are doing business. 

The US stock market and the governance of innovative enterprise 

This project combines a number of collaborative efforts led by William Lazonick with 

Mary O’Sullivan (University of Pennsylvania); Rebecca Harding (The Work 

Foundation); Henrik Glimstedt (Stockholm School of Economics and Lund University); 


174

Kazuo Wada (University of Tokyo), Yoichi 

Kobayakawa (Chuba University), and Tsuneo Suzuki (Gakashuin University). This 

project seeks to understand the evolving relation between financial institutions and 

innovative enterprise over time and across the advanced economies. 

The work with O’Sullivan builds on a major project, Corporate Governance, Innovation, 

and Economic Performance (www.insead.fr/CGEP), that we co-directed from INSEAD. 

The main financial support for that project came from the European Commission’s 

Targeted Socio-Economic Programme, INSEAD Association for Research, and the US 

National Science Foundation. The project asks how financial institutions influence the 

innovative strategies and capabilities of business enterprises, with a focus on hightechnology 

industrial sectors. Much of the research focuses on the changing functions of 

the stock market (control, cash, combination, and compensation) in the industrial 

corporation and the impacts of these functions on corporate strategy, organization, and 

finance. At present, Lazonick and O’Sullivan are doing studies that compare the US, 

British, and French experiences in a) the evolution of the venture capital industry and b) 

the financing of the videogame software industry. The comparative work on the venture 

capital industry is also being done in collaboration with Rebecca Harding of The Work 

Foundation. 

The work with Glimstedt is a study of the adoption and impacts of stock options at 

Ericsson, being carried out in cooperation with the company. The study asks what 

function or functions stock options perform in the industrial corporation. Are they used 

to attract, retain, motivate, and/or recognize employees? What is the relation, in terms of 

employee compensation, between stock options and other forms of remuneration? It is 

planned to expand this research into a general study of the evolution of stock options as a 

mode of compensation in the United States and their diffusion to Europe since the late 

1990s. 

The work with Wada, Kobayakawa, and Suzuki makes use of detailed databases of 

Japanese company directors and managers, going back to 1898, to identify networks of 

financiers, entrepreneurs, and managers who collaborated in the development of Japanese 

industry. It is of consequence for understanding the process of industrial development to 

know whether entrepreneurs acted as individuals or as linchpins of networks that could 

enable them to identify new industrial opportunities and mobilize the financial resources 

to support setting up the firms to take advantage of them. Was there an organized 

business community, formal or informal, driving the process of industrial development? 

Did serial entrepreneurs work with identifiable networks of business associates whose 

capabilities they knew and whose motives they trusted? 

The Evolution of the US biotech industry 

This project led by William Lazonick with Ed March and Oner Tuluom begins with a 

primary focus on Massachusetts where dramatic export growth is concentrated in medical 

manufacturing sectors in general and biopharmaceutical products in particular. 

Government funding underpins Boston’s biotech advantage. As a group, universities, 


175

esearch institutes, and hospitals in Boston have long 

been the premier recipients of research and training grants from the National Institutes of 

Health (NIH). The central role of the government in the development of the Boston 

biotech industry becomes all the more apparent when we take note of the types of 

products that the most successful biotech companies have been producing. Among the ten 

leading dedicated biopharmaceutical companies in the United States in 2005, 73 percent 

of their $29.8 billion in product revenues came from brands that have been approved as 

“orphan drugs”. Since 1983, under the Orphan Drug Act, biopharmaceutical companies 

have been receiving research subsidies and market exclusivity to develop drugs for 

genetic and rare diseases — drugs that, it is believed, would not have been developed 

without special government support. Many of these drugs have become blockbusters with 

sales of $1 billion or more. Besides funding the knowledge base that underpins the 

biotech industry and subsidizing the development and commercialization of drugs for 

genetic and rare diseases, the government is the source of a very significant proportion of 

the purchasing power for these drugs in the United States. Prescription drug expenditures 

have been an increasing proportion of national health expenditures, reaching about 10 

percent in the mid-2000s. 

This project investigates the federal regulatory policies toward prescription drug prices 

and executive compensation. Currently, Congress is debating the extent to which the 

government should regulate the prices of prescription drugs, which are generally far 

higher in the United States than in the other rich nations of the world. The 

biopharmaceutical companies argue that if drug prices are lowered they will have less 

money available to invest in R&D, with the result that fewer new drugs will become 

available to the public. However, policymakers should take a close look at how the 

successful biopharmaceutical companies are actually allocating their profits. In the cases 

of Amgen and Genentech, number one and number two among the independent 

biopharmaceutical companies, they have been allocating about as much of their profits to 

stock repurchases as to R&D in the 2000s. The purpose of stock repurchases is to give a 

boost to a company’s stock price. Prime beneficiaries of stock repurchases are none other 

than the high-level corporate executives who make these allocative decisions. In the US 

biopharmaceutical industry, the debates over the regulation of the prices of drugs and the 

pay of executives should be examined in relation to one another. 

Employment and Regional Development in the United States and Mexico 

The U.S. and Mexican economies, already closely linked, have since the implementation 

of NAFTA become even more integrated through increased trade, investment flows, and 

migration. Nonetheless, the economies remain distinct in numerous ways. Mexico, still 

much poorer than the United States, retains a much larger traditional sector (especially in 

agriculture) and informal sector. The United States has a much more diversified 

economy, but also higher unemployment. This project compares the two countries, 

particularly from the perspective of employment, and attempts to create intellectual 

linkages among scholars and practitioners in the two countries. 


176

The major research component to date is entitled “Retail workers on both sides of the 

border”. The retail industry is being transformed by dramatic market shifts and rapid 

technological change. To better understand the consequences of these changes, this study 

focuses on turnover and retention, training, service levels, and product knowledge in the 

frontline workforce in the food and consumer electronics sectors. The study will explore 

what is changing in the industry and how companies are developing selection, training, 

compensation, and supervision strategies to cope with these changes. By gathering 

information directly from people who are implementing and experiencing changes in the 

industry, including industry association staff, company executives, store-level managers, 

and employees, the study will generate well-informed and practical recommendations for 

preparing and managing the retail workforce of the future. This study is part of a larger 

multinational effort examining the retail workforce in Denmark, France, Germany, 

Mexico, the Netherlands, and the United Kingdom as well as the United States, and 

comparing new developments in these countries. This study is funded by the Russell Sage 

Foundation. 

Renewable Energy in New England: Technology, Industry and Workforce Policies 

Since the state and federal restructuring of regulations governing the electricity supply 

industry in the late 1990s, new policy avenues have emerged to promote the development 

of the distributed generation of electricity in general and the role of renewable energy 

sources in particular. This program seeks to understand the interaction between 

competitive and policy influences on the pace and direction of technological capabilities, 

product commercialization, and regional industry growth and performance of renewable 

energy in New England. The first study in this program focused on workforce 

development policies related to the photovoltaic industry. Working collaboratively with 

other centers in the UMass System, current research is examining policy initiatives that 

can improve on the regional innovation system advancing the renewable energy sector, 

including solar, wind and related power electronics necessary to achieve price 

competitive distributed generation. 

New England Initiative 

The six states in New England are the most widely recognized regional geography in the 

country. The New England Initiative (NEI) researches, analyzes, promotes region wide 

debate and discussion, and provides technical and strategic assistance to better understand 

the nature of regional challenges and opportunities to advance the quality of life in the 

region. As a region of states relatively small in area or population, many of the social, 

economic and environmental dynamics of change are interdependent and cross-state 

boundaries. Many of the common challenges are best addressed through multi-municipal 

regional entities where the NEI offers technical and strategic support and assistance to 

advance mutual learning among regional organizations. Other challenges can only be 


177

addressed more effectively through state policy. Most 

significantly there remain opportunities for improving New England wide approach to 

federal program priorities 

and initiative. This applies to a broad range of concerns, including the incubation of 

innovative emerging sectors, the stability of the manufacturing economic base, physical 

infrastructure and environmental quality, and workforce development. The NEI strives to 

work with organizational partners throughout New England to meet the region wide 

challenges by providing research and technical assistance, advancing common 

understanding of regional challenges, and identifying better solutions through 

coordinated and complementary responses. The lead partners with the CIC New England 

Initiative are the New England Council (NEC), the oldest region wide trade association in 

the United States, and the New England Association of Regional Councils (NEARC) 

which encompasses all regional planning councils in New England. Director Mass and 

CIC Senior Research Associate David Soule have made presentations throughout New 

England to promote the New England Initiative. The CIC NEI is also a founding and 

active participant in the New England Smart Growth Alliance and the New England 

Futures partnership < www.newenglandfutures.org/>. The lead partners with the CIC New 

England Initiative are the New England Council (NEC), the oldest region wide trade 

association in the United States, and the New England Association of Regional Councils 

(NEARC) which encompasses all regional planning councils in New England. 

In Fall 2005 the New Hampshire Charitable Trust supported the NEI pioneering activity 

in training representatives from the state’s Regional Councils in Social Impact 

Assessment as a tool for Community Planners. Planning is underway for adapting a 

similar training session for the participating members of the Vermont Association of 

Planning and Development Agencies in 2007. The NEI is working with lead partners and 

others in all six states to facilitate the reestablishment and federal support for a New 

England Compact. During the 2005-2006 the CIC partnered with Institute for 

Visualization and Perception Research with seed support from CFCI to advance a New 

England Indicators project seeking to establish integrated tools for managing a region 

wide data base for all 1537 municipalities and open source mapping capabilities. This last 

activity has been formally endorsed and is supported by New England Futures, NEARC 

and NEC. 

Community Development & Work Study Program 

A two-year grant from the Department of Housing and Urban Development (HUD) led 

by CIC faculty affiliate Chris Tilly and supported graduate students from the University’s 

Regional Economic and Social Development Department (RESD). Instead of working as 

research or teaching assistants, the grant, which was matched by the University, requires 

students to work 15 hours a week as community development fellows. This past year this 

work continued with the City of Lowell Department of Planning and Development, 

Coalition for a Better Acre, and Lawrence Community Works. Dave Turcotte, program 

manager with the Center for Family, Work and Community and adjunct faculty in RESD, 


178

assists in finding placements after meeting with the students to determine their work 

preferences and economic eligibility.. 

In addition and building on these efforts, CIC faculty affiliate Phil Moss, working with 

Lawrence CommunityWorks, has provided support and oversight working with graduate 

students to promote development and implementation of participatory budgeting in 

Lawrence, MA. Phil has also coordinated work with RAs in support of Coalition for a 

Better Acres and participated in research and strategy setting for a campaign to promote 

more affordable housing in Lowell. Moss also consulted with Massachusetts Law Reform 

for a fair housing case involving a class action suit by former residents of the Julian 

Steele public housing project against the city of Lowell for perpetuating and exacerbating 

residential segregation in Lowell. 

The Retail Workforce in a Changing Competitive Landscape: The University of 

Massachusetts Retail Study 

The retail industry is being transformed by dramatic market shifts and rapid technological 

change. To better understand the consequences of these changes, this study focuses on 

turnover and retention, training, service levels, and product knowledge in the frontline 

workforce in the food and consumer electronics sectors. The study will explore what is 

changing in the industry and how companies are developing selection, training, 

compensation, and supervision strategies to cope with these changes. Chris Tilly is 

leading this effort at the CIC in coordination with Françoise Carré, Research Director, 

Center for Social Policy, University of Massachusetts Boston and in collaboration with: 

the National Retail Federation 

By gathering information directly from people who are implementing and experiencing 

changes in the industry, including industry association staff, company executives, storelevel 

managers, and employees, the study will generate well-informed and practical 

recommendations for preparing and managing the retail workforce of the future. This 

study is part of a larger multinational effort examining the retail workforce in Denmark , 

France , Germany , Mexico , the Netherlands , and the United Kingdom as well as the 

United States , and comparing new developments in these countries. This study is funded 

by the Russell Sage Foundation, the largest foundation entirely devoted to funding social 

science research. 

Industrial Restructuring and Regional Development in Massachusetts 

Massachusetts has been a “high technology” state ever since it led the way in the mass 

production of cotton textiles and shoes in the early 1800s. However, the nature of the 

technology and the organization of industry have changed repeatedly. For some time 

now, there has been a shift from manufacturing to services, and a shift away from local 

ownership of industry. This project pulls together a set of studies of particular issues 

affecting Massachusetts industries and the regional economy. The activities related to this 


179

project are newly developed this year. They include 

studies underway on Massachusetts exports to European Union led by William Lazonick 

and Edward March and High Tech employment patterns in 55 High Tech industries 

examined by William Mass. The first completed project supported by Chris Tilly was 

completed by research associate Sara White of Cambridge College on employment at 

Gillette in Massachusetts. 

VIII. Recent Publications 

Michael Best 

“Massachusetts Medical Devices: Leveraging the Region’s Capabilities”, 

MassBenchmarks, Vol. 8, No. 1, 2006: 14-25. On-line at 

http://www.massbenchmarks.org/publications/massbenchmarks.htm 

“Cluster Dynamics in Malaysian Electronics,” in K.S. Jomo (ed.) Malaysian 

Industrial Policy, forthcoming. 

Robert Forrant 

Skill Was Never Enough: The Rise and Precipitous Decline of the Connecticut River 

Valley Industrial Corridor, Baywood Publishers, in the Series, Work, Health and 

Environment, forthcoming 2007. 

William Lazonick 

“Globalization of the ICT Labor Force,” in R. Mansell, C. Avgerou, D. Quah, and R. 

Silverstone, eds., The Oxford Handbook on ICTs, Oxford University Press, 2006: 

75-99. 

Competitive Advantage on the Shop Floor, Harvard University Press, 1990; 

translated into Chinese by Renmin University Press, 2006. 

“Evolution and Allocation of Stock Options: Adapting US-Style Compensation to the 

Swedish Business Model,” co-authored with Henrik Glimstedt and Hao Xie, 

European Management Review, 3, 3, 2006: 1-21. 

“The Theory of Innovative Enterprise,” published in Russian, Economic Herald of 

Rostov State University, 4, 3, 2006: 7-32. 

“Evolution of the New Economy Business Model,” in Eric Brousseau and Nicola 

Curien, eds., Internet and Digital Economics, Cambridge University Press, 2007: 

59-113. 

“Varieties of Capitalism and Innovative Enterprise,” Comparative Social Research, 

24, 2007: 21-69. 

“Shareholder Value and the Governance of Innovative Enterprise,” in U. Jürgens, 

G. Schuppert, D. Sadowski, and M. Weiss, eds., Perspectives of Corporate 

Governance, Nomos, 2007. 

International Encyclopedia of Business and Management Handbook of Economics, 

Thomson Learning, 2002; translated into Chinese, 2007. 

“The US Stock Market and the Governance of Innovative Enterprise,” Industrial 

and Corporate Change, forthcoming. 


180

“Economic Institutional Change and Employer 

Pensions,” in Teresa Ghilarducci and Christian Weller, eds., Employee Pensions 

and Labor Relations, Labor and Employment Relations Association Research 

Volume, 2007 (forthcoming) 

“Transitions of a Displaced High-Tech Labor Force,” co-authored with Steven 

Quimby, in Tom Juravich, ed., The Future of Work in Massachusetts, University 

of Massachusetts Press, 2007 (forthcoming). 

“Corporate Governance, Innovation, and Economic Development,” in Ha-Joon 

Chang, ed., Institutions and Development, World Institute for Development 

Economic Research, 2007 (forthcoming). 

“Business History and Economic Development,” in Geoffrey Jones and Jonathan 

Zeitlin, eds., The Oxford Handbook of Business History, Oxford University Press, 

2007 (forthcoming). 

“Innovative Enterprise and Economic Development,” in Youssef Cassis and Andrea 

Colli, eds., Business Performance in the Twentieth Century: A Comparative 

Perspective, Cambridge University Press, 2007 (forthcoming). 

“Contemporary Capitalism,” in S. Durlauf and L. Blume, eds., The New Palgrave 

Dictionary of Economics, Palgrave, 2008 (forthcoming). 

William Mass 

“Teaching Sustainability and Professional Ethics,” in Robert Forrant and Linda Silka 

(eds.) Inside and Out: Universities and the Sustainable Regional Development 

Process, Baywood Publishers, 2006. 

“Massachusetts’ Reliance on High Technology: A Double-edged Sword,” Center for 

Industrial Competitiveness, Working Paper May 2007, and online publication by 

MassEconomy.org. 

“High Technology Reports,” Seven Massachusetts Regional Reports (Berkshire, 

Boston, Cape Cod, Central, Northeast, Pioneer Valley, Southeast) Original 

contributions for the “Massachusetts Technology Benchmarking Project,” 

Economic and Public Policy Research Unit, University of Massachusetts Donahue 

Institute, funded by United States Economic Development Administration, 

December 2005. Revised 2007 for Massachusetts Economic Assessment and 

Analysis Project for online publication, MassEconomy.org,, with James Giddings, 

forthcoming. 

“Bristol Main Street Textiles and Teleflex Medical NEG: A Program Summary and 

Initial Assessment,” with Thomas Merrill, Report to Commonwealth 

Corporation, June 2007. 

“The Future of High Tech Employment - Massachusetts High-Technology 

Industries’ Employment Trends, 1997–2006,” Research and Evaluation Report, 

Volume 5, Issue 2, Common Wealth Corporation, forthcoming. 

“Stormy Weather and Silver Linings: Massachusetts’ Reliance on High 

Technology,” in William Mass (ed.) Democracy, Labor, and Sustainability in the 

New Economy, forthcoming. 

William Mass (ed.) Democracy, Labor, and Sustainability in the New Economy, 

forthcoming. Manuscript revision to be submitted to Baywood Publshers. 


181

Philip Moss 

“Learning about discrimination by talking to employers.” Philip Moss and Chris Tilly. In 

William Rodgers III, Handbook on the Economics of Discrimination. Cheltenham, 

UK: Edward Elgar, 2006. 

"Under Construction: The Continuing Evolution of Job Structures in Call Centers," 

with Chris Tilly and Harold Salzman, accepted 12/06 by Industrial Relations. 

Chris Tilly: 

“Under construction: The continuing evolution of job structures in call centers.” Philip 

Moss, Hal Salzman, and Chris Tilly. Industrial Relations, forthcoming. 

“Wal-Mart and its workers: NOT the same all over the world.” Connecticut Law 

Review, May 2007. 

“The Mexican retail sector in the age of globalization: Lousy jobs, invisible unions.” 

Chris Tilly and José Luis Álvarez Galván. International Labor and Working Class 

History, Fall 2006. 

“Laws and injustice: Fighting for human rights in Mexico.” Marie Kennedy and Chris 

Tilly. New Politics, Summer 2007. 

“Employment conditions as social determinants of health part I: The external domain.” 

Supriya Lahiri, Rafael Moure-Eraso, Marian Flum, Robert Karasek, Ephraim 

Massawe, and Chris Tilly. New Solutions, Vol.16, No.3, 2006. 

“Participación extranjera en el autoservicio mexicano: El efecto Wal-Mart.” José Luis 

Álvarez Galván and Chris Tilly. Comercio Exterior, November 2006. 

“Wal-Mart goes south: Sizing up the chain’s Mexican success story.” Chris Tilly. In 

Stanley Brunn, ed., Wal-Mart World. New York: Routledge, 2006. 

“Trabajo marginal: Trabajadores en el comercio y los servicios en México.” José Luis 

Álvarez and Chris Tilly. In Enrique de la Garza and Carlos Salas, editors, La Nueva 

Situación del Trabajo en Mexico 2000-2003. Mexico City: Instituto de Estudio del 

Trabajo, 2006. 

“Labor market inequality, past and future: A perspective from the United States.” Chris 

Tilly. In Lena Gönas and Jan Carlsson, Divisions of Gender and Work. Aldershot, 

UK: Ashgate, 2006. 

“The economic environment of housing: Income inequality and insecurity.” Chris Tilly. 

In Rachel Bratt, Chester Hartman, Mary Ellen Hombs, and Michael Stone, eds., 

Housing: Foundation for a New Social Agenda. Philadelphia, PA: Temple University 

Press, 2006. 

IX. CONFERENCE PRESENTATIONS 

Robert Forrant: 

“Learning To Get Along: Large Institutions, Institutional Cultures and the Art of Making 

Partnerships Work,” with Christoph Strobel, Presented at CITA Conference on 

University-Community Partnerships, University of Massachusetts Lowell, April 27, 

2007. 


182

“Valuing Engagement: How Do We Express the 

Meaning of our Partnership Efforts?” with Anne Chalupka, Presented at CITA 

Conference on University-Community Partnerships, University of Massachusetts 

Lowell, April 27, 2007. 

William Lazonick: 

Featured speaker, “China, East Asia, and the Globalization of High-Tech Labor,” 

International Forum of Comparative Political Economy of Globalization, Renmin 

University of China, Beijing, September 3, 2006. 

Lecture, “Innovative Enterprise and Economic Development,” Faculty of Economics, 

Renmin University of China, September 8, 2006. 

Presentations on aircraft engines, telecommunications equipment, and video games, 

ESEMK (European Socioeconomic Models of a Knowledge-Based Society) 

Workshop, Ecole des Hautes Etudes en Sciences Sociales, Université de Paris VI, 

October 19-20, 2007. 

“Globalization of the High-Tech Labor Force, Asia-Pacific Academy of Management and 

Business, SIM University, Singapore, March 5, 2007. 

“Globalization of the High-Tech Labor Force, INSEAD Seminar Series, INSEAD 

Singapore, March 7, 2007. 

“Entrepreneurship, Innovation, and Development,” Conference on Rethinking 

Development in the Age of Globalization, Southern New Hampshire University, April 

7, 2007. 

“Globalization of the High-Tech Labor Force,” Workshop on Education and Economic 

Development, Ecole des Hautes Etudes en Sciences Sociales, Université de Paris VI, 

April 26, 2007. 

“Globalization of the High-tech Labor Force,” 23 rd EGOS (European Group for 

Organizational Studies) Colloquium, Vienna University of Economics and Business 

Administration, July 7, 2007. 

Featured speaker, “Entrepreneurship, Innovation, and Development,” International 

Summer School of e-Business and Complexity: New Management Practices, 

University of Salento, Ostuni, Italy. July 12, 2007 

Globalization of the High-Tech Labor Force,” Second International Conference on 

Management of Globally Distributed Work, Indian Institute of Management 

Bangalore, Bangalore, India, July 25, 2007. 

“The Rise and Fall of Lucent Technologies,” with Edward March, Conference on 

Innovation and Competition in the Global Communications Technology Industry, 

INSEAD, Fontainebleau, France August 23, 2007. 

“Alcatel-Lucent as a Global Competitor,” with Marie Carpenter, Conference on 

Innovation and Competition in the Global Communications Technology Industry, 

INSEAD, Fontainebleau, France August 23, 2007. 

William Mass: 

New England: Measures, Indicators and New Tools – Six States, One Destiny,” with Jim 

Giddings, New England Association of Regional Councils, Annual Meeting, 

Manchester Village, Vermont, November 4, 2006. 


183

“New England: Measures, Indicators and New Tools 

– Six States, One Destiny,” with Jim Giddings, presented at the “New(s) England 

Revolution: From Politics to Courtroom to Classroom” Conference, University of 

Massachusetts Lowell, April 7, 2007. 

“University in the Region: Policy Development and Indicators for New England” with 

David Soule, and Jim Giddings, Presented at CITA Conference on University- 

Community Partnerships, University of Massachusetts Lowell, April 27, 2007. 

“New England Measures and Indicators – An Update,” with Jim Giddings and Gupta 

Vivek, presented at The Boston Foundation, June 25, 2007. 

Phil Moss: 

Job Opportunities Task Force: Race and Employment Consultative Session, The Annie E. 

Casey Foundation, August 30, 2006. 

Participant: Urban Institute Roundtable, “Public and Private Roles in the Workplace: 

What are the Next Steps in Supporting Working Families?” April 18-19, 2007. 

Discussant: “Conference on Global Studies of Discrimination,” Princeton Institute for 

International and Regional Studies, Princeton University, May 17-19, 2007. 

Chris Tilly: 

Colegio de Tlaxcala, Conferencia Magistral. “Ocupar! Resistir! Producir! Los 

argentinos reconstruyen su economía desde abajo.” June 15, 2007. Tlaxcala, Mexico. 

Colegio de Tlaxcala, Seminar on “Ejes del Desarrollo y Estructuras del Empleo: México 

en el Mercado Global.” June 1, 6, and 8, 2007. 

“Explicaciones de divergencias económicas entre regiones y naciones.” June 1. 

“Instituciones y competitividad en el mercado global.” June 6. 

“Como las empresas cambian la estructura del empleo.” June 8. 

“Empleo y desarrollo: Factores institucionales y puntos de apalancamiento.” June 8. 

Colegio de México, Centro de Estudios Internacionales. “Wal-Mart en el mundo: 

Estrategias distintas en contextos distintos.” April 30, 2007. Mexico City. 

Centro de Investigación Laboral y Asesoría Sindical, Primera Conferencia Nacional de 

Activistas y Dirigentes Nacionales. “Empresas transnacionales: El caso de Wal-Mart 

de México.” April 20-22, 2007. Mexico City. 

Universidad Autónoma de Zacatecas, Doctorado en Desarrollo Regional. “El impacto de 

Wal-Mart en México.” March 21, 2007. Zacatecas, Mexico. 

Universidad Autónoma de Zacatecas, Doctorado en Desarrollo Regional. “Ocupar! 

Resistir! Producir! Los argentinos reconstruyen su economía desde abajo.” March 

21, 2007. Zacatecas, Mexico. 

Colegio de Mexico, Centro de Estudios Internacionales. “Ocupar! Resistir! Producir! 

Los argentinos reconstruyen su economía desde abajo.” March 5, 2007. Mexico City, 

Mexico. 

Instituto Tecnológico Autónomo de México, Departamento de Relaciones 

Internacionales. “Viviendo el movimiento feminista en los Estados Unidos.” March 

5, 2007. Mexico City, Mexico. 

UCLA, Institute for Industrial Relations, seminar series. “The surprising saga of Wal- 

Mart in Mexico: Market dominance without lower wages.” November 30, 2006. Los 

Angeles, CA. 


184

Columbia University, Department of Urban Planning, Lectures in Planning. “Occupy! 

Resist! Produce! Argentineans rebuild the economy from the bottom up.” November 

13, 2006. New York, NY. 

University of Connecticut Law School, “Wal-Mart Matters” conference. “Wal-Mart and 

workers: NOT the same all over the world.” October 20-21, 2006. Hartford, CT. 

Don Zizzi: 

“New England Compact,” Presentation to the Executive Committee, New England 

Association of Regional Councils, Nashua, New Hampshire, 2007. 

X. COLLABORATION WITH OTHER CENTERS/INSTITUTES AND/OR 

DEPARTMENTS 

Robetrt Forrant, CIC Faculty affiliate, participated in a collaborative winning grant 

proposals. First, “An Ethnographic Study of Lowell, MA: Immigration, 

Globalization and an All-American City” is a newly funded three-year contract 

(approx. $100,000) that represents a collaboration between Middlesex Community 

College, various departments at UMass Lowell, community and neighborhood 

groups and agencies and the Lowell National Historical Park. There is money for 2 

RA’s a year starting 2007-2008 academic year. Principal investigators are Robert 

Forrant and Linda Silka, Director of CFCW, and Christoph Strobel in the History 

Department. 

Robert Forrant in partnership with the Cultural Organization of Lowell and the 

Revolving Museum has received a $35,000 grant from the University of 

Massachusetts President’s Office Creative Economy Fund to support a two-pronged 

project on behalf of Lowell’s creative economy. 

William Lazonick and Ed March collaborated with the Toxic Use Reduction 

Institute (TURI) and Lowell Center for Sustainable Production in developing 

projects on safer chemicals. 

William Laznoick, Ed March and William Mass held initial discussions for 

collaboration between UML CIC and UML nanotechnology initiative. Paper by 

William Lazonick and Edward March on: ”Microtech to Nanotech by way of 

Biotech” to be prepared for the University of Massachusetts Lowell/Center for 

High-rate Nanomanufacturing Interdisciplinary Conference: Nanotechnology, 

Literature, and Society, December 6-7, 2007 

William Lazonick has the following academic affiliations and collaborative 

relationships as: 

Distinguished Research Professor, INSEAD, since 1996 (to terminate August 31, 

2007) 


185

Research Fellow (in process), Institute of International Business, Stockholm 

School of Economics. 

Invited Professor (in process) Faculty of Economics, University of Bordeaux. 

William Lazonick was First opponent, Adjudication Committee, doctoral thesis of 

Jon Vatnaland, “Stability and Change in the Organization of Industry: The Chain 

Store Innovation and the Transformation of American Retailing in a Comparative 

Perspective,” University of Oslo, May 22, 2007 

William Lazonick was the organizer, Conference on “Innovation and Competition in 

the Global Communications Technology Industry,” INSEAD, Fontainebleau France, 

August 23-24, 2007. 

William Mass continued collaboration with George Grinstein, Director, Institute for 

Visualization and Perception Research and graduate research assistants from both 

centers working on the New England Indicators and Measures Project. 

Chris Tilly led Community Development Work Study Program, a collaborative 

effort with the Center for Family, Work, and Community. 

Chris Tilly is a consultant on the “Employment conditions as social determinants of 

health” for a collaborative project with UML faculty in the Departments of Work 

Environment and Economics, with Supriya Lahiri, Rafael Moure-Eraso, Marian 

Flum, Robert Karasek, and Ephraim Massawe, resulting co-authorship on a 

publication written during 2006-2007. 

SEMINAR SERIES 

The joint CIC-RESD Seminar Series provides a forum for bringing leading 

academics, policy analysts and program administrators in the area of economic and 

regional development to the UMass Lowell campus, and for presenting the ongoing 

research of CIC faculty, fellows, and affiliates. The series attracts other U Mass 

Lowell faculty as well as other faculty and students from around the region. The 

seminar series establishes or consolidates links with prominent and path breaking 

academics and practitioners in key areas. In addition to providing access to leading 

researchers, students gain exposure to career paths in a variety of social and economic 

policy arenas and programs. During Fall 2006 individual seminars were jointly 

sponsored by two university committee (CITA and the Interdisciplinary 

Environmental Programs), Graduate School of Education, and the College of 

Engineering 

CENTER FOR INDUSTRIAL COMPETITIVENESS 

REGIONAL ECONOMIC AND SOCIAL DEVELOPMENT 

Seminar Series Fall 2006 

University and Community, Environment and Public Health, & 


186

Shifting Geopolitics in Latin America 

September 

25 John Allison, Founder and Former Director, Capital Region Education 

Council 

“Entrepreneurship in the Public Sector: 

Building a Multi-Municipal Education Collaborative, 1966-2006” 

October 

2 Armand Carriere, Director, UniverCity Partnership 

"Worcester UniverCity Partnership and Recent Lessons of University 

Partnerships" 

10 William Oakes, Purdue University & Interim Director, EPICS 

"Models of Community Engagement and Colleges of Engineering" 

(Tuesday on Monday schedule - Columbus Day University Closed) 

16 Jim Gordon, President, Cape Wind 

“Harvesting New England Wind” 

23 Elizabeth Grossman, Author & Journalist 

"High Tech Trash: Digital Devices, Hidden Toxics, and Human Health” 

30 Steve Ellner, Universidad de Oriente (UDO), Puerto La Cruz, Venezuela 

“Venezuela and Shifting Geopolitics: Global, Regional, and Local” 

November 

6 Eva Paus, Professor & Director, Center for Global Initiatives, Mount Holyoke 

College 

“The Missing Links between Foreign Investment and Development: 

Lessons from Costa Rica and Mexico" 

13 Ross Gelbspan, Award Winning Journalist & Author of Heat is On and Boiling 

Point 

“Global Climate Change: Urgency, Political Obstacles & Solutions” 

20 Elizabeth Harriman, Senior Research Associate, Toxics Use Reduction 

Institute, UML 

“Greening the Electronics Supply Chain: 

Policies and Practices in Adoption of Safer Materials" 

27 Jack Spence, Associate Dean and Professor of Political Science, UMass Boston 

“The Nicaraguan Election and Post-War Central America: 

Transitions Toward Democracy and Social Equity” 

December 

4 Laura Collin Harguindeguy, Professor and Researcher, Colegio de Tlaxcala, 

Mexico 

“The Social and Solidarity Economy in Latin America: 

A Countercultural Movement of the New Millennium 

XI. Regional/Local Community Outreach 


187

Robert Forrant leads the work with Massachusetts Benchmark, a joint effort of UMass 

and the Federal Reserve Bank of New England. Massachusetts Benchmark provides 

descriptions and analyses for any entity concerned with economic development in the 

Merrimack Valley and northeast Massachusetts. Robert Forrant is also a regular 

commentator on the state economy on radio station WUML’s morning wakeup program 

and a monthly columnist at the Lowell Sun, 

Robert Forrant in partnership with the Cultural Organization of Lowell and the Revolving 

Museum has received a $35,000 grant from the University of Massachusetts President’s 

Office Creative Economy Fund to support a two-pronged project on behalf of Lowell’s 

creative economy. 

In his dual roles as CIC Director and Director of the Office of Regional Development Ed 

March has engaged in several key Industrial Outreach efforts including: 

March has collaborated with Economic Development Councils in several initiatives to 

advance industrial cluster formation within the region in partnership with the 

Merrimack Valley Economic Development Council. 

He participated in a pilot Homeland Security project initiated to showcase the 

technologies available from northeastern Massachusetts companies that can be used 

in an interactive, multimedia wireless communications network for first responders 

to an emergency. 

March is involved in a project in progress to identify new commercial opportunities 

for analytical instrument companies in the region by fostering a closer working 

relationship with pharmaceutical companies attempting to address the challenges of 

the FDA initiative “Process Analytical Technology”. 

In fall 2007, a new project will be initiated to develop a response to the issues 

documented in the “Reconnecting Gateway Cities” report sponsored by Mass Inc. 

Focusing on the cities of Lowell, Lawrence, and Haverhill, one area of 

consideration will be on the identification of industrial clusters that have growth 

potential in the region and the capability of creating new employment opportunities 

for a range of worker skill levels, from entry level to professional. 

Additionally, in partnership with the North Shore Technology Council and Babson 

College, the March and others at UML are working to identify the high growth 

potential industrial clusters in the North Shore region and developing a strategy to 

accelerate this growth through a coordinated utilization of emerging technology and 

cross-sector business alliances. 

The New England Initiative led by William Mass with its two lead partnering regional 

organizations, the New England Association of Regional Councils and the New England 

Council, is also a founding partner of the New England Futures Partners that also 

includes Institute for Sustainable Communities, The Boston Foundation, Orton Family 

Foundation, Mount Auburn Associates and Citistates Group. These organizations 

endorsed and support the New England Indicators Project. This past year The New 

England Futures funded a CIC project that entailed interviewing regional leaders and 

drafting a “Game Plan for New England”. This plan culminated in a July 9,2007 meeting 


188

at the New England Federal Reserve bank of leading 

New England organizations to discuss the development of a regional New England 

Compact to enhance regional policy development and coordination. The meeting was 

hosted by Congressman John Larson (CT), the fourth ranking Democrat. Participants 

included the above organizations and the New England Governors Conference, New 

England Board of Higher Education, and the Northern Forest Center. 

The CIC NEI is also a founding and active participant in the New England Smart Growth 

Alliance where David Soule and now Don Zizzi are regular participant and collaborates 

with the Lincoln Institute of Land Policy, the Federal Home Loan Bank Board, and 

Region 1 of the US EPA. 

The Community Development Work Study Program placed students in the last year at: 

City of Lowell Department of Planning and Development, Coalition for a Better Acre, 

and Lawrence Community Works. In collaboration with Lawrence Community Works, in 

2005-2006 Phil Moss aided in the production of "Our Money, Our Future, Our Right to 

Know: The People's Guide to the Lawrence City Budget." 

http://www.lcworks.org/docs/City_Budget_Guide_English.pdf. As an outgrowth of this 

activity, during 2006-2007 he wrote and implemented a survey of city residents 

concerning their evaluation of city public services, the quality of life in Lawrence, and 

their priorities for future public services. He continued to work on two projects with the 

Coalition fora Better Acre 1) Upper Merrimack Street citizens’ planning initiative and 2) 

Affordable housing campaign. As part of the latter efforts Moss consulted for the 

Massachusetts Law Reform for a fair housing case involving a class action suit by former 

residents of the Julian Steele public housing project against the city of Lowell for 

perpetuating and exacerbating residential segregation in Lowell. 

The “Employment and Regional Development in the United States and Mexico” project 

led by Chris Tilly has established student exchange programs with two Mexican 

universities, the Universidad Autónoma Metropolitana-Xochimilco (UAM-X) in Mexico 

City, the Universidad de las Americas (UDLA) in Puebla, and Colegio de Tlaxcala, 

Mexico and has been carrying out exchanges. The related project “Continuity and change 

in low-wage work in retail trade in the United States” is a collaboration with the Center 

for Social Policy, UMass-Boston. 

XII. Proposal Submitted/Awarded 2006/2007 

Phil Moss and Chris Tilly continued work on two multi-year projects previously awarded: 

Continuity and Change in Low-wage Work in Retail Trade in the United States: A Set 

of Company Case Studies, funded by the Russell Sage Foundation. Chris Tilly and 

Francoise Carre are the Principle Investigators, Moss is a consultant. 

European Case Studies of Low-Wage Work, The Food Processing Sector, funded by 

the Russell Sage Foundation 

The entire 2006-2007 CFCI award was used to support grad research assistants from 

RESD. The CFCI funded RA assistance supported the development of three aspects of 


189

the New England The two priority activities proposed 

in the 2006-2007 CIC proposal to CFCI were successfully supported. 

First, and most significantly, research on the literature on indicators at the 

community and the regional level was conducted and along with data exploration 

supported winning awards for seed funding from National Academy of Sciences and 

The Boston Foundation. Early in the year it supported a PowerPoint presentation on 

a desk top program developed in collaboration with IVPR to the November 4, 2006 

Annual meeting of NEARC. In addition, it supported research into the history of the 

New Regional Commission and other areas that was critical to support the efforts 

leading to the vitally important July 4, 2007 meeting at the New England Federal 

Reserve to consider the establishment of a New England Compact, a novel 

organizational effort. The CIC used the CFCI funding to hire a RESD graduate RA 

with considerable computer science experience who ably interfaced, coordinated 

with and supported the collaborations with IVPR as well as made original 

contributions in data collection and design of data base management. All these areas 

will need continued development as part of ongoing efforts to get sufficient external 

support to accomplish full scale development of the software and data base. 

Second, the CFCI RA funding supported the RESD graduate student RA to utilize 

Dun & Bradstreet firm level data and more complete employment data from public 

sources. This research provided supported for The New England Consortium 

(TNEC). TNEC received maps and data bases on over 90 NAICS defined industries 

using or disposing of hazardous materials in each of the six New England states. 

These resources aided their marketing of Hazardous Waste Management training 

programs. The value of this effort is evident in their continued support by purchasing 

a renewal of the license for CIC access to the DnB data base for continued updating 

of their firm level data base. 

Robert Forrant collaborated with other UML units and community organizations in 

securing external grants listed in the previous two sections. 

William Lazonick submitted to the Ford Foundation, June 26, 2007, on “Transnational 

collaboration on participative democracy,” linking activities of the CIC, CFWC and 

RESD UMass Lowell and Janaagraha Center for Citizenship and Democracy, for 

$135,528. Participating UCUIC affiliates included Forrant, Mass, Moss and Tilly. 

William Lazonick submitted a Collaborative proposal on finance and innovation to the 

European Commission, Framework 7 program, organized by the Open University, UK, 

and through University of Bordeaux, France. Submitted May 10, 2007; ranked highly in 

evaluation round. 

William Lazonick received funding from INSEAD R&D for the Conference on 

Innovation and Competition in the Global Communications Technology industry, held at 

INSEAD, Fontainebleau France, August 23-24, 2007; 23,000 Euros. 


190

William Lazonick is a participant in a project at the 

Institute of International Business, Stockholm School of Economics, funded by Svenska 

Handelsbanken. His portion will fund a RESD RA working with the CIC over several 

years. 

William Mass was awarded $14,000 to Commonwealth Corporation to fund a graduate 

research assistant to analyze data on the performance of National Emergency Grants 

awarded primarily to manufacturing firms displacing large numbers of employees. The 

report was completed by June 30, 2007. 

William Mass was awarded $6,000 by Institute for Sustainable Communities for work 

undertaken by Senior Research Fellow David Soule to develop a “Game Plan for New 

England Futures” that was a follow on to the New England Futures project. This report 

was completed March 20, 2007. 

William Mass was awarded $21,000 ($11,000 from the National Academy of Sciences 

and $10,000 from The Boston Foundation as matching grants) in support of the 

development of a demo project for New England Indicators and Measures. This project is 

a collaborative project with IVPR and Director Georges Grinstein is a Co-Principal 

Investigator. This project emerged out of the efforts stimulated by and with limited 

support from CFCI award of $5,150 in January 2006 as part of the Innovation Grants 

program. 

William Mass was awarded $22,000 from the Massachusetts Economic Assessment and 

Analysis Project for a series of reports on Massachusetts high tech employment and 

exports, and regional high technology industry development for the seven Benchmark 

regions. All but two of the reports were completed by August 31, 2007. 

William Mass secured donations to the CIC New England Initiative program of $5000 

from the New England Association of Regional Councils and its members and $5000 

from Data Haven is a community project led by a volunteer Board of Directors as part of 

the south central Connecticut Regional Growth Partnership 


191

16. THE CENTER FOR INTELLIGENT BIOMATERIALS 

Annual Report: July 30, 2007 

Director: Professor Kenneth A. Marx 

EXECUTIVE SUMMARY 

The Center for Intelligent Biomaterials (CIB) has carried out research in a number 

of different project areas. We have actively collaborated internally at UML with: Prof. 

Georges Grinstein, IVPR, Center for Biomolecular and Medical Informatics, Prof. Alkim 

Akyurtlu, Dept. Elec. Eng, and CMOS, Prof. Susan Braunhut, Dept. Biol. Sciences, and 

Profs. Joey Mead and Carol Barry, Dept. Plastics Eng., NSF Nanomanufacturing Center. 

Externally, we have collaborated with Dr. M.L. Ujwal, Brandeis University, Director of 

Bioinformatics and Scientist at Eli Lilly, Prof. S. Badylak, McGowan Inst. Tissue 

Regeneration, Univ. Pittsburgh and Prof. R. Dima, University of Cincinnati. A total 

amount of $ 1,358,800 in grant funding was received during this past year to fund CIB 

related projects and was used to fund research. Significant funding was obtained from 

DARPA during this past year’s research, as well as minor support from the NSF 

Nanomanufacturing grant. The various projects involved 4 Ph.D. students within the 

center collaborating with various Ph.D. students, Postdoctoral fellows, technicians in the 

different centers or academic groups with which we collaborated. This research resulted 

during 2006 and 2007 in the publication or in press status of 15 full length refereed 

papers. Two major Review articles written by the Director, have appeared this past year 

as Book Chapters in the volumes entitled: ‘Smart Biosensor Technology’ and 

‘Piezoelectric Sensors’ Vol. 6. The Director also served as Guest Editor for a Special 

Thematic Issue of Microscopy Research and Technique, where he is on the Editorial 

Board, entitled: “Facilitating Nanomanufacturing Using Microscopy Techniques.” This 

Special Issue appeared recently in the June, 2007 issue of the journal with an Introduction 

and a research article contributed by the Director. Also, 1 continuation in part patent 

application was filed on Chiral Metamaterials as well as moving along in process 2 other 

patents, including the Smart Bandage, that were filed in previous annual report years. The 

Center is a co-investigator on recently funded major multi-year DARPA Grant ($ 

1,192,000) in collaboration with Prof. Susan Braunhut. The second year grant funding 

from DARPA is currently in the process of being awarded. 

1. MISSION STATEMENT 

The primary aim of the Center for Intelligent Biomaterials is to achieve excellence in 

basic and applied research on the evolved intelligent or smart properties of biological 

macromolecules for biomaterials applications and to promote its research advances in 

order to support and sustain the regional economic and social development of 

The Center for Intelligent Biomaterials 

192

Massachusetts. To implement the mission we provide 

students with an affordable educational experience geared toward carrying out research at 

the undergraduate and graduate levels. The informational and smart properties of 

biological molecules and structures have value intrinsically (DNA information/ function, 

gene and protein sequence and structure recognition and function in Biotechnology) or as 

applied signal transduction or analyte recognition elements of integrated systems 

(biosensors, smart materials, clinical devices, whole cell biosensors) or in creating 

structures that can manipulate EM 

radiation in unusual ways (double negative metamaterials). To achieve these aims, we 

foster interdisciplinary research projects over a wide range of subject areas involving 

collaborations with other U Mass Lowell CFCI Centers and Institutes and research 

groups as well as external research groups and companies. These aims are implemented 

by obtaining external federal grant funding and U Mass Lowell/industry collaborative 

funding from the high technology and biotechnology/pharmaceutical sectors. 

2. GENERAL DESCRIPTION AND GOALS 

The Center for Intelligent Biomaterials is a UML recognized center that carries out 

innovative basic and applied biomaterials/biosensors research in a number of areas at the 

interface of cell biology, biochemistry, computer Science, molecular biology and polymer 

science. Major collaborative projects involve the ‘Smart Bandage’ technology and 

development of Quartz Crystal Microbalance Biosensors for clinical diagnostic use. The 

former will speed up the rate of wound healing and tissue regeneration and the latter will 

provide clinical diagnosis of oncological specimens to the practicing physician. Research 

in bioinformatics and cheminformatics is being pursued to understand properties of 

proteins and nucleic acids and their interactions with small molecules so that these 

macromolecules can be incorporated into the design of 'smart' biomaterials and 

biosensors. Biosensors are also being designed that incorporate the smart properties of 

whole cells into the signal transduction pathways of the devices. In our most recent 

collaborative project, we have focused on research to develop and construct novel Chiral 

Metamaterials for unusual optical applications in instrument design and specific 

applications such as enriching the drug discovery process. In the Center, we apply a 

variety of techniques in Information Technology, computational simulations, Biophysical 

Chemistry and Molecular Biotechnology to the systems under study. 

3. RESEARCH GROUPS AND ACTIVITIES FOCUS AREAS 

In addition to the detailed list of projects presented in Section VI. below, the CIB 

has three major focus areas for research described immediately below: 

1. The first area is developing the QCM device as a cell biosensor and the study and 

development of a Smart Bandage for enhanced wound healing applications and also to 

characterize the meso and nano structures of thin polymeric films grown 


193

electrochemically and enzymatically. We have had 

great success in all of this activity with new research published on thin films as well as 

cell biosensing research. We collaborate with the research group of Profs. Braunhut 

(Biological Sciences) as well as with the NSEC Nanomanufacturing Group of Profs. 

Mead and Barry on different aspects of this research. During this past year, we have 

obtained and finished the first year of DARPA funding as part of a 6 University 

consortium developing novel mammalian limb regeneration technology in collaboration 

with Univ. Pittsburgh, Northwestern U., U. Utah, Cornell U. and the Wistar Inst. 

2. The second area is in computational genomics and molecular biology. We are using the 

large public databases of DNA from different organisms to ask questions concerning: a) 

sequence usage and location in the genome; b) DNA thermodynamic stability and its 

relationship to other statistical metrics including the information content of the DNA 

sequences; c) applying high dimensionality visualization and data mining techniques to 

gene expression and chemical compound (quinone molecules) descriptor datasets (with 

Dr. Ujwal, Eli Lilly) and to gene expression data sets for tissue regeneration studies (with 

Prof. Grinstein IVPR); and d) utilizing physical property parameter calculations of DNA 

sequences to understand the sequence properties and interactions with sequence specific 

binding proteins; e) using entropy function approaches to determine the quantitative 

charge distribution distributions of different protein families for the purpose of functional 

classification (with Prof. R. Dima). 

3. In the third area, a collaboration with Prof. Alkim Akyurtlu, Dept. Elec. & Comput. 

Eng. and CMOS and Prof. Bill Goodhue, Photonics Center, we have developed a 

significant project focused on creating novel chiral metamaterials. The objective is to 

create new optical components for new instrumental design applications in a variety of 

disciplines in the visible, near and far-IR, to name just a few possibilities. 

4. ASSOCIATED PERSONNEL 

Associated Faculty 

Prof. Kenneth A. Marx - Director, U Mass Lowell, Chemistry Dept./CIB 

Prof. Georges Grinstein - U Mass Lowell, Computer Science Dept., (IVPR) 

Prof. Edwin Jahngen - U Mass Lowell, Chemistry Dept. CIB 

Dr. Alkim Akyurtlu – Dept. Electrical and Computer Engineering, U Mass Lowell 

Dr. Nantaken Wongkasem - Dept. Electrical and Computer Engineering, U Mass Lowell 

Dr. Rajiv Pande, Department of Chemistry, CIB, Yale U. MBA, consultant 

NanoBiosensor Project 

Associated External Collaborators 

. 


194

Prof. George C. Ruben - Dartmouth College, Biol. 

Sciences Dept., GeoM Co., West Lebanon, NH 

Prof. Ruxandra Dima – Chemistry Dept., University of Cincinnati, Cinn., OH 

Dr. M.L. Ujwal – Dir. Bioinformatics Program, Brandeis University, Scientist, Eli Lilly, 

Indianapolis 

5. NEW RECENT FACULTY AFFILIATIONS 

Dr. M.L. Ujwal – Dir. Bioinformatics Program, Brandeis University, Scientist, Eli Lilly, 

Indianapolis 

Prof. Ruxandra Dima – Chemistry Dept., University of Cincinnati, Cinn., OH 

Dr. Micah Halpern – Midland Molecular Instittute, Midland MI 

Dr. Rajiv Pande, Department of Chemistry, CIB, Yale U. MBA, consultant 

NanoBiosensor Project 

6. DOCTORAL STUDENT SUPPORT/ CURRENT 

Mr. Jeffrey Bizzaro - U Mass Lowell, Chemistry Dept., Ph.D. candidate (Marx), Director, 

Bioinformatics.org 

Mr. Brad Hennemuth – U Mass Lowell, Chemistry Dept, Ph.D. candidate (Marx) 

Ms. Dina Wassaf – U Mass Lowell, Chemistry Dept., Ph.D. candidate (Marx) 

Mr. Chia-Ho Cheng - U Mass Lowell, Chemistry Dept., Ph.D. candidate (Marx) 

7. RESEARCH ACTIVITIES/COLLABORATIONS 

Computational Molecular Biology & Biochemistry 

1. Homopolymer tract characterization 

These simplest of repetitive sequence elements in all eukaryotic genomes are 

found with quite varying but higher than expected frequencies that suggest functional 

roles in cells. We have characterized poly [d(A).d(T)] and poly [d(G).d(C)] tracts in 28 

different eukaryotic organisms. A particular focus has been on an AT -rich organism D. 

discoideum, the slime mold, as well as human DNA and P. falciparum, the malaria 

parasite. This has been done both experimentally and by accessing and characterizing 

these sequences in the GENBANK database. This study is being extended to a range of 

other organisms of varying phylogeny as well as AT base composition, whose DNA 

sequences are available in GENBANK. We have also investigated the non-random 

spacing of poly [d(A).d(T)] tracts in the more AT-base rich organisms. These results are 

thought to be due to the tracts avoiding the core regions of nucleosomes. A paper was 

published this past year on the nucleosomal spacing of long tracts in D. discoideum and 

other A+T rich organisms. 


195

Prof. Kenneth A. Marx, Department of Chemistry, CIB 

Mr. Jeff Bizzaro, Ph.D. student, CIB 

Dr. Dang Duc Long, Ph.D. awarded, CIB 

2. Open Source Code Bioinformatics-www.bioinformatics.org 

The www.bioinformatics.org is an international non-profit organization that 

serves as a collaboratory and hosts part of The Open Lab. It's aim is the development of 

open source code software in bioinformatics and cheminformatics. Loci is a UNIX based 

network-distributed system of clients and servers ('loci') for data processing. Clients 

include control structure and graphical user interface loci. All loci are represented as 

nodes in a 'Workflow Diagram' and are joined by lines depicting network connections. 

This network forms the basis for a graphical scripting language. The network distributed 

nature of loci deals with large datasets in a unique way with GUI loci residing on a local 

workstation while compute intensive processing loci execute remotely on high 

performance computers. The joining of loci across the internet can be used to form 

worldwide collaborations. Numerous development tools include: Python, GTK+ , the 

Gnome environment, CORBA, DOM, XML, etc. The servers for www.bioinformatics.org 

are housed in the CIB as a service to the international scientific community. Nearly 

13,000 members worldwide use the website hosted in our Center. 

Department of Chemistry, CIB: 

Mr. Jeff Bizzaro, Director, Bioinformatics.org, Ph.D. candidate Dept. Chemistry, UML 

Prof. Kenneth A. Marx, Prof. Chemistry UML, Director CIB, Scientific Advisor, The 

Open Lab 

3. DNA Melting Simulation-MELTSIM as a Bioinformatics Tool 

Bioinformatics tools are needed to analyse the massive sequence databases 

resulting from the Human Genome Project. Raw DNA sequence can be studied in terms 

of 

its equilibrium thermodynamic melting behavior. We have developed the use of 

MELTSIM to simulate DNA equilibrium melting properties. MELTSIM is a suite of 

programs built around a statistical mechanical algorithm that simulates the equilibrium 

melting states of any DNA sequence. We have shown that MELTSIM accurately 

simulates the experimental melting behavior of an entire eukaryotic genome (yeast-S. 

cereviseae: 12,067,277 bp). MELTSIM can also calculate and display the melting 

behavior or regions along any given sequence. For example, we have demonstrated the 

utility of the positional melting feature of MELTSIM to identify exons in multi-exon 

genes in the AT-rich organisms D. discoideum and S. mansoni, as well as to display the 

melting along entire yeast chromosomes. We have extended MELTSIM to study more 


196

than 8,000 DNA sequences from nearly 30 eukaryotic 

organisms over the entire 20-70-% GC base composition range. MELTSIM is also being 

studied as a way to classify microorganisms based upon the details of the melting of their 

RNA species. Melting is also beginning to be used as a tool in phylogenetic analyses of 

short oligonucleotide sequences in collaboration with Dr. M Halpern. 


Adjunct Prof. Richard D. Blake - U Mass Lowell, Chemistry Dept./CIB(Emeritus Prof., 

U. Maine) 

Dr. Micah Halpern – Midland Molecular Institute, Midland, MI 

Mr. Jeffrey Bizzaro, Ph.D. student, Department of Chemistry, CIB, Dir. 

www.bioinformatics.org 

4. Physical Property Calculations of DNA Sequences- Helping to 

Model DNA-Proteins interactions in the Eukaryotic Centromere 

We utilize experimentally parameterized dinucleotide and trinucleotide DNA sequence 

property datasets to calculate sequence properties and demonstrate correlations with the 

experimentally determined physical properties of those DNA sequences as well as the 

protein binding properties of those DNA sequences. Our initial proof-of-principle 

research work has focused on the short yeast Centromere sequences. We have 

demonstrated novel and interesting correlations of calculated physical properties of two 

specific protein binding sites with the specific protein affinity constants as well as real 

biological outcomes such as measured chromosome loss rates in characterized DNA 

mutants of the the yeast centromeres. During this past year we have had one major paper 

published in a high impact factor journal (BMC Bioinformatics), and another was 

recently submitted to the IEEE Proceedings Symposium 7 th Intl BIBE Conf. and is now 

in press. 


Dr. Dang Duc Long, Ph.D. awarded, Department of Chemistry, CIB 

Mr. Brad Hennemuth – U Mass Lowell, Chemistry Dept, Ph.D. candidate (Marx) 

5. Vis/Datamining of large biological databases 

We are carrying out visualization and data mining analyses of genomic DNA and 

protein sequence data from the Human Genome Project, as well as other large 

biotechnological and pharmaceutical company functional genomics datasets. In the past, 

funding from Pfizer, Millenium Pharmaceuticals and Genetics Institute has supported 

previous work in collaboration with the IVPR at UML. We have been heavily involved in 

setting up a joint Bioinformatics Option Program at the B.S., M.S. and Ph.D. level in the 

Computer Science, Biology and Chemistry Departments at UML. Currently, we are 


197

working with a former AnVil start-up and Brandeis 

University colleague, Dr. ML Ujwal, now at Eli 

Lilly, IN. on the characterization of quinoid compounds in the NCI Cancer Compound 

Screening Database. 


Prof. Georges Grinstein, IVPR at UML 

Dr. Dang Duc Long: Ph.D. awarded (Marx) 

Dr. M.L. Ujwal, Dir., Bioinformatics Program, Brandeis Univ., Scientist, Eli Lilly 

6. Chiral Metamaterials 

We have continued studies, initially via EM Theory calculations, to identify novel 

optical properties of various repeating structures that form metamaterials. Metamaterials 

possess double negative, and in some cases, chiral properties that allow them to 

differentially interact with different light polarizations. Experiments during the past year 

on devices in the microwave and THz (with Prof. Bill Goodhue) frequency ranges have 

verified that real devices possess the simulated properties we had previously calculated. 

This new class of optical materials will be useful in creating new types of unique optical 

elements for use in many different fields of optical instrument technology. We have 

converted a provisional patent to a filed utility patent during the past year based upon this 

research and have submitted another disclosure to the CVIP for an application of 

metamaterials to the design of a novel nanoprobe instrument. In addition, 4 full length 

papers have been published and a fifth has been submitted. 


Prof. Alkim Akyurtlu, Department of Elec. Eng., CMOS 

Nantaken Wongkasem, Department of Elec. Eng., Ph.D. awarded, CMOS 

Prof. Bill Goodhue, Photonics Center, UML 

7. DARPA Funded Mammalian Limb Regeneration 

This new DARPA funded multi-institution collaboration involves data mining of 

salamander microarray experiments conducted by experimentalists at the Univ. of Utah 

and Northwestern U. and new mouse microarrays. We have finished the first year of 

funded research activity. We are involved in developing a molecular signature for the 

regenerating mammalian blastema during digit regeneration following amputation. Also, 

we will be involved in the development of a model for the regenerating mammalian limb 

in the later stages of the DARPA funding. 


198

Prof. Kenneth A. Marx, Department of Chemistry, 

CIB 

Prof. Susan Braunhut, Department of Biological Sciences 

Dr. Kate Vorononikova, Biology Dept. 

Mr. Chia-Ho Cheng, Department of Chemistry, CIB, Ph.D. student (Marx) 

Mr. John Sharko, Department of Computer Science at UML, student (Grinstein) 

Other DARPA Team Members: 

Prof. Steve Badylak, Univ. Pittsburgh 

Prof. Ellen Heber Katz, Wistar Institute 

Prof. Lorraine Gudas, Columbia U. 

Prof. Shannon Odelberg, Univ. Utah 

Hans Georg Simon, Northwestern U. 

8. Computational Protein-Drug Structure & Biochemistry 

A new collaboration this year has been initiated with Prof. R. Dima, University of 

Cincinnati. The focus is on the use of bioinformatics and cheminformatics approaches to 

carry out a number of computational research tasks. The first is to classify the hundreds 

of protein structure/function families in the public databases based upon the statistics of 

their amino acid residue type distributions within the primary sequences of the members 

of each family. The second is to investigate the molecular dynamics and stretching 

energetics of constituent microtubule proteins a/b tubulins +/- tubulin binding drugs. 

These studies have potential biomedical implications for drug development. 


Prof. Ruxandra. Dima, Department of Chemistry, University of Cincinnati 

Ms. Dina Wassaf, Department of Chemistry, CIB, Ph.D. student (Marx) 

Smart Systems Development 

1. QCM Studies of cells-cellular biosensor & wound healing 

system development 

In this collaboration with the research group of Prof. Susan Braunhut in the Dept. 

of Biological Sciences at UML, we have examined two project areas. 1) The attachment 

and viscoelastic properties of normal and transformed endothelial cells binding to the 

gold electrode surface of the Quartz Crystal Microbalance (QCM). It may be possible to 

develop a useful sensor for whole cell properties using this approach. This approach 

could be used as a complex and sensitive cell based biosensor of interest to the 

biotechnology and pharmaceutical industry for the detection of molecules having distinct 

effects on attached cells. As well, we are hoping that the QCM will be useful for the 

diagnosis of patient oncological biopsy specimens. This has led us to funding from the 


199

Army for a Homeland Security Grant oriented grant 

to investigate the use of cell QCM biosensor for detection of airborne chemicals and 

toxins. 2) We recently finished a DARPA funded Grant to investigate the growth 

stimulation effects and uncover the mechanism of underlying negative potentials on 

adhering endothelial cells as a model for wound healing. We have also filed two pending 

patents, one on a 'smart' bandaid concept and the other on use of the whole cell QCM 

biosensor in drug discovery and clinical diagnosis. This research has led to the significant 

6-institution consortium DARPA funded grant award mentioned above to develop Human 

Limb Regeneration capability. A new activity to be initiated soon this year will be a 

biosensor project to develop a robust QCM for field deployment using living cells for 

detection of complex biological threats. 

Two major Review articles in the area of biosensors written by the Director, have 

appeared as Book Chapters in the volumes entitled: ‘Smart Biosensor Technology’ and 

‘Piezoelectric Sensors’ Vol. 6. 



Postdoctoral Fellow, to be hired (Potentially Dr. Ales Dostal) 

Mrs. Donna McIntosh, Biology Dept. 

2. NSF NSEC Nanomanufacturing 

We are engaged in research as part of a 5-year funded NSF project, which is to 

create a nanobiosensor that may be applied to breast cancer detection. Initially, the 

project goals are to create a substrate with nanoscale features that can be used to 

immobilize oriented antibodies specific for the detection of cancer protein antigens. We 

are trying a chemistry oriented approach for antibody orientation. A number of major 

technical issues must be solved before this biosensor becomes a reality. 

. The Director also served as Guest Editor for a Special Nanomanufacturing 

Thematic Issue of the research journal Microscopy Research and Technique, where he is 

on the Editorial Board. The special June, 2007 issue recently appeared and contained and 

Introduction and one research article written by the Director as well as 7 other refereed 

articles. The Special Issue is entitled: “Facilitating Nanomanufacturing Using 

Microscopy Techniques.” 



Dr. Rajiv Pande, Department of Chemistry, CIB, Yale MBA 

Mr. Vikram Shankar, Department of Biological Sciences, UML 

Prof. Joey Mead, CHN, Dept. Plastics Eng. 

Prof. Carol Barry, CHN, Dept. Plastics Eng. 

8. PUBLICATIONS & PATENTS (only 2005 & 2006 & refereed) 


200

Patents 

“Chiral Metamaterials” (A. Akyurtlu, K.A. Marx, N. Wongkasem) Utility patent filed 

1/18/06 with 

US Patent Office. 

“Nonlinear Metamaterials Properties Applied to the Design of a Novel THz Tunneling 

Gap Microscope” (A. Akyurtlu, J. Therrien, K.A. Marx) Disclosure filed with CVIP 

6/15//05. 

Publications 

I am Guest Editor of a Special Thematic Issue of the journal Microscopy Research and 

Technique: “Facilitating Nanomanufacturing Using Microscopy Techniques”. Around 9 

contributed research articles and reviews are currently being submitted to me and sent for 

review for this issue, in press (2006). 

“Calculated Tertiary Structure Properties of the Saccharomyces cerevisiae Centromere 3 

DNA and its Mutants Correlate with their in vivo Chromosomal Loss Rates,” (K.A. Marx 

and D.D. Long), IEEE Proceedings 7 th BIBE, (2007) in press. 

“A Machine Learning Approach to Pharmacological Profiling of the Quinone Scaffold in 

the NCI Database: Effective Against Melanoma and Leukemia Cell Lines,” (M.L. Ujwal, 

P. Hoffman and K.A. Marx), IEEE Proceedings 7 th BIBE, (2007) in press. 

“Evidence for Proximal to Distal Limb Amputation Site Effects from Global Gene 

Expression Correlations found in Newt Microarrays,” (K.A. Marx, J. Sharko, G.G. 

Grinstein, S. Odelberg and H.G. Simon), IEEE Proceedings 7 th BIBE, (2007) in press. 

“Heat Map Visualizations Allow Comparison of Multiple Clustering Results and 

Evaluation of Dataset Quality: Application to Microarray Data,” (J. Sharko, G.G. 

Grinstein K.A. Marx, J. Zhou, C.H. Cheng, S. Odelberg and H.G. Simon), Proceedings 

Euro InfoViz (2007) in press. 

“Development of Negative Refractive Index Chiral Metamaterials in the Optical 

Frequency Regime,” (N. Wongkasem, A. Akyurtlu, K.A. Marx), IEEE Trans. Antennas & 

Propagation, Special Issue on Optical and THz Antennae Technology, in press (2007). 

“Fabrication of a Novel Micron Scale Y-Structure Based Chiral Metamaterial: Simulation 

and Experimental Analysis of its Chiral and Negative Index Properties in the Terahertz 

and Microwave Regimes,” (N. Wongkasem, A. Akyurtlu, K.A. Marx, W.D. Goodhue, J. 

Li, Q. Dong, E.T. Ada), Microscopy Res. Tech., 70, 497-505 (2007). 


201

“Enabling Nanomanufacturing Using Microscopy 

Techniques,” (K.A. Marx), Microscopy Res. Tech., 70, 493-496 (2007). 

“A Comparative Study of the Cytoskeleton Binding Drugs Nocodazole and Taxol with a 

Mammalian Cell Quartz Crystal Microbalance Biosensor: Different Dynamics Responses 

and Energy Dissipation Effects,” (K.A. Marx, T. Zhou, A. Montrone, D. McIntosh and 

S.J. Braunhut), Analytical Biochemistry, 361, 77-92 (2007). 

“The Quartz Crystal Microbalance and the Electrochemical QCM: Applications to 

Studies of Thin Polymer Films, Electron Transfer Systems, Biological Macromolecules, 

Cells and Biosensors,” (K.A. Marx) In: Piezoelectric Sensors 5, (A. Janshoff and C. 

Steinem, eds.) Springer-Verlag, Berlin and Heidelberg, Series on Chemical Sensors and 

Biosensors, 371-424 (2007). 

“Toward Understanding the Intelligent Properties of Biological Macromolecules- 

Implications for Their Design into Biosensors,” (K.A. Marx) In: Smart Biosensor 

Technology, (G. Knopf and A. Bassi, eds), CRC Press, Taylor & Francis, New York, 3-81 

(2007). 

“Group Theory Based Design of Isotropic Negative Refractive Index Metamaterials,” (N. 

Wongkasem, A. Akyurtlu and K.A. Marx) Prog. in Electromagnetics Res., 63, 295-310 

(2006). 

“Development of Double Negative Metamaterials in the THz Regime,” (N. Wongkasem, 

A. Akyurtlu, K.A. Marx) Proceedings SPIE (Invited), Boston, MA, 6373, in press 

(2006). 

“Development of Double Negative Chiral Metamaterials in Visible Regime,” (N. 

Wongkasem, A. Akyurtlu, K.A. Marx), IEEE AP-S Int’l Symp. And USNC/URSI Nat’l 

Radio Science Meeting, Albuquerque, in press (2006). 

“DNA Deformability Changes of Single Base Pair Mutants within CDE Binding Sites 

within S. cerevisiae Centromere DNA Correlate with Measured Chromosomal Loss rates 

and CDE Binding Site Symmetries,” (B. Hennemuth and K.A. Marx) BMC Molecular 

Biology, 7, 12-20 (2006). 

"Evidence for Long Poly(dA).Poly(dT) Tracts in D. discoideum DNA at High 

Frequencies and Their Preferential Avoidance of Nucleosomal DNA Core Regions," 

(K.A. Marx, Y. Zhou and I. Assil), J. Biomol. Str. & Dyn., 23, 429-446 (2006). 

9. CONFERENCES/PANELS 


202

1. Attended 15 th Conversation in Biomolecular 

Structure and Dynamics, SUNY Albany, Albany, NY on 6/19-6/23/07. I presented a 

research study along with my Ph.D. student Dina Wassaf. 

2. Jaipur, India, 4/1-4/10/06 traveled to visit and review programs at the Birla Institute of 

Science and Technology in Jaipur. I was hosted by Dr. Harish Pande, former Vice 

Chancellor at Birla Institute. 

3. 7 th Int’l BIBE, IEEE Conf. Workshop Co-Chair of 4 th UMAss Bioinformatics 

Conference- Oct. 14-17, 2007. 

4. Attended and presented talks at the following DARPA Funders conferences for RIR 

Project: 

a. Keystone Resort, Keystone, Colorado, May. 2006 

b. Fort Sam Houston, San Antonio Texas, Nov. 2006 

c. Northwestern Univ. Sept, 2006 

d. Walter Reed Army Hospital, Dec, 2006 

e. Cornell Univ. NYC, March, 2007 

f. Grand Teton Lodge, Jackson Hole Wyoming, May, 2007 

Clinical Biosensor, Wound Healing, Metamaterials and Bioinformatics 

Commercialization Technology Presentations Made to Obtain Development 

Funding: 

U Mass Lowell Industry Day 4/28/06 

Q-Sense, Inc. Materials Res, Soc, Mtg. Presentation CEO, Pres Cell QCM 

Biosensor Nov. 2006 

Triton Systems, Inc., Oct. 2006 

Club 

Warren Isabelle, BOD Arts and Sciences, Oct 17, 2006 Presentation UMAss Fac. 

DARPA Director Dr. Tony Tether and representatives, Spring 2007 

Kimberly Clark, Inc., Law firm representatives- June, 2007 

10. INTRA-UNIVERSITY and INTER-UNIVERSITY COLLABORATIONS 

The CIB carries out active intra-university collaborations with a number of different 

Centers and individual investigators. Here I list them briefly. I have already described 


203

these collaborations in great detail in section VI. 

Current and Recent Research Projects and refer the reader to the appropriate pages. 

1. High Dimensionality Visualization and Data mining in Bioinformatics-collaboration 

between my CIB and the IVPR, Director Prof. Georges Grinstein and with Dr. ML Ujwal, 

Dir. Bioinformatics Program Brandeis Univ. and Eli Lilly. 

2. Development of QCM cell biosensor technology for Homeland Security (new Army 

Biosensor Grant), drug discovery and clinical diagnostics, 'Smart' Bandage project for 

enhanced wound healing-collaboration and DARPA funded Mammalian Limb 

Regeneration between my CIB and research group of Prof. Susan Braunhut, Dept. 

Biological Sciences. This collaboration involves 5 other University and Research 

Institutions: Univ. Pittsburgh, Univ. Utah, Northwestern Univ., Wistar Institute, Cornell 

Univ. 

3. Developing novel chiral metamaterials systems that possess unusual optical properties 

for all types of optical instrumentation and telecommunications activities. A collaboration 

with the CIB and the research group of Prof. Akyurtlu (Dept. EE) in CMOS. In this 

project we collaborate as well Prof. Bill Goodhue, Photonics Center on the fabrication of 

metamaterials structures. 

4. Bioinformatics and cheminformatics studies of protein sequences in the public 

databases to understand the functional classification of proteins based upon their 

distributions of charged residues analyzed through an entropy based metric. Also, 

molecular dynamics and molecular stretching studies will be performed on the 

biologically important tubulin polymerizing protein system interacting with medically 

important drugs in current and future use as cancer chemotherapeutic agents. This is a 

collaboration wit Prof. R. Dima, Univ. Cinncinnati, OH. 

11. REGIONAL/LOCAL COMMUNITY AND INTERNATIONAL TECHNICAL 

OUTREACH 

In the area of regional, national and international technical outreach, for the past 8 years 

the CIB has hosted The Open Lab, at www. bioinformatics.org. www.bioinformatics.org 

is a >15,000 member international open source code software collaboratory comprised of 

over 1000 active volunteer software developers worldwide. Its aim is to create free 

software for the bioinformatics community worldwide. The CIB hosts two servers that 

house the www.bioinformatics.org website and helps promote the activities of this 

volunteer service non-profit organization. Mr. Jeffrey Bizzaro, Director of The Open Lab, 

is currently a Ph.D. student in Prof. Marx's research group within the CIB. 

12. FUNDING 


204

Funded Current/Past Year total: $ 1,487,800 

DARPA Funding-Mammalian Limb Regeneration (3/15/06-3/14/08) 

Co-PI with Prof. Sue Braunhut, PI $ 1,192,000 

Army Sensor Nanomanufacturing Program, PI with Prof. Braunhut $ 141,000 

Chiral Metamaterials Seed Funding, PI with Prof. A. Akyurtlu $ 

132,800 

CFCI Innovation Grant RA Funding- 1 yr $ 

22,000 

Pending total: $ 346,225 

DARPA 2 nd Year Funding ‘Mammalian Limb Regeneration’ Project, 

Co-PI with Prof. Susan Braunhut PI $ ~1,200,000 

CFCI Innovation Grant RA Funding- 1 yr $ 

22,000 

13. JOURNAL EDITORIAL/REVIEW BOARDS/SCIENTIFIC ADVISORY BOARDS 

Journal Editorial Boards: Microscopy Research & Technique; Journal of 

Bionanoscience. 

Journal Review Boards: Proceedings National Academy of Science, USA; 

Biopolymers; J. Biomolecular Structure and Dynamics; Biochim Biophys. Acta.; 

Inorganica Chimica Acta.; Protein Purification and Expression; Biochemistry; 

Biophysical Journal, Microscopy Technique & Structure, Biomacromolecules, 

Langmuir, Biosensors and Bioelectronics, Biotechnology Progress 

Consulting/contract research: consulting for and contract funding from a variety 

of biotechnology, pharmaceutical and biomaterials companies- Morphogenesis, 

Inc., GeoMCo., AnVil, Inc., ChiScientific, Inc., External Reviewer for Center 

Proposals for the Science Foundation Ireland. 

Scientific Advisory Board Memberships: Co-Founder of AnVil Informatics, Inc. 

and Scientific Advisory Board Member and Consultant; ChiScientific, Inc., 

Scientific Advisor and consultant. Scientific Advisor of The Open Lab (at 

www.bioinformatics.org), an international Open Source Bioinformatics Software 

development collaboratory. 


205

Grant Reviewer: National Science 

Foundation, Army Research Office, State of Maine 

Agricultural Grants Program, California Seed Grants Program, UML Seed Grant 

Program, USDA, 

Textbook Reviewer: Benjamin Cummings Co., Inc.; Oxford University Press, 

University Science Books, Addison Wesley, John Wiley & Sons 

14. STRATEGIC GOALS 

Our major Center (CIB) strategic goals are as follows: 

1. In collaboration with the Center for Biomolecular and Medical Informatics, the CIB 

will continue to promote the new Bioinformatics Options in Computer Science and 

Biological Sciences, as well as promote the interdisciplinary interaction necessary to 

foster novel bioinformatics research between our two Centers and on the UML campus as 

a whole. During this past year we have worked jointly on a CFCI funded project to 

develop Breast Cancer Clinical standard software. Also, the 4th University of 

Massachusetts Bioinformatics Conference will be held on Oct. 14, 2007 at the 7 th Int’l 

BIBE, an IEEE Conference, as a result of our Centers working together. 

2. The CIB’s collaboration with Prof. Alkim Akyurtlu, Dept. Electrical Engineering, on 

the development of novel chiral metamaterials properties is now in its third year. We have 

made substantial progress both from the standpoint of calculated simulations of how the 

real device interacts with EM radiation as well as experimental verification in the 

microwave and THz via device fabrication and experimentation. This has resulted in 

three submitted disclosures to CVIP, a filed utility patent application as well as an 

additional CIP filing; and an NSF Proposal to create a novel nanoprobe THz Scanning 

Tunneling Gap Spectroscopy device incorporating metamaterials. We are actively seeking 

funding through DARPA and other federal funding agencies. 

3. We have recently broadened the collaboration between the CIB and the research group 

of Prof. Susan Braunhut, Dept. of Biological Sciences. We have adopted a QCM cell 

biosensor to Homeland Security diagnostics applications. We have also developed a 

Smart Bandage project that has had commercialization funding from the Chancellor and 

for which we received significant funding from DARPA during this report period. The 

CIB has now finished the first year of participation in a major 6-university consortium 

DARPA Proposal to develop a mammalian limb regeneration model system. We are 

continuing in the second year of funding of this project. 


206

17. CENTER FOR NETWORK AND 

INFORMATION SECURITY 

(CNIS) 

Annual Report of Research Activities 

For the Period of August 2006 to August 2007 

J. Wang, Director 

Table of Contents 

1. Mission Statement of CNIS …………………………………………………….. 

2. General Description and Goals ………………………………………………… 

2.1. Purpose 

………………………………………………………………………. 

2.2. Goals 

…………………………………………………………………………. 

3. Research Focus Areas …………………………………………………………... 

4. Associated Personnel ……………………………………………………………. 

5. Students Supported ……………………………………....................................... 

6. Current Research Projects ……………………………………........................... 

6.1. Research Projects 

……………………………………………………………. 

6.2. Research Laboratories 

……………………………………………………….. 

7. Publications (August 2006-August 2007) ……………………………………… 

8. Conference Presentations (August 2006-August 2007) ……………………….. 

9. Invention Disclosures ………………………..………………………..………… 

10. Collaborators with Other Centers/Institutes and/or Departments ………….. 

11. Regional/Local Outreach and Professional Service …………………………... 

11.1. Research Seminar 

……………………………………………………………. 

11.2. Conference/Workshop Technical Programming Committee Members, 

Chairs, 

Organizers 

…………………………………………………………… 

11.3. NSF and Other Funding Agencies Grant Proposal Reviewing 

……………… 

12. External Proposals Submitted/Awarded 2006/2007 ………………………….. 

13. Results of CFCI Support ……………………………………………………….. 

1 

2 

2 

2 

2 

3 

3 

4 

4 

5 

5 

8 

9 

9 

9 

9 

10 

11 

11 

13 

CENTER FOR NETWORK AND INFORMATION SECURITY 

207

1. Mission Statement of CNIS 

The Center for Network and Information Security (CNIS) is to assist the university 

fulfilling its mission of providing high quality and affordable education to students. CNIS 

is focusing its efforts of research, teaching, and public service on critical issues of cyber 

security and related areas. 


Network and information security (NIS) is a fast growing new area in industrial 

development, academic curriculum, and theoretical research. NIS involves multiple 

disciplines including computer science, computer engineering, and mathematics. Listed 

below are the purposes and goals of CNIS. 

1.1. Purpose 

1. Provide a structure to implement and improve teaching and research in 

network and information security across multiple disciplines in multiple 

departments. 

2. Improve visibility of our network security programs and research activities. 

1.2. Goals 

Increase productivity of NIS teaching and research across multiple disciplines: 

1. Involve and attract more students to study network and information 

security. 

2. Increase activities of joint grant proposals and carry out joint research 

projects. 

3. Direct doctoral and master’s students on interdisciplinary thesis research. 

4. Recruit undergraduate students to participate in research projects. 

5. Increase collaboration with local computer companies. 


CNIS focused its research in the reported period on the following areas: 

1. Wireless sensor network deployments and applications 

2. Intrusion detection in wireless networks 

3. Network processor programming paradigm and compiler optimization 

4. Database security and spatial-temporal database management 


208

5. Energy consumption analysis of microprocessors on security functionalities 

6. Software forensics 

7. Performance modeling and analysis of network processors 


Professor: 

1. Dr. J. Wang, Director 

2. Dr. Mark Yin (retired in Spring 2007) 

Associate Professor: None 

Assistant Professor: 

3. Dr. Cindy Chen 

4. Dr. Guanling Chen 

5. Dr. Adam Elbirt, Associate Director 

6. Dr. Ben Liu 

7. Dr. Yan Luo 

8. Dr. David Martin 

9. Dr. Li Xu 

Affiliated personnel from other universities 

10. Dr. Wenjing Lou, WPI (Her activities are not reported in this report) 


Doctoral students: 

1. Stanley Barr (Advisor: D. Martin) 

2. Stephen Brington (Advisor: J. Wang) 

3. Abdeslam Elhajjajy (Advisor: L. Xu) 

4. Jie Fan (Advisor: Y. Luo) 

5. Nan Li (Advisor: G. Chen) 

6. Wei Li (Advisor: C. Chen) 

7. Piti Piyachon (Advisor: Y. Luo) 

8. Faruq Rahman (Advisor: D. Martin) 

9. Anwar Saipulla (Advisor: B. Liu) 

10. Ke Xiang (Advisor: Y. Luo) 

11. Zhi Yang (Advisor: L. Xu) 

12. Hongda Yin (Advisor: G. Chen) 

13. Zhijun Yu (Advisor: J. Wang) 

14. Ning Zhong (Graduated in November 2006. Advisor: J. Wang) 


209

MS students: 

15. Homayara Akter (Advisor: G. Chen) 

16. Sean Casey (Graduated in January 2007. Advisor: B. Liu) 

17. Chunyan Du (Advisor: J. Wang) 

18. Peter Gamache (Advisor: A. Elbirt) 

19. Prabhu Govindaswamy (Supported in part by FY-2006-07 CFCI grant. 

Advisor: G. Chen and J. Wang) 

20. Chris Hayes (Advisor: Y. Luo) 

21. Zhonghong Huang (Supported in part by FY-2005/2006 CFCI grant. 

Graduated in May 2007. Advisor: B. Liu and J. Wang.) 

22. Justin Latham (Advisor: Y. Luo) 

23. Chun-Yin (Cathy) Liu (Advisors: G. Chen and G. Livingston) 

24. Sourav Maity (Advisor: Y. Luo) 

25. Andrew Oliveira (Advisor: A. Elbirt) 

26. Sean O’Melia (Advisor: A. Elbirt) 

27. Wesley Owen (Advisor: D. Martin) 

28. Aiken Pang (Advisor: Y. Luo) 

BS students: 

29. Jeff Beckwith (Advisor: C. Chen and J. Wang) 

30. Steven LeBoeuf (Advisor: L. Xu and J. Wang) 


5.1. Research Projects 

CNIS research projects in the reported period were centered on its research focuses, 

including 

1. Parameterized wireless sensor network coverage with minimum cost 

2. Wireless intrusion detection 

3. Network processor programming paradigm and compiler optimization 

4. Spatial-temporal database systems 

5. Energy consumption analysis of microprocessors on security functionalities 

6. Instruction set extensions to accelerate cryptographic algorithms 

7. Sensor network benchmarking 

8. Fine-grained sensor network energy profiling and prediction 


210

9. Performance modeling and analysis of network processors 


211

5.2. Research Laboratories 

1. G. Chen and B. Liu. Directed the Secure Wireless Network Lab (SWIN Lab). 

2. A. Elbirt. Directed the Information Security Lab (InfoSec Lab). 

3. J. Wang. Directed the Network and Systems Security Lab (NSS Lab). 

4. L. Xu. Directed the CAML Compilers Lab (CAML Lab). 

6. Publications (August 2006-August 2007 – CNIS Members in Bold) 

Refereed Books 

1. J. Wang. Computer Network Security Theory and Practice. Beijing: Higher 

Education Press. October 2006. ISBN 7-04-020141 

Refereed Journals and Book Chapters 

2. C. Chen. Spatio-Temporal Query Language. Encyclopedia of GIS. Springer, 

2007. 

3. G. Chen, K. Minami, and D. Kotz. Naming and Discovery in Mobile 

Systems. Invited Book Chapter in P. Bellavista and A. Corradi, editors, The 

Handbook of Mobile Middleware. Auerbach, October 2006. 

4. Y. Xu, G. Chen, J. Ford, and F. Makedon. Detecting Wormhole Attacks in 

Wireless Sensor Networks. In Sujeet Shenoi, editors, Critical 

Infrastructure Protection, pages 207-219, Springer. In Press. 

5. Y. Ouyang, Z. Le, G. Chen, J. Ford, and F. Makedon. Protecting Source 

Location in Sensor Networks. Journal of Pervasive and Mobile Computing. 

Submitted. 

6. G. Chen, M. Li, and D. Kotz. Data-Centric Middleware for Context-Aware 

Pervasive Computing. Journal of Pervasive and Mobile Computing. 

Submitted. 

7. A. J. Elbirt. Accelerated AES Implementations Via Generalized Instruction 

Set Extensions. Journal of Computer Security. Submitted. 

8. P. Gamache, A. Galante, G. Seben, and A. J. Elbirt. Validating Baseball Bat 

Compliance. Sports Engineering. Submitted. 

9. D. Figueiredo, B. Liu, Y. Guo, J. Kurose, and D. Towsley. On the Efficiency 

of Fluid Simulation of Network. Computer Networks Journal. 50:1974-1994, 

2006. 

10. B. Liu, P. Brass, O. Dousse, P. Nain, D. Towsley. Mobility Improves 

Coverage of Sensor Network. IEEE Trans. on Mobile Computing. 

Submitted. 


212

11. L. Zhao, Y. Luo, L. Bhuyan and R. Iyer. A Network Processor Based 

Content Aware Switch, IEEE Micro Special Issue on High-Performance 

Interconnects, 26(3):72-824, May/June 2006. 

12. Y. Luo, J. Yu, J. Yang, and L. Bhuyan. Conserving Network 

Processor Power Consumption by Exploiting Traffic Variability. 

ACM Transaction on Architecture and Code Optimization. 4(1), March 2007. 

13. J. Lu, Y. Luo, and J. Wang. Analytical Performance Analysis of Network- 

Processor-Based Application Designs. IEEE Transactions on Parallel and 

Distributed Systems. Submitted. 

14. L. Xu. RobotStudio: A Universal IDE for Teaching Undergraduate 

Computer System Courses. Journal of Computing Sciences in Colleges. 

22(6):65-72, 2007. 

15. L. Xu. Project the Wiki way: Using Wiki for Computer Science Course 

Project Management. Journal of Computing Sciences in Colleges. 22(6):109- 

116, 2007. 

16. J. Wang and N. Zhong. Efficient Point Coverage in Wireless Sensor 

Networks. Journal of Combinatorial Optimization. 11:291-304, 2006. 

17. J. Wang and N. Zhong. Minimum-Cost Sensor Arrangement for Achieving 

Wanted Coverage Lifetime. International Journal on Sensor Networks. In 

Press. 

18. P. Berman, B. DasGupta, M.-Y. Kao, and J. Wang. On Constructing an 

Optimal Consensus Clustering from Multiple Clusterings. Information 

Processing Letters. Accepted. 

Refereed Conferences 

19. W. Li, C. Chen, and J. Wang. An Efficient Clustering Method for High- 

Dimensional Data. International Conference on Data Mining (ICDM07), 

Submitted. 

20. Y. Sheng, K. Tan, U. Deshpande, B. Vance, H. Yin, C. 

McDonald, T. Henderson, G. Chen, D. Kotz, A. Campbell, and J. Wright. 

MAP: A Scalable Infrastructure for Securing 802.11 Wireless Networks. 

IEEE InfoCom 2008. Submitted. 

21. Y. Sheng, K. Tan, G. Chen, D. Kotz, and A. Campbell. 

Detecting 802.11 MAC Layer Spoofing Using Received Signal Strength. 

IEEE InfoCom 2008. Submitted. 

22. H. Yin, G. Chen, and J. Wang. Detecting Protected Layer-3 Rogue APs. In 

Proceedings of the Fourth IEEE International Confernece on Broadband 


213

23. Communications, Networks, and Systems (BROADNETS), September 2007. 

24. Y. Xu, G. Chen, J. Ford, and F. Makedon. Distributed Wormhole Attack 

Detection in Wireless Sensor Networks. In Proceedings of the First Annual 

IFIP Working Group 11.10 International Conference on Critical 

Infrastructure Protection, Hanover, NH, March 2007. 

25. A. J. Elbirt, L. Abdallah, K. Fisher, A. Koren, and P. Scollin. Tablets at the 

Bedside: Accuracy Testing of Secure Wireless-Based Data Entry in a 

Nursing Education Laboratory. In University of Massachusetts Instructional 

Technology Conference, April 5 2007. 

26. A. J. Elbirt. Fast and Efficient Implementation of AES via Instruction Set 

Extensions. In the Proceedings of IEEE 21st International Conference on 

Advanced Information Networking = and Applications (AINA-07), Third 

IEEE International Symposium on Security in Networks and Distributed 

Systems, May 21-23 2007, Niagara Falls, Canada. 

27. P. Scollin, A. J. Elbirt, A. Koren, and K. Fisher. Tablets at the Bedside: 

Accuracy Testing of Secure Wireless-Based Data Entry in a Nursing 

Education Laboratory. In Proceedings of the Twenty-Fifth International 

Nursing Computer and Technology Conference, June 14-17 2007, San 

Francisco, CA. 

28. Q. Dong, S. Banerjee and B. Liu. Throughput Optimization and Fair 

Bandwidth Allocation in Multi-Hop Wireless LANs. IEEE Infocom, 2006. 

29. B. Liu, P. Thiran, and D. Towsley. Capacity of a Wireless Ad Hoc Network 

with Infrastructure. In Proc. of ACM MobiHoc. 

30. L. Wang, B. Liu, D. Goeckel, and D. Towsley. Connectivity in Cooperative 

Wireless Ad Hoc Networks. Submitted to MobiHoc 2007. 

31. Q. Dong, S. Banerjee, and B. Liu. Throughput Optimization and Fair 

Bandwidth Allocation in Multi-Hop Wireless LANs. In Proc. IEEE Infocom, 

2006. 

32. B. Liu, O. Dousse, and J. Wang. Barrier Coverage of Wireless Sensor 

Networks. Military Communication Conference (MILCOM’07). Submitted. 

33. P. Piyachon and Y. Luo. Compact State Machines for High Performance 

Pattern Matching. In Proceedings of the IEEE/ACM Design Automation 

Conference (DAC), San Diego, CA, June 4-8, 2007. 

34. P. Piyachon and Y. Luo. Efficient Memory Utilization on Network 

Processors for Deep Packet Inspection. In Proceedings of the ACM 

Symposium on Architecture for Networking and Communications Systems, 

San Jose, CA, Dec 3-5, 2006. 


214

35. J. Lu and J. Wang. Analytical Performance Analysis of Network-Processor- 

Based Application Designs. In Proceedings of the 15 th International 

Conference on Computer Communications and Networks (IC3N06), 

Arlington, VA, Oct. 2006, Pages 33-39. 

36. Z. Yu and J. Wang. Fault-Tolerant Sensor Coverage for Achieving Wanted 

Coverage Lifetime with Minimum Cost. In Proceedings of the Second 

International Conference on Wireless Algorithms Systems, and Applications. 

August 2007.. 

37. L. Xu. RobotStudio: A Modern IDE-Based Approach to Reality 

Computing. In SIGCSE 2007: Proceedings of the 38th SIGCSE technical 

symposium on Computer Science Education. Pages 313-317, 2007. 

38. L. Xu. Project the Wiki way: Using Wiki for Computer Science Course 

Project Management. In SIGCSE 2007: Proceedings of the 38th SIGCSE 

technical symposium on Computer Science Education. 2007. 

39. L. Xu. Using Robotics to Teach Compiler Construction. In University of 

Massachusetts Instructional Technology Conference, April 5 2007. 

40. F. Martin and L. Xu. Chirp on Crickets: Teaching Compilers Using an 

Embedded Robot Controller. In Proceedings of the ACM 37 th Symposium on 

Computer Science Education (SIGCSE), ACM Press, 2006. 

Other Publications and Technical Reports 

41. N. Li, G. Chen, and M. Zhao. Autonomic Fault Management for Wireless 

Mesh Networks. IEEE Networks Magazine, Speciail Issue on Wireless Mesh 

Networks. Submitted. 

42. F. Limondin and A. J. Elbirt. PowerMeasure - A LabVIEW Virtual 

Instrument. University of Massachusetts Lowell 10th Annual Student 

Research Symposium, April 26, 2007. 

43. P. Gamache and A. J. Elbirt. Ultrasound Detection of Corked Baseball Bats. 

University of Massachusetts Lowell 10th Annual Student Research 

Symposium, April 26, 2007. 

44. G. Larcom and A.J. Elbirt. Gone Phishing. IEEE Technology and Society 

Magazine, 25(3), pp. 52-55, Fall 2006. 

45. S. Barr, S. Cardman, and D. Martin. Matching Global Data References in 

Related Executables. UML CS technical report. 

46. L. Xu. The Chirp Language Specification. UML CS technical report. 

47. L. Xu. Profiling TinyOS Applications. UML CS technical report. 


215

7. Conference Presentations (August 2006-August 2007) 

1. A. J. Elbirt, L. Abdallah, K. Fisher, A. Koren, and P. Scollin. Tablets at the 

Bedside: Accuracy Testing of Secure Wireless-Based Data Entry in a Nursing 

Education Laboratory. In University of Massachusetts Instructional 

Technology Conference, April 5 2007. 

2. A. J. Elbirt. Fast and Efficient Implementation of AES via Instruction Set 

Extensions. In the Proceedings of IEEE 21st International Conference on 

Advanced Information Networking = and Applications (AINA-07), Third IEEE 

International Symposium on Security in Networks and Distributed Systems, 

May 21-23 2007, Niagara Falls, Canada. 

3. J. Lu and J. Wang. Analytical Performance Analysis of Network-Processor- 

Based Application Designs. The 15 th International Conference on Computer 

Communications and Networks (IC3N06), Arlington, VA, October. 2006. 

4. Z. Yu and J. Wang. Fault-Tolerant Sensor Coverage for Achieving Wanted 

Coverage Lifetime with Minimum Cost. In Proceedings of the Second 

International Conference on Wireless Algorithms Systems, and Applications. 

August 2007. 

8. Invention Disclosures 

1. Hongda Yin, Guanling Chen, and Jie Wang. Detecting Protected Layer-3 

Rogue APs. 2006. 

9. Collaborators with Other Centers/Institutes and/or Departments 

1. Dr. Eva Buzawa. Criminal Justice Department, UML. Emergency Services 

and Law Enforcement Networks. 

2. Dr. Andrew Campbell. Dartmouth College. Wireless Networks. 

3. Dr. Robert S. Gray. BAE Systems. Mobile Wireless Ad Hoc Networks. 

4. Dr. Tristan Henderson. Dartmouth College. Wireless Networks. 

5. Dr. Ker-I Ko. SUNY Stony Brook. Average Complexity. 

6. Dr. David Kotz. Dartmouth College. Wireless Networks. 

7. Dr. Fillia Makedon. Dartmouth College. Sensor Networks. 

8. Dr. Samson Mil’shtein. Electrical and Computer Engineering Department, 

UML. Analog Encryption. 

9. Dr. Wenjing Lou. Department of ECE, WPI. Wireless security. 


216

10. Dr. James Sherwood, Mechanical Engineering Department, UML. 

Validating Baseball Bat Compliance. 

11. Dr. W. Wu. University of Texas at Dallas. Data Mining. 

10. Regional/Local Outreach and Professional Service 

10.1. Research Seminar 

• CNIS organized a weekly research seminar each Thursday. Each seminar 

lasted for two hours. Faculty members, students, and outside speakers 

presented and discussed papers of their own or papers of other people. 

People from outside CNIS attended various seminar talks. 

10.2. Conference/Workshop Program Committee (PC) Members, Chairs, Organizers 

1. C. Chen. PC member: International Conference on Distributed Computing 

and Internet Technology, 2006. 

2. C. Chen. PC member and Session Chair: ACM International Workshop on 

Web Information and Data Management, 2006. 

3. G. Chen. PC member: Information, Network, and Communications Security 

Track at General Symposium of IEEE Global Communications Conference 

(GLOBECOM), November 2007. 

4. G. Chen. PC member: International Conference on Distributed Smart 

Cameras (ICDSC), September 2007. 

5. G. Chen. PC member: The International Conference on Autonomic and 

Trusted Computing (ATC), July 2007. 

6. G. Chen. PC member: The 4th International Conference on Ubiquitous 

Intelligence and Computing (UIC), July 2007. 

7. G. Chen. PC member: First International Symposium on Data, Privacy, 

and E-Commerce, 2007. 

8. G. Chen. PC member: IFIP International Symposium on Network-Centric 

Ubiquitous Systems 2006. 

9. A. J. Elbirt. Session chair: The IEEE 21st International Conference on 

Advanced Information Networking and Applications (AINA-07), The Third 

IEEE International Symposium on Security in Networks and Distributed 

Systems, 2007. 

10. B. Liu. PC member: IEEE Conference on Computer Communications 

(Infocom). 2007. 


217

11. B. Liu. PC member: IEEE PerCom Workshop on Pervasive Wireless 

Networking. 2007. 

12. B. Liu. PC member: International Conference on Computer 

Communications and Networks (ICCCN), 2006. 

13. B. Liu. PC member: IEEE Conference on Computer Communications. 2006. 

14. B. Liu. PC member: International Performance Computing and 

Communications Conference. 2006. 

15. B. Liu. PC member: The IEEE 20th International Conference on Advanced 

Information Networking and Applications. 2006. 

16. B. Liu. PC member: Second IEEE PerCom Workshop on Pervasive Wireless 

Networking. 2006. 

17. L. Xu. Organizer: CITIWIKI Web2.0 Technologies Summer Workshop. 

2007. 

18. Y. Luo. PC member: International Conference on Computer 

Communications and Networks (ICCCN). 2006. 

19. D. Martin. PC member: Workshop on Privacy Enhancing Technologies. 

2007. 

20. J. Wang. PC member: The 3 rd International Conference on Algorithmic 

Aspects in Information and Management, 2007. 

21. J. Wang. PC member: The 12th Annual International Computing and 

Combinatorics Conference (COCOON). 2006-07. 

22. J. Wang. Organizer: The DIMACS Workshop on Discrete Mathematical 

Problems in Biomedicine. Rutgers University, April 2007. 

23. J. Wang. PC co-chair: The 13 th Annual International Computing and 

Combinatorial Conference (COCOON). 2007-08. 

10.3. NSF and Other Funding Agencies Proposal Reviewing 

1. J. Wang. Reviewed several proposals for NSF. 2006-07. 


1. J. Ma and C. Chen (co-PI). High Resolution Topographic Gravity Wave 

Mapping over Southern Hemisphere. NSF Antarctic Research (Aeronomy & 

Astrophysics). $324,461. Pending. 

2. G. Chen, D. Martin, and J. Wang. Automating Accurate Detection of 

Wireless Rogue APs. CVIP. $29,450. Declined. 


218

3. G. Chen, D. Martin, and J. Wang. Automated 

Detection of Rogue 

Wireless Access Points in Enterprise Networks. MTTC. $39,982. Declined. 

4. G. Chen and G. Livingston. Wireless In-Situ Reasoning Architecture for Mesh 

Networks. NSF NeTS. $232,855. Declined. 

5. G. Chen. Dartmouth Internet Security Testbed. DHS. $80,886. Funded. 

6. G. Chen. M.A.P. (Measure, Analyze, Protect): Security through Measurement 

for Wireless LANs. DHS HSARPA Grant. 08/2005-08/2007. $119,704. 

Funded. 

7. G. Chen. Federated Intelligent Cross-Model Surveillance. UMass Lowell Seed 

Program 2006. $9,990. Funded. 

8. G. Chen. Self-Troubleshooting Wireless Networks. Google. $81,466. 

Pending. 

9. G. Chen, E. Buzawa, and J. Wang. A Center of Excellence for Technology 

and Training for Border Security and Immigration. DHS. $3,102,000. 

Pending. 

10. G. Chen, A. J. Elbirt, and J. Wang. An Open Infrastructure for Experimental 

Research on Hardware-Assisted Wireless Security. NSF CRI. $299,561. 

Pending. 

11. A. J. Elbirt. Tablets at the Bedside: Secure Wireless-Based Data Entry in a 

Nursing Education Laboratory. Microsoft Research. $75,075. Declined. 

12. A. J. Elbirt. Enabling the Use of Any Computer – Secure, Virus-Immune, 

Without-A-Trace, MTTC. $39,613. Declined. 

13. A. J. Elbirt. Tablets at the Bedside: Accuracy Testing of Secure Wireless-Based 

Data Entry in a Nursing Education Laboratory. UMASS Strategic Initiative 

Grant – Enhancing Teaching and Learning Through the Use of Technology. 

$24,064. 2006-2007. Funded. 

14. A. J. Elbirt (co-PI) and S. Mil’shtein. Analog Encryption and Frequency 

Mixing Using Tri-Gate HEMT. AFRL/IF Information Warfare: Offensive 

and Defensive Counterinformation. $705,841. Pending. 

15. A. J. Elbirt (co-PI) and S. Mil’shtein. Analog Encryption and Frequency 

Mixing Using Tri-Gate HEMT. ONR Electronic Warfare Technology. 

$730,416. Pending. 

16. A. J. Elbirt (co-PI) and D. Megherbi. REU Site: University of Massachusetts 

Lowell Undergraduate Research and Training in Computer Engineering and 

Related Fields. NSF. $363,000. Pending. 

17. A. J. Elbirt (consortium PI). Homeland Security Defense and Education. DHS 

SAFECOM. $1,500,000. Pending. 


219

18. A. J. Elbirt. Enabling the Use of Any Computer – Secure, Virus-Immune, 

Without-A-Trace, DHS Cyber Security Research and Development. 

$139,044. Pending. 

19. B. Liu. Cooperative Wireless Networking: Foundations and Practice. NSF. 

$150,000. Funded. 

20. Y. Luo. Distributed Packet Inspection and NIC using IXA and IA Architecture. 

Intel Corp. 01/01/06-12/31/06. $25,000. Funded. 

21. Y. Luo. Ultra High-Speed Deep Packet Inspection for UltraScience Network. 

Department of Energy. $297,355. Pending. 

22. Y. Luo, K. Chandra, G. Chen, and J. Wang. CRI-IAD: Programmable 

Network Infrastructure with Emerging Technologies. NSF. $400,000. Pending. 

23. D. Martin, K. Daniels, and A. Schulman. Binary Code Search via Feature 

Extraction. Google. $102,400. Pending. 

24. L. Xu. RobotStudio: A Modular IDE-Based Holistic Approach to Teaching 

Language Engineering and Compilers Using Educational Robots. NSF CCLI. 

$141,179. Pending. 

25. L. Xu and A. Elbirt. 2007 HP Higher Education Technology for Teaching 

Grant, Active Learning with TabletPC and Wiki. Hewlett-Packard. $68,000. 

Funded. 

26. L. Xu. Using Physical and Virtual Robots to Enhance Undergraduate 

Computer Science Courses. 2007 UMass Professional Development Grant. 

$6,000. Funded. 

27. L. Xu (co-PI). Wiki CITI. 2007 Massachusetts Commonwealth Information 

Technology Initiative K-12 Grant. $30,000. Funded. 

28. L. Xu. RobotStudio: An IDE for Embedded Robotic System Teaching and 

Development. UMass PDG grant. 2006-07. $4,000. Funded. 

29. L. Xu. Memory Profiling and Performance Optimization for IXP Network 

Processors. Intel IXP2350 equipment grant. 2006. $7,600. Funded. 

30. L. Xu. Packet Inspection and Filtering on Wireless Edge Devices. Intel 

Embedded IA equipment grant. 2006. $8,000. Funded. 

31. J. Wang. Collaborative Research: Studies on Average Complexity CCF- 

0429906. NSF. $161,992. Existing grant. Amount for the current year: 

$50,000. Funded. 

32. J. Wang and W. Wu. Discrete Mathematical Problems in Computational 

Biomedicine. DIMACS Grant. $12,000. Funded. 


220

12. Results of CFCI Support 

Prabhu Govindaswamy was the recipient of the CFCI 2006-07 research assistantship. He 

was working on a multi-sensor surveillance project in which he was developing an 

intelligent sensing system integrating distributed cameras and wearable sensors. This 

integrated software and hardware system enables automatic sensor fusion in response to 

triggering events. For example, an annotated camera image can be used to alert an 

operator when a person with wearable sensors falls on the stairs. We believe that this 

system can reduce deployment cost, better serve human operator, and increase the 

alarm accuracy. The technologies Prabhu has been developing include on-board camera 

processing, sensor indoor localization, and middleware for sensor control. The goal of 

this project is to provide an early evaluation on how well this system works in the 

emerging healthcare application domain, with which we can apply for future funding 

opportunities. Prabhu plans to defend his thesis in November of 2007 and submit his 

thesis research for publication. 


221

Annual Report 

Academic Year 2006-2007 

18. CENTER FOR PUBLIC HEALTH RESEARCH AND HEALTH PROMOTION 

Submitted by 

Co-Directors: Dr. Barbara Mawn and Dr. Craig Slatin 

August 13, 2007 

Center for Public Health Research and Health Promotion 

222


The mission of the Center for Public Health Research and Health Promotion 

(CPHRHP) is to promote health and to prevent illness and disability as a foundation of 

sustainable social and economic development. We take as our standard a definition of 

health as a state of complete physical, mental and social well-being and not merely the 

absence of disease or infirmity. The Center conducts research, service, and intervention 

activities that can inform and shape the education of health professionals, and it supports 

community-based involvement and participatory research. As part of a public university, 

the Center values the role of campus-community partnerships in attending to health care 

and health promotion the needs of the surrounding region. To assist in the University's 

mission of regional sustainable development, the Center focuses on an important 

component of sustainable development: establishing the basis for optimal health for all. 

The Center strives to understand and explain the social determinants of health, 

and to collaborate with others to develop strategies for preventing illness, injury, 

disability and premature mortality, and promoting health. We work with other UML 

centers, institutes, colleges, and departments, along with community-based and advocacy 

organizations, government, employers, labor unions, environmental and environmental 

justice organizations, and healthcare provider organizations. We are committed to the 

pursuit of social justice and the elimination of health disparities. 

The mission of the University of Massachusetts Lowell is to provide to students 

an affordable education of high quality and to focus some of its scholarship and public 

service on assisting sustainable regional economic and social development in the nation 

and the world. The CPHRHP’s mission is in congruence with the University’s mission as 

the ultimate aim of both is to promote regional social and economic development. The 

premise of the mission of CPHRHP is that this development can only succeed within a 

healthy environment. The research and training activities within the Center focus on the 

elimination of health disparities and the promotion of health within a variety of contexts. 


The mission and goals of CPHRHP were revised in the 2006- 2007 academic year. 

With the recent addition of the Division of Disability and Rehabilitation Research, the 

Co-Directors, along with the Associate Director, Dr. Sean Collins revised the mission and 

goal statements. These were reviewed and approved by participating faculty and staff 

members within the Center. The revised goals include: 

1. Promote collaboration across the multiple disciplines within the 

university that are involved in public health. 

2. Examine significant questions including but not limited to, those related 

to effective health education, promotion, and policy. 


223

3. Explore the use of health education, promotion, and research to improve 

public health and health care, with special attention to environmental 

and occupational health. 

4. Promote and practice rigorous research using established and innovative 

approaches including both qualitative and quantitative methods. 

5. Establish UML as a regional base for collaboration around efforts to 

develop sustainable solutions to public health problems. 

6. Conduct research and research-related activities regarding the social 

determinants of health and health disparities. 

7. Encourage the development of partnerships with agencies and 

organizations in the Merrimack Valley and elsewhere as a way to 

advance the Center's understanding and commitment to the health 

education and promotion needs of diverse communities. 

8. Develop methods and conduct research focused on preventing disability 

by facilitating social participation and interaction for people across the 

full range of the human experience. 


The major research focus areas within CPHRHP include the following categories. 

They will be described in more detail in the “Current Research” and “Proposals 

submitted” sections of this report. 

1. Occupational Health and Safety 

• PHASE in Healthcare (Promoting Healthy and Safe Employment in 

Healthcare). This NIOSH-funded project examined health disparities 

among healthcare workers. It included research, community outreach 

and education program components. Craig Slatin and Laura Punnett 

were Co-principal Investigators. While the funding for this project has 

been completed, during the past year numerous presentations have 

been presented at national and international conferences. In addition 

several manuscripts are under review or in progress. The final report to 

NIOSH was submitted in 2007. 

• Occupational Health and Safety / Worker Health Education: The New 

England Consortium, Hazardous Waste / Emergency Response 

Workers Health and Safety Training Project. Craig Slatin and Charles 

Levenstein, co-principal investigators. 

• Dr. Mawn is currently in the process of developing a collaborative 

proposal with the Center for High-Rate Nanotechnology, 

Nanomanufacturing Center of Excellence (CHN/NCOE). An 

innovation Enhancement Proposal Award was submitted in July, 2007. 


224

• The aim of this proposal was to seek funding and support for one halftime 

Research Assistant (RA) who would assist in the development of 

a literature review and research proposal on nanotechnology as it 

pertains to health and safety of workers and the environment. 

Significant questions that the proposal may examine include: What are 

the specific health effects of nanomanufacturing on the workers in the 

industry? Who is at most risk for health risks related to manufacturing 

of nanotechnology particles? What are the policies in place to protect 

workers and how are they implemented? What is the knowledge level 

about these risks in the industry by workers and managers? What are 

the best practices to minimize risks in a sustainable economy? 

2. Health in Immigrant Populations 

The Center has advanced its pursuit to build capacity to address a range of 

important immigrant health issues. The primary immigrant population given 

attention has been the Brazilian community, but we seek to address a broader set 

of communities and issues. Center members Dr. Eduardo Siqueira and Dr. 

Mansoureh Tajik have worked with others in the School of Health and 

Environment in these efforts – Dr. Barbara Mawn, Dr. Cora Roeloffs, Dr. Lisa 

Abdallah, and Dr. Maria Brunette. 

3. Disability and Rehabilitation Research. Under the leadership of Associate 

Director Sean Collins, this division is involved in several research projects. The 

major areas of research interest and development include: 

• Plasticity, adaptation, and accommodation; translational research; 

interventions to sustain health; epidemiology prior to 

rehabilitation; and needs assessment, with a focus on the person 

and quality of life 

• Translating emerging knowledge from basic sciences into 

implementation; technology and research and development that 

leads to evidence-based interventions and accommodations; 

qualitative and quantitative evaluation of therapeutic interventions 

(e.g., duration and frequency); and improving the practice of 

rehabilitation 

• Adaptation and plasticity at the level of cells, organs and systems; 

approaches that go beyond healing and reversal of injury; and 

studies of retraining reflex functions 

• Mechanisms of response and adaptation from exercise 

interventions at level of cells, organs and systems 

• Reconciling outcomes between bench science and clinical studies; 

examining quality-of-life and impact on families; secondary effects 

of impairment/disabilities and long-term management of chronic 

disabilities and conditions 


225

• Development of the concept of Universal Design of the built 

environment for sustaining health, contrasting the medical model 

with the social and public health models, and outcome measures 

• Research collaboration for: biological basis of disability & 

rehabilitation, robotics, and telemedicine; neural-prosthetic 

interfaces; advanced assistive technologies; clinical trials to 

promote novel rehab interventions; osteo-integration and 

nanotechnology to build devices that integrate with dysfunctional 

tissue; and research on outcomes and quality-of-life measures 

4. Health Promotion Research 

• Prevention of Unplanned Pregnancy: Dr. Ainat Koren recently 

resubmitted at R01 to the Office of Population Affairs, Department of 

Health and Human Services. Award Pending. 

• Health Literacy: Dora Tova, Undergraduate service learning project 

and doctoral dissertation research project supported with CFCI funding 

5. Work Environment Policy Research: OSHA Voluntary Protection Programs; 

Export of occupational hazards through globalization. 


Dr. Barbara Mawn, Co-Director 

Dr. Craig Slatin, Co-Director 

Dr. Sean Collins, Associate Director 

Affiliated faculty: 

Nursing Dept.: Dr. Karen Melillo, Dr. Ainat Koren, Dr. Stephanie Chalupka, Dr. Betty 

Morgan, Dr. Katherine Rosa 

Physical Therapy Dept.: Sean Collins, Deirdra Murphy, Cynthia Ferrara 

Community Health and Sustainability: Dr. Beverly Volicer, Dr. Michael O’Sullivan, 

Dr. Nicole Champagne, Dr. Patrick Scollin, Dr. A. James Lee, Dr. Eduardo Siqueira, Dr. 

Mansoureh Tajik 

Economics: Dr. Monica Galizzi 

Work Environment: Dr. Laura Punnett, Dr. Charles Levenstein (UML Professor 

Emeritus) 

Consulting Researchers: Dr. Lee Ann Hoff, Dr. Carole Pearce (UML Professor 

Emeritus) 

Faculty from Other Universities: Dr. Beth Rosenberg, Tufts University Medical 

School, Department of Family and Community Medicine. 

Associated Staff: 


226

• Diane Doherty, Project Administrator, PHASE in Healthcare and TNEC 

• Rebecca Gore, Biostatistician, PHASE in Healthcare 

• David Coffey, All Hazards Training Program Coordinator, TNEC 

• Tom Estabrook, Special Projects Manager, TNEC 

• Marian Flum, AFSCME Training Project, Evaluator 

• Judy Martineau, Staff Assistant, TNEC 

• Paul Morse, Project Director, TNEC 

• Therese O’Donnell, Outreach and Marketing Coordinator, TNEC 

• Richard Sadkowsky, Technical Resources Coordinator, TNEC 

• Wayne Sanborn, Assistant Project Director, TNEC 

New Faculty Affiliations within Last Three Years 

Community Health and Sustainability Department: Dr. Mansoureh Tajik 

Physical Therapy Department: Dr. Sean Collins, Dr. Deirdra Murphy, Dr. Cynthia 

Ferrara 

Nursing Department: Dr. Katherine Rosa, Dr. Betty Morgan 


• Dora Tovar, Research Assistant with Center for Public Health Research and 

Health Promotion. Dora is a Work Environment doctoral student conducting 

research addressing health literacy issues in worker health and safety training. In 

the fall of 2006, she received final IRB approval for her study and soon after 

began to collect the data for her dissertation. In Spring 2007, she continued 

collecting the data. She plans on defending her dissertation in December, 2007. In 

addition, in January, 2007, she conducted an interview with Dr. Slatin with the 

head of the Voluntary Protection Program. She presented a paper and a poster on 

the preliminary findings of her work at a regional and national conference. 

• Amy Rival, a first year masters student in Health Policy in the Department of 

Community Health and sustainability, served as research assistant on the 

American Federation of State, County and Municipal Employees (AFSCME) 

project. She has played an integral role in developing the newsletter, preparing for 

the Iowa sessions, reviewing and organizing the hundreds of photos taken for the 

PhotoVoice project, working with the evaluation team, and using NVivo to 

analyze transcripts of the Iowa interview and focus group sessions. She will 

continue on the project next year as the primary architect of the newsletter, 

working with the evaluation team, assisting in developing evaluation instruments, 

analyzing data, and conducting literature review in preparation for articles on the 

work at U of Iowa. 


227


• Pilot Research Study: Dr. Mansoureh Tajik has worked with the Brazilian 

Women’s Group to pilot test a Portuguese version of the survey instrument Health 

Promoting Lifestyle Profile (HPLP) II to validate it amongst Brazilian women 

prior to future use in research about Brazilian immigrant women’s health. 

• The New England Consortium (TNEC) is a partnership of the University of 

Massachusetts Lowell in the Center for Public Health Research and Health 

Promotion and five Coalitions for Occupational Safety and Health 

(ConnectiCOSH, MassCOSH, NHCOSH, RICOSH, and Western MassCOSH). 

Current research projects include assisting UMass Lowell’s Department of 

Computer Sciences in developing advanced robotic technology for use in 

hazardous waste site remediation, HAZMAT emergency response, and disaster 

response and recovery scenarios, an interactive touch screen interface used for 

rapid damage assessment of wide disaster areas, and a software tool for command 

and control. Over an eight week period this summer, the Center for Public Health 

Research and Health Promotion and TNEC hosted the Massachusetts Local Public 

Health Institute’s Foundations of Local Public Health Practice course in northeast 

Massachusetts. 

• The CPHRHP conducts evaluation research for the nation-wide health and safety 

training program of the American Federation of State, County and Municipal 

Employees (AFSCME). Dr. Eduardo Siqueira is the PI and Dr. Marian Flum 

conducts the evaluation research. This year, the project supported Amy Rival as a 

RA. The program is unique in that it involves union members who conduct health 

and safety training courses form the AFSCME evaluation team. Dr. Flum leads 

the team in learning and developing new evaluation techniques. This year the 

union asked the team to evaluate a joint labor-management systems of safety 

program at the University of Iowa’s facility management division. The evaluation 

included a web-based survey of all Facilities Management personnel, 

approximately 400 employees. A PhotoVoice project was conducted with 

custodians, who continue to have high injury rates in spite of the two year old 

safety program. The custodians took pictures of health and safety problems they 

encountered on the job, and then discussed the photos, categorized hazards, and 

prioritized them. In addition key management and union leadership were 

interviewed. Focus groups evaluating the effect of the program and the need for 

improvement were conducted with separate groups of custodians, maintenance 

workers, utilities and grounds workers, and health and safety representatives. The 

team also developed a Newsletter for health and safety trainers in the union. Next 

year the team will be evaluating train-the-trainer programs that prepare union 

activists to become health and safety trainers. 


228

Publications 

Cifuentes, M, Slatin, C. “Inter-Method Agreement between O*NET and Survey 

Measures of Psychosocial Exposure among Healthcare Industry 

Employees.” American Journal of Industrial Medicine. 2007 in press. 

Collins SM, Karasek R. Vagal Responses to Work and Rest Day Strain: Possible 

Cardiac Disease Risk Mechanisms. European Journal of Cardiovascular 

Prevention and Rehabilitation, 2006; 13(Supplement 1) S51. 

Diaz KJ, Collins SM, Cahalin LP. Physical Therapy Implications in the 

Management of 

Patients with Defibrillators and Pacemakers. Cardiopulmonary Physical 

Therapy Journal, 2006; 17(2) 56-61. 

d'Errico A, Punnett L, Cifuentes M, Boyer J, Tessler J, Gore R, Scollin PA, Slatin C. 

“Hospital Injury Rates In Relation To Socioeconomic Status And Working 

Conditions.” Occup Environ Med. 2006 Dec 20; [Epub ahead of print], 

PMID: 17182643 [PubMed - as supplied by publisher] 

Fisher, K. & Koren, A. (2007). Palm Perspectives: The Use of Personal 

Digital Assistants in Nursing Clinical Education. A Qualitative Study. Online 

Journal of Nursing Informatics (OJNI), 11, (2) [Online]. Available at 

http://eaa- knowledge.com/ojni/ni/11_2/fisher.htm 

Flanagan, J., Melillo, K. D., Abdallah, L., & Remington, R. (2007). Interpreting 

laboratory values in the rehabilitation setting. Rehabilitation Nursing, 32(2), 

77- 84. 

Flum, M., Slatin, C. “‘Nothing Changes if Nothing Changes’: An Interview with 

Barbara Rahke, Executive Director of Philaposh,” New Solutions, a Journal of 

Environmental and Occupational Health Policy. Vol. 16 (3). 2006. 

Hoff, L.A., Slatin, C. "Workplace Health and Safety: Report of PHASE/MNA Focus 

Groups,” A two-part series, Massachusetts Nurse, Vol. 77, No. 8 & 9, 2006. 

Medina F, Meseguer AB, Montilla-Herrador J, Collins SM, Saturno-Hernandez PJ. 

Reliability and validity of patient’s reports for physical therapy quality 

assessment: An empirical analysis regarding the use of exercises for neck 

pain in Spain. Journal of Rehabilitation Medicine , 2006; 38: 354-359. 

Melillo, K.D. (2006). Legal issues and gerontological nursing [expert panel 

member]: Part 1, Abuse and neglect of older adults. In Dolores Alford, 


229

Section Editor, Legal issues, 4-part series. Journal of Gerontological Nursing, 32(1), 

10-12. 


member]: Part 2, Responsible parties and guardianships. In Dolores 

Alford, Section Editor, Legal issues, 4-part series. Journal of 

Gerontological Nursing, 32(2), 15-18. 


member]: 

Part 3, Standards of care. In Dolores Alford, Section Editor, Legal issues, 4- 

part series. Journal of Gerontological Nursing, 32(3), 9-12. 

Melillo, K.D. (In Press). Psychological and social impact of age-related vision loss 

in older adults. In S. C. Houde (Ed.). Vision loss in older adults. New York: 

Springer Publishing. 

Melillo, K.D. (Contributor). Geriatric nursing leaders of today. In P. Ebersole 

(2006). Geriatric nursing: Growth of a specialty. New York: Springer 

Publishing Company. 


member]: 

Part 1, Abuse and neglect of older adults. In Dolores Alford, Section Editor, 

Legal issues, 4-part series. Journal of Gerontological Nursing, 32(1), 10-12. 


member]: Part 2, Responsible parties and guardianships. In Dolores Alford, 

Section Editor, Legal issues, 4-part series. Journal of Gerontological Nursing, 

32(2), 

Morgan, B., Hultman, T. & Zhan, L. (2007).End of life care: A case Analysis of an 

HIV patient. Journal of Chinese PLA, 27(4), 25-30. 

Morgan, B. (2006). Peer consultation: A unique experiential model for P/MHNP 

students. Perspectives in Psychiatric Care: The Journal for 

Advanced Psychiatric Nurses, 42 (4), 238-244. 

Morgan, B. (2006). Knowing How to Play the Game: Hospitalized Substance 

Abusers’ Strategies for Obtaining Pain Relief. Pain Management Nursing, 7 (1), 

31-41. 

O'Sullivan, M., Slatin, C., Siqueira, C.E., Sperrazza K., Koren, A., Melillo, K.D., 

Cifuentes, M., Hoff, L.A., Champagne, N., Galizzi, M., and PHASE-In Healthcare 

Research Team. “ ‘It’s Part of the Job:” How Health Care Restructuring and the 

Culture of Health Care Contribute to the Detriment of the Health and Safety of 


230

Workers in Community Hospitals and Nursing.” In F. Ewan & P. Hyde & L. 

McKee (Eds.), Organizing and Reorganizing: Power and Change in Health Care 

Organizations. Houndsmills, Basingstoke,Hampshire, UK: Palgrave Macmillan. 

(Forthcoming, Summer 2007) 

Remington, R., Abdallah, L., Melillo, K.D., & Flanagan, J. (2006). Managing 

problem behaviors associated with dementia. Rehabilitation Nursing, 31(5), 

186-192. 


Presentations from the PHASE Project and other Center- affiliated faculty 

presentations at the 2006 Annual American Public Health Association Conference, 

Boston, MA, November, 2006 are summarized in Table 1. 

Table 1. Selected Presentations on the PHASE Project and other 

health promotion topics by other CPHRHP affiliated Faculty, 

American Public Health Association Annual Conference, 2006 

Presentation Title 

Presenter 

Social context of occupational health disparities for 

healthcare workers: Findings of the PHASE in Healthcare 

research project 

Craig Slatin 

Violence and abuse in the healthcare workplace: The 

context for disparities 

Lee Ann Hoff 

Reporting of occupational injuries in healthcare facilities: 

Findings from hospital, long term care, and other settings 

Ainat Koren 

Impact of healthcare restructuring in Massachusetts on the 

health and safety of healthcare workers 

C. Eduardo Siqueira 

Socioeconomic Status and Working Conditions as 

Predictors of Survey Response in Healthcare Workers 

Manuel Cifuentes 

Home healthcare nursing: Risk factors for blood exposures 

and sharps injuries 

Stephanie Chalupka 


231

Scale Effects in Family Substance Abuse Treatment 

Programs 

A. James Lee 

Social disparities in the burden of occupational exposures 

Margaret M. Quinn 

Ergonomic exposures and socioeconomic status: Findings of 

the "PHASE in Healthcare" research project 

Laura Punnett 

Assessment of biomechanical exposure to upper extremity 

musculoskeletal disorder risk factors in hospital 

laboratories 

Laura Punnett 

Modeling the Costs of Cardiac Rehabilitation Programs: A 

Methodological Perspective 

A. James Lee 

Socioeconomic status and back disorder risk factors in 

healthcare workers 

Jon Boyer 

Association between O*NET and survey measures of 

psychosocial exposure in healthcare workers 


Upper Extremity Musculoskeletal Exposures and the 

Healthcare Worker: Is there a Gradient by Socioeconomic 

Status? 

Jamie Tessler 

Toward Tomorrow: A Common Agenda for Health and 

Environment 

Polly Hoppin 

Hospital sharps injury rates: The need for a common 

denominator 

Hyun Kim 

Assessing occupational health hazards of home health care 

workers: Comparison of qualitative methods 

Pia K. Markkanen 

Global estimates of occupation related depressive episode 

from the WHO World Health Survey 


Men family planning/reproductive health counseling: 

Recruitment retention and accomplishments 

Ainat Koren 

Culture of nursing: A factor in nurses health and safety 

Barbara Mawn 


232

Additional Conference Presentations 

"Occupational Injuries, Workers' Reporting and Firms Policies in the Healthcare 

Industry: The Challenges and Rewards of Combining Qualitative and Quantitative 

Research Methodologies." Monica Galizzi, Petra Miesmaa, Craig Slatin, and the 

"PHASE in Healthcare" team. The Conference on the Analysis of Firms and 

Employees (CAFÉ) in Nuremberg, Germany, September 29-30, 2006. Presentation by 

Monica Galizzi. Peer-reviewed and published abstract. 

“From Love Canal to SARA: How Did It Happen? Labor’s HAZWOPER Worker 

Health and Safety Policy Initiative, 1979-1986.” Craig Slatin. Invited plenary speaker 

on a panel presenting the history of the NIEHS Worker Education and Training 

Program. National Trainers’ Exchange Conference. Las Vegas, Nevada. March, 2007. 

“The New England Consortium (TNEC) – A University-Community Partnership for 

Strengthening the New England Region Worker Health and Safety Movement.” Craig 

Slatin, Jane Fleishman, Paul Morse, Chuck Levenstein. UML CITA Conference, 

Community-University Partnerships: How Do We Achieve The Promise? Lowell, MA. 

April 25 - 27, 2007. Presentation by Jane Fleishman. 

Doris Tova (CFCI supported RA). Paper presented at the 2nd Annual Social 

Inequality and Public Policy Conference held on April 27, 2007 at UMASS Boston. 

“Literacy in the Workplace: Impact on Worker Health and Safety Training”. 

Doris Tova. Poster Presentation to the Annual American Society of Safety Engineers 

Safety 2007 Conference in Orlando Florida. June, 2007. “Functional Literacy in the 

Workplace: Impact on Health and Safety Training.” 

“Reporting Occupational Injuries in Healthcare Facilities”. Presented by: Ainat 

Koren. Co-Authors: Koren, A., Galizzi, M., Slatin, C., Sperrazza, K., Devereaux 

Melillo, K., Mawn, B., Pearce, C. and the Phase in Healthcare Research Team. 

Presented at the Workplace Hazards to Nurses and other Healthcare Workers: 

Promising Practices for Prevention Conference of the Massachusetts Nurses 

Association. June 7-8, 2007. 

“Ergonomic and Psychosocial Risk Factors for Injuries in Healthcare Work. 

Presented by Laura Punnett. Co-Authors: Punnett, L., Boyer, J., Cifuentes, M., 

d’Errico, A., Gore, R., Park, J., Tessler, J. and members of the Phase in Healthcare 

Team. Presented at the Workplace Hazards to Nurses and other Healthcare 

Workers: Promising Practices for Prevention Conference of the Massachusetts 

Nurses Association. June 7-8, 2007. 

“Violence and Abuse in Healthcare Workplace: The Context for Disparities.” 

Presented by Dr. Carole Pearce. Co-authors: Pearce, C., Hoff, L., Melillo, K., Koren, 


233

A., Sperrazza, K., Slatin, C. and members of the Phase in Healthcare Team. 

Presented at the Workplace Hazards to Nurses and other Healthcare Workers: 

Promising Practices for Prevention Conference of the Massachusetts Nurses 

Association. June 7-8, 2007. 

“Culture of Nursing: A Factor in Nurses’ Health and Safety.” Presented by Dr. 

Barbara Mawn. Co-authors: Mawn, B., Hoff, L., Koren, A., Melillo, K., Pearce, C., 

Sperrazza, K. and members of the Phase in Healthcare Team. 

Collaboration with Other Centers/Institutes/Departments 

SHE Seminars: As a result of the 2007 School of Health and Environment 

retreat, a seminar series was held in the spring 2007 semester. Dr. Siqueira together 

with Fausto da Rocha, executive director of the Brazilian Immigrant Center, 

participated in the School of Health and Environment seminar titled “Eliminating 

Health Disparities and Promoting Health and Safety in our Immigrant 

Communities.” In addition, he moderated the seminar sponsored by the Center to 

discuss the activities of the Brazilian Housecleaner Cooperative “Vida Verde.” This 

seminar was conducted in collaboration with the Center for Women and Work. 

These seminars reflected the Center’s increasing work with the Brazilian 

community in Massachusetts. The speakers in the two seminars are key contacts of 

Dr. Siqueira who have collaborated in the project titled Collaboration for Better 

Work Environment for Brazilians (COBWEB) in Massachusetts. 

Qualitative Research Network Seminars: As Co-founders and Members of the 

Qualitative Research Network, Drs. Mawn and Slatin supported the planning and 

coordination of the following events: 

• Women Living with HIV: Patricia Stevens, University of Wisconsin 

Milwaukee 

Monday October 23, 2006 2 – 3:30 pm, McGauvran 410 

Patricia Stevens, RN, PhD, FAAN, received the National Science 

Foundation funding for her longitudinal qualitative research in 

health. 

• Visual Data Analysis in Qualitative Research: Georges Grinstein, PhD 

Tuesday, November 14, 2006, 12 – 1:30 pm, Wannalancit Mill 

Dr. Grinstein directs the Institute for Visualization and Perception 

Research. This work has great importance to the emerging potential for 

analysis of visual data. 


234

• Methods and Findings in Qualitative Research in Conflict Resolution: Eben 

Weitzman, Ph.D. 

March 6, 2007, 2-4 pm. Dr. Weitzman is a social organizational 

psychologist deeply engaged in research and practice in group and intragroup 

conflict, and a methodologist with interests in computer-aided data 

analysis. Weitzman is also an editor of the journal Field Methods. 


1. CPHRHP collaborated in the planning and support of the SHE Seminar Series on 

“Eliminating Health Disparities and Promoting Health and Safety 

in our Immigrant Communities”. This event occurred on March 26, 2007. Panel 

participants from the local and regional community included: Milagro Grullon, Planner 

from the City of Lawrence, Department of Community and Economic Development; 

Fausta da Rocha, Executive Director of the Brazilian Immigrant Center, Boston; Sonith 

Peou, Program Director, Metta Health Center, Lowell Community Health Center; and 

Paulette Renault-Caragianes, Community Liaison, Lowell community Health Center 

2. CPHRHP along with Center for Women and Work co-sponsored a follow up UML 

symposium entitled: "The Role of Brazilian Immigrant Women in Community 

Organizing for Sustainable Environment: Vida Verde Co-op Project" 

Local community Speakers: Heloisa Galvao and Monica Chianelli 

3. The New England Consortium (TNEC), TNEC has been working since 1987 to 

provide top quality participatory hands-on hazardous waste operations and emergency 

response worker health and safety training throughout the region. The COSH 

organizations provide a diversified set of health and safety training programs for labor 

union members, community organizations, health care professionals, school personnel, 

immigrants, teen workers and other groups and individuals. Increasingly, this training has 

broadened out to cover emergency preparedness for mass casualty events including 

natural and man-made disasters and potential disease outbreaks. During Project Year 

2007, TNEC delivered training to more than 16,000 workers. 

TNEC continues to work with diverse groups of public and private sector firms and 

organizations. Important partnerships include work with the U.S. Environmental 

Protection Agency and New England Native American Tribes and the design and 

delivery of customized courses to inspectors and compliance officers from the 

Occupational Safety and Health Administration. TNEC is involved in ongoing 

collaborations with UMass Lowell’s Center for Industrial Competitiveness, a number of 

environmental technology job training programs, and an informal alliance with Keene 

State’s OSHA Education Center. This year TNEC is working with the Massachusetts 

Teachers Association and the Region II Public Health Emergency Preparedness Task 

Force on the development of Avian Flu/ Pandemic curriculum and a train-the trainer 

program for over 400 school personnel, and continuation of Work Zone Safety training 

with the Massachusetts Water Resource Authority and Massachusetts Department of 

Safety. 


235

4. On June 7-8, 2007, the CPHRHP and the School of Health and Environment cosponsored 

a Massachusetts Nursing Association Conference entitled: Workplace Hazards 

to Nurses and other Healthcare Workers: Promising Practices for Prevention”. This was 

attended by over 100 nurses from across the state. Several presentations from the Phase 

project comprised a featured plenary session of the 2 day program. 


SHE Signature Initiative: Dr. Siqueira and other members of the Center, such as Dr. 

Roelofs, Brunette and Abdallah, will have their Signature Initiative Proposal “New 

Voices in Health and Environment” funded by the School of Health and Environment in 

the fall of 2007. 

Innovative Enhancement Award: Submitted by Dr. Barbara Mawn to the Committee of 

Federated Centers and Institutes for the support of an RA and the development of a 

Federal level research grant in the area of health and safety of workers in the 

nanotechnology field. July, 2007. 

Proposal submitted to NIH to address maintenance of health behaviors in the 

Brazilian Community: Dr. Tajik was the lead author on a proposal in response to a NIH 

program announcement for research investigating the long-term maintenance of newly 

acquired healthy behaviors. Drs. Siqueira and Slatin collaborated with her in this effort. 

The proposal did not receive funding but a satisfactory review sheet was returned. We 

are satisfied with the effort and although we will not resubmit, the proposal elements will 

be modified for a future proposal. A project summary is provided below. 

Keeping the Habit: Exploring Health Behavior Initiation and Long-term 

Maintenance is a two-year longitudinal exploratory/quasi experimental research 

with a mixed-method approach that investigates complex and inter-related factors 

affecting the decision-making process in adoption and long-term maintenance of 

health behaviors in nutrition and physical activity in a predominantly low-income 

Brazilian immigrant population. In addition, the study tests the effectiveness of a 

previously developed participatory action model to promote initiation and longterm 

maintenance of a health behavior, and responds to the pressing call for 

identification of factors and mechanisms that ensure sustainability of healthy 

behaviors. 

The Mutuality and Participatory Action Model, which is in turn informed by 

the Socio-Ecological Model (SEM), is used as the theoretical framework in this 

study. Based on this framework, participants could actively participate in 

exploration of factors affecting their decision making in adoption and long-term 

maintenance at various levels of influence that include intrapersonal, inter- 


236

personal, organizational, environmental, and policy levels. Following that, they 

could actively participate in design and implementation of contextually and 

culturally relevant intervention programs that promotes initiation and long-term 

maintenance of healthy diet and physical activity. 

The study includes baseline, a follow-up interim (after 6 months), and a final 

(after 12 months) interviews with all recruited participants. The interviews include 

an adapted version of Health Promotion and Lifestyle Profile II (HPLP-II) survey, 

which measures health promoting lifestyle defined as a multidimensional pattern 

of self-initiated actions and perceptions that serve to maintain or enhance the level 

of wellness, self-actualization and fulfillment of the individual and has two subscales 

in nutrition and physical activity; a short questionnaire to establish specific 

behavior change in diet and physical activity and timeline; and measurements to 

establish and track changes in each participant’s Body Mass Index (BMI). The 

design also includes a series of 3 PhotoVoice (a participatory qualitative methods 

approach) sessions conducted with the participants in the experimental group. A 

sample of 132 adult male and female participants using criteria sampling from 

among the Lowell Brazilian immigrant population will be recruited for this study. 

Based on the sampling criteria, the participants will be adult (18 and over) male 

and female Brazilian immigrants who are willing to participate, willing to 

consider behavior change in diet and physical activity, and wiling to remain in the 

study for at least 18 months. 

The results from this study will extend our knowledge about factors that affect 

long-term maintenance of behavior changes in diet and physical activity in 

minority and immigrant population, test a model for healthy behavior 

maintenance, and begin to respond to a pressing call for identification of factors 

that ensures sustainability of healthy behaviors in the general population. 

Resubmission of an R01 Proposal to the Office of Population Affairs, Department of 

Health and Human Services. 

Dr. Ainat Koren resubmitted a proposal entitled: “The Path to an Unintended Pregnancy 

Couple’s Perspective”. The estimated total cost of this study is $150,000. It is a 

qualitative study which will examine the complex sociocultural factors and decisionmaking 

dynamics among couples that can lead to an unintended pregnancy. The proposed 

study will recruit minorities from local community agencies including the Lowell 

Community Health Center, and the Montachusett Opportunity Council in Fitchburg, MA. 

The proposal was submitted in May, 2007 and the decision is pending. 


237

19. CENTER FOR SUSTAINABLE ENERGY 



August 17, 2007 

1. Brief Overview of Center 

In the abstract, the Center for Sustainable Energy exists to develop systems to provide 

energy for various end uses in an environmentally and economically sustainable manner. 

In the concrete, past and present projects in the center have focused on rural renewable 

energy systems for medical, educational, town, and agricultural use, solar/electric/fuelcell 

systems, photovoltaic-assisted lighting, green building thermal efficiency test 

methods and case studies, solar crop drying, solar design tools, solar resource databases, 

and PV battery testing. The center is unique in the degree to which it combines 

undergraduate and graduate education, research, public service, service-learning, and 

public education into its projects. 


The Center for Sustainable Energy seeks to improve energy efficiency in end-use sectors 

and to increase the diversity of energy resources consistent with an economically and 

environmentally sustainable future. The center strives to combine undergraduate and 

graduate education, research, public service, service-learning, and public education into 

its projects. The mission and major purposes of the University of Massachusetts Lowell 

are to provide to students an affordable education of high quality and to focus some of its 

scholarship and public service on assisting sustainable regional economic and social 

development. The Center goals help support the overall mission of the university. 

2. Objectives 

More specific objectives within this broad mission include: 

• Be a leader in village renewable energy systems through research and education. 

• Incorporate service-learning with sustainable projects into engineering courses at U 

Mass Lowell. 

• Work with faculty to incorporate service-learning projects into mainstream courses 

throughout the College of Engineering in particular, but other colleges and other 

universities also. 

• Design and install solar/hydro systems for vaccine refrigeration, transceiver radio 

communication, lighting, laptop PCs, water purification, and agriculture for remote 

Center for Sustainable Energy 

238

• medical clinics, schools, and towns in Peru and develop infrastructures for local 

people to take over development and maintenance of such systems. 

3. Focus Areas: Discovery/Learning/Engagement (Research/Teaching/Service) 

Our focus areas that in general combine discovery, learning, and engagement 

(research, teaching, and service) include: 

• The Village Empowerment Project involves the development of systems 

appropriate for use in developing countries: low cost; reliable; sustainable in 

terms of energy, environmental impact, and economics. Students, both graduate 

and undergraduate, develop such systems as parts of service-learning projects in 

courses and theses for graduate degrees. Trips have been made twice as year for 

two weeks since August of 1998, led and organized by the center. 

• Service-Learning Integrated throughout a College of Engineering: SLICE. The 

goal here is integrate service-learning (S-L) projects into mainstream required 

courses in the engineering programs so that every student has at least one course 

every semester with S-L. One of the objectives, besides better learning of subject 

matter in the courses, is recruitment and retention of underrepresented groups in 

engineering. To date, over half the engineering faculty (along with a few others in 

other colleges) have incorporated S-L into at least one course. The center director 

is the faculty coordinator for this project. 

• What appears to be the only academic program with graduate degrees explicitly in 

energy engineering (solar) is essentially run in collaboration with the center. The 

director of the center is the graduate coordinator of that program. 

• Applied research and development of: fuel cell and electrolyzer thermal 

modeling; electrolyzer and hydrogen and oxygen storage systems development; 

fuel cell vehicle hydrogen storage comparisons; complex solar system design tool 

for reliability; PV-thermal collector field testing; solar lantern and LED lamp 

development; data acquisition systems for remote PV systems; thermoelectric, 

phase-change vaccine refrigerator development; solar crop dryers; photocatalytic 

water purification with dye indicator; life cycle environmental impact analysis of 

PV modules; energy efficient aquaculture; optimal design method for solar water 

pumping systems; solar autoclaves; in-depth case studies of green buildings; 

energy implications of scoring systems for green buildings; biogas digesters for 

cold climates; geopressured-geothermal, solar conversion system to produce 

potable water; and remote sustainable development. 

4. Faculty/Staff Members 

The following faculty/staff are members/collaborators of the center: 

John Duffy, Director (as of May 1996), Mechanical Engineering Department (solar 

electrolyzer/fuel cell systems, electric vehicles, thermal testing of buildings, passive solar 

systems, PV systems, solar rural systems) 


239

Raul Raudales, Principal of Mesoamerican Development Institute (solar crop drying, 

solar water purification) 

Hong Wei Sun, Assistant Professor, Mechanical Engineering (MEMS micro systems, 

solar thermal concentrators). 

Paul Soper, former University Chaplain, Catholic Center (developing countries) 

Cheryl West, research associate, formerly with the Center for Work, Family, and 

Community, presently doctoral candidate Work Environment program (service-learning) 

Alan Rux, Electrical Engineering Department (solar radios, assistive technology) 

Bill Moeller, Professor Emeritus, Civil Engineering (sustainable development) 

5. New Faculty and Staff Affiliations (last three years) 

We have collaborated with the following new faculty and staff: 

• Linda Barrington, Director of Service-Learning College of Engineering. 

Linda reports directly to John Duffy and is supported in part by the NSF 

SLICE grant and in part by the university. 

• Hong Wei Sun, Assistant Prof., Mechanical Engineering. Collaborated on 

service-learning projects related to heat transfer and energy efficiency and was 

working with a Fulbright Fellow coming from Nigeria for the next academic 

year to study solar thermal concentrators to produce heat and hydrogen. 

• Yan Luo, Assistant Professor, Electrical and Computer Engineering. Worked 

on service-learning projects in his computer architecture courses involving 

remote sensors for monitoring and control of temperatures, purchased with 

SLICE funds. 

• Chris Niezrecki, Assoc. Prof., M.E. Chris was the co-PI on the first solar 

water purification project funded by the NCIIA. We also collaborate on some 

service-learning projects in his design of machine elements course. 

• Joel Therrien, Assistant Prof., ECE. Joel is a former student in energy 

engineering, and we collaborated on a service-learning project in his circuits 

course for a hydro educational display system at the Tsongas History Center. 

• Amy Cannon, Adjunct Assistant Professor, Work Environment. Amy helped 

two graduate students with TiO2 as a photocatalyst for solar water purification 

in recycled PET plastic bottles for remote areas. 

• Deirdra Murphy, Assistant Professor, Physical Therapy. Advises PT students 

working on the Village Empowerment Project; went to Peru June 2007 to 

work with disabled local students and develop service-learning projects. 

• Nicole Champagne, Associate Professor, Health Education. Service-learning 

projects for Health Education students. 

In addition, there are about 36 faculty members total (including the dean and three 

department chairs in the College of Engineering) that have incorporated service-learning 

into their courses as part of the SLICE initiative in the college of engineering. The 

initiative is led by John Duffy of the Center. 


240

6. Students 

The following graduate students have worked in/with the center since June of 2006: 

Somchai Jiajitsawat, solar vaccine refrigerator development (D. Eng. in process) 

George Nitschke, geothermal and solar ponds for hydrocarbon and water 

production (D.Eng.). 

Peter Dubro, solar water purification indicator with TiO 2 catalyst (M.S. thesis) 

Ujjwal Bhattacharjee, financial incentives for renewable energy (D. Eng. in process) 

Nto Diarra, stochastic systems approach to solar water pumping design with 

applications in Mali (Ph.D. thesis in final editing). 

Jesús Solis, biogas systems for farms in cold remote areas and service-learning (M.S. 

thesis). 

Manuel Heredia, solar water purification with bottles coated with TiO2 and servicelearning 

(M.S. thesis). 

Jorge Barrientos, green building case studies and life-cycle environmental impact of 

PV modules (M.S. candidate). 

Tanya Martinez, indigenous peoples reservations green building designs (M.S. 

candidate). 

Eric Morgan, service-learning and photocatylst coating of bottles for solar water 

purification (M.S. candidate). 

Robert Williams, service-learning and study of byproducts safety of photocatalyst and 

dye indicator from solar water bottle purification (M.S. candidate). 

Carolina Barreto, Fulbright Scholar, solar agricultural irrigation systems (M.S. 

candidate). 

Rafael Castro, solar fuel cell systems (M.S. candidate). 

Vivian Crespo, service-learning and rural solar systems (M.S. candidate). 

John Wang (bioengineering program), service-learning and rural health delivery 

(Ph.D. candidate). 

Chigbo Mgbemene, Fulbright Fellow for one year, faculty member from Mechanical 

Engineering Department of University of Nigeria, Nsukka; solar compound parabolic 

concentrators with thermoelectric modules for electricity generation. 

Several others supported by the SLICE grant on service-learning under the direction 

of other faculty. 

In all, 12 graduate students were supported financially through the center. 

In addition, 6 undergraduates (ME and EE) worked on capstone design projects 

through the center. 

♦ Degrees awarded by the university, with theses based on work at the center: 


241

o George Nitschke, geopressured- geothermal, solar conversion system to 

produce potable water (DEng thesis 2006). 

o Manuel Heredia, manufacture of bottles with TiO 2 catalyst for solar water 

purification (MS thesis 2006) 

o Jesús Solis, biodigester design for cold regions (MS thesis 2006) 

o Peter Dubro, solar water purification indicator with TiO 2 catalyst (MS 

thesis 2007) 

7. Current Discovery/Learning/Engagement Projects 

Major current projects include: 

• Portable solar vaccine refrigerator: This was the specific project funded with the half 

research assistantship from the CFCI to Somchai Jiajitsawat. The objectives of this 

work are: 1. Design a portable solar refrigeration system capable of maintaining 

vaccine temperatures between 2 °C and 8 °C for at least 4 days of operation without 

access to grid electricity. 2. Test the feasibility of using the system in different 

remote locations having a high number of unvaccinated children and lacking grid 

electricity. 

The basic concept is to integrate direct-coupled PV thermoelectric modules 

(TEMs) with latent heat energy storage (LHES) using water as the phase change 

material along with heat pipes. In this concept, a photovoltaic panel (PV) directly 

powers thermoelectric modules (TEMs) to generate a cooling effect during the day. 

LHES is integrated into the refrigerator design as a cooling backup to maintain the 

cooling at night. Heat pipes are utilized in the system to passively control the 

temperature for vaccine storage. 

The coupling of PV and TEMs was investigated first with mathematical 

models. The results showed that sufficient cooling could be produced from the 

coupling. The heat pipe attached to TEMs appeared to be able to improve COP 

(coefficient of performance) of TEMs. An experiment showed that it is possible to 

use the heat pipes to maintain acceptable vaccine temperatures above that of ice as the 

energy storage medium. 

A feasibility field study of the system was then simulated for three remote 

sites. The results showed that the direct-coupled PV-TEM combined with latent 

energy storage (using ice) was fully adequate in providing cooling for the vaccines 

throughout the year. 

Two key components have been verified as follows: heat pipe and coupled 

PV and TEMs. The results revealed that problems related to the low melting point of 

the water could be solved by the installation of a cylindrical heat pipe between the 

LHES and the vaccine storage. An experiment showed that the vaccines were kept at 

a temperature of about 3 degrees C while the ice was at the freezing point of 0 C. The 

low COP of TEM was improved by incorporating a heat pipe as a thermal diode and 

sufficient cooling energy was produced from coupling PV and TEMs. 


242

Fig 1. Prototype of vaccine refrigerator 

A prototype of the refrigerator has been built and tested using one and two 

TEM (Fig. 1). A vacuum insulated panel will be added. 

More details are available in Jiajitsawat, Somchai, A Portable Direct-PV 

Thermoelectric Vaccine Refrigerator with Ice Storage through Heat Pipes, Dissertation 

Proposal, March, 2007. 

• Village Empowerment: Two more trips to Peruvian villages, in January and June 

2007, with 10 and 15 students/volunteers, respectively. We now have over 80 

systems in 42 different villages in the same region. The villages in general have no 

electricity, no telephone service, no space heating, biweekly bus transportation, and 

untreated water, in several cases only from open streams. The systems, which harvest 

energy with photovoltaic modules, solar thermal collectors, and microhydro turbines 

and in some cases from the grid, provide radio transceiver communication, lights, 

vaccine refrigerators and other medical devices, water supply and water purification, 

roads, aquaculture fish, laptop computers, and science experiments in schools, 

medical clinics, and municipalities. Some of the systems have dramatic impacts: In 

perhaps the most remote village of the group, Huallmi, with no electricity and no 

telephone, in the six months prior to our installing a transceiver radio in the medical 

clinic in January 2006 there were seven deaths related to childbirth due to delays in 

getting medical help; from January 2006 to our return in June 2006 there were no 

deaths in childbirth. Technologies developed and installed with graduate and 

undergraduate students as well as volunteers during the past year include: 

o Solar water purification with recycled soda bottles coated with an emulsion of 

TiO2 with a dye indicator. 

o Inexpensive radio transceivers for medical clinics, most solar powered. 

o Solar water pumping systems. 

o Biodigester for methane gas production, constant pressure type with moving 

hood. 

o Composting toilet. 

o Solar crop dryer. 

• Service-Learning Integrated throughout a College of Engineering: SLICE. The 

goal here is integrate service-learning (S-L) projects into mainstream required courses 


243

• in the engineering programs so that every student has at least one course every 

semester with S-L. To date, over half the engineering faculty (along with a few 

others in other colleges) have incorporated S-L into at least one course. The center 

director is the faculty coordinator for this project. 

• Case studies of green buildings. Nineteen in-depth case studies were developed and 

documented in a report to the Massachusetts Technology Collaborative by Jorge 

Barrientos, Ujjwal Bhattacharjee, Tanya Martinez, and John Duffy as well as through 

entries into the High Performance Building Data Base of the U.S. Dept. of Energy. 

There are many other current projects mentioned in various other sections under 

students, publications, grants, etc. 

8. Publications/Awards 

• Bhattacharjee, U. and J. Duffy, 2006, “Effect of PV on Reducing Demand 

Charges: Case of a 26 kW PV System in MA,” Proceedings Annual National 

Solar Conference, American Solar Energy Society, July. 

• Jamadagni, S., and J. Duffy, 2006, “Energy and Associated Environmental 

Impacts of the Draft High Performance School Rating System,” Proceedings 

Annual National Solar Conference, American Solar Energy Society, July. 

• Jiajitsawat, S., and J. Duffy, 2006, “A Portable Direct-PV Thermoelectric 

Vaccine Refrigerator with Ice Storage through Heat Pipes,” Proceedings of the 

2006 National Solar Energy Conference, American Solar Energy Society. 

• Duffy, John, Linda Barrington, Cheryl West, John McKelliget, Eugene Niemi, 

Sammy Shina, Hongwei Sun, Chris Niezrecki, Robert Parkin, Majid Charmchi, 

Peter Avitabile, 2007, “Service-Learning in Core Courses Throughout a 

Mechanical Engineering Curriculum,” Proceedings American Society of 

Engineering Education Annual Conference. 

• Duffy, J., D. Kazmer, L. Barrington, J. Ting, C. Barry, Z. Zhang, D. Clark, A. 

Rux, 2007, “Service-Learning Integrated into Existing Core Courses throughout 

a College of Engineering,” Proceedings American Society of Engineering 

Education Annual Conference. 

• Barrington, L, and J. Duffy, 2007, “Attracting Underrepresented Groups to 

Engineering with Service-Learning,” Proceedings American Society of 


• Barrientos, J., U. Bhattacharjee, T. Martinez, and J. Duffy, 2007, “Green 

Buildings in Massachusetts: Comparison between Actual and Predicted Energy 

Performance,” Proceedings Annual Meeting American Solar Energy Society. 

• Heredia, M., and J. Duffy, 2007, “Photocatalytic Destruction of Water Pollutants 

using a TiO2 Film in PET Bottles, Proceedings Annual Meeting American Solar 

Energy Society. 

• Dubro, P., and J. Duffy, 2007, “Dye Indicator for the Effectiveness of TiO2 Water 

Purification,” Proceedings Annual Meeting American Solar Energy Society. 


244

Awards 

o U Mass President’s Award for Public Service, 2006. 

o Boston Celtics Heroes Among Us Award, 2007. 

o The Massachusetts Campus Compact named the Village Empowerment project 

one of three finalists for the Jimmy and Rosalynn Carter Award for University 

Community Partnership, April 2007. Carter Foundation certified universitycommunity 

partnership. 

Patent 

• Duffy, J.J., and D. Shapiro, Electrolyzer Pressure Equalization System, U. S. 

Patent No. 7097748, August 29, 2006. 


♦ Duffy, J., 2006, Village Empowerment Project,” invited presentation 

Merrimack Valley Venture Forum, Lowell, MA, December. 

♦ Duffy, J., 2007, “Village Empowerment Service-Learning Project,” invited 

seminar, Ill. Inst. Tech., Chicago, March. 

♦ Duffy, J., 2007, “Village Empowerment: Peru Project,” invited presentation, 

Boston University, March. 

♦ Duffy, J., 2007, “Solar Systems for Developing Countries,” invited 

presentation, MIT Energy Forum Thought Leaders Seminar, March. 

♦ Duffy, J. and five students, 2007, subjects in “Village Empowerment 

Partnership,” video produced by Jane Pikor, Emerson College, for the MA 

Campus Compact Carter Award Presentation, April, 

♦ Duffy, J., 2007, “Sustainability in International Service-Learning Projects,” 

invited presentation and panel discussion, Engineers Without Borders 

International Annual Conference, U Mass Amherst, April. 

♦ Duffy, J., 2007, invited presentation and session chair, “Recruiting, Developing 

and Guiding Faculty as Team Project Coaches,” Best Practices of 

Interdisciplinary Team Project Programs Conference, Ill. Inst. Tech., Chicago, 

April. 

♦ Duffy, J., 2007, “Village Empowerment: Toward Sustainability in 

International Service-Learning Projects,” workshop, annual conference of 

the Community College National Center for Community Engagement, 

Phoenix, May. 

♦ Duffy, John, Linda Barrington, Cheryl West, John McKelliget, Eugene 

Niemi, Sammy Shina, Hongwei Sun, Chris Niezrecki, Robert Parkin, Majid 

Charmchi, Peter Avitabile, 2007, “Service-Learning in Core Courses 

Throughout a Mechanical Engineering Curriculum,” American Society of 


♦ Duffy, J., D. Kazmer, L. Barrington, J. Ting, C. Barry, Z. Zhang, D. Clark, A. 

Rux, 2007, “Service-Learning Integrated into Existing Core Courses 

throughout a College of Engineering,” American Society of Engineering 



245

♦ Barrington, L, and J. Duffy, 2007, “Attracting Underrepresented Groups to 

Engineering with Service-Learning,” American Society of Engineering 


♦ Barrientos, J., U. Bhattacharjee, T. Martinez, and J. Duffy, 2007, “Green 

Buildings in Massachusetts: Comparison between Actual and Predicted 

Energy Performance,” Annual Meeting American Solar Energy Society. 

♦ Heredia, M., and J. Duffy, 2007, “Photocatalytic Destruction of Water 

Pollutants using a TiO2 Film in PET Bottles, Annual Meeting American Solar 

Energy Society. 

♦ Dubro, P., and J. Duffy, 2007, “Dye Indicator for the Effectiveness of TiO2 

Water Purification,” Annual Meeting American Solar Energy Society. 


The center collaborates with approximately 35 faculty members through the SLICE 

project in developing S-L projects in undergraduate and graduate courses, including 

faculty in the college of health, college of arts and science, and the business school. 



The center collaborates with at least 12 local community partners in those S-L 

projects (http://slice.uml.edu ). Of course, we collaborate with various government 

bodies (Ministry of Health, Ministry of Education, and local town governments) in 

over 42 villages in Peru. Other collaborative endeavors with other universities are 

mentioned under the faculty and publication sections above. 

12. Proposals submitted/Awarded 2006/2007 

Proposals submitted include (in addition to those under grants obtained below): 

♦ NCIIA Sustainable Development Program, Oct. 2006. 

♦ NCIIA Special E-Teams Program, January 2007. 

♦ Equal Exchange Grant Program. 

Grants obtained include: 

• Implementation of Service-Learning Integrated throughout a College of 

Engineering (SLICE); PI, sponsor: NSF ($1,005,000; 2005-09) no-cost extension 

• NSF International Research and Education in Engineering Program, 

supplement to SLICE grant ($31,480; 2007-08) 


246

• Solar Water Purification Bottles with Dye 

Indicator for Developing Countries; sponsor: National Collegiate Inventors and 

Innovators Alliance ($17,500; 2007-2008) 

• International Service-Learning Project in the Colleges of Health and 

Engineering, Healy public service grant, UML ($9600, 2007-09) with Deirdra 

Murphy and Nicole Champagne 

Center contact: 

John Duffy, Professor 

Mechanical Engineering Department 


One University Ave. 

Lowell, MA 01854 

978-934-2968 

FAX: 978-934-3048 

e-mail: John_Duffy@uml.edu. 

http://energy.caeds.eng.uml.edu 

Report to: Nancy_Pitkin@uml.edu 

(Draft report written Aug. 17, 2007 by John Duffy) 


247

20. CENTER FOR WOMAN AND WORK 

Annual Report for 2006-07 

Meg A. Bond, Ph.D., Director 

I. MISSION OF THE UML CENTER FOR WOMEN AND WORK 

The Center for Women and Work (CWW) at the University of Massachusetts Lowell is a vibrant 

community of scholars – representing diverse disciplines – who are dedicated to the Center’s 

mission to: 

• Advance knowledge about the relationship between gender and work through research 

• Enhance understanding of this relationship through education and training 

• Challenge inequalities, particularly through institutional change 

II. GENERAL DESCRIPTION & GOALS 

Since its inception in 1998, the Center for Women and Work has demonstrated its strong 

commitment to addressing the gendered conditions of work in several key ways: by designing and 

implementing programs and projects that foster new ways of thinking about the gendered 

conditions of work; by encouraging and supporting interdisciplinary linkages across and 

throughout all of our networks; and by bringing to the forefront the reciprocal relationship 

between women’s work and the well-being of communities. 

Moreover, the CWW has a synergy with elements of the unique mission of the University of 

Massachusetts Lowell, including promoting sustainable regional economic and social 

development and fostering diversity. CWW is acutely attuned to the negative impact of gendered 

work conditions, and we believe that fully productive and sustainable societies are not possible as 

long as workplace and economic barriers for women remain. CWW not only focuses on how 

economic opportunities vary by gender but also seeks to understand how work issues are related 

to race, ethnicity, class, sexual orientation, age, and disability status. The Center is, therefore, 

dedicated to fostering creative links that benefit individuals in their personal and societal 

networks, advancing social innovations that benefit communities, and encouraging and 

supporting intellectual risk-taking to produce sustainable strategies that work toward greater 

equity and that make all people’s lives healthier and more rewarding. 

The specific goals for each of CWW’s strategic priority areas as are follows: 

1. Advancing Knowledge – i.e., to promote research and scholarship that will advance 

our understanding of the relationship between gender and work 

• Sponsor a focused set of innovative research projects that work toward greater 

gender equity and healthier work lives for women 

• Promote creative linkages across disciplines and support a network of 

scholars engaged in interdisciplinary projects on women and work 

• Support grant writing within this network 

Center for Women and Work 

248

• Disseminate CWW scholarship to local, 

regional, and national audiences 

2. Enhancing Understanding – i.e., to further intellectual inquiry about issues related to 

women and work among students and to support the professional development of a 

cohort of junior scholars able to generate their own scholarship on women and work 

• Enhance understanding of women and work issues through educational programs 

and community forums 

• Develop a curriculum plan for students wanting to gain expertise in the 

gendered conditions of work 

• Support student involvement in CWW projects on women and work 

• Support the general professional development of women students at UML 

3. Challenging Inequalities - i.e., to seek remedies for gender-based inequality in the 

workforce through disseminating information and promoting institutional change, 

including within our own institution. 

• Foster an institutional culture that supports women’s advancement within 

the university 

• Share information on issues related to women & work with the university 

and community 

• Promote partnerships between university and community members for addressing 

gendered working conditions and other concerns for working women 

• Provide organizational consultation & technical assistance 

4. Promoting the sustainability of CWW – i.e., to establish an effective infrastructure 

and generate enough resources to keep the Center a vibrant organization able to meet 

our goals. 

1. Establish a stable infrastructure for CWW & support sufficient staffing 

levels 

2. Maintain an interdisciplinary space accessible to the broader university 

community 

3. Expand the network of associates contributing to the research, service, 

curricular and action elements of the CWW program 

4. Fostering collaborations with national and international professional 

networks 

III. ASSOCIATED PERSONNEL (2006-07) 

Director 

Meg A. Bond, Professor, Department of Psychology 

Senior Associates 

Laura Punnett, Professor, Department of Work Environment; Co-Director, Kerr 

Ergonomics Institute 

Jean L. Pyle, Professor Emerita, Department of Regional Economic & Social 

Development 

Paula Rayman, Professor, Department of Regional Economic & Social Development 


249

CWW Associates 

Mignon Duffy, Assistant Professor, Department of Sociology 

Andrew Hostetler, Assistant Professor, Department of Psychology 

Michelle Haynes, Assistant Professor, Department of Psychology 

Sarah Kuhn, Associate Professor, Department of Regional Economic & Social 

Development 

Cheryl Najarian, Assistant Professor, Department of Sociology 

Susan Thomson, Instructor, Anthropology, Middlesex Community College 

Susan Winning, Coordinator, UML Labor Extension Program 

Sharon Wasco, Assistant Professor, Department of Psychology (Associate on leave) 

CWW Affiliates 

Maria Julia Brunette, Assistant Professor, Department of Work Environment 

BongKyoo Choi, Postdoctoral Research Fellow, Department of Work Environment 

Pia Markkanen, Research Associate, Department of Work Environment 

Susan Moir, Director, Labor Resource Center, UMass Boston 

Imogene Stulken, Protestant Campus Minister 

Robin Toof, Assistant Director, Center for Family, Work, & Community 

Undergraduate and Graduate Students 

Maria Aguiar, Undergraduate Work Study Student 

May Elewa, Department of Regional Economic & Social Development 

Jaime Jackson, Undergraduate Work Study Student 

Heather Norcross, Department of Psychology 

Laurie Santiago, Undergraduate Work Study Student 

Margaret Scarsdale, BA/MA Student, Department of Regional Economic & Social 

Development 

Working W.I.S.E. Project Staff 

Jody Lally, Project Director 

Padmaja Sistla, Research Assistant 

IV. CURRENT RESEARCH AND ACTION PROJECTS 

Our current research and action projects reflect the four strategic priorities that comprise 

our mission (see page 1). 

Strategic Goal #1: Advancing Knowledge 

1) CWW Associates Program 

At the heart of CWW is the Associates Program, which serves as a hub for innovative 

scholarly projects and helps expand the overall resource base for exciting and consequential 

work that forwards the mission of CWW and the University. Each year, the program is 

imbued with new vitality as the CWW welcomes new Associates, each actively involved in 

pursuing distinctive projects related to the gendered conditions of work. During 2006-07, we 


250

hosted eight Associates representing the disciplines of 

psychology, sociology, public health, economics, labor relations, and anthropology. 

The Associates Program provides a supportive intellectual community that both supports 

these individual projects and fosters unique interdisciplinary collaborations and grant 

proposals. This leading-edge program has the potential to become a model for other 

university centers that want to expand their focus beyond a small core group of faculty and 

students. 

During 2006 & 07, CWW Associates have: 

• Developed grant-funded projects (see also Section V below): 

o Funding from NSF to support a 2007 “Project Working W.I.S.E.” 

conference on women working in the STEM fields ( (Paula Rayman, 

Meg Bond, & Maria Brunette) 

o Funding from UMass Healey/Public Service Grant to support a project 

in 06-08 on “Redefining aging; Redefining community” (Andy Hostetler 

& Susan Thomson) 

o Seed funding from University Research Council on “Building a Care 

Movement in Massachusetts (Mignon Duffy) 

• Supervised graduate student projects on such topics as leadership models for union 

women, issues facing women in science and technology careers, caring for survivors 

of rape, redefining aging in the community 

• Presented a symposium about CWW at the European Association for Work and 

Organizational Psychology (May 2007) 

• Produced six authored or edited books and special journal issues on women and work 

• Published 27 journal articles and book chapters, and made over 30 individual 

presentations to professional audiences 

• Expanded the CWW Working Papers Series (WPS) to seven manuscripts with new 

papers on women and science, affirmative action, issues for people working with 

victims of rape, and elder care. The WPS is a vehicle for making Associates’ work 

more quickly available for dissemination. Hard copies of all CWW working papers 

are available upon request (see full list in Section VI below). 

• Developed two new courses: Gender, Work and Public Policy (RESD) and 

Sociology of Disability (Sociology). Plans are in the works to create another new 

course on Feminist Methodologies (Sociology). 

• Served on numerous university, community, and professional boards 

2) Center-Sponsored Research Programs 

In addition to the Associates Program, CWW currently has three core, center-sponsored 

research endeavors, each of which involves interdisciplinary collaborations. 

• Carework: People, Policies and Politics 

The research focus of several CWW Associates revolves around the theme of 

“carework,” or paid and unpaid caring for other people, in various forms. For 

example, Jean L. Pyle’s work exposes the growing care deficits in the lives of women 

who migrate transnationally to provide care services to others as nannies, domestics or 

healthcare workers. She documents the double-bind their home governments face, 


251

needing women to migrate for economic reasons but not 

wanting citizens abused abroad or the accompanying adverse publicity. Andrew 

Hostetler and Susan Thomson received a Healey/Public Service Endowment Grant for 

a project entitled “Redefining Aging, Redefining Community.” The two-year project 

is focused on better understanding the needs of the aging population in Lowell with 

particular attention to differences according to gender, socioeconomic class, and 

ethnicity. One aspect of Mignon Duffy’s research is a large historical quantitative 

study of paid care workers, focusing on the intersections of gender, race, and 

immigration with care in the paid labor market. She is particularly interested in the 

historical occupational mobility of child-care workers and the different constructs of 

childcare over time in the United States. Sharon Wasco is developing a study for and 

about those who care for rape survivors. Her community-based research program will 

include attention to both the emotional reactions of rape victim advocates to the 

difficult nature of their work and the effect of organizational support on their self-care 

strategies. Laura Punnett has been studying occupational health and safety problems in 

the healthcare sector for several years, documenting the range of exposures across the 

socioeconomic spectrum that affect both direct-care and other workers. Given this 

convergence of interests, CWW is exploring several new initiatives on this theme, 

including spearheading an inter-campus carework policy agenda and compiling an 

edited volume on women, work, and caregiving. 

• Women in Science, Technology, Engineering, and Mathematics 

The Working WISE Project, funded by the National Science Foundation, is a 

visionary project has brought together intergenerational scholars from diverse 

disciplines in order to foster dialogue among leading experts regarding workplace 

factors associated with women’s success in Science, Technology, Engineering, and 

Mathematics (STEM) fields. The Project centered around a working conference 

held in April 2007. Working in intergenerational, interdisciplinary groups, 

conference attendees identified what has changed for women in the STEM 

(science, technology, engineering, and mathematics) fields and developed specific 

proposals for future research, public policy, and workplace action. Four themes 

guided these discussions: 1) educational pathways for women entering STEM 

careers, 2) discrimination in the workplace, 3) work-life balance, and 4) job and 

organizational factors in which lead to success in these fields. An edited 

conference volume will summarize results and be distributed widely to academic, 

industry, and public policy audiences. The keynote speaker at the conference was 

Dr. Evelynn M. Hammonds, professor of the history of science and of African- 

American studies at Harvard University. Hammonds serves as Harvard’s senior 

vice provost for Faculty Development and Diversity. Members of the team that 

organized the conference are Professor Paula Rayman of Regional Economic and 

Social Development (RESD), principal investigator; Psychology Professor Meg 

Bond, co-principal investigator; Assistant Professor Maria Brunette of Work 

Environment, co-principal investigator; Jody Lally, Project Director; and May 

Elewa and Padmaja Sistla, Research Assistants. 

• Gendered Work Climates, Discrimination, and Health 

This research program is a multi-year collaboration between CWW and the Kerr 

Ergonomics Institute (KEI) and now also includes the new Center for the 

Promotion of Health in the New England Workplace (CPH-NEW) at UML. It 

focuses on researching the links between work climate, discrimination, and 

harassment against women in the workplace, levels of stress, adverse health 


252

outcomes, and increased business costs (due to higher 

absenteeism, increased turnover, lowered productivity, and higher worker 

healthcare costs). 

During 2006-07, we convened an interdisciplinary research group of faculty and 

students from Psychology, Work Environment, and Sociology to address a common set 

of research questions through secondary analysis of extant data sets, including data 

collected in 2000 through a survey of UML staff. Our previous work had shown 

differences in ratings of psychosocial work climate between gender-segregated and – 

integrated jobs, which might also have reflected differences in work content. This year 

we compared descriptions of work demands among the different occupations 

represented and found some evidence through a quantitative (cluster) analysis that 

respondents’ interpretation of the psychological and physical demands items in the 

survey (Karasek Job Content Questionnaire) might differ by job title. In order better to 

understand these findings, and to learn how different people understand and interpret 

the items in detail, we have now begun a set of qualitative interviews of UML staff 

members in the same range of job categories. These interviews will be carried out 

during the summer and perhaps early fall of 2007 and will then be analyzed for 

completion of the draft manuscript. (Lead Associates: Laura Punnett & Meg Bond; 

Research Associate BonKyoo Choi; assistance in recruiting interviewees from Susan 

Winning) 

• Workplace Diversity 

Meg Bond has written a book on workplace diversity entitled Workplace 

Chemistry: Addressing Organizational Diversity in the 21 st Century (University 

Press of New England). The book summarizes a case study of a manufacturing 

firm undergoing a process of organizational change aimed at increasing diversity. 

It traces the complex dynamics involved as organizations make a commitment to 

help all employees work to their fullest potential and to provide insights useful to 

others who share such goals. The book is due out in October 2007. 

Through a contract with the National Institute for Occupational Safety and 

Health, Meg Bond, Laura Punnett, and several students developed a 

catalog of workplace measures that assess aspects of the work environment 

relevant to ethnicity, race, and gender diversity such as harassment, 

discrimination, work-family balance, and general organizational climate for 

diverse groups of workers (see Bond, Kalaja, et al. in Section VI). The 

compendium has been in press for a couple years; release of the hard copy volume 

is expected in the fall of 2007. Our team recently also consulted with NIOSH on 

putting the compendium on line to make the measures even more accessible to 

interested researchers. 

Strategic Goal #2: Enhancing Understanding 

1) Curriculum Development 

CWW sponsored a new course taught by Paula Rayman in the Spring of 2007 

entitled, “Gender, Work, and Public Policy.” This seminar explored the challenges 

and opportunities associated with such factors as: economic globalization, 

government restructuring, work-family balancing, environmental safety, gender 


253

discrimination, and political/social injustice. A number 

of CWW Associates offered guest lectures during the semester. There was an 

emphasis on how public policies can advance progress towards equality and better 

quality of life. The seminar will be offered again in the Fall of 2007. 

2) Graduate Certificate on Diversity in the Workplace 

CWW is exploring an interdisciplinary graduate certificate program on diversity 

and healthy workplaces. We expect to submit a formal proposal for the certificate 

program during the 2007-08 academic year. 

3) Collaboration with the Laboratory for Interdisciplinary Design (LID) 

The LID, which is physically adjacent to CWW, is an unusual teaching and learning 

space, supporting interdisciplinary, collaborative, active learning, and service 

learning. The LID can support projects on issues of particular concern to women; it 

also supports improved pedagogy, which research shows can help retain women in 

technical fields. During the year, the LID was furnished, outfitted with computers, 

craft materials, hand tools, and a used electronic projector. 

As Coordinator of LID, Sarah Kuhn (also CWW Associate) has been spearheading 

the development of curriculum to support new teaching merging the technical and 

the social. A new interdisciplinary service learning general education course, 

Designing the Future World, has at last been approved by the UML General 

Education Committee. The course will be taught for the first time in Fall 2007. 

During the 2006-07 academic year, Dr. Kuhn identified potential issues and 

collaborators, and drafted a concept paper for submission to the UMass President’s 

Creative Economy initiative, entitled “Sustainable Design: Creativity in the Public 

Interest” with collaborators from across the university. 

Strategic Goal #3: Challenging Inequalities 

1) Ninth Annual “Gathering at the Well” Forum on “Who Cares? The People, Policies and 

Politics of Carework: March 29, 2007 

CWW sponsors an annual forum entitled “Gathering at the Well” that is attended by many from 

the greater Lowell community as well as UML faculty, staff, and students. We selected this 

imagery because historically women gathered at the well to collect water and share common 

issues. They turned what is often an onerous task into a source of strength. The CWW Forum, 

“Gathering at the Well,” is designed to tap into that strength by promoting dialogue on issues of 

women and work and striving for awareness and solutions. 

The Forum theme for 2007 was “Who Cares? The People, Policies, and Politics of 

Carework” and the event addressed the issue of eldercare, with specific emphasis on concerns 

for the careworkers. The forum opened with a presentation by Susan Thomson, which 

provided a thorough and comprehensive look at the many faces and facets of care-giving; her 

talk was made even more poignant by the sharing of personal stories of caregivers in the 

greater Lowell community. Expanding on Deborah Stone’s “triangle of care,” Susan 

introduced “the tetrahedron of care,” tangibly demonstrating the connection between and 

among the person receiving care, the careworker, family members, and the community. A 

panel comprised eminent speakers including Alice Wolf, Massachusetts State Representative; 

Rebecca Gutman, SEIU 1199; and Marian Weisenfeld, Greater Boston Interfaith 

Organization. The panel discussed the needs of the elderly – including feeling connected 


254

with their community – and the needs of careworkers in 

general. Discussions shed light on how our society has no systematic way to deal with aging. 

Most fundamentally, our elder-care system does not support the emotional, physical, and 

economic needs of careworkers. The impact of this neglect is that there are few incentives to 

take up carework professionally, which results in family and friends being more concerned 

and worried about their loved ones and, more saliently, having to shoulder more of the burden 

in this area. 

The keynote speaker was Lisa Dodson, a noted research professor at Boston College, who 

delivered a forceful and passionate look at the gross inequalities that tear at the fabric of 

women caregivers’ lives. Dodson expressed dual concerns about caregivers’ perception of 

themselves and also the carework they do – issues that she is all too familiar with because of 

her field research, which focuses on the lives of low income careworkers in the expanding 

care labor force. According to Dodson, “Being individualistic or independent is looked at 

synonymously with being a complete person, and not being independent is looked at as being 

incomplete.” She said we need to be a society that highly regards interdependence and that 

recognizes that we all need to give and receive. 

The morning’s events also included table discussions where over 80 forum attendees 

discussed issues such as the concerns of the elderly, government interventions or the lack of 

it, and how difficult it is for family to care for their loved ones when they live far away. Each 

group had to list their suggestions for improvement, which were then displayed throughout 

the hall. Also, as part of CWW’s mission to advance change, participants were encouraged to 

write down, and commit to, their own personal resolutions for advancing change in a care 

movement. 

The Forum organizing committee was chaired by Imogene Stulken and included Susan 

Thomson, Mignon Duffy, Heather Norcross, and Meg Bond. The Forum was co-sponsored 

with the Psychology Graduate Student Organization and Protestant Campus Ministry. It was 

funded in part by the UML Council on Diversity and Pluralism and the UML Council of 

Federated Centers and Institutes. 

2) Lowell Women’s Week: March 2006 

CWW sponsored two events during this year’s Lowell Women’s Week. As part of 

its commitment to community involvement, CWW co-sponsored a public hearing 

that focused on advancing women toward wage equality and a luncheon that 

spotlighted women’s issues in the workplace. The public hearing, lead by the 

Massachusetts Commission on the Status of Women, sought to collect stories from 

women who have been negatively impacted by discriminatory wages. Along with 

CWW’s sponsorship, the public hearing was co-sponsored by American Association 

of University Women, Massachusetts Coalition for Women’s Wage Equality, UMass 

Lowell Council on Diversity & Pluralism and Labor Extension Program, the 

Merrimack Valley Central Labor Council, and YWCA of Lowell. 

The UMass Labor Extension Program and CWW also co-sponsored a Lowell 

Women’s Week luncheon, which was primarily designed to bring together UMass 

women employees. The luncheon had a broad focus, and featured discussions not 

only on the economic disenfranchisement of women, issues of work/family balance, 

lack of leadership roles for women, ergonomic issues, but also on personal themes 


255

familiar to women: the stress of constantly 

multitasking, lack of appreciation for work done, and performing work outside the 

scope of one’s job description. 

Both events sought to advance change by calling for specific action steps that 

empower women and reconfigure structural policies that perpetuate these 

inequalities. 

3) Community Collaborations 

• Partnership Against Sexual Assault 

In close collaboration with psychology students and staff members at Rape Crisis 

Services of Greater Lowell, Sharon Wasco convened a new organization called 

Greater Lowell Partnership Against Sexual Assault (GLPASA). GLPASA is a 

community coalition of professionals who provide medical, legal, advocacy and 

mental health care to diverse community members in Lowell affected by rape and 

sexual violence. The group has been meeting on a monthly basis since March 2007; 

and participants represent a wide range of Lowell and Middlesex County agencies 

such as: Lowell Community Health Center, Saints Medical Center; UML, Lowell 

and Chelmsford Police Departments, Middlesex District Attorney’s Office, 

Middlesex Sheriff’s Office, United Teen Equality Center, Asian Task Force, 

African Assistance Network, International Institute Lowell, Alternative House, 

Middlesex Community College, Victim Rights Law Center, and FOCUS. Current 

priorities include developing a sustainable GL-PASA, continuing building 

alliances through interactive 

monthly meetings, and assessing need for a coordinated response to sexual assault 

(SART/SANE) in Lowell 

(http://www.uml.edu/college/arts_sciences/psychology/In_the_Community/the_co 

mmunity.html for more information about GLPASA). 

• Voices for Planned Parenthood 

The Center for Women & Work worked with Planned Parenthood League of 

Massachusetts to establish a chapter of Voices for Planned Parenthood Group 

(VOX) on campus during the 2006-07 academic year. Screenings of the films “The 

Education of Shelby Knox” and “The Abortion Diaries” were held on campus to 

promote the new group to the University community. The UML chapter of VOX 

focuses on health education and awareness of women’s reproductive rights in the 

community. 

4) Publications and Outreach 

The Center for Women and Work produces and distributes two issues yearly of a 

newsletter, Perspectives. This publication includes articles about all aspects of the 

Center’s activities. The newsletter is mailed to about 1,000 individuals from all over 

the country. 

5) Support a Community of Equity at UMass Lowell 

• Work with UML Service Excellence Transformation Team 

The overall purpose of the UMass Lowell Campus Transformation Project is to 

improve the physical, economic, and social aspects of UML through a variety of 


256

initiatives, including developing interdisciplinary 

teaching and research activities, extending connections to community programs, 

and maintaining a clean and safe working environment for the University 

community. One team – the Service Excellence Team –invited CWW Director 

Meg Bond and community psychology student Lyndsey Tarsia to join their efforts 

so that the group could draw upon insights gathered from the prior UML survey 

conducted by CWW. The goal of the Service Excellence Team is to address the 

day-to-day experience of everyone on campus—faculty, staff, students and 

external groups involved with UML. The team will conduct focus groups and 

surveys to assess opportunities for change at UML. Based on the information 

gathered, the team will recommend strategies for enhancing the quality of work 

life at UML and improving customer service. 

• Call for Gender Equity Study at UMass Lowell 

In collaboration with the UMass Lowell Labor Extension Program, CWW has 

submitted a request to the new Chancellor to undertake a campus-wide gender 

equity study. The call for action grew out of discussions in March among women 

representing diverse departments of the University of Massachusetts Lowell who 

gathered together for a luncheon in the Alumni Lounge to share the pressing and 

pivotal issues they face in the UML workplace. 

Strategic Goal #4: Promoting the Sustainability of CWW 

1) Maintaining an Interdisciplinary Space 

CWW’s office is frequented by graduate students from Psychology, RESD, and 

Work Environment. We have computers available for general student use, and 

keep our offices open all week with the help of TAs and work-study students so that 

the university community can use our space to gather informally. CWW has also 

made our conference room available for regular meetings of faculty and student 

groups such as Gender Studies and a support group for Junior Faculty. We have 

joined with Political Science/Model Leagues Program, Gender Studies, Cultural 

Studies, and faculty involved with a new Multidisciplinary Design Lab to foster an 

educational community in the basement of Coburn that revolves around gender, 

diversity, and hands-on learning. 

2) Fostering Collaborations Locally, Regionally, Nationally and Internationally 

In terms of intra-university collaborations, we have had a particularly strong 

relationship and on-going collaboration with the Kerr Ergonomics Institute. Much 

of that collaborative work will now also be coordinated with the new Center for the 

Promotion of Health in the New England Workplace (CPH-NEW). We also work 

closely with the Laboratory for Interdisciplinary Design (LID) which is an unusual 

teaching and learning space, supporting interdisciplinary, collaborative, active 

learning, and service learning. In addition, we actively collaborate and co-sponsor 

programs with the Center for Family, Work, and Community (CFWC), the Council 

on Diversity and Pluralism, and the Departments of Psychology, Work 

Environment, Sociology, and Regional Economic & Social Development. We also 

coordinate our activities and co-sponsor events with the Gender Studies Program, 

the Lowell Center for Sustainable Production (LCSP), the Center for Public Health 


257

Research and Health Promotion (CPHRHP), and the 

Peace and Conflict Studies Institute (PACSI). 

During this past year, we have strengthened our working relationships with 

statewide groups dedicated to women’s issues. We co-sponsored events with the 

Massachusetts Chapter for the American Association for University Women and the 

Massachusetts Commission on the Status of Women. We were among the cosponsors 

of the Massachusetts Conference on Women. Meg Bond was invited to 

join the Middlesex Regional Council of the Massachusetts Commission on the Status 

of Women. 

In addition, CWW extends our impact through strong relationships with national 

and international groups, including the National Institute for Occupational Safety 

and Health; Brandeis University Women’s Studies Research Center; Massachusetts 

Commission on the Status of Women; National Society for the Psychological Study 

of Social Issues; National Society for Community Research and Action; University 

of Haifa International Conference on Social Responsibility; Boston Combined 

Jewish Philanthropies; PEACEWORK: American Friends Service Committee; 

European Association for Work and Organizational 

Psychology; and the International Congress on Women, Work, and Health. CWW 

is also a member of the National Center for Research on Women. 

3) Establishing a stable infrastructure for CWW & support for sufficient staffing levels 

CWW will be celebrating our 10 th anniversary in 2008. We are planning a series of 

celebratory events that have multiple goals: 1) to celebrate our accomplishments, 2) 

to increase the visibility of CWW – locally, regionally, nationally & internationally, 

and 3) to establish funding for a more sustainable infrastructure. We have formed 

an advisory board, which will hold its first meeting on September 20, 2007. We will 

be holding three events (one per semester from Fall 2007 to Fall 2008), each of 

which combine the goals of increased visibility for CWW and fundraising. 

4) Unveiling New CWW Logo 

To celebrate entering our 10th year, CWW unveiled a new logo. The design was 

developed by Ekaterina Konovalova, whose background in advertising and marketing 

helped her to envision the image of unity of women and work. According to Ekaterina, 

the liveliest element in the graphic composition is the letter “C,” which symbolizes hair 

tresses swirling around the figure of a woman. The logotype reflects the integration of 

womanhood and involvement with work. 

V. RESEARCH AND PROJECT SUPPORTS (2006-07) 

A. Student Research Support 

• One half-time graduate research assistant on CFCI funds 

• One half-time graduate research assistant on NSF funds 


258

• One graduate assistant from the Department of Psychology 

• Two students on contacts with funds from CFCI 

• Three undergraduate students on work-study funds 

B. Grants & Contracts 

Funding received: 

$200,000 Grant from the National Science Foundation 

Paula Rayman (PI), Meg Bond (Co-PI), and Maria Brunette(Co-PI) received 

National Science Foundation (NSF) funding to support a working conference that 

gathered an intergenerational and interdisciplinary community of racially and 

ethnically diverse scholars to have a dialogue about scholarship on workplace 

factors that are associated with women’s success in STEM fields. The Project 

funding period is January 2006 to December 2007. 

$12,504 Collaborative Grant from the Committee of Federated Centers and Institutes, to 

CWW jointly with the Kerr Ergonomics Institute (2006-07) 

$1,000 Grant from the UML Council on Diversity and Pluralism to sponsor the Spring 

2007 Gathering at the Well Forum 

$10,000 Healey and Public Service Endowment Grant 

CWW Faculty Associates Andrew Hostetler and Susan Thomson received funding 

for a two-year project entitled “Redefining Aging, Redefining Community.” The 

two-year project will begin in the fall of 2006. The project has both community 

research and curriculum innovation goals. The community research and outreach 

component is focused on better understanding the needs of the aging population in 

Lowell with particular attention to differences according to gender, socioeconomic 

class, and ethnicity. It aims to conduct a “developmental mapping” of community 

resources and a similar mapping of residents’ goals and needs. In addition to 

identifying gaps in available services, the project will result in a novel planning and 

resource guide that will allow emerging seniors of the Merrimack River Valley to 

plot out individualized developmental paths that will meet their anticipated goals 

for social and community involvement. The primary curriculum innovation 

objectives are to integrate research-centered service-learning into courses at both 

Middlesex Community College and UML, establish an interdisciplinary and 

intergenerational research partnership between students and area senior citizens 

and service providers. (2006-08) 

$10,000 University Research Council Seed Grant 

Mignon Duffy, CWW Faculty Associate, received a seed grant from the University 

Research and Scholarship Council to complete an interdisciplinary analysis of 

recent state-level policy initiatives related to care in Massachusetts. This project, 

entitled “Building a Care Movement in Massachusetts,” is an effort to connect the 

work of academics studying the paid and unpaid work of care to organizing 

strategies used by activists. The first phase of this effort will focus on a limited 

number of care-related policy initiatives that have recently been on the state-level 


259

agenda within Massachusetts, such as health care 

reform, paid family leave, and collective bargaining proposals for personal care 

attendants. The second phase will be focused on developing a strategy to engage 

care scholars in the state policy arena. (2007-09) 

Other proposals submitted: 

1) Submitted a proposal to the UML Council on Diversity and Pluralism for the 

continuation of the CWW mentoring programs for graduate students and junior 

faculty. Not funded. 

2) Submitted a proposal to the 2007 President’s Initiative Fund to support student 

involvement in research on “Gender in the Workplace.” Not funded. 

VI. PUBLICATIONS & PROFESSIONAL PRESENTATIONS (2006-07) 

CWW Working Papers 

Bond, M.A., & Punnett, L. (2006). Expanding our understanding of the psychosocial work 

environment. Center for Women & Work Working Paper Series, WP06-01. 

Brunette, M. J., Rayman, P., Bond, M., & Yuan, L. (in press). A Delphi study to structure a 

working conference on women’s success in science, technology, engineering, and 

mathematics (STEM) fields. Center for Women & Work Working Paper Series, WP07-02. 

Haynes, M. C., & Heilman, M E. (in press). Perceptions of Affirmative Action (AA): 

Implications for attitudes towards AA and its psychological consequences. Center for 

Women & Work Working Paper Series, WP07-03. 

Moir, S., & Skidmore, E. (2006). Pre-apprenticeship model for women entering and 

succeeding in the construction trades. Center for Women & Work Working Paper Series, 

WP06-03. 

Najarian, C.G. (2006). Deaf mothers, maternal thinking, and intersections of gender and 

ability. Center for Women & Work Working Paper Series, WP06-02. 

Thomson, S. (in press). The care tetrahedron: Portraits of elder care in the United States. 

Center for Women & Work Working Paper Series, WP07-04. 

Wasco, S. M., Knight, M. K., Fernández, M. C., Twarog, K. E., Norcross, H. L., Martin, K. 

C., de Laubenfels, M. J. (in press). Reactions to rape research: Examining upset and regret 

among ethnicity diverse college women. Center for Women & Work Working Paper Series, 

WP07-01. 

Books, Monographs & Edited Journal Issues 

Bond, M.A. (forthcoming October 2007). Workplace Chemistry: Promoting Diversity 

through Organizational Change. Hanover, NH: University Press of New England. 


260

Bond, M.A., Kalaja, A., Markkanen, P., Cazeca, D., Daniel, S., Tsurikova, L., & Punnett, L. 

(2007). Compendium of Diversity-Related Measures for Research in Occupational Health. 

National Institute for Occupational Safety and Health (NIOSH), US DHHS, Cincinnati OH. 

Bond, M.A. & Harrell, S. (Eds.) (2006). Special Issue on Stories of Diversity Challenges in 

Community Research and Action. American Journal of Community Psychology, 36 (3/4). 

Markkanen, P., Hurst, P., Quinn, P., Hakim, A., & Dessy, M. (In press). Children, solvents, 

and shoemaking in Cibaduyut, Indonesia: local case - global primary prevention. Geneva: 

World Health Organization. 

Najarian, C. G. (2006). ‘Between Worlds’: Deaf Women, Work, and Intersections of Gender 

and Ability. New York: Routledge. 

Summerfield, G., Pyle, J. & Desai, M. (2006). Globalization, Transnational Migration, and 

Gendered CareWork. Symposium in Globalizations, 3 (3). 

Journal Articles 

Bond, M. & Harrell, S. (2006). Diversity challenges in community research and action: The 

story of a special issue. American Journal of Community Psychology, 36 (3/4). 

Cifuentes, M., Gore, R., Boyer, J., Tessler, J., d’Errico, A., Scollin, P., Lerner, D., Kriebel, 

D., Punnett, L., & Phase in Healthcare Research Team. (2007). Inter-method agreement 

between O*NET and survey measures of psychosocial exposure among healthcare 

employees. American Journal of Industrial Medicine, 50(7), 545-553, doi: 

10.1002/ajim.20480. 

Cohler, B. J., & Hostetler, A. J. (2006). Gay and lesbian lives in the third age: Possibilities 

and paradoxes. In J. B. James & P. Wink (Eds.), The Crown of life: Dynamics of the early 

postretirement period. Annual Review of Gerontology and Geriatrics, 26, 263-281. 

d'Errico, A., Punnett, L., Cifuentes, M., Boyer, J., Tessler, J., Gore, R., Scollin, P.A., Slatin, 

C., Phase in Healthcare (2007). Hospital injury rates in relation to socioeconomic status 

and working conditions. Occupational and Environmental Medicine, 64, 325-333, doi: 

10.1136/oem.2006.027839. 

Duffy, M. (2007). Doing the dirty work: Gender, race, and reproductive labor in historical 

perspective. Gender & Society, 21 (3), 313-336. 

Gold, J.E., Park, J.S., Punnett, L.(2006). Work routinization and implications for ergonomic 

exposure assessment. Ergonomics, 49(1), 12-27. 

Harrell, S. & Bond, M.A. (2006). Listening to diversity stories: Principles for practice in 

community research and action. American Journal of Community Psychology, 36 (3/4). 

Hostetler, A. J., Sweet, S., & Moen, P. (2007). Gendered career paths: A life course 

perspective on returning to school. Sex Roles, 56(1/2). 


261

Kuhn, S. & Rayman, P. (forthcoming). Software and 

internet industry workers in Massachusetts: Findings and implications for the future of 

work. The New England Journal of Public Policy. (Reprinted from book chapter, see 

below) 

MacDonald, L.A., Harenstam, A., Warren, N.D., & Punnett, L. (2007) Incorporating work 

organization into occupational health research - An invitation for dialog. Occupational and 

Environmental Medicine (accepted). 

Miranda, H., Gold, J.E., Gore, R., Punnett, L. (2006) Recall of prior musculoskeletal pain. 

Scandinavian Journal of Work Environment and Health, 32(4), 294-300. 

Myers, D., Kriebel, D., Wegman, D.H., Karasek, R.A. Punnett, L. (2007) The social 

distribution of risk at work: Acute injuries and physical assaults among healthcare workers 

working in a long-term care facility. Social Science & Medicine 64, 794-806. 

Najarian, C. G. (2006). Deaf mothers, maternal thinking, and intersections of gender and 

ability. Scandinavian Journal of Disability Research, 8(2-3), 99 - 119. 

Punnett, L. (2006). Socioeconomic differences in severe back morbidity. (Invited 

Commentary) Occupational and Environmental Medicine 63;369-370. 

Pyle, J. (2006). Globalization, transnational migration, and gendered care work: An 

introduction. Globalizations, 3(3), 282-295. 

Pyle, J. (2006). Globalization and the increase in transnational care work: The flip side. 

Globalizations, 3(3), 297-315. 

Pyle, J. & Ward, K. (forthcoming). Recasting Our Understanding of Gender and Work 

During Global Restructuring. In Globalization and Economy, edited by Paul James. Sage 

Publications. (Reprint of article originally published in International Sociology, 2003, 

special issue on Globalization, Gender, and Social Change in the 21 st Century. 8(3), 461- 

489.) 

Wallace, R.F., Kriebel, D., Punnett, L., Wegman, D.H., Wenger, C.B., Gardner, J.W., Kark, 

J.A. (2006) Risk factors for recruit exertional heat illness by gender and training period. 

Aviation Space and Environmental Medicine, 77(4), 415-21. 

Book Chapters, Technical Reports, & Conference Proceedings 

Bond, M.A. & Punnett, L. (In press). Expanding our understanding of the psychosocial work 

environment. In Bond, et al. (Eds.), Compendium of Diversity-Related Measures for 

Research in Occupational Health. National Institute for Occupational Safety and Health 

(NIOSH), US DHHS, Cincinnati OH. 

Hostetler, A.J. (forthcoming in 2008). Generativity and the mature gay men: An ecological 

approach. Invited submission for P. Hammack & B. J. Cohler (Eds.), Life course and sexual 

identity: Narrative perspectives on gay and lesbian identities. New York: Oxford University 

Press. 


262

Hostetler, A. J. (forthcoming). Homosexuality & bisexuality: Cultural and historical 

perspectives. Invited submission for The Chicago companion to the child. Chicago: 

University of Chicago Press. 

Kuhn, S. (2007). Evocative Objects. In S. Turkle (Ed.), Objects in Mind: Falling for science, technology, 

and design. Cambridge, MA: MIT Press. 

Kuhn, S. & Rayman, P. (2007). Women on the edge of change: Employees in United States 

information technology companies. In C. Burger (Ed.), Reconfiguring the Firewall: A Cross- 

Cultural Context for Recruiting Women to IT. A.K. Peters, Ltd. 

Kuhn, S. & Rayman, P. (2007). Software and internet industry workers in Massachusetts: 

Findings and implications for the future of work. In T. Juravich (Ed.), Future of Work in 

Massachusetts. Amherst, MA: University of Massachusetts Press. 

Martin, F. & Kuhn, S. (2006) Computing in context: Integrating an embedded computing 

project into a course on ethical and societal issues. 2006 Proceedings of the Association for 

Computing Machinery Special Interest Group on Computer Science Education (ACM- 

SIGCSE 2006) 

Pyle, J. (Forthcoming). Public Policy and Local Economies: The Phenomenon of Secondary 

Migration. In Pho, T. L., Gerson, J. & Cowan, S. (Eds.), Southeast Asian Refugees and 

Immigrants in the Mill City: Changing Families, Communities, Institutions – Thirty Years 

Afterward. University Press of New England. 

Slatin, C., Punnett, L., et al. (2006, December). Health Disparities among Healthcare 

Workers. Final Report, Grant # R01 OH007381, National Institute of Occupational Safety 

and Health. 

Professional Presentations 

Arabas, J., Rack, M. & Thomson, S. (2006). Multicultural Service-Learning: Storybooks and 

Ethnographies in the Service of Understanding. Northeast Regional Campus Compact 

Conference. Nashua, NH. 

Bond, M.A. (Chair). (2007). Is Ecological Research Ecological? Is Research Validity Valid? 

Session at the 11 th Biennial Conference of the Society for Community Research and Action, 

Pasadena, California. 

Bond, M.A. (2007). Visions for an Equitable Workplace: Harnessing Diversity for 

Organizational Vitality. Invited panel at the European Association for Work and 

Organizational Psychology, Stockholm, Sweden. 

Bond, M.A. (Chair), Hostetler, A., Pyle, J. & Rayman, P. (2007). Sustaining Our Work as 

Organizational Scholar-Change Agents: Creating an Interdisciplinary Community to Address 

Gender and work. Symposium presented at the European Association for Work and 

Organizational Psychology, Stockholm, Sweden. 


263

Bond, M.A. (2007). Workplace Chemistry: Reflections 

on Organizational Change to Address Diversity. Invited talk at Vanderbilt University. 

Bond, M. & Harrell, S. (2006). Diversity Stories in Community Research and Action: Toward 

developing Principles for Community Psychology. First International Conference on 

Community Psychology, San Juan, Puerto Rico. 

Bond, M. (2006). Challenges Facing Community Action Research Centers: Lessons from a 

Center on Women and Work. First International Conference on Community Psychology, 

San Juan, Puerto Rico. 

Bond, M. & Harrell, S. (2006). Diversity Stories in Community Research and Action: Toward 

developing Principles for Community Psychology. First International Conference on 

Community Psychology, San Juan, Puerto Rico. 

Cifuentes, M., Gore, R., Boyer, J., Tessler, J., d’Errico, A., Scollin, P., & Punnett, L. (2006). 

Association between O*NET and survey measures of psychosocial exposure in healthcare 

workers. American Public Health Association Annual Meeting, Boston MA. 

Cifuentes, M., Gore, R., Boyer, J., Tessler, J., d’Errico, A., Scollin, P., & Punnett, L. (2006). 

Socioeconomic status and working conditions as predictors of survey response in healthcare 

workers. American Public Health Association Annual Meeting, Boston MA. 

Duffy, M. (2007). Building a Care Movement: Three Frames for Change. Paper accepted for 

presentation at Eastern Sociological Society’s annual meetings. Philadelphia, PA. 

Duffy, M. (2006). The History of the Global Care Chain: Immigrant Caring Labor in the 

United States. Social Science History Association annual meetings. Minneapolis, MN. 

Frumin, E., Vossenas, P., Moriarty, J., Orris, P., Halpin, J., Krause, N., Punnett, L. 

(2006).Workload related musculoskeletal disorders among hotel housekeepers: Worksite 

surveillance reveals a growing national problem. NIOSH NORA Symposium, 

Washington DC. 

Harrell, S. & Bond, M.A. (Chairs) (2007). Developing Diversity Principles for Community 

Research and Action. Session at the 11 th Biennial Conference of the Society for Community 

Research and Action, Pasadena, California. 

Haynes, M. C. & Heilman, M. E. (2007). Perceptions of Affirmative Action (AA): 

Implications for attitudes towards AA and its psychological consequences. Presented at the 

22 nd Annual Society for Industrial Organizational Psychology Conference; New York, New 

York. 

Hostetler, A. J. (2007). Choosing care, sacrificing community? Older adults and the prospects 

for building multicultural, intergenerational caring communities. Paper to be presented at 

the Fifth Annual Carework Conference, New York, N.Y. 


264

Kuhn, S. (2006). Coming to our Senses in Higher 

Education: Using “low technology” to enhance engagement, learning, and embodied 

knowledge. Invited workshop as a “Back by Popular Demand” session; workshop repeated 

three 

times at conference because of very high demand. Teaching Professor Conference, Chicago, 

IL. 

Najarian, C. (2007). The public and private lives of politicians: Negotiating work, family, and 

public policies. Paper to be presented at the Fifth Annual Carework Conference, New York, 

N.Y. 

Najarian, C. G. (2006). Personal Responsibility and Deaf Women’s Work Experiences in the 

New Economy. Peer-reviewed paper presented at Refereed Roundtable at the American 

Sociological Association Meetings, Montreal, Quebec, Canada. 

Najarian, C. G. (2006). Deaf or deaf?: College Educated Deaf Women as Linguistic Minorities 

in Families and Schools. Peer-reviewed paper presented at the Society for the Study of 

Social Problems Meetings, Montreal, Quebec, Canada. 

Najarian, C. G. (2006). The Bilingual Work of Deaf Mothers: Gender, Ability, and Maternal 

Thinking. (Invited contribution) The Salon: Faculty Colloquium in the Fine Arts, 

Humanities, and Social Sciences, University of Massachusetts Lowell, Lowell, MA. 

Najarian, C. G. (2006). Deaf Mothers, Maternal Thinking, and Intersections of Gender and 

Ability. Eastern Sociological Society Meetings, Boston, MA. 

Najarian, C. G. (2006). Women in the Workplace. Session Presider, Eastern Sociological 

Society Meetings, Boston, MA. 

Punnett, L. (2007) Inequitable Distribution of Workplace Risks: Insights from Studying 

Musculoskeletal Disorders. C. O. Sappington Memorial Lecture (Invited Keynote). 

American College of Occupational and Environmental Medicine, American Occupational 

Health Conference, New Orleans LA. 

Punnett, L. (2007) Socioeconomic disparities in health and in occupational exposures: 

Relevance for workplace health promotion and protection programs. NORA Symposium, 

Midwest Center for Occupational Health and Safety, University of Minnesota, Minneapolis 

MN. 

Punnett, L. (2006). Work-Related Musculoskeletal Disorders in Men and Women: Is the 

Burden Equitably Distributed? (Invited Keynote) 28th International Congress on 

Occupational Health, Milan, Italy. 

Pyle, J. (2007). Globalization and the increase in transnational care work: The flip side. Paper 

to be presented at the Fifth Annual Carework Conference, New York, N.Y. 

Pyle, J. (2007). Human Trafficking: What Are the Issues? University of North Florida. 

(Human Trafficking Awareness Week Lecture). 


265

Pyle, J. (2007). Human Trafficking: What Are the 

Issues? Northeast Florida Human Trafficking Task Force, Jacksonville, FL. 

Tessler, J., Boyer, J., Cifuentes, M., Park, J.K., Scollin, P., Punnett, L. (2006) Upper extremity 

musculoskeletal exposures and the healthcare worker: Is there a gradient by socioeconomic 

status? American Public Health Association Annual Meeting, Boston MA. 

Rayman, P. (2007). Caring for caregivers. Paper to be presented at the Fifth Annual 

Carework Conference, New York, N.Y. 

Thomson, S. (2007). Portraits of Elder Care in the United States. Invited talk for the Center 

for Women & Work 9 th Annual Gathering at the Well Forum. University of Massachusetts 

Lowell, Lowell, MA. 


266

21. COMBUSTION LABORATORY 

2006-2007 YEAR-END REPORT 

TO CFCI UML 

I. Mission Statement 

This Center is engaged in activities in fire research (chemistry and physics of 

fire; initiation mechanisms; fire prevention and extinguishment). These activities 

are in support of current and pending cooperative efforts with such federal and 

other agencies as the Transportation Security Administration, Department of 

Energy, NASA, NIST, and UMASS-Amherst (UMA). 

II. General Description 

We have been working with UML and UMA colleagues in Chemical Engineering, 

Plastics Engineering, Mechanical Engineering, Civil and Environmental 

Engineering, Chemistry, and Physics Departments. Our past and ongoing 

activities include the following areas of research: 

• Mechanisms for initiation of fire. 

• Facilitation of combustion by application of electrostatic field effects. 

• Improvement of industrially important combustion reactions with friendly 

environmental benefits. 

• Fire initiation and mitigation. 

III. 

IV. 

Research Activities Focus Areas: Anionic and Electrostatic Field Effects in 

Hot Surface Catalyzed Combustions. (This area will be discussed in Section 

VII.) 


Our activities this past year have been interdisciplinary within this University. 

These activities have included the following personnel: 

• UMLDep’t of Chemistry: Professors William Bannister (Center Director) and 

Edwin Jahngen 

• UML Dep’t of Physics: Professor James Egan 

• UML Dep’t of Plastics Engineering: Professors Francis Lai, Nick Schott and 

Ramaswami Nagarajan 

• UML Dep’t of Civil & Environmental Engineering: Dr. Pradeep Kurup 

• UML Dep’t of Mechanical Engineering: Professor Hungwei Sun 

• UMA Dep’t of Mechanical and Industrial Engineering: Dr. David Schmidt 

• UMA Dep’t of Chemical Engineering: Professors William C. Curtis, Jr and 

George W. Huber 

Combustion Laboratory 

267

V. New faculty affiliations within the past three years: 

• Dr. Ramaswamy Nagarajan (Plastics Engineering) 

• Dr. Hungwei Sun (Mechanical Engineering) 

VI. Student Research Support 

Our group has provided financial and technical support to three graduate students 

(Jirayu Chaosukhum; Wipoo Sriseubsai; Pongphisanu Muangchareon. 

VII. Current Research Projects: Electrostatic (Anionic) Effects in Hot Surface 

Combustions 

We have confirmed our prevcious findings that: 

• Initial phase of hot surface catalyzed oxidation is anionic, not free radical. 

• Oxygen radical anions abstract protons in a rapid initial step to form a 

carbanion and hydroxyl free radical In a second slow rate determining step, 

electron transfer from the carbanion to radical anion forms an alkyl free 

radical, which only then proceeds in oxidation sequences. Carbanion 

intermediacy provides lowered energy path. Free radical character determines 

ultimate product identity. 

• Seebeck effects govern generation of oxygen radical anions at the hot surface. 

Negative charge effects facilitate oxidations. Inverse relationships exist 

between hydrocarbon hot surface ignitability and combustibility. 

• Surfaces with negative Seebeck effects facilitate selective oxidations, but 

require higher temperatures to effect ignition of fuels than is the case for 

positive Seebeck effect surfaces. 

• Transient rapidly moving incandescent “red spots” presage fuel ignition across 

the surface. This may provide a capability for detection of incipient stage of 

fire development, allowing triggering of extinguishing and alarm sounding 

before ignition actually occurs. 

• The Fischer-Tropsch (F-T) reaction is the basis of a multi-billion dollar 

industry whereby coal, charcoal, biomass and other carbonaceous materials can 

be oxidized using super-heated steam (at very high temperatures) to form 

carbon monoxide and hydrogen: C + H 2 O → CO + H 2 . The CO is used in 

the “Oxo’ process to form industrially important aldehydes; hydrogen is an 

increasingly important fuel for use in emission free automobiles. Both the CO 

and hydrogen can be combined in an extension of the F-T process to form 

clean burning low-soot forming Diesel fuel with no sulfur or other polluting 

contaminants This clean Diesel fuel is at the moment somewhat more 

expensive than conventional Diesel; but as the world’s petroleum resources are 

dwindling with concomitant ever-increasing fuel prices at the pump, the F-T 

process derived fuel is becoming an ever more popular industrial route, with 

much cleaner burning fuel, and with several million barrels a year in current 

production and use. The F-T process is typically conducted at high 

temperatures. Our initial findings are that the process can be performed at 


268

much lower temperatures when large negative electrostatic charges are applied, 

which would considerably cheapen the reaction system. 

• The burning of hydrocarbon fuel air mixtures (particularly Diesel fuels) takes 

place at extremely high temperatures, resulting in concomitant combustion of 

nitrogen in the air to form highly toxic nitrogen oxides (“NO x ”) which present 

serious environmental problems in automotive engine performance. We are 

looking at the possibility of application of electrostatic charges with a view 

toward decreasing engine temperatures and NOx emissions. 

• The following depicts the mechanism for hot surface combustion 

H 

F 

E AC 

T 

2 o 3 o 

B 

1 o 

D 

E 

A 

C 

G 

Reaction Coordinate 

.. _ 

A: Reactants: R-H R H + : O . Blue line 

── denotes primary (1 o ) hydrocarbon 

.. Green line 

── denotes secondary (2 o ) hydrocarbon 

Orange line ── denotes tertiary (3 o ) or benzyl [Ф-CH[ 

2 -] 

hydrocarbon 

Red line 

── 

denotes non-ionic free radical pathway 

B: Transition state in formation of carbanion and hydroxyl free radical 

C: Unstable intermediate: formation of R: - (carbanion)/hydroxyl free radical pair 

D: Transition state in formation of R . free radical/hydroxide anion (rate determining) 

E: Unstable intermediate: formation of R . free radical/hydroxide anion 

F: Transition state in formation of oxidation products 

G: Products: CO, CO 2 , H 2 O, etc. 

23 

H: Reaction path without carbanion intermediacy formation in fast step. 

Following is a recently achieved example of facilitated Fischer-Tropsch combustion of 

carbon by water gas (CO + H 2 O), by application of electrostatic field effects: 

12 

Carbon dioxide ( % CO) 

10 

8 

6 

4 

2 

0 


1.5 1 0 -1 -1.5 

269 

Electrostatic field (K Volt) 

600 C 

650 C 

700 C

In addition, we have made discoveries in the following new areas: 

• Successive positive/negative electrostatic field pulses facilitate oxygen radical 

anion formation from air by Seebeck electron transfer to the hot surface during 

positive phases. Higher reaction rates result from radical anion repulsion from 

surfaces during the negative phase. 

• Industrially important oxidations (e.g., Fischer-Tropsch, and oxychlorinations 

and nitrous oxide oxidations); and inorganic oxidations such as Contact 

preparation of sulfuric acid from sulfur, nitric acid preparation from ammonia, 

and Deacon preparation of chlorine from HCl, occur similarly with higher rates 

and yields at lower temperatures. 

• Injection of small amounts of water into internal combustion engines has 

previously been shown to enhance engine performance (decreased fuel 

consumption, engine temperatures and soot and NO x emissions. We believe we 

have discovered that the underlying principle in these salutary effects is the 

Fischer-Tropsch oxidation of soot particles by the injected water, and that 

water may also cause greater oxidation of soot by NO x emissions (with 

corresponding decreases in NO x ). 

• Building upon these principles, the incorporation of pulsed +/- electrostatic 

fields into engine operations is expected to further reduce internal combustion 

engine temperatures, fuel requirements, and NO x and soot emissions, with even 

higher increases in engine horsepower. 

• Better Seebeck catalysts should result in optimized performance for 

commercial oxidations, and for engine performance. 

VIII. Most recent publications: 

Paramasawat, W.; Lai, F.; Muangchareon, P.; Sriseubsai, W.; Chaosukhum, 

J.; Chiang, S-K; Meesrisom, A.; Donatelli, A.; Kurup, P.; Schott, N.; Egan, J.; 

Jahngen, E.; Bonner, F.; Muangchareon, P.; Sriseubsai, W.; Chiang, C-S; 

Meesrisom, A.; Nagarajan, R.; Chaosukhum, J.; Sengupta, S.; Euaphantasate, 

N.; Bannister, W. “Anionic Effects in Hot Surface Combustions”, Proc., 16 th 

Annual Halon Options Technical Working Conf., Natl. Inst. Of Standards and 

Technology, Albuquerque, NM, May 24-26, 2006. 

Invention Disclosure: “Anionic and Electrostatic Field Effects in Hot Surface 

Catalyzed Combustions”, to UML; August 2007 

IX. Conferences 

Anionic Effects in Hot Surface Oxidations. 16 th Annual Halon Options 

Technical Working Conf., Albuquerque, NM, May 2006. 


270

X. Intra-University Collaboration 

As cited previously in this report, there have been extensive activities within the 

University involving the Departments of Plastics Engineering, Civil and 

Environmental Engineering, Mechanical Engineering: Chemistry, and Physics. 

XI. 

Regional/Local Community Technical Outreach 

We have initiated a working partnership with engineering staff at the 

University of Massachusetts (Amherst). 

XII. Proposals Submitted: 

To NineSigma, Cleveland, OH. “Use of Anionic and Electrostatic Field Effects 

in Hot Surface Catalyzed Combustion to Reduce Nitrous Oxide Emissions in 

Exhaust Gas in Contact Aeration Processes at Sewage Plants”. $200,000; 

August 2007 

Submitted By: 

William Bannister, Center Director 

14 August 2007. 


271

22. INSTITUTE FOR NANOSCIENCE AND ENGINEERING TECHNOLOGY 

(INSET) 

Arthur C. Watterson, Director 


1. Mission 

The Institute for NanoScience and Engineering Technology is a collaborative University 

wide interdisciplinary research and development center that focuses on research, 

education and training regarding nanoscience and engineering technology that will 

advance our knowledge and improve the lives of the people of the Commonwealth. 


Nano research includes control of materials structures from the atomic level to intricate 

structures by methods such as self assembly of supramolecular as well as enzyme 

reactions. New materials with new properties will be generated by these techniques. 

These new materials will be of interest to the Commonwealth as they can generate new 

start up companies to benefit the state economy. 

Goals: 

Develop collaborative research with other Centers, Departments and Colleges within the 

University. 

Develop collaborative research with industry 

Develop research projects funded by government agencies 

Provide education and training in nanoscience and nanoengineerng for UMass Lowell 

students and postdoctoral research students 

Provide education and training for the regional community 

3. Research Focus 

The research focus within INSET is directed at novel materials which includes: 

materials research as illustrated by the following areas 

Nano chemistry of substituted fullerenes that show promise for drug delivery and also as 

efficient conducting polymers. 

New nanostructures formed from the synthesis of triblock copolymers 

New self assembled polymeric drug delivery systems which include nanosized particles 

to promote rapid delivery and uptake of drugs. Dual drug delivery systems have also been 

developed 

Enzyme synthesis of new polymeric materials that show potential applications in both the 

medical field, the electronics industry and the cosmetics field. These materials and their 

applications are the current focus: 

INSTITUTE FOR NANOSCIENCE AND ENGINEERING TECHNOLOGY 

272

New MRI imaging contrast agents 

Dual nano carriers for cosmetics and drug delivery 

Polyelectrolytes 

Fire retardant polymers 

Sequestration of Lead with Nano Particles 

Antimicrobial activity 

Encapsulation of Botulinum inhibitors 

Analytical research 

Analysis and oxidation/reduction studies on alpha-tocopherol as well as organic 

compounds in storm drain water in Massachusetts 

Selective recognition of Calcium ions by polymeric phenols 

4. Faculty and Staff Associated with INSET 

Arthur C. Watterson, Professor Emeritus, Director, Department of Chemistry, University 

of Massachusetts Lowell 

Long Chiang, Professor, Dept of Chemistry, University of Massachusetts Lowell 

Virinder Parmar, Visiting Professor, Dept of Chemistry, University of Massachusetts 

Lowell 

Rudy Faust, Professor, Dept of Chemistry, University of Massachusetts Lowell 

David Ryan, Professor, Dept of Chemistry, University of Massachusetts Lowell 

Lynne Samuelson, Dept of Chemistry, University of Massachusetts Lowell 

Eugene Barry, Professor, Dept of Chemistry, University of Massachusetts, Lowell 

Marina Ruths, Assistant Professor, Department of Chemistry, University of 

Massachusetts Lowell 

Jayant Kumar, Professor, Dept of Physics, University of Massachusetts Lowell 

Thomas Shea, Professor, Dept of Biological Sciences, University of Massachusetts 


Mark Hines, Professor, Dept of Biological Sciences, University of Massachusetts Lowell 

Jackie Zhang, Associate Professor, Dept of Environmental Engineering, University of 

Massachusetts Lowell 

Bal Ram Singh, Professor, University of Massachusetts, Dartmouth 

Robert Fisher, Research Professor, Dept of Chemical Engineering, MIT 

Clark Colton, Professor, Dept of Chemical Engineering, MIT 

Anna Moore, Assistant Professor of Radiology, Mass General Hospital 

Ashok Prasad, Visiting Professor, Dept of Chemistry, University of Massachusetts Lowell 

Sunil Sharma, Visiting Professor, Department of Chemistry.University of Massachusetts 


Throughout the following sections the activities linked to CFCI funding are 

indicated by a double asterisk and bold face type 


Undergraduate students 


273

Graduate Students 

Rahul Tyagi 

Vincent Tucci 

Thomas Farrell 

Postdoctoral Research Associates 

Mukesh Pandey 

Ravi Mosurkal 

6. Current Research Progams 

The research projects in INSET are predominantly synthesis and characterization of 

new materials. 

Drug Delivery Materials – research continues on the modification and testing of 

polyethylene glycol (PEG) based nanospheres. NIH supported funding for the testing of 

delivery of an antioxidant formulation as well as other anticancer materials in mice. The 

work has produced encouraging results. 

Fire Retardant Materials – Research continues on modification of polymers with crosslinking 

and formation of inverse micelles for encapsulation of known fire retardant 

compounds such as metal hydroxides to make them more compatible with commercial 

polymers. A grant from MTTC was obtained for scaling up the reactions 

Magnetic Resonance imaging (MRI) – Research continues in this project as several 

fluorinated nanospheres with fluorescent dyes attached have been prepared and are being 

tested at MIT. Targeting peptides have been attached and are being tested for selectivity. 

Fullerene Chemistry – Resesarch continues on the functionalization and subsequent 

chemistry of C60 fullerenes. Two Photon phenomena are an exciting new discovery in 

this area. It can have important applications in the medical field. 

Multiblock and Amphiphilic Polymers – Research continues on the synthesis and 

characterization of new multiblock polymers and their applications, particularly in the 

medical field, namely stent coating materials. 

7. Peer reviewed publications of INSET 2005 – 2006 

(** means graduate student supported by Institute funding) 

1) **Synthesis and characterization of nano carrier containing antioxidant 4- 

methylcoumarin. Pandey, Mukesh K.; Tyagi, Rahul; Parmar, Virinder S.; Tucci, 

Vincent; Kumar, Jayant; Shea, Thomas; Watterson, Arthur C.. Polymer Preprints 

(American Chemical Society, Division of Polymer Chemistry) (2007), 48(2), 958- 

959. 

2)**Design and synthesis of novel crosslinked polydimethylsiloxanes for use in flame 

retardant applications. Tucci, Vincent B.; Pandey, Mukesh K.; Tyagi, Rahul; 


274

Parmar, Virinder S.; Kumar, Jayant; Watterson, Arthur C.. Polymer Preprints 

(American Chemical Society, Division of Polymer Chemistry) (2007), 48(2), 276- 

277. 

3)**Lipase (novozyme 435) catalyzed chemo selective one pot synthesis of surfactants. 

Farrell, Tom; Tyagi, Rahul; Pandey, Mukesh K.; Parmar, Virinder S.; Watterson, 

Arthur C.. Polymer Preprints (American Chemical Society, Division of Polymer 

Chemistry) (2007), 48(2), 244 

4) **Selectivity of lipase (novozyme 435) in pegylated and siloxane polymers. Tyagi, 

Rahul; Pandey, Mukesh K.; Kumar, Rajesh; Tucci, Vincent; Kumar, Jayant; 

Parmar, Virinder S.; Watterson, Arthur C.. Polymer Preprints (American 

Chemical Society, Division of Polymer Chemistry) (2007), 48(2), 219-220. 

5) Specificities of acetoxy derivatives of coumarins, biscoumarins, chromones, flavones, 

isoflavones and xanthones for acetoxy drug: Protein transacetylase. Kumar, Ajit; 

Singh, Brajendra K.; Sharma, Nawal K.; Gyanda, Kapil; Jain, Sapan K.; Tyagi, 

Yogesh K.; Baghel, Anil S.; Pandey, Mukesh; Sharma, Sunil K.; Prasad, Ashok K.; 

Jain, Subhash C.; Rastogi, Ramesh C.; Raj, Hanumantharao G.; Watterson, Arthur 

C.; Van der Eycken, Erik; Parmar, Virinder S. European Journal of Medicinal 

Chemistry (2007), 42(4), 447-455. 

6) Synthesis and characterization of dual nanodelivery systems containing vitamin E for 

cosmetics and pharmaceuticals. Kumar, Rajesh; Tyagi, Rahul; Watterson, Arthur 

C.; Parmar, Virinder S.; Kumar, Jayant ACS Symposium Series (2007), 

961(Cosmetic Nanotechnology: Polymers and Colloids in Cosmetics), 139-148. 

Publisher: American Chemical Society, 

7)**Design and synthesis of novel amphiphilic polymers for MRI and selective targeting 

in cancer diagnosis/therapy. Pandey, Mukesh K.; Tyagi, Rahul; Kumar, Rajesh; 

Parmar, Virinder S.; Watterson, Arthur C.; Kumar, Jayant; Hardiman, Michelle T.; 

Zhou, Jin; Brower, Kevin P.; Fisher, Robert J.; Colton, Clark K. . PMSE Preprints 

(2007), 96 855-856. Publisher: American Chemical Society, 

8)**Enzymatically synthesized pegylated polymers as nano-micellar drug delivery 

systems. Kumar, Rajesh; Tyagi, Rahul; Pandey, Mukesh K.; Parmar, Virinder S.; 

Kumar, Jayant; Watterson, Arthur C.. PMSE Preprints (2006), 95 981-982. 

9)**Biocatalytic synthesis of organo-siloxane copolymers for flame retardant 

applications. Mosurkal, Ravi; Tucci, Vincent; Samuelson, Lynne A.; Bruno, 

Ferdinando; Westmoreland, Philip R.; Kumar, Jayant; Watterson, Arthur. Polymer 

Preprints (American Chemical Society, Division of Polymer Chemistry) (2006), 

47(2), 1110-1111 

10) Novel function of calreticulin: characterization of calreticulin as a transacetylase- 


275

mediating protein acetylator independent of acetyl CoA using polyphenolic acetates. 

Raj, Hanumantharao G.; Kumari, Ranju; Seema; Gupta, Garima; Kumar, Rajesh; 

Saluja, Daman; Muralidhar, Kambadoor M.; Kumar, Ajit; Dwarkanath, Bilikere S.; 

Rastogi, Ramesh C.; Prasad, Ashok K.; Patkar, Shamkant A.; Watterson, Arthur C.; 

Parmar, Virinder S. Pure and Applied Chemistry (2006), 78(5), 985-992. 

11) Microwave-assisted synthesis of antimicrobial dihydropyridines and 

tetrahydropyrimidin-2-ones: Novel compounds against aspergillosis. Chhillar, Anil 

K.; Arya, Pragya; Mukherjee, Chandrani; Kumar, Pankaj; Yadav, Yogesh; Sharma, 

Ajendra K.; Yadav, Vibha; Gupta, Jyotsana; Dabur, Rajesh; Jha, Hirday N.; 

Watterson, Arthur C.; Parmar, Virinder S.; Prasad, Ashok K.; Sharma, Gainda L. 

Bioorganic & Medicinal Chemistry (2006), 14(4), 973-981. 

12) Prolonged Charge-Separated States of Starburst 

Tetra(diphenylaminofluoreno)[60]fullerene Adducts upon Photoexcitation. El- 

Khouly, Mohamed E.; Anandakathir, Robinson; Ito, Osamu; Chiang, Long Y. 

Journal of Physical Chemistry A (2007), 111(30), 6938-6944. 

13) Large concentration-dependent nonlinear optical responses of starburst 

diphenylaminofluorenocarbonyl methano[60]fullerene pentads. Elim, Hendry I.; 

Anandakathir, Robinson; Jakubiak, Rachel; Chiang, Long Y.; Ji, Wei; Tan, Loon- 

Seng. Journal of Materials Chemistry (2007), 17(18), 1826-1838 

14)**Comparison of singlet oxygen generation efficiency between water-soluble C60- 

diphenylaminofluorene conjugates and molecular micelle-like FC4S. So, Grace; 

Karotki, Aliaksandr; Verma, Sarika; Pritzker, Kenneth; Wilson, Brian; Chiang, 

Long Y.. Journal of Macromolecular Science, Part A: Pure and Applied 

Chemistry (2006), 43(12), 1955-1963. 

15) Synthesis and characterization of hexadecaaniline-grafted comb-like poly(maleic 

acid-alt-1-octadecene). Anandakathir, Robinson; Canteenwala, Taizoon; Wang, 

Hsing-Ling; Chiang, Long Y.. Department of Chemistry, University of 

Massachusetts Lowell, Lowell, MA, USA. Journal of Macromolecular Science, 

Part A: Pure and Applied Chemistry (2006), 43(12), 1945-1954. 

16) Large Cross-Section Enhancement and Intramolecular Energy Transfer upon 

Multiphoton Absorption of Hindered Diphenylaminofluorene-C60 Dyads and Triads. 

Padmawar, Prashant A.; Rogers, Joy E.; He, Guang S.; Chiang, Long Y.; Tan, Loon- 

Seng; Canteenwala, Taizoon; Zheng, Qingdong; Slagle, Jonathan E.; McLean, 

Daniel G.; Fleitz, Paul A.; Prasad, Paras N Chemistry of Materials (2006), 18(17), 

4065-4074. 

17) Low multielectron reduction potentials of emerald green [60]fullerenes. 

Canteenwala, Taizoon; Li, Wenguang; Wang, Hsing-Ling; Chiang, Long Y. 

Chemistry Letters (2006), 35(7), 762-763. 


276

18) Unusual photophysical properties of emerald green [60]fullerene. El-Khouly, 

Mohamed E.; Canteenwala, Taizoon; Araki, Yasuyuki; Ito, Osamu; Chiang, Long 

Y.. Chemistry Letters (2006), 35(7), 710-711. 

19) Synthesis and Characterization of Monolayers and Langmuir-Blodgett Films of an 

Amphiphilic Oligo(ethylene glycol)-C60-hexadecaaniline Conjugate. Tang, 

Zhexiong; Padmawar, Prashant A.; Canteenwala, Taizoon; Gao, Yuan; Watkins, 

Erik; Majewski, Jaroslaw; Chiang, Long Y.; Wang, Hsing-Lin. Langmuir (2006), 

22(12), 5366-5373 

20) Comparison of three methodologies for the determination of pulmonary fungal 

burden in experimental murine aspergillosis. Sheppard, D. C.; Marr, K. A.; 

Fredricks, D. N.; Chiang, L. Y.; Doedt, T.; Filler, S. G Clinical Microbiology and 

Infection (2006), 12(4), 376-380. 

21) **Synthesis and characterization of photoresponsive diphenylaminofluorene 

chromophore adducts of [60]fullerene. Padmawar, Prashant A.; Canteenwala, 

Taizoon; Verma, Sarika; Tan, Loon-Seng; Chiang, Long Y. Journal of Materials 

Chemistry (2006), 16(14), 1366-1378. on 

22)**Photoinduced Processes in a Tricomponent Molecule Consisting of 

Diphenylaminofluorene-Dicyanoethylene-Methano[60]fullerene. El-Khouly, 

Mohamed E.; Padmawar, Prashant; Araki, Yasuyuki; Verma, Sarika; Chiang, Long 

Y.; Ito, Osamu. Journal of Physical Chemistry A (2006), 110(3), 884-891. 


1)**Synthesis and characterization of nanocarrier containing antioxidant 4- 

methylcoumarin. Pandey, Mukesh K.; Tyagi, Rahul; Parmar, Virinder S.; Tucci, 

Vincent B.; Kumar, Jayant; Shea, Thomas; Watterson, Arthur C. Abstracts of 

Papers, 234th ACS National Meeting, Boston, MA, United States, August 19-23, 

2007 (2007), 

2)** Design and synthesis of novel crosslinked polydimethylsiloxanes for use in flame 

retardant applications. Tucci, Vincent B.; Pandey, Mukesh K.; Tyagi, Rahul; 

Parmar, Virinder S.; Kumar, Jayant; Watterson, Arthur C. Abstracts of Papers, 

234th ACS National Meeting, Boston, MA, United States, August 19-23, 2007 

(2007), 

3)** Lipase (Novozyme 435) catalyzed chemoselective one pot synthesis of surfactants. 

Farrell, Tom; Tyagi, Rahul; Pandey, Mukesh K.; Parmar, Virinder S.; Watterson, 

Arthur C.. Chemistry, Abstracts of Papers, 234th ACS National Meeting, Boston, 

MA, United States, August 19-23, 2007 (2007), 


277

4)**Selectivity of lipase (Novozyme 435) in 

pegylated and siloxane polymers. Tyagi, Rahul; Pandey, Mukesh K.; Tucci, Vincent 

B.; Kumar, Rajesh; Kumar, Jayant; Parmar, Virinder S.; Watterson, Arthur C 

Abstracts of Papers, 234th ACS National Meeting, Boston, MA, United States, 

August 19-23, 2007 (2007), 

5)**Design and synthesis of novel amphiphilic polymers for MRI and selective targeting 

in cancer diagnosis/therapy. Pandey, Mukesh K.; Tyagi, Rahul; Kumar, Rajesh; 

Parmar, Virinder S.; Watterson, Arthur C.; Kumar, Jayant; Hardiman, Michelle T.; 

Zhou, Jin; Brower, Kevin P.; Fisher, Robert J.; Colton, Clark K. Abstracts of 

Papers, 233rd ACS National Meeting, Chicago, IL, United States, March 25-29, 2007 

(2007), 

6)**Biocatalytic synthesis of organo-siloxane copolymers for flame retardant 

applications. Mosurkal, Ravi; Tucci, Vincent; Samuelson, Lynne; Bruno, 

Ferdinando; Westmoreland, Phillip R.; Kumar, Jayant; Watterson, Arthur C.. 

Abstracts of Papers, 232nd ACS National Meeting, San Francisco, CA, United 

States, Sept. 10-14, 2006 (2006), POLY-533. 

7)**Enzymatically synthesized pegylated polymers as nano-micellar drug and gene 

delivery systems. Kumar, Rajesh; Tyagi, Rahul; Pandey, Mukesh K.; Parmar, 

Virinder S.; Kumar, Jayant; Watterson, Arthur C.. Abstracts of Papers, 232nd 

ACS National Meeting, San Francisco, CA, United States, Sept. 10-14, 2006 (2006), 

PMSE-546. 

8) Laboratory modules on environmental impacts of nanotechnology. Zhang, Xiaoqi; 

Bruell, Cliff; Hines, Mark; Watterson, Arthur C.; Barry, Carol MF. Department 

of Civil and Environmental Engineering, University of Massachusetts Lowell, 

Lowell, MA, USA. Abstracts of Papers, 233rd ACS National Meeting, Chicago, 

IL, United States, March 25-29, 2007 (2007), CHED-251. 

9)** Biocatalytic modification of naturally occurring Iron porphyrin as a renewable 

catalyst. Nagarajan, Subhalakshmi; Tyagi, Rahul; Nagarajan, Ramaswamy; Kumar, 

Jayant; Watterson, Arthur C.; Bruno, Ferdinando; Samuelson, Lynne A Abstracts of 

Papers, 233rd ACS National Meeting, Chicago, IL, United States, March 25-29, 2007 

(2007), CELL-133 

Patents 

1) Polyoxyalkylene copolymers, compositions and methods of making the same. 

Kumar, Rajesh; Kumar, Jayant; Parmar, Virinder Singh; Watterson, Arthur C.. 

(University of Massachusetts, USA). PCT Int. Appl. (2006), 36pp. 

2) Amphiphilic polymers and methods of use thereof. Colton, Clark K.; Watterson, 

Arthur; Kumar, Rajesh; Parmar, Virinder S.; Fisher, Robert; Kumar, Jayant. 

(Massachusetts Institute of Technology, USA). PCT Int. Appl. (2006) 


278

9. Collaborations with other Centers and /or Departments 

There are many collaborations with the Center for advanced Materials (CAM) 

Publications 1,2,4,6,7,8,9 and conference presentations 1.2.4.5.6 are a result of 

collaborative work with CAM which includes collaboration with the Chemistry and 

Physics Departments 

Publication 7 and presentation 5 are with the collaborators at MIT 

Presentation 8 is a collaboration with the Departments of Civil and Environmental 

Engineering and Biology. 


We have a continuing collaboration with Dr. Philip Westmoreland in the Chemical 

Engineering Department at UMass Amherst on the Fire Retardant Materials Project. 

We have a continuing collaboration with Dr. Clark Colton and Dr. Robert Fisher in the 

Chemical Engineering Department at MIT and with Anna Moore at Mass General 

Hospital on the MRI imaging project. Publication number 7 is the first publication of this 

project. Colton and Fisher have three graduate students on the project which has been 

supported by the Deshpande Foundation for $170,000 and is now supported by AXLE 

Corporation 

11. Proposals submitted/awarded 


National Science Foundation, A. Watterson, J. Kumar (not funded) 

MTTC Technology Initiative, Arthur Watterson. Jayant Kumar (funded) 

NineSigma, A. Watterson (Funding Pending) 

Proposals submitted and funded 

02/15/05 to 02/14/08 Starburst Fullerene-chromophore Conjugates for Multiphoton 

Absorption and Photovoltaic Applications 

Source of Support: Air Force Office of Scientific Research 

(AFOSR) 

Total Award Amount: $360,000 

9/1/05 to 8/31/08 J. Zhang, C. Brule, M. Hines, A. Watterson Introduction of 

Nanotechnology in Engineering Curriculum 

Source of Support: National Science Foundation 

Total Award Amount: $ 200,000 


279

7/1/06 to 8/31/07 A. Watterson. Use of Microfluidics Technology to Examine 

the Behavior of Nanoparticle Drug Delivery Systems 

Source of Support: Microfluidics Corporation 


3/1/07 to 2/28/08 A. Watterson, J. Kumar Biocatalytic Synthesis of Novel 

Polysiloxanes for Flame Retardant Applications: 

Massachusetts Technology Transfer Corporation 


4/1/07 to 9/30/09 A. Watterson Enhanced Imaging and Therapy for Cancer 

Source of support: AXLE Corporation (Through MIT) 

Total Award Amount $393,000 


280


23. INSTITUTE FOR PLASTICS INNOVATION 

At The University Of Massachusetts Lowell 

The Institute for Plastics Innovation’s central mission is to address industry-wide 

concerns in a multi-disciplinary manner in order to develop new plastics manufacturing 

technologies and standards. The IPI assists in sustainable regional economic and social 

development. 

The mission and major purpose of the University of Massachusetts Lowell are to provide 

to students an affordable education of high quality and to focus some of its scholarship 

and public service on assisting sustainable regional and economic and social 

development. 

Description and Goals 

The Institute for Plastics Innovation at the University of Massachusetts Lowell develops 

and provides knowledge-based plastics manufacturing expertise to partners. The IPI 

provides an environment where start-up companies will develop into technology and 

manufacturing employers in Massachusetts. 

• To partner with companies to develop economically significant intellectual 

property. 

• To transfer, license, and support current patents and intellectual property 

companies. 

• To provide an incubation space for companies which are synergistic with the 

expertise of the Institute for Plastics Innovation. 

The Institute for Plastics Innovation's central mission is to address industry-wide 

concerns in a multi-disciplinary manner in order to develop new plastics manufacturing 

technologies and standards. 

Research Focus Area 

The Institute for Plastics Innovation has been transformed over the past few years to a 

focus on industrial partnerships. These partnerships have enabled the IPI to better serve 

the companies individual needs, while protecting the intellectual 

property that is developed at the IPI. These partnerships are developed around novel 

technologies which are either developed or enhanced at the Institute. The Institute’s 

INSTITUTE FOR PLASTICS INNOVATION 

281

University personnel presents a review of the research progress to each of the sponsors 

individually. These review meetings include oral presentations and 

written reports. Review meetings are held at the University of Massachusetts Lowell and 

are attended by member companies, student affiliates, and Institute professional staff. 

Faculty members recognize the need to assist industry in developing techniques and 

teaching skills required to keep the American plastics industry competitive in future 

decades. To meet this challenge the department has been active in soliciting research 

projects from industry and from the state. Since 1984, the department has had a sevenfold 

increase in its support from these sectors. 

The University of Massachusetts Lowell is uniquely qualified to produce research results 

for an integrated plastics manufacturing system, helping member companies gain a 

competitive edge. 


Dr. Stephen P. McCarthy, Director 


Plastics Engineering Dept. 


(978) 934-3417 

(978) 934-3065 FAX 

stephen_mccarthy@uml.edu EMAIL 

Other Faculty 

Thomas Shea, Biology Department, University of Massachusetts 

Robert Nicolosi, Clinical Life Sciences, University of Mass. Lowell 

Bryan Buchholz, professor, Work Environment & Director, BioEngineering 

Aldo Crugnola, Professor, Plastics Engineering 

Kathleen Doyle, Professor & Chair, Clinical Laboratory and Nutritional Sciences 

Carl Lawton, Professor, Chemical Engineering 

Catherine Galligan, Project Manager, Sustainable Hospitals Project 

Jerry Hojnacki, Professor (former Dean of Graduate School) 

David Kazmer, Professor, Plastics Engineering 

Christopher Nazerecki, Professor, Mechanical Engineering 

Hongwei Sun, Professor, Mechanical Engineering 

Daniel Schmit, Professor, Plastics Engineering 

Gerard Dybel: Gate Working Lab, hand biomechanics and ergonomics 

Alan Rux, Technician, Electrical Engineering 

Sheila Noone, Professor, UMass Medical Center, Worcester 


282

Student Interaction 

The Department of Plastics Engineering has about 200 undergraduate students and 325 

full and part-time graduate students. Many of these students have performed their 

research in conjunction with the IPI within the past year. All were graduate students. 

Anshuman Shrivastava 

Young-Hoon Kim 

Dr. Muhammad Azam 

Scott Wharram 

Kiran Karve 

Graduate Student Researchers 

Undergradate Student Researchers 

Research of the Institute 

The Institute for Plastics Innovation advances the state of current plastics manufacturing 

technology by performing research programs that focus on the key issues facing the 

plastics industry today. The institute pools the resources of multi-disciplinary U.S. 

university and industry experts, where necessary collaborative research is utilized to 

solve current challenges impeding the advanced of plastics manufacturing technology. 

New manufacturing technologies are expected to be developed with many of these new 

technologies being a direct result of multi-disciplinary interactions between university 

and industry personnel. The results of the research will be used directly by participating 

companies, thus ensuring that laboratory research is adaptable to the true manufacturing 

setting. 

Current Research 

Massachusetts Medical Device Development Center, John Adams Grant, $150,000 

Massachusetts Medical Device Development Center, Mass. Tech. Collab., $125,000 

Nanospheres for Opthalmic Drug Delivery, $70,428 

Development of an Electrical Stimulation Dish for Cell Culture that Can Overcome 

Shortcomings & Improve Gene Introduction, $50,000 

Massachusetts Institute of Technology, Exploring the Application of Functionalized 

Nanospheres for Pb Removal $ 9,901.00 

Xenith Corporation, Development Project for Impact Protection Equipment, $70,428 

U.S. Navy, Low Density Cellular Foams, $25,000 

Zeeland Chemical Corporation, “Evaluate DOE of EMA vs. Fusabond, $10,000 


283

Publications 


MassMEDIC's 11th Annual Conference, May 2007 

Association of University Research Parks (AURP) BioParks 2007, May 2007, 

“University – Industry Collaborations and Novel Gap Funding Approaches” 

Merrimack Valley Venture Forum, The Birth & Growth of a Medical Device Product, 

Feburary 2007 

OEM New England – Plastec New England 2006 

Medtech Insight, Investment In Innovation (In 3 ) EAST: A Preview of Early- 

Stage Medical Technology Companies, October 2006 

Collaboration with other Centers/Institutes/and or Departments 

Other Centers/Institutes 

Massachusetts BioManufacturing Center, UML 

Continuing Studies, Industrial Seminar at Clariant Corp. 

Nanomanufacturing Center of Excellence 

Plastics Institute of America 

Other Departments 

Electrical and Computer Engineering, UML 

Mechanical Engineering, UML 

MassMedic 



John Adams Grant, June 2007, $500,000 

John Adams Grant, January 2007, $150,000 

KaZak Composites Inc., “Innovative, Low Cost Hydraulic Spreader with Portable 

Compressed Gas Power and Manual Override” 

Osram-Sylvania Inc., Injection Molding Research 


284

24. INSTITUTE FOR VISUALIZATION AND 

PERCEPTION RESEARCH 


Georges Grinstein 

Haim Levkowitz 

Co-Directors 


The Institute for Visualization and Perception Research (IVPR) is an interdisciplinary group whose 

research and contract activities focus on the development of systems, displays and interaction techniques 

that enable scientists to explore multidimensional databases by analytic and visual means. We seek to 

facilitate and improve the exploration of various types of data, including large and complex datasets, such 

as those obtained from studies of health and crime statistics, as well as multi-parameter image data like that 

obtained by earth resource satellites and medical imaging systems. Our work—which is both theoretical 

and applied—draws from the fields of computer science, computer engineering, mathematics and 

psychology. Most recently our focus has been on applying our visualization and data mining techniques to 

bioinformatics. 


The specific goals of the IVPR are to: 

• Apply knowledge of perception to the development of visualization technologies; 

• Integrate analytic approaches with visual ones in the development of tools; 

• Train visualization scientists; 

• Disseminate visualization technology via presentations and papers as well as technology 

transfer; 

• Provide consultation in visualization to industry and government. 

With its expertise in the areas of interactive visualization of complex data, the IVPR can support 

information engineering activities, including management, analysis, exploration, and development. 


The research areas we focus on include: 

• visual and analytic data mining of databases 

• visualization of imagery data (e.g., earth satellite, medical) 

• visualization applied to information retrieval and web searching 

• multispectral data fusion 


285

• integration of visualization and supercomputing 

• color models and imaging 

• image registration and analysis 

• human computer interface 

• system issues (graphics, visualization, virtual reality) 

• software design and development 


Co-Directors 

Dr. Georges Grinstein 

Dr. Haim Levkowitz 

Faculty members from various departments in the University, along with external 

collaborators, are involved in research problems at the Institute. 

Currently, the list includes the following personnel 

• Dr. Karen Daniels (computational geometry, data mining) 

• Dr. Georges Grinstein (visualization, data mining) 

• Dr. Haim Levkowitz (visualization, data and text mining, internet and web, color 

theory, imaging) 

• Dr. Gary Livingston (data mining, databases) 

• Dr. Lee Jones (mathematical modeling, statistics) 

• Dr. Alex Gee (visualization and user interfaces) 

• Dr. Patrick Hoffman (Data mining and visualization, at InforSense) 

• Dr. R..Daniel Bergeron (Visualization, at UNH) 

• Dr. Maria Cristina Ferreira de Oliveira (Visualization and Perception, at the 

University of Sao Paulo, Brazil) 

• Dr. Rosane Minghim (Visualization and Perception, at the University of Sao 

Paulo, Brazil) 

• Dr. William Mass (visualization and national indicators, at RESDI) 

• Dr, Catherine Plaisant (Visual Analytics, at UMaryland) 

• Dr. Jean Scholtz (Visual Analytics, at Pacific Northwest National Laboratories) 

• Dr. Marjan Trutschl (visualization and bioinformatics, at LSUS) 

• Dr. Urska Trutschl (visualization and bioinformatics, at LSUS) 

• Dr. R. Bobrow (kinetic visualizations, at BBN) 


• Chi-Hung Chiang (Sc.D. December 2006) Analyzing Patterns in User Interaction 

with Information Visualization Systems (Dr. Chiang has been involved with the 

UVP platform along with the Evident project) 


286

• Jianping Zhou (Sc.D. August 2007) 

Bioinformatics Visualization and Data Mining (Dr. Zhou has worked with the 

SensAble project, the UVP platform, and microarray data) 

• Howard Goodell (Sc.D. June 2006) Bioinformatics Visualization of Data 

Exploration Processes (Dr. Goodell took a post doctoral fellowship at Inria in 

Paris, France for the 2007 year and is now working at InforSense in 

Massachusetts) 

• Hongli Li (Sc.D. expected 2008) Large graphs and pathways (Ms. Li has worked 

on various large graph projects) 

• Shaun Morrissey (Sc.D. expected 2008) Real time visual representation of 

Firewall/Security Rules sets (Mr. Morrissey is working at MITRE on security 

related issues) 

• Alex Baumann (Sc.D. expected 2009) The Haptics and Sound API (Mr. Baumann 

has worked on haptics and sound projects for SensAble). 

• Damon Berry (Sc.D. Expected 2009) Force points, a mathematics theory of 

visualization (Mr. Berry is working on the Indicator project) 

• Henry Kostowski (Sc.D. expected 2009) A mathematical theory of visualization 

(Mr. Kostowski is building a theory based visualization system) 

• Vivek Gupta (Sc.D. expected 2008) A new desktop metaphor (Mr. Gupta has been 

working on a new desktop metaphor, for which the University has applied for a 

patent) 

• Brian Drohan (Ph.D. expected 2008), Architectures for Electronic Health 

Records. (Mr. Drohan has been working on the MGH project and focused on risk 

analysis for breast cancer and visualizations for physicians) 

• Loura Costello (Sc.D. expected 2009), Data Analysis for Breast Cancer Risk 

Assessment (Ms. Costello has been working on using AI and mathematical tools 

on the MGH project). 

• Amr Elbasiony (Sc.D, 2009) Human tissue characterization using imaging, 

visualization and vision. 

One high school student has been provided a summer research position. Two sophomores 

from CS have worked in the lab. 


BBN (Funded: 7/06-8/07) 

BBN has awarded Dr. Grinstein funds to explore motion, haptics and sound for use in 

data exploration. We have built a system that harnesses human perception and users can 

feel, hear and look at data interactively. 

NIST (Funded: 7/06-12/07) 

We are working with the University of Maryland and Pacific Northwest National 

Laboratories to continue to manage and evolve the Visual Analytics Science and 

Technology contests and conferences. 


287

Boston Foundation and the National Academy of Sciences 

(Both funded with Bill Mass: 7/07-12/07) 

We are working with Dr. Mass on the development of collaborative and web based 

interactive visualizations in the area of public planning and policy for New England 

indicators. 

Publications 

Plaisant C., Fekete JD, and G. Grinstein (2007), Promoting Insight Based Evaluation of 

Visualizations: From Contest to Benchmark Repository, to appear in IEEE Transactions 

on Visualization and Computer Graphics, 2007. 

Grinstein G., C. Plaisant, S. Laskowski, T. O’Connell, J. Scholtz and M. Whiting, VAST 

2006 Contest – A Tale of Alderwood, Proceedings of the IEEE Visual Analytics Systems 

and Technology Symposium, Baltimore, October 29-November 2, 2006 

Goodell H., C-H. Chiang, C. Kelleher., A. Baumann , and G. Grinstein (2006), Collecting 

and Harnessing Rich Session Histories, International Conference on Information 

Visualization (IV06), London, July 5-7, 2006, pp 117-123. 

Yang F, H. Goodell, R. Pickett., R. Bobrow, A. Baumann, A. Gee, and G. Grinstein 

(2006), Data Exploration Combining Kinetic and Static Visualization Displays, 

International Conference on Coordinated Multiple Views in Exploratory Visualization, 

London, July 4 2006. 

Grinstein G., F. Martin, and S. Kuhn, Radical Design: From Pencils to Software to 

Processes to Clothing, DIS2006 Workshop, Exploring Design as a Research Activity, 

Penn State, June 24-26, 2006 

H. Goodell, Chiang C-H., Kelleher C., Baumann A., and G. Grinstein, Metrics for 

Analyzing Rich Session Histories, AVI’06 Workshop on Beyond Time and Errors: Novel 

Evaluation Methods for Information Visualization, (BELIV06), Venice May 23, 2006. 

F. V. Paulovich, L. G. Nonato, R. Minghim, and H. Levkowitz. “Least Square Projection: 

a fast high precision multidimensional projection technique and its application to 

document mapping.” IEEE Transactions on Visualization and Computer Graphics, 

forthcoming. 

A. O. Artero, M. C. F. de Oliveira and H. Levkowitz. “Enhanced High Dimensional Data 

Visualization through Dimension Reduction and Attribute Arrangement.” In: Information 

Visualization, 2006, London, UK. In: 

Proceedings 10th International Conference on Information Visualization. Los Alamitos, 

CA : IEEE Computer Society, 2006. v. 1. pp. 707-712. 


288

Paulovich, F. V. ; Nonato, L. G. ; Minghim, R. ; 

Levkowitz, H. . Visual Mapping of Text Collections through a Fast High Precision 

Projection Technique. In: 10th International Conference on Information Visualisation, 

2006, London. Proceedings of Information Visualisation 2006, 2006. v. 1. p. 282-290 

P. S. H. Cateriano, D.M. Eler, L. G. Nonato, M. C. F. de Oliveira, and H. Levkowitz. 

Empowering Iso-Surfaces with Volume Data. Proc. GRAPP 2006, International 

Conference on Computer Graphics Theory and Applications, 25 - 28 February, 2006, 

Setúbal, Portugal. 

For other CS related publications see the CBMI 2006-2007 report 


Numerous presentations at meetings of the IEEE, CBSE, ICDE, CHI, IBC, DDT, BioIT, 

and at Universities and Labs, including a keynote talk at the Pfizer Global Summit in the 

UK 

Tutorials and Workshops: 

• R. Minghim and H. Levkowitz. Visual Text Mining. Eurographics 2007, Prague, Czech 

Republic, September 4, 2007. 

• H. Levkowitz (Tutorial organizer). Perception for Visualization, from Design to 

Evaluation. Information Visualization 2006, London, U. K., July 2006. 

Numerous presentations, both tutorials and workshops, at many 

Collaborations 


Department of Biological Sciences 

Department of Chemistry 

BBN 

University of Maryland 

Pacific Northwest National Laboratories 

University of Sao Paulo, Sao Carlos, SP, Brazil 


We made numerous presentations to high schools and community colleges on the 

computer science and of course the bioinformatics programs to help increase the number 

of students and minorities joining our programs. 

Proposals Submitted/Awarded 

Awarded 

NSF with UMd and PNNL, 09/07 – 08/09, $408,689 


Collaborative Research: Scientific Evaluation Methods for Visual Analytics Science and 

technology (SEMVAST) Research on Visual Analytics 


289

Pfizer, 01/08 – 01/10. $75,000 


High-dimensional visualization of drug discovery data 

Boston Foundation, 07/07-12/07, $5,000 

PI: Dr. Bill Mass and Dr. Georges Grinstein 

NE Measures & Indicators: Regional System Tools to Advance a National Model 

National Academy of Sciences, 07/07-12/07, $10,000 

PI: Dr. Bill Mass and Dr. Georges Grinstein 

NE Measures & Indicators Prototype 


290


25. THE KERR ERGONOMICS INSTITUTE 

UNIVERSITY OF MASSACHUSETTS LOWELL 

Annual Report to CFCI 2006-2007 

August 13, 2007 

The mission of the Kerr Ergonomics Institute (KEI) is to conduct research and 

provide technical assistance to industry, labor, and the public sector on the health, 

safety, and productivity consequences of designing (or failing to design) jobs to fit 

human needs. KEI seeks specifically to evaluate the physical, psychosocial and 

organizational causes of workplace injury and disease, their associated costs, and 

the effectiveness of potential prevention measures. 

2. Description and Goals 

The Kerr Ergonomics Institute is the region's only comprehensive, university-based 

ergonomics research center to examine the relationship among occupational 

ergonomic hazards, psychosocial stress, and work organization, and their effects on 

worker health and safety. KEI takes a multi-disciplinary approach to the study and 

prevention of occupational injuries, musculoskeletal disorders, and stress-related 

illness. Their impact on employers, workers, and society threatens sustainable 

economic development through lost productivity and earnings, increased costs to 

employers, and impairment and reduced quality of life for affected workers. KEI's 

goal is to develop long-term solutions to the occupational health and injury crisis, 

promoting injury and disease prevention strategies as an essential component of 

industrial and public policy. 

The KEI contains the Job Content Questionnaire (JCQ) Center, which administers 

the international network and database of JCQ users. A related area of expertise is 

development of new forms of healthy work organization that both maintain 

productivity and reduce stress risks in the workplace. Work organization 

improvements that can reduce stress (increased employee skill development and 

participation in decision-making) also can lead to improved productivity in general. 

The new wave of industrial development requires skill-based forms of production, 

which in turn requires participatory methods of work organization change. 


The key areas of scholarship within KEI are: 

a. Measurement and evaluation of occupational ergonomic (physical) exposures 

b. Measurement and evaluation of psychosocial and organizational stressors 

Kerr Ergonomics Institute 

291

c. Evaluation of the health effects of both (a) and (b), and especially their 

interactions: acute injury, musculoskeletal disorders, cardiovascular disease, 

mental health, etc. 

d. Prevention of these exposures and their health effects through intervention at 

both the micro level (job, workplace) and the macro level (national public policy, 

economic incentive structure). 

4. Associated Personnel (Faculty and Staff) 

Dr. Laura Punnett, Professor and Co-Director 

Dr. Robert Karasek, Professor and Director (sabbatical/leave AY 2005-07, 

returned August 20076) 

Dr. Laura Punnett, Professor 

Dr. Sean Collins, Associate Professor 

Dr. Maria Brunette, Assistant Professor 

Dr. Bryan Buchholz, Professor 

Dr. David Wegman, Dean 

Sandra Gibson, Staff Assistant, Job Content Questionnaire Center 

5. New and temporary faculty affiliations (2006 - 2007) 

1. Junming Dai from Fudan University. Hong Kong, China, Doctoral student of 

Prof Fu, to study with Kerr UML professors: Robert Karasek Sean Collins and 

with Bong Kyoo Choi. He is developing a cross-sectional investigation of job stress 

and health in empolyees and job stress 

is a key risk factor. Job demand-control model and effort-reward model have been 

used to assess job stress. At the same time, burnout and depression and 

hypertension had been included as the health effect variables 

2. Dr. Dongmug Kang was in residence at UML from February to November, 2006, 

on a ten-month sabbatical from his home institution, Pusan National University, in 

Korea. Dr. Kang was engaged in analyses of organizational features and patterns 

of exposure and injury in the Korean automotive industry and is also participating 

in some new and ongoing research activities with Dr. Punnett. 

6. Students Supported (2006-07) 

a. BongKyoo Choi, Research Assistant (supported by CFCI funds in 2005-2006) 

Mr. Choi was a doctoral student in Work Environment whose advisor wass Dr. 

Karasek (UML doctorate June 2006). In the last year he has assisted primarily 

with preparation of a new manuscript, “Sexual harassment in context,” (authors: 

Bond M, Maloney E, Cazeca D, Dinh KT). His activities have included statistical 


292

consulting, conducting new and revised statistical analyses (e.g., weighting and 

path analysis), drafting text on the statistical methods for the manuscript, and 

reviewing and commenting on the manuscript overall. 

b. Other doctoral students supported in 2006-07 on work linked to KEI activities 

were Jon Boyer and Jamie Tessler. Mr. Boyer has been continuing his thesis 

research with support from grants for the project described below under f. 

Socioeconomic Disparities in Health. Ms. Tessler has been working as conference 

organizer, with Dr. Punnett, to produce the conference “PREMUS 2007,” the Sixth 

International Scientific Conference on Prevention of Work-Related 

Musculoskeletal Disorders, which will take place in Boston in late August, 2007. 

7. Current Research Projects (2006-07) 

a. JCQ: International Coordination and Evolution of Job Stress Assessment 

Methodologies 

(NOTE: this section includes description of activities from 2005-06 that were 

omitted in the Kerr 2005-06 report). 

The Job Content Questionnaire (JCQ), developed by Dr. Karasek with U.S. 

nationally standardized data, is broadly utilized around the world for assessing 

psychosocial workplace risks in epidemiological studies of chronic disease and 

wellbeing. The JCQ provides the basis for assessing job stress according to the 

Karasek "demand/control" model and has been translated into 27 languages. 

Several very large (40,000+ subjects), multi-country, multi-site Japanese and 

European studies of job stress and heart disease use the JCQ, developed, with 

agreements to make the data available to KEI researchers. 

International coordination of job stress hazard assessments in the workplace 

is managed at the JCQ Center, within KEI. The JCQ Center has an international 

board of directors and represents an example of international collaboration on an 

impressive scale. Several Work Environment students have utilized the JCQ for 

course projects in local industries, in developing research project summaries for the 

100+ JCQ projects, in developing the user network in conjunction with the 

Psychology Department, and in international standardization of stress hazard 

instruments. 

a. International Comparison of Psychosocial Job Hazards (JCQ) 

The main accomplishment is a revision of the much-used JCQ. This new 

version, JCQ 2.0, is now being pilot tested in studies involving 5000 workers in 

China – in studies in five sites. As can be seen below – this involves measurements of 

worker control (JCQ decision latitude) in a new form involving global neo-liberal 

effects, job security and organizational impacts. The Chinese JCQ study 

coordinator reports that four of these five studies will be completed by the end of 

2006 – and then can be analyzed. 


293

This new version of the JCQ was developed in multiple steps, starting with 

the testing of a Korean Pilot instrument already in February 2005 on 8,000 Korean 

workers. The next step – at the beginning of the Karasek sabbatical (2005-06) - was 

the formation of the Chinese JCQ 2.0 Pilot group in August 2005 and the Second 

ICOH Conference in Okayama, Japan, and this was followed by the International 

Workshop in Amsterdam in November 2005 (with the Chinese and Koreans 

participating), and finally with the international discussions during February and 

March 2006. 

The actual development of the JCQ 2.0 pilot version text (coordinated by R. 

Karasek) occured via electronic conference during February, March and April, 

2006. It was an international collaborative effort with other coworkers in China 

(Jian Li), the US (J. Johnson, BK Choi. P Landsbergis), Korea (S –I Cho), Canada 

(A. Ostry) as well as many others who have participated in recent sequence of JCQ 

International Workshop, and JCQ researchers in the field in many countries. This 

new version JCQ 2.0 is slightly longer than the final version will be. 

This collaboration has had many useful payoffs – including organizing 

opposition to the newly-elected Swedish government proposal to close the Swedish 

National Institute of Working Life. 

1. R. Karasek, Chair and co-organizer (w/Choi and Houtman): JCQ Center lunch 

Workshop 35 participants 20 countries. At this meeting the multi-site Job Content 

Questionnaire 2.0 Pilot study was formed (which had immediate results in the 

Amsterdam conference below). Second ICOH International Conference on 

Psychosocial Factors at Work, 26 August, 2005, Okayama, Japan. 

2. R. Karasek, Chair and organizer: JCQ International, Amsterdam, 2005 

“Methodologies for Measurement of Macro-Decision Latitude: Toward JCQ 

2.0: a TNO-Dutch Workshop,” November 10th and 11th, 2005. This special-topic 

focused international workshop wass part of the JCQ 2.0 development process (the 

Job Content Questionnaire, a psychosocial work hazards questionnaire). This event 

occurred in the Netherlands, (Amsterdam - Hoofddorp) at the TNO Institute, 

November 10 and 11th. The workshop goal was to determine how to "Measure 

Macro Decision Latitude in our Global Economy in the JCQ 2.0." All JCQ Users 

and Workshop participants were invited to attend. Chinese and Korean 

representatives of the newly developed Chinese JCQ 2.0 Pilot Study group, as well 

as the recently completed Korean Proto-Pilot of 2005, attended, along with 

representatives from five other countries. 

b. JCQ-Stage II: The JCQ 2.0 development process (the Job Content 

Questionnaire, a psychosocial work hazards questionnaire). 

1. R. Karasek, Chair and co-organizer (w/Choi and Houtman): JCQ Center 

lunch Workshop 35 participants 20 countries. At this meeting the multi-site Job 

Content Questionnaire 2.0 Pilot study was formed (which had immediate results in 

the Amsterdam conference below). Second ICOH International Conference on 

Psychosocial Factors at Work, 26 August, 2005, Okayama, Japan. 

2. R. Karasek, Chair and organizer: JCQ International, Amsterdam, 2005 


294

2. “Methodologies for Measurement of Macro-Decision Latitude: Toward 

JCQ 2.0: a TNO-Dutch Workshop,” November 10th and 11th, 2005. This specialtopic 

focused international workshop was part of the JCQ 2.0 development process 

(the Job Content Questionnaire, a psychosocial work hazards questionnaire). This 

event occurred in the Netherlands, (Amsterdam - Hoofddorp) at the TNO Institute, 

November 10 and 11th. The workshop goal was to determine how to "Measure 

Macro Decision Latitude in our Global Economy in the JCQ 2.0." Chinese and 

Korean representatives of the newly developed Chinese JCQ 2.0 Pilot Study group, 

as well as the recently completed Korean Proto-Pilot of 2005, attended - along with 

representatives from five other countries. 

c. Stage III: The JCQ 2.0 development process (the Job Content 

Questionnaire, a psychosocial work hazards questionnaire). 

This new version, JCQ 2.0, is now being pilot tested in studies involving 5000 

workers in China – in studies in four sites. This involves measurements of worker 

control (JCQ decision latitude) in a new form involving global neo-liberal effects, 

job security and organizational impacts. The Chinese JCQ study coordinator 

reports that four of these five studies will be completed by the end of 2006 – and 

then can be analyzed by mid 2007. 

This new version of the JCQ was developed in multiple steps, starting with 

the testing of a Korean Pilot instrument already in February 2005 on 8,000 Korean 

workers. The next step – at the beginning of the sabbatical - was the formation of 

the Chinese JCQ 2.0 Pilot group in August 2005 and the Second ICOH Conference 

in Okayama, Japan, and this was followed by the International Workshop in 

Amsterdam in November 2005 (with the Chinese and Koreans participating), and 

finally with the international discussions during February and March 2006. 

The actual development of the JCQ 2.0 pilot version text (coordinated by R. 

Karasek) occured via electronic conference during February, March and April, 

2006. It was an international collaborative effort with other coworkers in China 

(Jian Li), the US (J. Johnson, BK Choi. P Landsbergis), Korea (S –I Cho), Canada 

(A. Ostry) as well as many others who have participated in recent sequence of JCQ 

International Workshop, and JCQ researchers in the field in many countries. 

b. Heart Rate Variability and Monitoring of Job Stress/Stress-Disequilibrium Theory 



This area of research effort includes several related components that take 

tools from clinical medicine and using them in a new manner for job stress and 

health research. . It focuses on a broadly applicable method for measuring the 

physiological effects of stress on the body: cardiovascular monitoring of stress 

response via heart rate variability (HRV). The heart rate-variability field 


295

methodology, based on new techniques for 

analyses of standard Holter EKG monitoring, can assess the above "system-level" 

deficiencies in physiologic functioning linking cardiovascular, central nervous 

system, and endocrine response. Measuring the deregulation that occurs under 

chronic stress should allow understanding of peripheral blood flow contributions to 

chronic musculoskeletal disease development, as well as to understanding of the 

numerous job stress/coronary heart disease findings in epidemiologic studies. 

This project is important for assessing the health status of workforce 

participants as aging workforce chronic disease incidence increases (diabetes II, 

depression, heart disease-hypertension, etc.). This is a promising new area of job 

stress physiological risk measurement, with applications for cardiovascular disease 

(CVD), depression, pain response, asthma, and metabolic illness. 

The current goal is to develop a new field study – and write a research 

proposal for this involving Danish / EU funding – and parallel US/UML funding - to 

test the extent to which long term autonomic deregulation can be related to job 

stress. 

The project involves the beginning the research proposal 

(Boston/Copenhagen) – HRV Job Stress Study Design Panel – with a panel 

discussion at for university students, May 2, 2007 (KU/NFA - Copenhagen). 

b: Testing Job Stress/Heart Rate Variability and Workshop Development 

This second area of effort includes several related components: (a) 2 day 

international workshop where we provide the content for a new approach which 

takes tools from clinical medicine and using them in a new manner for occupational 

health research; (b) the seminar series at AMI; and (c) the beginning research 

proposal (Boston/Copenhagen). This project is important for assessing the health 

status of workforce participants as aging workforce chronic disease incidence 

increases (diabetes II, depression, heart disease-hypertension, etc.). This workshop 

introduces a promising new area of job stress physiological risk measurement, with 

applications for cardiovascular disease (CVD), depression, pain response, asthma, 

and metabolic illness. It focuses on a broadly applicable method for measuring the 

physiological effects of stress on the body: cardiovascular monitoring of stress 

response via heart rate variability (HRV). 

1. A NIVA (Nordic collaboration support council) international workshop: "Job 

Stress, Chronic Disease, and Heart Rate Variability: Measuring a New Pathway of 

Work-related Chronic Disease Risk" at the National Institute for Occupational 

Health (NFA/AMI) in Copenhagen Denmark, June 6-7, 2006 in Copenhagen, 

Denmark. 

Karasek was the chair, and organized this workshop as a major portion of 

this goal of the sabbatical to support Heart Rate Variability and Job Stress research. 

I provide roughly 2 hours of the workshop lecture material, and detailed content 

outline of the full seminar (PPT). The co-chair Sean Collins, from University of 

Massachusetts Lowell brought critical new research in this area, and Jester C 

Kristiansen, PhD AMI (Danish National Institute for Occupational Health), also a 

researcher in this area. 35 researchers from eight countries attended from Europe, 

Asia and North America. 


296

It should be noted that Harvard Medical 

School ran a large workshop in Boston on HRV methods in chronic disease one 

month before ours in Copenhagen. However, persons who attended both workshops 

thought ours was much better – and far more useful for environment and health 

issues. In spite of numerous presentation at the HarvMed event, their was no 

mention whatever there of the effects of job stress, nor any hints of the possibility of 

using HRV methods for the purpose of assessing healthy (or exhausted) response to 

the environment – only methodological details, drug relations, etc. 

2. Karasek organized, with Jesper Kristiansen of AMI, a series of research seminars 

in the heart rate variability, job stress and chronic disease area – to reinforce 

analytic skills in this area (sabbatical year 2005-06). As we began our research 

dialogue in the fall of 2005 it became clear that short discussion with individual 

researchers contributing short reviews and inconsistent coverage would not be 

sufficient to support truly successful research contributions in this area. A more 

tightly integrated approach was needed to develop the dialogue to support HRV 

research in this new occupational health direction, and support the “finale” the 

NIVA international Workshop. 

The Job Stress and HRV Seminars were all held at AMI, starting in/ /spring 

2006: January 11, 2006 (Karasek); February 22, 2006 (Kristensen and Garde), 

March 8, 2006 (Ellers); April 19th , 2006 (Gogenur); May 10 (Malmberg), 2006. 

c. Expanding the Demand/Control Model, and Links to Social Policy and to Other 

Social Well-being Approaches 



In this area, the major activity was another international conference: the 

30th birthday of the D/C Model – an international convocation to integrate the 

Karasek Demand/Control approach with other related intellectual/social policy 

contributions. 

1. “From Healthy Work to Healthy Society, the Thirtieth Birthday of the 

Demand/Control/Support Model”, Stockholm, Sweden 

Karasek was conference co-organizer with Töres Theorell, at the IPM 

national Institute for Psychosocial Medicine in Stockholm. The Conference was 

held at Moderna Museet, Stockholm, May 31 to June 1, 2006. Töres Theorell and 

IPM stood for the practical organization of the conference, while Karasek developed 

conference plan, new content, and built discussion linkages between different 

approaches. 32 researchers from over fifteen countries attended – well-known 

researchers in the area of social epidemiology, social differences in health, and 

psychosocial, work organization and stress physiology attended 

This is the birthday/anniversary celebration for the research direction that 

Karasek started in 1976 with the Demand/Control Model. Since much of the work 

since the late 1970’s has been in collaboration with Töres Theorell (also co/author of 

Health Work), we collaborated on organization of this international discussion: The 

goal was to re-link to the Scandinavian “movement toward improvements of social 


297

and political conditions for increased individual 

control in daily life related not only to the Demand/Control Model but also to its 

intellectual cousins and to the D/C model’s several extensions.” This was discussed 

in the context of Distribution, Production, Health and Reproduction. 

Karasek introductory talk (30 minutes PPT) focused on the political 

economic background of the current neo-liberal market economy – and how a 

comprehensive work organization and psychosocial approach (including the 

demand control model extensions – but importantly- all of the other related political 

economic approaches) could provide the foundations for an alternative political 

economy. Karasek co-chaired the General Discussion with Töres Theorell. 

The conference succeeded in building the platform for social policy 

discussions in the future linked to work organization and psychosocial factors. 

Conference contributions are now collected as a coming special issue of the 

Scandinavian Journal of Work Environment and Health (2007). 

d. Testing of the Job Stress Work-relatedness of Chronic Disease Disability 

This project has proceeded in multiple steps since fall of 2005, and is still ongoing. 

It involves research at Lund University/Malmo Hospital in collaboration with Per- 

Olof Ostergren, department chair, Mahnaz Mogaddiassi, Catarina Canivet, myself 

and BongKyoo Choi. The project involves following up new disability cases 

developing over a ten-year period from a base population in a representative sample 

of Malmo residents who were investigated initially for job stress association with 

heart disease (JACE database), MSD and cancer using the JCQ. Swedish 

population registries make possible data-linkage to national disability and health 

insurance information. A number of publications are currently in draft status. 

e. Social Costs of Poor Work Organization 

Current assessment of bad working conditions used in international discussionssuch 

as ILO statistics (accidents, work-related fatalities, or absenteeism registries in 

some developed countries) typically do not assess the social organization of work 

and its consequences working situations directly. This leaves a major gap in our 

understanding of the human costs of our global economics development, which has 

increased workplace competitive pressures, and restricted worker’s powers and 

protections. One barrier for understanding the full international scope of this 

problem is lack of scientifically standardized methodologies for internationally 

comparative assessment of psychosocial working conditions. Through the European 

JACE-JCQ project, the JCQ Center has continued devising and testing 

standardized methods that will function as core methods for this international JCQ 

project. This project utilizes the international JCQ dataset that represents 100,000 

workers in ten countries: USA (Dr. Robert Karasek and Bongkyoo Choi), Brazil (Dr. 


298

Tania Araujo), South Korea (Dr. Sejin Chang), 

Mexico (Dr. Leonor Cedillo), Taiwan (Dr. Yawen Cheng), Canada (Dr. Chantal 

Brisson), Japan (Dr. Norito Kawakami), Sweden (Dr. Per-Olof Ostergren), Italy (Dr. 

Marco Ferrario), and Begium (Dr. Marcel Kornitzer). A cross-national differential 

item function (DIF) analysis beyond conventional psychometrics has been tested to 

assure item invariance across countries. An innovative weighting method developed 

in the European JACE-JCQ project to reduce different occupation compositions 

across countries will be further tested on the larger international JCQ dataset. The 

effects of social policies on the quality of working life (psychosocial) and job-stress 

related policies is being examined among the participating countries. 

f. Cost-Effectiveness of Occupational Health Interventions 

Dr. Punnett and other KEI investigators have collaborated with Supriya Lahiri, 

Ph.D., in the Department of Economics, in the analysis of the cost-effectiveness of 

interventions to prevent occupational disease. (Previous work was described in 

detail in last year’s report.) New work this year has shifted to the Center for 

Promotion of Health in the New England Workplace, directed by Dr. Punnett, 

within which Dr. Lahiri is collaborating on the comprehensive analysis of the costeffectiveness 

of a “No-Lift” program to reduce low back pain (LBP) and injuries in 

the nursing home sector. Dr. Lahiri also has another ongoing effort to extend this 

work, with regard to LBP in the produce distribution sector, with UNICAMP Brazil 

and the Ergonomics Laboratory at the Calcutta University, College of Science and 

Technology. The overall goal is to validate the net-cost model for the monitoring, 

reporting and analyzing cost and effectiveness data through prospective studies in a 

variety of industrial settings and in countries at various stages of economic 

development. 

g. Ergonomic Exposures and Musculoskeletal Disorders in the Construction Sector 

Building on our past experience in construction ergonomics, a newly funded project 

seeks to develop data on occupational exposures relevant to studying osteoarthritis 

and other chronic knee disorders, using ergonomic field observation methods and 

questionnaire-based exposure assessments from two carpenters’ databases. Knee 

disorders are a major source of disability and early departure from work but there 

is limited knowledge about the risk of knee disorders related to work. Most studies 

finding associations with work have relied on job titles or relatively simple 

questionnaire surveys for exposure assessment and characterized exposure crudely, 

without information on level or type of biomechanical risk factors. As a result, little 

is known about the association of knee disorders with compressive force or torque 

on the knee joint resulting from varying intensities and durations of exposures to 

awkward sustained postures, squatting, kneeling, weight lifted, etc. Our goals are to 

improve upon this qualitative risk characterization by providing better specification 

of types of ergonomic risk factors along with semi-quantitative estimates of 

exposure intensity for these. A working population of union carpenters will be 


299

targeted because they have a range of types and intensity of biomechanical risks for 

knee disorders. The proposed study is designed with a focus on the risk of 

osteoarthritis and other chronic knee conditions associated with chronic 

biomechanical exposures to the lower limb. The outcomes from this study will be 

new knowledge about biomechanical exposures in these jobs that can be directly 

applied to preventing known risk circumstances (e.g., tasks resulting in 

unacceptable torque). This is an important area of research because there has been 

little research on chronic knee disorders as related to work exposures. It is 

innovative in the development of the health and exposure databases and the 

potential applicability of this method to extract useful data from other 

administrative health databases. 

In a separate initiative, we analyzed the data from a NIOSH cross-sectional study of 

musculo-skeletal pain reports and ergonomic risk factors in operators of heavy 

mobile equipment. 

A self-administered survey was administered to 598 unionized operating engineers 

in 9 states attending classes at union training centers. The survey assessed 

musculoskeletal pain at multiple body sites, workplace ergonomic and psychosocial 

exposures, general working conditions, job history, age, personal health and habits. 

Musculoskeletal symptoms at nine body locations were combined into four response 

variables by body area (full-body, arm, leg, and back/neck) and dichotomized 

(high/low) for multivariable logistic regression analysis. Results showed that lack of 

adjustability and poor physical environment were each associated with 

musculoskeletal pain in the back and neck, upper and lower extremities. Inadequate 

maintenance was most strongly associated with upper extremity symptoms. There 

was a high risk of leg pain among those who had to jump off their vehicle. Number 

of rest breaks per day (including lunch) had a weak and inconsistent protective 

effect. In multivariable models, strong associations between symptoms and 

ergonomic risk factors remained when adjusted for personal and general working 

environment factors. Symptom prevalence was positively associated with body mass 

index (BMI) but not age. Ergonomic exposures governed by equipment design were 

associated with reports of musculoskeletal symptoms in operating engineers, 

indicating a potential role for ergonomically designed equipment in injury 

prevention. 

h. Ergonomic Exposures and Musculoskeletal Disorders in Automobile Manufacturing 

We have carried out several studies of ergonomic exposures and musculoskeletal 

disorders of the back and upper extremity in the automotive industry. (Previous 

work was described in detail in last year’s report.) Most notable in this follow-up 

study was the extent of changes in production technology over six years and how 

these tracked workers’ perceptions of decision latitude on the job, as well as how 

they forced substantial revision in the ergonomic job analysis methodology utilized 

(informed by previous developments at KEI in the analysis of construction labor) 


300

[Gold et al., 2006]. Two other papers, one published this year and one under 

review, have addressed reproducibility of self-reported exposure to physical and 

psychosocial exposures at work by automotive plant employees [d’Errico et al., 

2007 and under review]; and the extent of forgetting prior musculoskeletal 

symptoms by employees who were no longer symptomatic [Miranda et al., 2006]. 

Another set of analyses examined agreement between subjective ratings and direct 

measures of ergonomic exposure in a subset of 76 workers. Direct measurements 

were found to explain some of the variability in several psychophysical exposure 

ratings in automobile manufacturing workers. In particular, significant 

relationships were found between self-reported manual effort and absolute grip 

force, estimated from electromyography (EMG), and between workers’ ratings of 

pace and directly measured grip force and wrist motion. When grip force was 

expressed as a percentage of each subject’s strength, the association was stronger 

and the regression model explained 27% of the variability in the manual effort 

ratings. Similarly, a multivariate regression model of work pace ratings on relative 

grip force and flexion-extension acceleration explained 35% of the variability. 

Musculoskeletal disorder symptoms (dichotomous) at the time of the direct 

measurements had an effect on these relationships: workers with hand/wrist 

symptoms provided ratings that were much more strongly related to the directly 

measured exposures. This effect modification was also observed for the 

relationship between the rating of wrist and hand position and direct 

measurements of wrist motion. 

i. Socioeconomic Disparities in Health 

This NIOSH-funded research project (Principal Investigators, Drs. Craig Slatin and 

Laura Punnett), on the extent to which working conditions explain the relationship 

between socio-economic status and health in the healthcare sector, submitted its 

final report in December, 2006. The work environment conditions that are risk 

factors for injury and disease showed a marked socioeconomic gradient: physical 

load (e.g., heavy lifting or repetitive manual work), shift work, high psychological 

job demands with low decision autonomy, threat of interpersonal violence, etc. 

Among many other findings, we showed that these features of the work environment 

were strongly associated with the risk of acute workplace injuries in the two study 

hospitals, and also that these job characteristics explained a high proportion of the 

strong socioeconomic gradient in injury risk [d’Errico et al., 2007]. 

j. Global Burden of Work-Related Low Back Pain and Arthritis 

The questions of whether or not musculoskeletal disorders (MSDs) are causally 

associated with physical workload, whether or not dose-response curves can be 

defined, and what proportion of MSDs in the U.S. workforce can be attributed to 

work demands, have generated substantial discussion in recent years. Challenges in 


301

interpreting the literature include diverse exposure assessment methods, definitions 

of endpoints, and other methodologic issues discussed below. In this context, we 

have previously undertaken several reviews of the epidemiology, some of which have 

been published in the open literature. Most recently we have collaborated with 

researchers at the World Health Organization in analyzing two large international 

data sets to estimate that about 37% of low back pain and as much as 60% of 

arthritis, world-wide, could be attributable to working conditions. 

k. Gender Issues in Occupational Health 

Overall differences between men and women in the rates and patterns of workplace 

injury and illness result to a large extent from the patterns of employment of men 

and women and the consequent differences in their exposures to health and safety 

hazards. With regard to musculoskeletal disorders, in particular, some of the 

gender differences in rates - even within job titles - appear to result from (formal or 

informal) job segregation and different task distributions, although the 

epidemiologic literature is not conclusive. To the extent that there are real 

differences, not confounded by job demands, these may represent behavioral or 

physiological factors or the added contribution of household work and the “double 

duty” of work and family (both physical and psychosocial aspects). Successful 

strategies for resolving health and safety problems among women workers need to 

take into account the features of women’s employment and its broader 

socioeconomic context. Collaboration with the UML Center for Women and Work 

to develop a research program related to these issues has been supported by the 

CFCI since 1998 and continued both as part of the recently concluded project on 

Socioeconomic Disparities in Health (see above) as well as separately. In May, 2007, 

Dr. Punnett was an invited plenary keynote speaker on this topic at the American 

Occupational Health Conference, annual meeting of the American College of 

Occupational and Environmental Medicine, in New Orleans LA.. 

8. Publications (2006-2007) 

a. Peer-Reviewed Journal Articles 

Araujo T, R. Karasek, ”Validity and reliabilityof the Job Content Questionnaire in formal 

and informal jobs in Brazil”, Scandinavian Journal of Work Environment and Health, 

(accepted May, 2007). 22 page manuscript. 

Cho SL, Eum KD, Choi BK, Paek DM, Karasek R. Social class, job insecurity, and job 

strain in Korea. Scand J Work Environ Health Suppl (Accepted July 2007). 

Choi BK, Kawakami N, Chang SJ, Koh SB, Bjorner J, Punnett L, Karasek R. A crossnational 

study on the multidimensional characteristics of the five-item psychological 

demands scale of the Job Content Questionnaire. Internat J Behav Med (MS# 054-06, 

accepted Apr 2007). 


302

Choi BK, Clays E, de Bacquer D, Karasek R. Socioeconomic status, job strain, and 

common mental disorders: an ecological (occupational) analysis. Scand J Work Environ 

Health Suppl (Accepted June 2007). 

Cifuentes M, Gore R, Boyer J, Tessler J, d’Errico A, Scollin P, Lerner D, Kriebel D, 

Punnett L, Phase in Healthcare Research Team. Inter-method agreement between 

O*NET and survey measures of psychosocial exposure among healthcare industry 

employees. Amer J Industr Med 2007; 50(7):545-553, doi: 10.1002/ajim.20480. 

Clays E, F Leynen, D de Backer, M Kornitzer, F Kittel, R Karasek, G de Backer, "High 

job strain and ambulatory blood pressure in middle-aged men and women from the 

Belstress study," Journal of Occupational and Environmental Medicine (accepted January 

2007). 

d’Errico A, Gore R, Gold JE, Park JS, Punnett L. Medium- and long-term reproducibility 

of self-reported exposure to physical ergonomics factors at work. Applied Ergonomics 

2007 Mar;38(2):167-75. 

d’Errico A, Punnett L, Cifuentes M, Boyer J, Tessler J, Gore R, Scollin P, Slatin C, 

Promoting Healthy and Safe Employment in Healthcare Research Team. Hospital injury 

rates in relation to socioeconomic status and working conditions. Occup Envir Med 

2007;64;325-333; published online 20 Dec 2006, doi: 10.1136/oem.2006.027839. 

Gold JE, Park JS, Punnett L. Work routinization and implications for ergonomic exposure 

assessment. Ergonomics 2006; 49(1):12-27. 

KD Eum KD, J Li, HJ Jhun, JT Park, SW Tak R Karasek, SI Cho, “Psychometric 

Properties of the Korean Version of the Job Content Questionnaire: Data from Health 

Care Workers,” International Archives of Occupational and Environmental Health 

(accepted October 2006). 

Karasek R, “The Stress-Disequilibrium Theory: Chronic Disease Development, Low 

Social Control, and Physiological De-regulation” Medicina del Lavoro, 97:2:258-271, 

2006. 

Karasek, R. ”Low social control and physiological deregulation: An outline of the Stress- 

Disequilibrium theory of chronic disease development, Towards a new Demand/Control 

model” Scandinavian Journal of Work Environment and Health, (accepted July, 2007). 

19 page manuscript. 

Karasek R, Choi BK, Ostergren PO, Kornitzer M, deSmet P. Testing two methods to 

create comparable scale scoring between the JCQ and JCQ-like questionnaires in the 

JACE study. International Journal of Behavioral Medicine (accepted June 2006). 

Lahiri S, Moure-Eraso R, Flum M, Tilly C, Karasek R, Massawe E. Employment 

conditions as social determinants of health. Part I: The external domain. New Solutions 

2006;16(3):267-288. 


303

Miranda H, Gold JE, Gore R, Punnett L. Recall of prior musculoskeletal pain. Scand J 

Work Environ Health 2006; 32(4): 294-300. 

Miranda H, Heliövaara M, Viikari-Juntura E, Knekt P, Punnett L. Physical work and 

chronic shoulder disorder. Results of a prospective population-based study. Annals 

Rheum Dis ( “Online First” May 25 2007; doi:10.1136/ard.2007.069419). 

Myers D, Kriebel D, Wegman DH, Karasek RA, Punnett L. The social distribution of 

risk at work: Acute injuries and physical assaults among healthcare workers working in a 

long-term care facility. Social Science Med 2007;64:794-806. 

Tak SW, Punnett L, Paquet V, Woskie S, Buchholz B. Estimation of compressive force 

on the lumbar spine from categorical posture data. Ergonomics (MS #06/095, accepted 

April 2007). 

Wallace RF, Kriebel D, Punnett L, Wegman DH, Wenger CB, Gardner JW, Kark JA. Risk 

factors for recruit exertional heat illness by gender and training period. Aviat Space 

Environ Med 2006 Apr;77(4):415-21. 

Wallace RF, Kriebel D, Punnett L, Wegman DH, Amoroso PJ. Prior heat illness 

hospitalization and risk of early death. Environmental Research 2007 Jun;104(2):290-5. 

b. Books and Book Chapters 

Bond MA, Kalaja A, Punnett L, Cazeca D, Daniel S, Tsurikova L. Expanding our 

Understanding of the Psychosocial Work Environment: A Compendium of Measures of 

Discrimination, Harassment, and Biases. Cincinnati OH: U.S. National Institute of 

Occupational Safety and Health, in press. 

T. Theorell, R. Karasek, (eds,) From Healthy Work to Healthy Society: 30 years with the 

Demand/Control/Support model “(Karasek model) (IPM, Stockholm: Conference 

contributions now collected as a coming special issue of the Scandinavian Journal of 

Work Environment and Health (winetr 2007) approximately 20 articles. 

c. Technical Reports 

Slatin C, Punnett L, et al. Health Disparities among Healthcare Workers. Final Report, 

Grant # R01 OH007381, National Institute of Occupational Safety and Health, Dec 2006. 

Adams KP, Punnett L. Musculoskeletal Symptoms and Risk Factors in Operators of 

Heavy Mobile Equipment. Final Project Report: Contract # 254-2006-M-17949, 

National Institute of Occupational Safety and Health, June 2007. 

d. Invited Commentaries & Other 

Messing K, Punnett L, Viikari-Juntura E. Ǻsa Kilbom, 1938–2005. (Obituary) Appl 

Ergonomics 2006;37: 681-2. 


304

MacDonald LA, H≅renstam A, Warren ND, Punnett L. Incorporating work organization 

into occupational health research - An invitation for dialog. Occup Environ Med 

(accepted July 2007). 

e. Manuscripts in review and preparation 

Choi, BK, J. Bjorner, P-O Ostergren, E. Clays, I Houtman, P de Smet, G. de Backer, M. 

Ferrario, L. Punnett, A. Rosengren, R. Karasek. ”A cross-cultural differential item 

functioning (DIF) analysis of the European JCQ database,” (in review Work and Stress). 

Choi, BK R Karasek, N Kawakami, S.Chang, ”Exploring the relationship between 

socioeconomic status and job strain of the Karasek’s Demand-Control Model: a crossnational 

study,” (submitted to Social Science and Medicine, December 2006). 

f. Student Theses 

Yuan, Lu. “Biomechanical analysis of physical loads on the low back and shoulder in 

drywall installation.” September 2006. (Thesis advisor: Bryan Buchholz) 

Choi, BongKyoo. “Methodological and theoretical issues in cross-national comparative 

studies of psychosocial job hazards: from questionnaire item to social class.” October 

2006. (Thesis advisor: Robert Karasek) 

f. Conference Abstracts & Presentations 



Adams KP, Punnett L. Musculoskeletal Symptoms and Risk Factors in Operators of 

Heavy Mobile Equipment. Sixth International Scientific Conference on Prevention of 

Work-related Musculoskeletal Disorders (PREMUS 2007), Boston MA, Aug 2007 

(accepted). 

Boyer J, Park JK, Tessler J, Scollin P, Cifuentes M, Punnett L, PHASE in Healthcare 

Research Team. Socioeconomic status and back disorder risk factors in healthcare 

workers. American Public Health Association 134 th Annual Meeting, Boston, Nov 2006. 

Boyer J, Tessler, J, Cifuentes M, Punnett L, PHASE in Healthcare. Development of an 

ergonomic job exposure matrix (JEM) for the healthcare sector. Sixth International 

Scientific Conference on Prevention of Work-related Musculoskeletal Disorders 

(PREMUS 2007), Boston MA, Aug 2007 (accepted). 

Buchholz B, Punnett L, Park J-S, Gold JE. Agreement between subjective ratings and 

direct measures of ergonomic exposure. Sixth International Scientific Conference on 

Prevention of Work-related Musculoskeletal Disorders (PREMUS 2007), Boston MA, 

Aug 2007 (accepted). 


305

Choi BK, Cho SL, Li J, Yang W, Jhun HJ, Xu Z, Park JT. A differential item functioning 

(DIF) test for the cross-national quantitative comparison of psychosocial job hazards 

between Chinese and Korean nurses. 9 th International Congress of Behavioral Medicine, 

Bangkok Thailand, Nov. 2006. 

Choi BK, Kawakami N, Chang SJ, Karasek R. Predictive power comparison of 

socioeconomic position indicators and job strain on negative mental health in the 

Belgian, Korean, and Japanese workers. 9 th International Congress of Behavioral 

Medicine, Bangkok Thailand, Nov. 2006. 

Cifuentes M, Gore R, Boyer J, Tessler J, d'Errico A, Scollin P, Punnett L, PHASE in 

Healthcare Research Team. Socioeconomic status and working conditions as predictors 

of survey response in healthcare workers. American Public Health Assoc. 134 th Annual 

Meeting, Boston, Nov 2006. 

Cifuentes M, Gore R, Boyer J, Tessler J, d'Errico A, Scollin P, Punnett L, PHASE in 

Healthcare Research Team. Association between O*NET and survey measures of 

psychosocial exposure in healthcare workers. American Public Health Assoc. 134 th 

Annual Meeting, Boston, Nov 2006. 

Cifuentes M, Sembajwe G, Tak SW, Gore R, Kriebel D, Punnett L. Global estimates of 

occupation related depressive episode from the WHO World Health Survey. American 

Public Health Association 134 th Annual Meeting, Boston, Nov 2006. 

Cifuentes M, Tak SW, Sembajwe G, Gore R, Punnett L, Kriebel D. International comorbidity 

of low back pain and major depressive episode. Sixth International Scientific 

Conference on Prevention of Work-related Musculoskeletal Disorders (PREMUS 2007), 

Boston MA, Aug 2007 (accepted). 

Collins SM, Karasek RA. Vagal Responses to Work and Rest Day Strain: Possible 

Cardiac Disease Risk Mechanisms. European Journal of Cardiovascular Prevention and 

Rehabilitation 2006; 13(Supplement 1): S51. 

Hvid H. and Karasek. R., “Interview of Karasek (by Helge Hvid) on Work Organization 

and Borderless Work in the Health Care Sector “ (dialogue, with audience discussion, one 

hour), Conference on Borderless Work and Healthcare, Roskilde University Center, 

Denmark, March 29,2006. 

Kang DM, Kim I, Kim J, Kim E, Koh SB, Punnett L. Reliability and validity of 

questionnaire to assess labor intensification. Sixth International Scientific Conference on 

Prevention of Work-related Musculoskeletal Disorders (PREMUS 2007), Boston MA, 


Karasek:, R. ”Towards a New Work Stress Biomarker Methodology - with discussion of 

’Job strain and autonomic indices of cardiovascular disease risk*,” 11 January (AMI) 

Arbejdsmiljøinstituttet. Copenhagen (2 hours). (*Collins SM, Karasek RA, Costas K 

(2005): Am J Ind Med; 48(3): 182-93. 


306

Karasek, R., Low social control and chronic disease in the global economy: The Stress- 

Disequilibrium Theory of physiological de-regulation, November 15, 2005. Division of 

Social Medicine and Global Health, Department of Health Sciences, Lund University, 

Malmo, Sweden. (1 and ½ hour) 

Karasek, R., “The Demand Control Model: Some Highlight and Future Directions.” 

Conferernce opening talk (30 minutes - PPT); The Second Danish Stress Researcher 

Conference, 7 Novmber, 2005, Statens Insitute for Folkesundhed (National Institute for 

Public Health), 

Karasek R., “Three Models of psychosocial work structure. Low social control, 

organizational process, and wellbeing,” February 2, 2006, Research Workshop in 

Administrative IT Systems and Working Conditions, Socialforskningsinstituttet, 

Copenhagen. 

Karasek: R. adm Hvid, H., 30 minute (PPT) “Do you Get Stressed form Workplace 

Change: Toward a Future Demand/control Model, “Den Personalpolitiske Messe 2006, 

Afrese mod Fremtidens Arbejsdsplads August 31, 2006 Bella Centret Copenhagen 

(Toward the Future Workplace). (The most popular workshop in the conference with 

4,000 attendees – 600). 

Karasek,R., Conference Plenary Address: “The Stress-Disequilibrium Theory: Chronic 

Disease Development, Low Social Control, and Physiological De-regulation,” (30 min. 

(43 PowerPoint slides) 28th International Congress on Occupational Health, June 14, 

Milan, Italy 

Karasek: R. Session Co- Chair with Giancarlo Cesana, “Job Stress and cardiovascular 

disease,” ICOH 2006 Satellite Symposium Cardiovascular Disease and Work, Varese, 

16-17 Centro Congressi Ville Ponti 

Karasek R., Comments by Robert Karasek on the 30th Birthday of the Demand/Control 

Model: Future political cconomy and intellectual linkages.” PPT Slides from the 

conference introductory talk by Robert Karasek. “From Healthy Work to Healthy 

Society: 30 years with the Demand/Control/Support model “(Karasek model) (IPM, 

Stockholm ), May 31 – June 2, Stockholm. (PowerPoint 30 slides).“ 

Karasek, R, “Job Stress and Chronic Disease,” August 13, 2005 Research Center for 

Occupational Medicine, Beijing University Third Hospital, Bejing, China 

Karasek, R., Global Health Forum Distinguished Guest Lecture School of Public Health, 

Seoul National University, Seoul Korea. “The Stress-Disequilibrium Theory: Chronic 

Disease Development, Low Social Control, and Physiological De-regulation” (3 hour 

presentation and Discussion (PPT)). August 16, 2005. 

Karasek R., Heart Rate Variability Analysis (reviews Collins, Karasek, Costas, AJIM, 

2005): New Analytic Methods at the University of Massachusetts Lowell. (30 min) Job 

Stress Workshop, School of Public Health, Seoul National University, Seoul Korea, 

August 17, 2005 


307

Karasek R., “The Achievements and Future Directions of the Demand/Control Model for 

Work Stress School of Public Health (30 min). Seoul National University, Seoul Korea, 

August 17, 2005. 

Karasek, R., “The Stress-Disequilibrium Theory: Chronic Disease Development, Social 

Control, and Physiological De-regulation” Low (1 hour PPT - Plenary Address). Second 

ICOH International Conference on Psychosocial Factors at Work, August 26, 2005, 

Okayama, Japan. 

MacDonald L, Härenstam A, Warren N, Punnett L. Work organization and risk factors 

for musculoskeletal disorders. Invited keynote: Sixth International Scientific Conference 

on Prevention of Work-related Musculoskeletal Disorders (PREMUS 2007), Boston MA, 


Miranda H, Heliövaara M, Viikari-Juntura E, Punnett L. Physical work-related loading 

and subsequent chronic shoulder disorder. Results of a prospective population-based 

study. APHA Annual Meeting, Nov 2006. 

Park JK, Buchholz B, Punnett L, Woskie S. Muscle activity and posture of upper 

extremity during laboratory simulated pipetting: Effect of work surface height. Human 

Factors and Ergonomics Society Annual Meeting, Oct 2006. 

Park JK, Boyer J, Buchholz B, Punnett L, PHASE in Healthcare Research Team. 

Assessment of biomechanical exposure to upper extremity musculoskeletal disorder risk 

factors in hospital laboratories. American Public Health Association 134 th Annual 

Meeting, Boston, Nov 2006. 

Park J.K., Buchholz B, Punnett L. Effects of work surface heights on wrist posture 

during laboratory simulated pipetting task. 2007 Joint Meeting of the Ergonomics 

Society of Korea/Japanese Ergonomics Society, May 2007. 

Piedrahita H, Punnett L, Shanavaz H. Epidemiologic study of cold exposure and 

musculo-skeletal disorders. International Ergonomics Association 16th Triennial 

Congress, Maastricht, the Netherlands, July 2006. 

Punnett, L. (May 2007) Inequitable Distribution of Workplace Risks: Insights from 

Studying Musculoskeletal Disorders. C. O. Sappington Memorial Lecture (Invited 

Keynote). American College of Occupational and Environmental Medicine, American 

Occupational Health Conference, New Orleans LA. 

Punnett, L. (June 2007) Socioeconomic disparities in health and in occupational 

exposures: Relevance for workplace health promotion and protection programs. NORA 

Symposium, Midwest Center for Occupational Health and Safety, University of 

Minnesota, Minneapolis MN. 

Punnett L, Boyer J, Cifuentes M, d’Errico A, Gore R, Park J, Tessler J, PHASE in 

Healthcare Research Team. (June 2007) Ergonomic and psychosocial risk factors for 

injuries in healthcare work. Invited speaker at the conference, Workplace Hazards to 


308

Nurses and Other Healthcare Workers: Promising Practices for Prevention, Massachusetts 

Nurses Association & the University of Massachusetts Lowell, Marlborough MA. 

Tak SW, Punnett L, Moir S, Buchholz B, Paquet VL, Wegman DH. Physical ergonomic 

hazards in highway tunnel construction: Overview from the Construction Occupational 

Health Program. APHA Annual Meeting, Nov 2006. 

Tak SW, Cifuentes M, Sembajwe G, Gore R, Kriebel D, Punnett L. Global estimates of 

work-related low back pain from the WHO World Health Survey. APHA Annual 

Meeting, 2006. 

Tak S, Punnett L, Sembjwe G, Cifuentes M, Gore R, Kriebel D. Global estimate of 

arthritis attributable to work by occupations: An analysis of the World Health Survey, 

2002-2003. Sixth International Scientific Conference on Prevention of Work-related 

Musculoskeletal Disorders (PREMUS 2007), Boston MA, Aug 2007 (accepted). 

Tak S, Punnett L, Paquet V, Buchholz B, Woskie S. Sources of variance in risk factors 

for knee injury in construction. Sixth International Scientific Conference on Prevention of 

Work-related Musculoskeletal Disorders (PREMUS 2007), Boston MA, Aug 2007 

(accepted). 

Tessler J, Boyer J, Cifuentes M, Park JK, Scollin P, Punnett L, PHASE in Healthcare 

Research Team. Upper extremity musculoskeletal exposures and the healthcare worker: Is 

there a gradient by socioeconomic status? American Public Health Association 134 th 

Annual Meeting, Boston, Nov 2006. 

Yuan L, Bucholz B, Punnett L, Kriebel D. Estimation of muscle contraction forces and 

joint resultant forces at the low back and shoulder during drywall installation. Human 

Factors and Ergonomics Society 51st Annual Meeting, Baltimore MD, Oct 2007 

(accepted). 

10. Collaboration with Other UML Centers, Institutes, and Departments 

KEI works with other centers on the UML campus in projects involving workplace 

linkages to community, gender and social inequality issues. In particular, we enjoy a 

multi-year collaboration with the UML Center for Women and Work (CWW), which 

extends our research agenda to examine the relationship between workplace climate and 

employee stress, health and work outcomes (absenteeism, turnover, lowered productivity, 

and costs). Specific research activities included completion of the UML employee survey 

on work climate and health, with the help of the research assistant supported by CFCI; 

collaboration on development of qualitative and quantitative study instruments for the 

Socioeconomic Disparities in Health project (see above); and preparation of a NIOSHfunded 

compendium of survey instruments for assessing aspects of workplace climate 

that are not typically included in the psychosocial domain by occupational health 

researchers. 


309

Collaboration has been established between Kerr and other research institutes and faculty 

members, especially within the School of Health and the Environment. The co-P.I.’s of 

the research project, Socioeconomic Disparities in Health (“PHASE in Healthcare”), 

were Dr. Punnett and Dr. Slatin of the Center for Public Health and Health Promotion. 

Participating faculty members were also drawn from the Departments of Nursing, 

Economics, and Community Health and Sustainability. Other major current topics of 

collaboration across UML are heart rate variability and chronic disease; costeffectiveness 

of occupational health interventions; and workplace management of 

disability (see project descriptions above). 

11. Regional, National and International Outreach 

Collaboration with entities outside UML is illustrated throughout this report. Other 

institutes of higher education with whom we have current research projects include the 

University of Connecticut, University of Massachusetts Medical Center, Harvard 

School of Public Health, and Washington University School of Medicine (St. Louis). 

We have also engaged colleagues in research and outreach activities from the Liberty 

Mutual Research Institute, the Massachusetts and Connecticut Departments of Public 

Health, UNITE-HERE (Union of Needletrades, Industrial and Textile Employees 

merged with Hotel Employees and Restaurant Employees International Union), U.S. 

Army Research Institute for Environmental Medicine, and the U.S. National Institute 

for Occupational Safety and Health. Internationally, our research has involved 

collaboration with the Swedish National Institute of Working Life, the Swedish 

National Institute of Psychosocial Medicine, Luleå University of Technology (Sweden), 

and the World Health Organization. 

Special recognition is due to the international networking undertaken by the JCQ Center, 

including the organizing of international symposia and workshops during each of the last 

several years: Brisbane Australia, 2000; Dusseldorf Germany, 2002; Toronto Canada, 

2003; Los Angeles CA, March 2005; Okayama Japan, August, 2005; Amsterdam the 

Netherlands, November, 2005; and Stockholm Sweden, June 2006. Development of 

internationally comparative methods for psychosocial work hazard assessment is one 

current major focus. Significant progress has been achieved in evaluation of the 

reliability and cross-cultural interpretations of the JCQ scales, and to begin planning for a 

revision of the JCQ ("JCQ 2.0"). 

Within the past year, a series of energetic discussions for developing the JCQ 2.0 took 

place at the 2 nd ICOH conference, “Psychosocial Actors At Work,” Okayama Japan, 

August 2005. Key domain areas under discussion are a) emotional demands, b) 

globalization and precarious employment, c) implications of new forms of production and 

work organization transforming work relations in the global economy (e.g., functional 

flexibility, employment flexibility, numeration flexibility, and technology impacts), and 

d) review of many new candidate scales and questions proposed by the JCQ Board and 

tested in a Korean subway worker study in 2005. 


310

The JCQ Workshop, “Methodologies for measurement of macro-decision latitude,” was 

held in Amsterdam, the Netherlands, November 10-11, 2005. It drew 14 researchers from 

7 countries. The main focus of this workshop was how to measure macro-level decision 

latitude in the globalization and flexibilization contexts. Following the workshop, the 

JCQ Board developed 23 new items of macro-decision latitude scale for the JCQ 2.0 pilot 

study in China, referencing the preliminary results of the Korean JCQ 2.0 pilot study. 

Those new items were administered in a survey at Kunming, China, in July, 2006 and 

will be further tested in other sites (Beijing, Shanghai, and Chengdu, China) by the end of 

2006. 

The international workshop, “From healthy work to healthy society: 30 years with the 

Demand/ Control/Support Model,” was held in Stockholm, Sweden, May 31 to June 1, 

2006. The workshop was organized by Dr. Karasek and Dr. Töres Thoerell, of the 

Swedish National Institute of Psychosocial Medicine. Over 30 researchers from 15 

countries discussed how to organize internationally and boost the movement towards 

improvement of social and political conditions for increased individual control in daily 

life related to not only the Demand-Control Model, but also to its intellectual cousins, and 

to the D-C model’s several extensions. The workshop participants achieved important 

consensus on several action plans: a) "Stockholm declaration for healthy psychosocial 

work conditions" addressing WHO primarily; b) co-authoring a monograph for educated 

lay people describing results of research on the DC and related models so far and their 

implications for societies worldwide; c) a web-based instrument, primarily aimed at ILO 

use, focusing on practical translations with heavy emphasis on interventions and 

scientific evaluations of those; d) a strategy document which aims at increased 

understanding of our research in a societal context; e) and a technical document 

describing deeper aspects of the demand-control model, the conducive production model 

and the stress-equilibrium model and their implications. 

Dr. Punnett is chair of the Local Organizing Committee of PREMUS 2007, the Sixth 

International Scientific Conference on Prevention of Work-Related Musculoskeletal 

Disorders, which will take place in Boston on 26–30 August 2007. This meeting will 

bring together over 400 researchers and practitioners from numerous countries, 

representing occupational ergonomists, health and safety specialists, economists, 

industrial engineers, kinesiologists, social scientists, and policy makers. This is the preeminent 

international meeting of researchers on causes and prevention of work-related 

musculoskeletal disorders, hosted by the Scientific Committee on Musculoskeletal 

Disorders of the International Congress on Occupational Health. 

12. Research Proposals Submitted or Awarded (2005-2007) 

a. Work Strain in Nurses(I) : Testing for Autonomic Exhaustion; and 

Work Strain in Nurses(II): Personal Expectation Effects on Exhaustion Response 

These combined proposals involve monitoring job stress and exhaustion (risk for 

heart disease via autonomic deregulation) among Copenhagen hospital nurses, using 

Heart Rate Variability (Holter) monitoring- together with engagement of Danish NFA 

researchers. 


311

Danish Hjerteforeningen (October 1, 2007, 

Arbejdsmiljøforsknings Fond (September 1, 2007); and to Forskningsråd for Sundhed og 

Sygdom (September, 2007). In each of these cases, we would apply for roughly 4,000, 

000 DKR ($720,000) - for a core project with two sub-areas - and would expect to 

support PhD students with this including Kerr actvity. 

A parallel application for funding in the US for monitoring of Boston area 

medical professionals would be made to US NIH NHLBI this winter (through Kerr at 

UML). 

b. Knee Disorders and Occupational Biomechanical Risks. Principal Investigator: Bryan 

Buchholz. NIOSH (9/06-8/09). Awarded July, 2006. 

c. Analysis of musculoskeletal symptoms in operating engineers. Principal Investigator: 

Laura Punnett. National Institute for Occupational Health-Spokane Research Laboratory 

(8/06-3/2007). Awarded July, 2006. 

d. Development of an ergonomic job exposure matrix for the healthcare sector. Principal 

Investigator: Laura Punnett. Harvard School of Public Health / Pilot Projects Research 

Training, 9/1/2006 – 6/30/07. (Dr. Punnett served as P.I. on behalf of Mr. Jon Boyer, 

doctoral student, pursuant to UML rules.) Awarded July, 2006. 

e. Center for the Promotion of Health in the New England Workplace (CPH-NEW). 

Principal Investigator: Laura Punnett. National Institute for Occupational Health (7/06 – 

6/11). Awarded July, 2006. 

In addition to these grant applications, a major funding strategy for KEI's 

psychosocial/work organization initiative has been to use the JCQ international platform 

to increase the visibility and influence of the JCQ and its related models. This has been 

done by creating a new website (www.jcqcenter.org) with a new web-based payment 

system. For providing prospective JCQ users with exact information (also easy access) on 

the non-English versions of the JCQ, the JCQ translation files at the JCQ Center have 

been reviewed, arranged, and updated by contacting the JCQ translators of the respective 

countries. This work has greatly enhanced the value of the JCQ User Network and 

permitted the JCQ Center to become partially self-sustaining through user fees. 


312

26. LOWELL CENTER FOR SUSTAINABLE 

PRODUCTION 

University of Massachusetts Lowell Annual Report 2006-2007 

1. Mission 

The mission of the Lowell Center for Sustainable Production is to promote communities, 

workplaces, and products to be healthy, humane, and respectful of natural systems. 

We use rigorous science and innovative strategies to develop practical solutions that 

promote environmentally sound systems of production and consumption. 

We reject the assumption that pollution, resource depletion, and health impairment are 

inevitable consequences of modern life. 

We also reject the assumption that the less powerful and privileged should be 

disproportionately harmed by practices and policies that degrade health, the 

environment, or human dignity. 

Instead, we are committed to working collaboratively with citizen groups, workers, 

businesses, institutions, and governments to build healthy work environments, thriving 

communities, and viable businesses and institutions that support a more sustainable 

world. 


The Lowell Center applies expertise in a number of fields including occupational health, 

environmental management and science, materials and process engineering, 

epidemiology, health policy, science policy, chemicals policy, economics, and 

organizational change to research and promote forms of production and consumption that 

are safe, healthy, environmentally sound, and socially accountable. 


Chemicals and Science Policy Program 

(www.chemicalspolicy.org) 

The Program develops scientific tools, methods, and policies that promote a more 

precautionary integrated chemicals policy regime. The Program seeks to improve 

decision-making under uncertainty with new scientific approaches and decision-tools that 

protect health and ecosystems. It also promotes “appropriate science” that more 

holistically characterizes complex risks in an interdisciplinary manner while creating and 

evaluating innovative solutions that prevent risks in the first place. As a leader in the 

development and application of the precautionary principle, the Program promotes its use 

in decision-making processes. The Program also develops model integrated chemicals 

Lowell Center for Sustainable Production 

313

policies and works closely with governments, non-profits, and industry to increase 

understanding of new directions in long-term chemicals policy around the globe. 

Environmental Health Initiative 

The Environmental Health Initiative (EHI) joined the Lowell center in September, 2004. 

EHI seeks to better understand relationships between environmental exposures and 

human health in workplaces and communities, and to develop and implement programs 

and policies aimed at reducing exposures to reverse rates of chronic disease. Working at 

the local, state, New England regional and national levels, EHI conducts research and 

analysis, and provides leadership and technical support to initiatives that seek effective 

action on links between the environment and human health. EHI currently works in three 

areas: asthma and environment; cancer and environment; and the application of scientific 

knowledge in public policy. EHI partners with the Asthma Regional Council in an 

initiative to promote investment by the health sector in environmental interventions, and 

is leading an initiative across the Lowell Center to develop a technical assistance program 

focused on environmental health-related communities. 

Environmental Management Systems (EMS) Service Program 

The EMS Service Program’s mission is to help public entities improve compliance, 

sustainability and environmental health and safety through the use of Environmental 

Management Systems and tools. Designated by EPA as a Local Resource Center in the 

PEER Center network, the Program provides training and designs opportunities for 

dialogue and sharing of experiences, and develops guides and tools to support efforts to 

move to sustainability. The Program continues to provide training and audit services to 

municipalities and the Massachusetts Bay Transportation Authority. The Program also 

has and continues to develop tools and guides for K-12 schools, water and wastewater 

utilities and colleges and universities. 

Sustainable Hospitals Program 

(www.sustainablehospitals.org) 

The Sustainable Hospitals Program (SHP) performs research and provides technical 

assistance to the health care industry in order to reduce occupational and environmental 

hazards. The premise of the SHP is that a team-based approach that integrates pollution 

prevention with occupational safety and health results in more sound and appropriate 

solutions. Key components of the SHP: 

o Project SHARRP – Safe Homecare and Risk Reduction for Providers. This is a 

research project for prevention of needlestick injuries and blood exposures in the 

home healthcare setting. This 4 year study (2004-2008) is funded by the National 

Institute for Occupational Safety and Health (NIOSH) and is being conducted in 

partnership with industry, labor and state government. 

o Needlestick and other Sharps Surveillance. This is a hands-on effort with the MA 

DPH to effect sharps injury prevention efforts in Massachusetts hospitals. 


314

o Contribution to Public Health Policy. The SHP participates in public health policy 

initiatives at the both the state and national levels. At the national level, SHP 

Director Margaret Quinn serves on the NIOSH NORA Healthcare Council and the 

NIOSH Prevention through Design (PtD) Committee. Locally, the SHP is a 

member of the Massachusetts Needlestick Advisory Committee. This committee 

advises the Massachusetts Department of Public Health on it promulgation of the 

rules and regulations of the Massachusetts Act Relative to Needlestick Injury 

Prevention (MGL Chapter 111 §53D). 

o The SHP website. A highly visible component of the SHP, the website provides 

resources to educate and help healthcare practitioners identify and evaluate more 

benign alternatives to existing products and practices. 

o Educational outreach. Members of the SHP educate members of the healthcare 

community on timely topics related to pollution prevention and occupational 

safety and health. This is accomplished through presentations at conferences and 

meetings, publication of articles, technical bulletins and fact sheets, and on-site 

seminars. 


315

4. Associated Personnel 2006-2007 

LCSP Directors 

Ken Geiser 

Co-Director, Lowell Center for Sustainable 

Production 

Director, Toxics Use Reduction Institute 

Professor, Work Environment 

David Kriebel 

Co-Director, Lowell Center for Sustainable 

Production 


Cathy Crumbley 

Program Director, Lowell Center for Sustainable 

Production 

Stephanie Chalupka 

Professor, Nursing 

Richard Clapp 

Adjunt Faculty, Work Environment 

Melissa Coffin 

Project Associate, Chemicals Science and Policy 

Program 

Sara Donahue 

Project Associate, Environmental Health Initiative 

Catherine Galligan 

Project Manager, Sustainable Hospitals Program 

Richard Healey 

Senior Advisor 

Polly Hoppin 

Director, Environmental Health Initiative; Research 

Assistant Professor, Work Environment** 

Molly Jacobs 

Project Manager, Environmental Health Initiative 

Pia Markkanen 

Sustainable Hospitals Program; Research Assistant 

Professor, Work Environment ** 

Gregory Morose 

Senior Program Manager, Mercury in Consumer 

Products and Alternatives Assessment 

Margaret Quinn 

Director, Sustainable Hospitals Program 


Susan Sama 

Sustainable Hospitals Program; Research Assistant 

Professor, Work Environment ** 

Madeline Snow 

Joel Tickner 

Yve Torrie 

**New Research Faculty within Last 3 Years 

Consultants 

Director, EMS Service Program 

Director, Chemicals Science and Policy Program 

Assistant Professor, Community Health and 

Sustainability 

Project Manager, Chemicals Science and Policy 

Program 


316

Richard Dennison 

Mary Lee Dunn 

Andrew Fasey 

Lizzie Grossman 

Amy Kyle 

Fred Murphy 

Lynn Rose 

Deborah Simes 

Chemicals Science and Policy 

Toward Tomorrow 




EMS Auditor and Trainer 

Environmental Health and Safety Consultant and 

Trainer 



Kate Adams 

Disease Clustering 

Anila Bello 

Sustainable Hospitals 

Marisa Caliri 

Towards Tomorrow, Clean Tech 

Javier Colon 

Chemicals Policy 

Sally Edwards 1 

Sustainable Product Design 

Homero Harari ?????????? 

Hyun Kim 


John Lindberg 

Nanotechnology 

Ephraim Massawe 2 

Sustainable Product Design 

Jessica Schifano 

Chemicals Policy 

Grace Sembajwe 



Science for Sustainability. Science for sustainability has the goal of helping humanity 

live sustainably on the Earth. Thus, sustainability science is an applied and integrative 

science whose purpose is not simply to understand the world better, but to inform social 

actions towards sustainability. Most of the pressing environmental crises share a 

fundamental characteristic: they appear to arise from disruptions of natural systems or 

cycles, the behavior of which is only partially understood. Global warming, endocrine 

disruption, ecologic and health risks from genetically modified organisms, environmental 

breast cancer risks – these are all hazards about which there remains a great deal of 

uncertainty. This project is developing a position paper and case studies that illustrate 

how this emerging field differs in many ways from traditional scientific research. 

The impact of precaution on the methods and goals of epidemiology. This project has 

the objective of integrating the concept of precaution into environmental epidemiology, 

so that this field can more effectively inform public debates and policymaking on 

environmental and health issues. A major emphasis of this work is the conventions of 

causal inference in epidemiology, and how they might be modified in response to the 

precautionary principle. When do we know enough to act as if an association is causal? 

1 Supported with CFCI Funding 

2 Supported with CFCI Funding 


317

The latter decision depends on context: whether safer alternatives exist, and weighing 

risks of acting when there is no hazard versus not acting on a true hazard. Ignoring this 

context may support inaction: continuing to study a hazard sends the message that there is 

insufficient evidence to act. 

Linking Disease Prevention to Sustainable Production. The goal of this project is to 

demonstrate the creative synergies between sustainable production and chronic disease 

prevention. Prevention is under-used and under-funded in our current healthcare system, 

but it is fundamental to sustainability. Many citizens and government officials continue to 

view economic development and health promotion/disease prevention as entirely separate 

issues and interest groups. To the contrary, an economy based on clean production and 

healthy work organizations can be both productive and directly benefiting the public’s 

health. By strategic reframing of what it means to be “clean” and “green,” the project is 

changing old patterns of thinking, reducing the avoidable disease burden in communities, 

and build momentum for both a more effective healthcare system and new forms of 

economic development. This project is initially focusing on the Merrimack Valley of 

Massachusetts and New Hampshire, and exploring root causes of two diseases – cancer 

and asthma, including exposures in production processes and consumption patterns. 

Disease Clustering and Episodic Environmental Releases. David Kriebel, Principal 

Investigator, Kate Adams, Small Grant Investigator. This project aimed to improve rapidresponse 

epidemiologic evaluation of single-incident exposure of a population (e.g. 

railway tanker accident) resulting in an acute disease outbreak. Methods were developed 

to allow rapid assessment of exposure-disease associations for such acute events, using 

software available to community investigators, including GIS technology to facilitate 

spatial data handling and visualization. 

REACH in Europe and in the US. The Lowell Center continues its work to understand 

and communicate the environmental and economic implications of the European Union’s 

proposed REACH (Registration, Evaluation, and Authorization of CHemicals) initiative. 

This legislative proposal is a significant step forward in chemicals policy, and it has 

significant implications beyond the European Union. The Lowell Center has been 

producing materials to assist in understanding this key policy, and has been ensuring that 

key players in the US chemicals policy debate gain a better understanding of this 

important policy. Through the summer of 2006, the LCSP, along with various state 

agencies, sponsored a series of single-day trainings on the European Union’s (EU) 

Registration, Evaluation, and Authorisation of Chemicals (REACH) regulation. These 

trainings were an effort to bring US firms importing into the EU or competing with 

products made by European companies, up to speed with the inevitability of REACH’s 

passage and the resulting preparation they would need to undertake to implement 

REACH. The trainings were also aimed at stimulating dialogue on going beyond 

REACH and on the implications of REACH for US policy development and industry 

practice. 


318

Business Engagement in Safer Chemistry. Following the 2005 Innovators Roundtable 

at the Darden School of Business, the Green Chemistry and Commerce Council (GC3) 

has continued to grow in both numbers and influence (the GC3 is now a known name for 

many in industry). At the Second Innovators Roundtable “The Role of Tools, Labels, and 

Retail in Promoting Safer Chemistry” held in Lowell, MA, in April 2007, the LCSP 

convened more than 60 representatives from a broad range of companies. While many of 

the meeting attendees had been participating in GC3 meetings and discussions since the 

group was formed in 2005, many others were new to the group and eager to participate. 

The meeting built on 16 months of work of three working groups: on Tools for 

Advancing Safer Chemistry, Advancing Design for Environment and Green Chemistry in 

Government, and Drivers for Innovation in Safer Chemicals 

State Level Chemicals Policy Reform. A report on Options for Chemicals Policy 

Reform, relevant for state level as well as national level reform, is currently being edited 

for publication in October, 2007. This report includes seven papers on chemicals policy 

reform options, focusing on the pros and cons of regulatory and non-regulatory 

options/tools. These papers were reviewed and discussed at a working meeting of 25 

national stakeholders from state agencies, state legislature, academia, industry and 

advocacy organizations on July 1-3, in Boston. We also began a project in late 2006 to 

develop databases of current and pending state level legislation and executive branch 

policies and to develop an analysis of these laws and policies that will be useful to state 

legislators, agencies and advocates. 

Environmental Management Systems (EMS) Service Program. The EMS Service 

Program's mission is to help organizations improve and sustain environmental 

performance through Environmental Management Systems. Designated by EPA as a 

Local Resource Center in the PEER Center network, the Program continues to work with 

colleges and universities, public schools, and municipalities in a variety of efforts to 

improve environmental performance and sustainability. Highlights over the past year 

include (1) Continuing to train managers, mechanics, and shop foremen at the 

Massachusetts Bay Transportation Authority to improve compliance and environmental 

stewardship; (2) completing a Healthy Schools Checklist for K-12 Schools; (3) 

completing an EPA-funded Environmental Management Guide for Colleges and 

Universities; (4) supporting the development of an Energy Management Guide for 

Utilities; (5) working on a project exploring the changing world of campus environmental 

health and safety professionals; (6) the design and delivery of a workshop, Best Practices 

and Management Systems to Promote Campus for Massachusetts state colleges and 

universities; and (7) assistance to the Town of Natick in achieving ISO 14001 

certification for its Environmental Management System. 

Toward Tomorrow: A Common Agenda for Health and Environment. EHI staff play 

key roles in this project, the overall purpose of which is to provide inspiration and tools 

that enable a wide range of organizations to envision a sustainable future and take 

effective steps towards it. The initiative seeks to develop an agenda for action on health 


319

and the environment by bringing together leaders and scholars from diverse fields—both 

people late in their careers and those who will shape and implement programs and 

policies over the next forty years. The aim is to identify goals that will guide the next 

generation as they address the complex linkages between human and ecosystem health: 

linkages critical for the diagnosis, treatment and prevention of global health threats. 

Toward Tomorrow activities include 1) Conducting oral histories with individuals whose 

work has substantially contributed to movements that seek economically, 

environmentally and socially equitable and sustainable systems of human activity; 2) 

Developing a Common Agenda for action on environmental and human health in the 

coming decades by drawing on the ideas and insights in the oral histories, and working 

with leaders from a range of organizations; and 3) Disseminating the Common Agenda to 

a wide array of groups capable of advancing it through their education, outreach and 

advocacy activities. In February 2007 we hosted a strategic retreat to advance a set of 

generational goals at the White Oak Conservation Center in Yulee, FL. 

Initiative to Promote Environmental Investments for Asthma. EHI works in 

partnership with the Asthma Regional Council to provide leadership and conduct relevant 

research and analysis on a major New England-wide initiative to advance the delivery 

and financing of home-based environmental interventions for asthma (e.g., supplies and 

services such as integrated pest management, smoking cessation, and education about 

environmental triggers). The premise of the initiative is that if environmental 

interventions—now shown to be effective in improving asthma symptoms and financially 

viable—are to be sustainable, and if they are to meet their potential to help reduce the 

burden of asthma, they need to be embedded in traditional delivery systems and financed 

by those funding sources that pay for health care. This year, EHI staff finalized a white 

paper featuring 10 innovative asthma management programs offered by public health 

departments that include an environmental component. The white paper was based on 

interviews with public health department officials as the local, county and state levels. 

EHI presented the white paper in September 2006 at an ARC symposium for health 

departments to encourage the adoption of these programs, and in November 2006 at the 

American Public Health Association annual meeting. EHI also responded to requests 

made by health payer decision-makers for a review of the literature on costs and costeffectiveness 

of environmental interventions and asthma education. Children’s Hospital 

Boston and ARC provided valuable input to and joined EHI in releasing “Investing in 

Best Practices for Asthma: A Business Case for Education and Environmental 

Interventions” was in June 2007. EPA invited EHI and ARC to present and discuss the 

business case on a national EPA-webcast. Lastly, EHI conducted interviews with the 8 

primary private and public health insurers in Massachusetts in order to characterize their 

asthma-related benefits policies, including the extent to which they cover costs or 

otherwise promote access to services and supplies for asthma education and 

environmental interventions. Funders for the ARC/EHI initiative include EPA, 

Children’s Hospital and The Boston Foundation. 


320

Report and Consensus Statement on Chemicals and Asthma. EHI played a lead role 

in conceptualizing and editing a guidance document on links between asthma and 

exposures to chemicals and other irritants and allergens commonly found in health care 

settings. We researched and wrote major sections of the report, which was published by 

Health Care Without Harm in October 2006, including the summary of the literature on 

associations between asthma and chemicals found in building materials, cleaners and 

pesticides, and the section on approaches to decision-making that consider information 

about risks and availability of alternatives. In July, 2006, EHI helped Clean Water Action 

convene a small group of scientists and practitioners to review the literature and 

collaboratively develop a consensus statement about the role of chemical exposures in 

initiating or exacerbating asthma. 

Coordination of Collaborative on Health (CHE) and Environment Asthma 

Discussion Group; Generation of Draft Research Agenda. EHI continued its work 

with CHE to develop a new national asthma discussion group, which brings together 

leaders and professionals from a range of organizations and settings to exchange 

information and insights about approaches for addressing the environmental aspects of 

asthma. In addition to ongoing work to plan bi-monthly phone conferences, including 

identifying and recruiting participants and speakers, EHI has participated this year in the 

drafting of a concept paper for development a national research agenda for asthma with a 

focus on filling the gap in research leading to opportunities for primary prevention. 

Report and Outreach on Environmental and Occupational Causes of Cancer. In 

conjunction with CHE Cancer group, EHI completed an update of the scientific literature 

on environmental and occupational causes of cancer, mechanisms of cancer induction, 

and primary prevention of cancer. In addition, EHI calculated the estimated proportion of 

2007 cancer cases with some evidence of occupational and environmental causes; 

presented a summary of cancer trends at a Commonweal meeting as part of an effort to 

bring together women’s health organizations concerned about environmental causes of 

cancer; and collaborated with the Mass. Breast Cancer Coalition and Silent Spring 

Institute in educating policy makers about the importance of including breast cancer 

research funds in the state budget. 

Guidance to the Project on Scientific Knowledge and Public Policy. The Project on 

Scientific Knowledge and Public Policy examines the nature of science and how it is used 

and misused in government decision-making and legal proceedings. Through empirical 

research, conversations among scholars, and publications, SKAPP aims to 1) enhance 

understanding of how knowledge is generated and interpreted, and how science is used 

and misused by decision-makers; 2) inform decision-makers about the nature of scientific 

inquiry and opinion. This year, a primary accomplishment was the convening of a fifth 

“Coronado” meeting, which focused on conventions in science and the law. EHI staff 

members serve on the Planning Committee for the project. 

Program Evaluation of the Harvard School of Medicine’s Center for Health & the 

Global Environment. On behalf of the Center for Health & the Global Environment at 


321

Harvard Medical School, EHI conducted an evaluation to assess the impact of the 

Center’s direct education course – Human Health & Global Environmental Change – on 

its former students by assessing: 1) current beliefs, interest and knowledge about the 

connections between the environment and human health among the course’s alumni, and 

2) the extent to which the course influenced alumni’s career path, professional activities 

and personal activities. The evaluation was successfully completed in January 2007. 

Clean Tech: An Agenda for a Healthy Economy. The goal of this project is to identify 

specific opportunities and benefits for making Massachusetts a leader in clean 

technologies (energy, materials reuse, advanced materials, safer chemistry, and green 

buildings) that serve the world, and to recommend a path to get there. The project is 

defining the clean tech sector in the state, gaining an understanding of the market 

potential and business needs to support growth and innovation, creating a vision for an 

economy based on cleaner, safer technologies, and evaluating the potential direct and 

indirect economic impacts of that economy. The project is looking at the existing 

resources in the state—including clean tech businesses, researchers, investors, 

government programs, and NGOs—as well as external drivers, and identify opportunities 

and tools for growth, including policies, partnerships, investments, research, business 

support, and education initiatives. Over the past year, the project has created an Advisory 

Committee of some 25 thought leaders from research, industry, finance, and other 

sectors; convened five focus discussions; conducted some 30 interviews; researched 

university resources across the state, and is creating a white paper with preliminary 

findings that will be published this fall. 

Sustainable Toys Initiative. The Lowell Center is in the early stages of convening a 

Sustainable Toys Initiative. We have identified toys as a product area where there is a 

consumer demand for information and market pressure for businesses to demonstrate 

environmental and social responsibility throughout the supply chain. The purpose of the 

Sustainable Toys Initiative is to find solutions to ensure that toys are safe and healthy for 

children, the earth, and the workers who make them, no matter where these toys are 

produced and consumed. This Initiative will encourage innovation in toy design and 

production to improve toy sustainability. These improvements will reduce potential 

liabilities associated with toy manufacture and use. In addition, this Initiative will provide 

an arena for sharing information and knowledge, which will increase public confidence in 

these products. 

Sustainable Biomaterials Collaborative. The Lowell Center is one of the Steering 

Committee Members of the Sustainable Biomaterials Collaborative, a network of 

organizations working together to spur the introduction and use of biomaterials that are 

sustainable from cradle to cradle. The Collaborative seeks to advance the development 

and diffusion of sustainable biomaterials by creating sustainability guidelines, engaging 

markets, and promoting policy initiatives. The Collaborative represents a wide range of 

stakeholders including green product businesses, social investment firms, recycling 

professionals, and academics, along with advocates focused on environmental health, 


322

environmental justice, or rural communities. Indeed, the Collaborative is unique in that it 

brings together diverse groups and issues across the lifecycle of biomaterials: sustainable 

agriculture and rural development in the growing of crops; clean production and green 

chemistry in the manufacture and use of biomaterials; and recycling, composting, and 

zero waste at the end of product life. Activities over the past year have included the 

creation of the Sustainable Bioplastic Master Guidelines, Bioplastic Purchasing 

Specifications for Foodware, and creating and growing the Sustainable Biomaterials 

Collaborative itself. 

8. Publications (2006-2007) 

Clapp R. Polychlorinated biphenyls. In: Last’s Public Health and Preventive Medicine, 

15 th ed. (in press) 

Clapp RW, Howe G, Jacobs M. Occupational and Environmental Causes of Cancer. 

Encyclopedia of Public Health (submitted). 

Belpomme D, Irigaray P, Newby JA, Howard V, Clapp R, Sasco AJ, Hardell L. The 

growing incidence of cancer: Role of lifestyle and screening detection (Review). Int J 

Oncology (in press). 

Clapp R. Mortality among US employees of a large computer manufacturing company: 

1969–2001. Environmental Health: A Global Access Science Source 5:30, 2006. 

Hansen, Steffen and Joel Tickner. Forthcoming 2007. The challenges of adopting 

voluntary health, safety and environment measures for manufactured nanomaterials. 

Lessons from the past for more effective adoption in the future. Nanotechnology Law 

and Business. 

Hansen, SF; Krayer von Krauss, MP; Tickner, J. 2007. Categorizing Mistaken False 

Positives in Regulation of Human and Environmental Health. Risk Analysis 27 (1): 225- 

240. 

Hansen, SF, Carlsen, L, Tickner, JA. 2006. Chemicals Regulation and Precaution: Does 

the REACH proposal really incorporate the Precautionary Principle. Environmental 

Science & Policy. (2007), doi:10.1016/j.envsci.2007.01.001 

Hansen, SF; Krayer von Krauss, MP; Tickner, J. 2006. Risk-Risk Tradeoffs, and the 

Precautionary Priniciple. Submitted to Journal of Risk Research 

Hansen, Steffen. Martin Krayer von Krauss and Joel Tickner. The Precautionary 

Principle and False Positives. Forthcoming. Late Lessons from Early Warnings II. 

European Environment Agency. 


323

Hoppin P, Jacobs M, Stillman L. Investing in Best Practices for Asthma: A Business 

Case for Education and Environmental Interventions. Asthma Regional Council, 2007. 

Hoppin P, Jacobs M and Ribble M. Enhancing Asthma Management Using In-Home 

Environmental Interventions: A Review of Public Health Department Programs: Asthma 

Regional Council, September 2006. 

Hoppin, P. IBM Employees v. IBM: Pitfalls and Opportunities of Litigation-Generated 

Research. New Solutions, 2006. 

Kriebel D, Checkoway H, Pearce N. Exposure and Dose Modeling in Occupational 

Epidemiology. Occup Environ Med, in press. 

Kriebel D. The reactionary principle: inaction for public health. Occupational and 

Environmental Medicine, in press. 

da Silva MC, Fassa AG, Kriebel D. Musculoskeletal Pain among Ragpickers in a 

Southern City in Brazil. Am J Industrial Med. da Silva MC, Fassa AG, Kriebel D. 

Musculoskeletal pain in ragpickers in a southern city in Brazil. Am J Ind Med. 2006 Mar 

28;49(5):327-336. 

Wallace RF, Kriebel D, Punnett L, Wegman DH, Wenger CB, Gardner JW, Kark JA. 

Risk Factors for Exertional Heat Illness by Gender and Training Period. Aviation, Space, 

and Environmental Medicine 2006; 77(4): 415-421. 

da Silva MC, Fassa AG, Kriebel D. Minor psychiatric disorders among Brazilian 

ragpickers: a cross-sectional study. Environmental Health, A Global Access Science 

Source 2006; 5:17. 

Vineis P, Kriebel D. Causal models in epidemiology: past inheritance and genetic future. 

Environmental Health: A Global Access Science Source 2006; 5: 21. 

Miligi M, Seniori Costantini A, Benvenuti A, Kriebel D, Bolejack V, Tumino R, 

Ramazzotti V, Rodella S, Stagnaro E, Crosignani P, Amadori D, Mirabelli D, Sommani L, 

Belletti I, Troschel L, Romeo L, Miceli G, Tozzi GA, Mendico I, Vineis P. Occupational 

Exposure to Solvents and the Risk of Lymphomas. Epidemiology 2006; 17:552-561. 

Corbo GM, Agabiti N, Pistelli R, Valente S, Kriebel D, Forastiere F. Parental smoking 

and lung function: Misclassification due to background exposure to passive smoking. 

Respir Med. 2006 Sep 23; [Epub ahead of print] 

Pearce N, Checkoway H, Kriebel D. Bias in occupational epidemiology studies. 

Submitted, Occup Environ Med, 2006 Oct 19; [Epub ahead of print] 


324

Myers DJ, Kriebel D, Karasek R, Punnett L, Wegman DH. The social distribution of risk 

at work: Acute injuries and physical assaults among healthcare workers working in a 

long-term care facility. Social Science & Medicine 2007, 64:794–806. 

Dodič Fikfak M, Kriebel D, Quinn MM, Eisen EA, Wegman DW. A case control study 

of lung cancer and exposure to chrysotile and amphibole at a Slovenian asbestos-cement 

plant. Annals Occup Hygiene 2007; 51:261 – 268. 

Cozzensa da Silva M, Fassa AG, Domingues MR, Kriebel D. Gonalgia entre 

Trabalhadores e Fatores Ocupacionais Associados: Uma Revisão Sistemática [in 

Portugese: Knee pain in wokers and associated occupational factors: a systematic 

review]. Cadernos De Saúde Pública / Reports In Public Health, in press. 

Checkoway H, Pearce N, Kriebel D. Selecting appropriate study designs to address 

specific research questions in occupational epidemiology. Occup Environ Med, in press. 

Wallace RF, Kriebel D, Punnett L, Wegman DH, Amoroso PJ. Prior heat illness 

hospitalization and risk of early death. Environmental Research, in press. 

Hemmingsson T, Kriebel D, Tynelius P, Rasmussen F, Lundberg I. Adolescent mental 

health predicts quitting smoking in adulthood: a longitudinal analysis. European Journal 

of Public Health, in press. 

Markkanen P, Quinn M, Galligan C, Chalupka S, Davis L, Laramie A. (2007). There is 

no place like home: A qualitative study of the working conditions of home healthcare 

providers. Journal of Occupational and Environmental Medicine, Vol 49 (3), pp.327- 

337. 

Snow, M. Environmental Management Guide for Colleges and Universities May 2007 

(to be posted shortly on EPA’s website) 

Tickner, Joel. Forthcoming. From Reaction to Sustainable Solutions: A Framework for 

Improving Environmental Decision-Making in the Context of Complex Social-Ecological 

Systems. In, Ruiz de Elvira, Antonio, Incendios y Medio Ambiente en Galicia: Una 

Reflexion Critica.Academy of Public Service of Galicia. 

Tickner, Joel. 2007. Risk Assessment is not Enough. Rationale for the Precautionary 

Principle. In, Toscano, W and Robson, M. Risk Assessment in Public Health. Jossey 

Bass. 

Tickner, Joel and Kriebel, David. 2006. The role of precaution and science in 

environmental health policy. In Fisher, Jones and von Schomberg eds, The Precautionary 

Principle and Public Policy Decision Making. A prospective analysis of the role of the PP 

for emerging scientific and technological fields in different regions of the world. Edward 

Elgar 


325

Tickner, Joel. 2007. New European chemicals policy overhaul begins to take the handle 

off the toxics pump. The Pump Handle Blog. February 7. 

http://thepumphandle.wordpress.com/2007/02/ 

Tickner, Joel. 2007. Point Counterpoint: The Future of US Chemicals Regulation. 

Chemical and Engineering News 85(2): 34-38. 

Tickner Joel, Stober Judy and Chelser Elizabeth. 2002. Applying Precaution in the 

Context of Chemical Safety. Regional Activity Center for Cleaner Production, Annucal 

Technical Publication. December: 25-29 

Wu Nerissa, Herrmann Thomas, Paepke Olaf, Tickner Joel, et. al. 2007. Human 

Exposure to PBDEs: Associations of PBDE Body Burdens with Food Consumption and 

House Dust Concentrations. Environmental Science and Technology, 41 (5), 1584 -1589 

9. Events and Presentations 

Events 

Toward Tomorrow Summit: Creating the Possible: Generating a Common Agenda for 

Health & Environment. White Oak Conservation Center, Yulee, Florida, February 28- 

March 2, 2007. 

Best Practices and Management Systems to Promote Campus Sustainability, a workshop 

for Massachusetts state colleges and universities on ways to improve sustainability, 

compliance, operations, and environmental health and safety, co-sponsored with UMass 

Amherst and the Executive Office of Energy and Environmental Affairs, June 14, 2007. 

4 training sessions for the Massachusetts Bay Transportation Authority on environmental 

management systems, compliance, and sustainability. 

Semi-annual meeting of the Public Entity EMS Resource Center: Washington D.C., June, 

2006. 

Reach Training Series, Detroit Michigan, San Francisco, CA, Seattle, WA, September 

2007 

Workshop on trade implications of REACH, MA Export Center, Amherst, MA, 

November 1, 2007 

Second Green Chemistry and Commerce Council, Innovators Roundtable The Role of 

Tools, Labels, and Retail in Promoting Safer Chemistry. Lowell, MA May, 2007 

Chemicals Policy Options Report discussion meeting, July 1-3, 2007 


326

Presentations 

Bello, Anila. Quantitative assessment of airborne exposures generated during common 

cleaning tasks-a pilot study. University of Massachusetts Lowell and University of 

Connecticut joint research and education symposium. Sturbridge, MA; May 21, 2007. 

Bello, Anila. Preventing asthma in the workplace: Exposures to cleaning agents 

Massachusetts Nurses Association & University of Massachusetts Lowell School of 

Health & Environment conference: Workplace Hazards to Nurses and Other Healthcare 

Workers: Promising Practices for Prevention. Marlborough, MA; June 2007. 

Chalupka S, Markkanen P, Chaulk D, Davis L, Firsova N, Galligan C, Laramie A, Quinn 

M Home healthcare nursing: Risk factors for blood exposures and sharps injuries, 

American Association of Public Health (APHA). Presented at APHA 134 th Annual 

Meeting and Exposition. November 4-7, 2006. Boston, MA. 

Chalupka, S. Home Health Care Nursing: Sharps Injury Risk Factors & Prevention. 

Presented at American Association of Occupational Health Nurses 2007 Symposium; 

Orlando, FL; April 2007 

Chalupka, S and Markkanen, P. Preventing Injuries to Nurses in Home Care Settings. 

MNA/UML Conference: Workplace Hazards to Nurses and Other Healthcare Workers: 

Promising Practices for Prevention. Marlborough, MA; June 7-8, 2007. 

Clapp R, Hoppin P, Kriebel D. Erosion of the integrity of public health science in the 

USA. Occupational & Environmental Medicine 2006; 63:367-68. 

Clapp R. “Mortality in a large computer manufacturing company, 1969-2001.” 

American Public Health Association Annual Meeting, Boston, November 7, 2006. 

Clapp, R. “Occupational and Environmental Causes of Cancer.” Second International 

Congress of the Paris Appeal, Paris, France, November 9, 2006. 

Clapp, R. “Occupational and Environmental Causes of Cancer.” Collaborative on Health 

and Environment Annual Meeting, San Francisco, CA, October 13, 2006. 

Crumbley, C. Environmental Challenges for Our Future-What Are the Solutions? 

Keynote presentation for Lowell: The Flowering City. Lowell, MA. April 5, 2007. 

Crumbley, C. Understanding the Food Versus Fuel Debate. FoodMed 2007. Boston, 

MA Jun2 28, 2007 

Edwards, S. Making toys safer for the world’s children: An exploration of globalization 

and sustainable product design in the toy industry. POW at TURI, May 2, 2007 


327

Edwards, S. Toys and Sustainable Product Design. Radio interview with Barbara 

Glickstein, host of Healthstyles program on public radio station WBAI-Pacifica in NYC, 

June 22, 2007 

Galligan, C. Reducing occupational and environmental hazards in healthcare. 

Baystate Healthcare Annual Safety Committees Retreat; Holyoke, MA. April 2007 

Hoppin P, Jacobs M, Ribble M. “Health Departments: Improving Asthma Through 

Home-Based Interventions.” Asthma Regional Council Symposium. September 27, 2006. 

Hoppin, P, Jacobs M, and Stillman S. “Investing in Best Practices for Asthma: A 

Business Case.” U.S. Environmental Protection Agency, Communities in Action for an 

Asthma Friendly Environmental National Webcast, June 19, 2007. 

Jacobs M, Clapp R, Nelson J. “Environmental Epidemiologic Evaluation: The 

importance of designing studies that are responsive to community concerns.” 

International Society for Environmental Epidemiology Annual Meeting, Paris, France, 

September 5, 2006. 

Jacobs M, Hoppin P and Stillman L. “Home-Based Environmental Interventions for 

Asthma: A Review of Health Department Programs.” American Public Health 

Association Conference, November 2006. 

Kim H and Kriebel D. Alternative Regression Models in Public Health Surveillance. 

University of Massachusetts Lowell and University of Connecticut joint research and 

education symposium. Sturbridge, MA; February 2007 

Kim H and Kriebel D. Alternative Regression Models in Public Health Surveillance. 

Presented to Massachusetts Department of Public Health, Boston, MA; September 2006. 

Kriebel, D. Lecturer in Epidemiology in the Masters Program, University of Turin, Italy. 

Lecturer in 1-week course on Cohort Studies, May 2007. 

Kriebel, D. Precaution: what’s epidemiology got to do with it? Invited lecture to the 

Epidemiology Department, University of North Carolina School of Public Health, 

February 2007. 

Kriebel, D. Occupational Injury Surveillance: What is its role in a rapidly industrializing 

country? Harvard School of Public Health, April 2007. 

Kriebel, D. How much evidence is enough? Conventions of causal inference. Invited 

paper at The Coronado Conference IV. Conventions in Science and the Law. Bretton 

Woods, NH, May 2007. 


328

Markkanen P, Quinn M, Chalupka S, Chaulk D, Firsova N, Davis L, Galligan C, 

Laramie A. Assessing occupational health hazards of homehealth care workers: 

Comparison of qualitative research methods. Presented at American Association of 

Public Health (APHA). APHA 134 th Annual Meeting and Exposition. Boston, 

MA. November 4-7, 2006. 

Markkanen P. Philadelphia. Prevention through design: experience in the healthcare 

sector [Presentation on SHARRP and Sustainable Hospitals Project Research 

findings]. Presented at American Industrial Hygiene Association Conference, 

Philadelphia, PA; June 5, 2007. 

Quinn M, Chalupka S, Galligan C, Kriebel D, and Markkanen P. Meeting of NIOSH 

affiliated home healthcare research groups at the American Public Health Association 

(APHA) Conference, Boston, MA, November 2006. 

Snow, M. Improving Compliance, Performance and Operations: New England Chapter 

of the American Public Works Association, Yarmouth, Massachusetts, 6/22/06. 

Snow, M. Bridging the ‘Divide’ between Sustainability, EH&S, Facilities Management 

and Environmental Management Systems at the Smart and Sustainable Campuses 

national conference, University of Maryland, April, 19, 2007. 

Tickner, J. Lessons learned from applying precaution in chemicals safety efforts 

Intergovernmental Forum on Chemical Safety, September, 2006 

Tickner, J.. The Toward Tomorrow Project, American Public Health Association, 

Boston, MA, November, 2006 

Tickner, J. Desde la Reaccion Hacia Las Soluciones Sostenibles, Seminar on Climate in 

Galicia, Santiago, Spain, January, 2007 

Tickner, J. A Precautionary Approach to Nanotechnology, City of Seattle Lecture Series, 

Seattle, WA, February, 2007 

Tickner, J. A Precautionary Approach to Nanotechnology, City of Portland Lecture 

Series, Portland, OR, February, 2007 

Tickner, J. A Rationale for Goal Setting, Toward Tomorrow Summit, Jacksonville, FL. 

February, 2007 

Tickner, J. A Proactive Path Towards Sustainability, Parker Lecture Series, Lowell, MA, 

March, 2007 

Tickner, J. Dealing with Persistent Toxic Substances the Precautionary Way, Working on 

Waste, Claremont, NH, May, 2007 


329

Tickner, J. A vision of sustainable chemistry New York Clean Health and Environment 

Conference, Albany, NY, December, 2006 

Tickner, J. Identifying Tools to Rapidly Characterize and Prioritize Chemicals, US EPA 

Data Users Conference, Austin, TX, December, 2006 

Tickner, J.The European Reach Initiative, Challenges and Opportunities for Safer 

Chemistry Footwear and Apparel Industry Association, New York, NY, March, 2007 

Tickner, J. Chemicals Management as if safer chemistry really mattered Americana 

Conference, Montreal Quebec Canada, March, 2007 

Tickner, J.Progress of the Green Chemistry and Commerce Council. Green Chemistry 

and Commerce Council Roundtable, Lowell, MA, April, 2007 

Tickner, J. REACH and sustainable chemistry: an opportunity for trade union leadership 

United Steelworkers Health and Safety and Campaign Department, Pittsburgh, PA, June, 

2007 

Tickner, J. Reforming US Chemicals Policy as if health safety and environment really 

mattered. University of Pittsburgh conference on REACH, Pittsburgh, PA, June, 2007 

Tickner, J. Promoviendo una quimica mas sostenible, Universidad Compultense de 

Madrid Summer Course on REACH, El Escorial Spain, July, 2007 

Tickner, J. Moving towards safer chemistry: an opportunity for trade union leadership 

United Steelworkers Health and Safety Conference, Dearborn, MI, August, 2007 

Torrie, Y. Policy Strategies and Innovations: Options for Reforming State Chemicals 

Management Policy, National Environmental Partnership Summit, New Orleans, LA 

May, 2007 

Torrie, Y. Green Chemistry and Commerce Council: Drivers for Innovation and 

Marketing Safer Products, Characterizing Chemicals in Commerce, Austin, TX 

10. Collaboration with other Center Centers/Institutes and/or Departments 

Polly Hoppin devoted two days per week this year promoting collaboration across 

Centers and Departments within the School of Health and Environment, including 

developing a statement of mission, vision and seven year goals; planning and convening a 

series of cross-disciplinary seminars for the School; developing teams of committed 

faculty from all the departments in the School to guide communications and fundraising. 

In conjunction with faculty in the Nursing Department and in the Center for Work, 


330

Family and Community, EHI staff developed a grant proposal to EPA for education to 

pregnant women about prenatal environmental risks to children. 

There were regular discussions with the Center for Green Chemistry on the best ways to 

map green chemistry and chemicals policy so that they are synergistic. 

Cathy Crumbley regularly represented the Lowell Center at the Committee on Industrial 

Theory and Assessment. 



Richard Clapp provided technical support for C-10 radiation and cancer monitoring in 

Newburyport and other Merrimack Valley towns; also located support for shellfish 

examination around Seabrook Nuclear Power Station. 

Richard Clapp worked with the Massachusetts Breast Cancer Coalition and Silent Spring 

Institute to educate policy makers about the importance of including breast cancer 

research funds in the Massachusetts state budget. 

Polly Hoppin and Molly Jacobs collaborated with Children’s Hospital, Boston Medical 

Center and the Asthma Regional Council on strategies for promoting investments in 

environmental education and supplies and services. As part of this initiative, they 

conducted outreach to payers (e.g., Neighborhood Health and Medicaid) and policy 

makers, especially EPA. 

Polly Hoppin collaborated with the Massachusetts Public Health Association to organize 

four fora on occupational and environmental health (including topics on climate change 

and health; local community organizing on health issues; and biomonitoring). 

Madeline Snow led two focus groups with MIT, Boston College, Brown University, 

Georgetown University, Rhode Island School of Design, Cornell University, UMass 

Amherst, and the Campus Consortium of Environmental Excellence on the changing role 

of campus environmental health and safety professionals (spring of 2007). 

Madeline Snow assisted Enel Energy, operator of the Boott hydroelectric plant on the 

Merrimack River, in developing options and strategies to incorporate Environmental 

Management Systems in their operations. 

Madeline Snow developed a Best Practices and Management Systems to Promote 

Campus Sustainability workshop for Massachusetts state colleges and universities to 

share best practices on ways to improve sustainability, compliance, operations, and 

environmental health and safety,; A total of 67 people participated in the workshop with 

21 of 29 state colleges and universities represented as well as state and federal agencies. 


331

Follow up work to continue the sharing and learning across state campuses is being 

proposed. 

Over the past year, the Lowell Center provided research assistance and technical support 

to: 

A. 

• The Massachusetts Breast Cancer Coalition, the Clean Water Fund, and the 

Alliance for a Healthy Tomorrow on the precautionary principle and 

precautionary chemicals policies in Massachusetts. 

• The New England Asthma Regional Council, Network Health, and Neighborhood 

Health Plan on asthma prevention and related issues. 

• The national Collaborative on Health and Environment, including coordination 

of national asthma discussion group and preparation of a paper on environmental 

links with cancer. 

• Advocates throughout the country working to advance integrated chemicals 

policies. 

• Greater Lowell Technical High School and U.S. National Park Service on 

systems to improve environmental compliance and performance. 

• Mass. Dept. of Public Health on occupational injury surveillance, on cancer risk 

in firefighters, and on sharps injury prevention in healthcare workers. 

Boards and Advisory Groups 

Margaret Quinn, Catherine Galligan and Pia Markkanen serve on the Massachusetts 

Statewide Advisory Board on Needlestick Injuries and Safe Needle Devices, MA Dept of 

Public Health; Boston, MA 

Margaret Quinn serves on the NIOSH NORA Healthcare Council and serves as 

representative to the NIOSH Prevention through Design (PtD) Committee. 

B. Ken Geiser is a Member of the Chemical Information Management Advisory Panel of the 

U.S. Environmental Protection Agency. 

C. 

Classroom Presentations 

Richard Clapp and Molly Jacobs gave separate class presentations for Karla Armenti’s 

public health course at the University of New Hampshire. 

Molly Jacobs gave a class presentation in Beth Rosenberg’s public health course at Tufts 

University, February 20, 2006. 

D. 

12. Proposals Submitted 2006-2007 


332

Status Sponsor Title Total Budget 

NF HARVARD UNIVERSITY Audit of Environmental Programs $63,637 

F 

MA DEPT OF 

ENVIRONMENTAL 

PROTECTION Environmental Municipal Steward Training $28,149 

F 

F 

CAMPUS CONSORTIUM FOR 

ENVIRON EXCELLENCE 

ENVIRONMENTAL HEALTH 

FUND 

Communications describing University changes in 

environmental responsibilities $1,500 

Consultation to State Legislature regarding 

Alternatives to Brominated Flame Reta $23,837 

NF SUMMIT FOUNDATION Sustainable Toys Initiative $68,179 

NF 

U.S. ENVIRONMENTAL 

PROTECTION AGENCY 

Enabling Schools to Make Environmental Health 

and Safety Education an Integral Part $80,590 

F 

F 

GLOBAL ENVIRONMENT & 

TECHNOLOGY FDN 

BOSTON FOUNDATION 

Energy-Focused EMSs in Wastewater Utilities in 

New England $8,560 

Promoting Health Sector Support for Home 

Environmental Interventions - Phase 2 $40,000 

F 

F 

THE JENIFER ALTMAN 

FOUNDATION 

KENDEDA FUND 

Update of Occupational & Environmental Cancer 

Report $7,176 

Strengthening Core Activities of the Lowell 

Center for Sustainable Production, U $109,494 

F 

H.J. HEINZ COMPANY 

FOUNDATION 

Proposal for work on chemical restrictions in 

products in Europe $22,000 

F JOHN MERCK FUND Clean Tech: An Agenda for a Healthy Economy $70,000 

Pending MARISLA FOUNDATION 

Advancing Chemicals Policy Reform at the 

Federal, State, and Corporate Level in t $225,875 

NF National Biosolids Partnership 

Technical Assistance to Local New England 

Agencies Developing NBP Biosolids EMSs $10,000 

F 

Massachusetts Executive Office 

of Environmental Affairs 

Best Practices and Management Systems to 

Promote Campus Sustainability $6,800 

F Anonymous Clean Tech: An Agenda for a Healthy Economy $150,000 

F 

F 

Johnson Family Foundation 

Panta Rhea Foundation 

Technical Assistance Coordinator for Supporting 

Forward-Looking Businesses and the Advocacy 

Community $60,000 

A Movement-Building Strategy for Environmental 

Health $25,000 


333

F 

V. Kann Rasmussen Foundation 

Advancing a Precautionary Vision for Health and 

Environment $310,000 


334

27. BIOMANUFACTURING CENTER AND INSTITUTE FOR PLASTICS INNOVATION 

Annual CFCI Report 

DISPOSABLE, PLASTIC BIOREACTORS 

Submitted by: Dr. Carl Lawton and Dr. Stephen McCarthy 

During the production of biologics, a tremendous amount of money is spent on 

cleaning, sterilization, and verification of the sterilization of typically stainless steel 

fermentors and piping. A significant savings could be realized if a disposable vessel or liner 

system were to be developed. This collaborative project will involve the development of a 

cost effective disposable plastic bioreactor which will function as well as the current 

bioreactors in terms of cell viability. The development will involve blow molding various 

vessels and development of stirring, oxygen control, and monitoring. 

Focus 2006 

The focus of 2006 was funding of graduate student Justin Whitfield to develop a 

sustainable recyclable material that could be used for blow molding of bioreactors. The 

following are excerpts from his thesis describing this work. 

ENZYMATIC DEGRADATION OF BIOINSPIRED PHOTOPOLYMERS 

Justin Whitfield 

A. Vinylbenzyl Thymine Photopolymers 

Thymine, a base ubiquitous in the DNA of all living systems; has been shown 

to undergo a 2 + 2 photodimerization through a well understood mechanism 3,4 

that is fundamentally responsible for causing skin cancer in many living 

organisms. 56-7 Through bioinspiration, the properties of thymine residues have been 

3 Blackburn, G. M.; Davies, R. J. H. Photochemistry of 1-methylthymine and 3-methylthymine. J. 

Chem. Soc. C 1966, 1342-1345. 

4 Lamola, A. A.; Mittal, J. P. Solution photochemistry of thymine and uracil. Science 1966, 154, 

1560-1561. 

5 Farmer, P.; Walker, J. The Molecular Basis of Cancer. Wiley Interscience Publishers, New York 

1985. 

6 Yamada, H.; Hieda, K. Wavelength dependence (150-290 nm) of the formation of the cyclobutane 

dimer and the (6-4) photoproduct of thymine. Photochemistry and Photobiology 1992, 55, 541-548. 

7 Boehncke, W. H. Topical photodynamic therapy for psoriasis. Comprehensive Series in 

Photosciences 2001, 2, 259-270. 

Biomanufacturing Center 

335

transferred to a series of water soluble 

photopolymers based on vinylbenzyl thymine. 8 Extensive testing has shown the 

great potential of these thymine polymers as photoresist materials, and even as a 

template medium for enzymatic aniline polymerization. 9 

However, in order to truly create an environmentally benign photoresist 

system, the fate of the polymer after it has served its function must be considered. 

In human cells there are enzymes present that recognize regions of DNA that have 

had the photo 2 + 2 reaction take place. To search and remove these 

photodamaged sections is the function of excisionase enzymes. Upon removal of the 

dimers, the DNA is repaired with “new” thymine residues. 

The process of DNA repair is not universal among all species however. 

Bacteria in particular are typically more conservative of their nucleic acids and use 

DNA photolyase to directly reverse the photodimerization reaction so as to return to 

the unaltered form. 10 

Vinylbenzyl thymine photopolymers are rendered water soluble through the 

copolymerization of various para-substituted styrene cationic and anionic 

comonomers. The polymers become insoluble upon exposure to 254 nm UV light 

due to the high molecular weight and complicated structure of the crosslinked 

network and are immobilized on a hydrophilic substrate due to hydrogen bonding 

and van der Waals interactions. 11 

With the vinylbenzyl thymine photopolymer mimicking this biological 

system, the decision was made to explore if the enzyme E. coli DNA photolyase could 

in fact be used to reverse this photocrosslinking and return the polymer back to its 

original water soluble state (Scheme #.). 

8 Cheng, C. M.; Egbe, M. J.; Grasshoff, M. J.; Guarrera, D. J.; Pai, R. P.; Taylor, L. D.; Warner, J. 

C. Synthesis of 1-(vinylbenzyl)thymine, a novel, versatile multi-functional monomer. J. Polymer Sci., 

Part A: Polymer Chem. 1995, 33, 2515-2519. 

9 Trakhtenberg, S.; Hangun-Balkir, Y.; Warner, J. C.; Bruno, F. F.; Kumar, J.; Nagarajan, R.; 

Samuelson, L. A. Photocrosslinked Immobilization of Polyelectrolytes for Enzymatic Construction of 

Conductive Nanocomposites. J. Am. Chem. Soc. 2005, 127, 9100-9104. 

10 Sancar, A. Structure and function of DNA photolyase and cryptochrome blue-light 

photoreceptors. Chem. Rev. 2003, 103, 2203-2237. 

11 Yu, C. A.; Trakhtenberg, S.; Cain, T. E.; Warner, J. C. Effect of Dye Additives on 

Photodimerization of Thymine Pendant Groups in Water-soluble Photoresist Polymers. J. Polym. 

Environ. 2006, 14, 131-134. 


336

1n 

4n 

1n 

4n 

O 

N 

O 

N 

H 

Cl 

NEt 3 

O 

CH 3 

hν 

DNA Photolyase 

O 

H 3 C 

N 

O 

N 

H 

Cl 

NEt 3 

O 

CH 3 

H 

N 

O 

N 

CH 3 

NEt 3 

Cl 

H 

N 

O 

N 

Cl 

NEt 3 

1n 

4n 

1n 

4n 

Scheme #: 2 + 2 cycloaddition and enzymatic reversal in polystyrene polymer 

system. 

B. E. coli DNA Photolyase 

Escherichia coli DNA photolyase is a 471 amino acid polypeptide with a 

molecular weight of around 49,000 Da. Extensive work on this enzyme in particular 

by Dr. Aziz Sancar, has illuminated much of the structure and function of this 

enzyme. The enzyme has been shown to contain two cofactors. The first is 5,10- 

methenyltetrahydrofolate (MTHF), which acts as a light-harvesting “antenna.” 

MTHF then transfers this energy over a distance of 16.8 Å to flavin adenine 

dinucleotide (FAD), the second cofactor that donates an electron to catalyze the 

- 15 

splitting of the cyclopyrimidine dimer via radical mechanism (Scheme #.). 121314 

12 Sancar, A. Structure and function of DNA photolyase. Biochemistry 1994, 33, 2-9. 

13 Sancar, G. B.; Smith, F. W.; Sancar, A. Identification and amplification of the E. coli phr gene 

product. Nucleic Acids Research, 1983, 11, 6667-6678. 

14 Sancar, A.; Smith, F. W.; Sancar, G. B. Purification of Escherichia coli DNA photolyase. Journal 

of Biological Chemistry, 1984, 259, 6028-6032. 

15 Park, H.; Kim, S.; Sancar, A.; Deisenhofer, J. Crystal structure of DNA photolyase from 

Escherichia coli. Science, 1995, 268, 1866-1872. 


337

O 

N 

Glu n 

hν 

HN 

N 

O 

HN 

O 

N 

P 

O 

N 

NH 

O 

* 

* FADH- 

R 

N 

N 

H 

N 

O 

NH 

O 

H 2 N 

N 

H 

R 

MTHF 

* 

O 

HN 

H 2 N 

N 

N 

H 

N 

Glu 

n 

N 

N 

O 

* MTHF 

O - 

e- 

O 

R 

N 

N 

O 

N 

H 

NH 

O 

FADH- 

O 

HN 

N 

P 

N 

NH 

O 

O - 

O 

N 

H 

FADH 

O 

NH 

O - 

O 

e- 

O 

O 

HN 

NH 

HN 

NH 

HN 

NH 

O 

N 

N 

O 

O 

N 

N 

O 

O 

N 

N 

O 

P P P 

Scheme #: Thymine crosslinking reversal mechanism. 12 

To determine feasibility of this enzymatic crosslinking reversal in the 

thymine-based polymer system, a pigment-toned photoresist process was used as a 

model. This system uses a thin layer of water soluble thymine polymer coated on a 

polyethylene terephthalate subtrate (Figure #.). 16 The polymer chosen for evaluation 

was a 1:4 copolymer of vinylbenzylthymine and vinylbenzyltriethylammonium 

chloride (1:4 VBT:TEQ). This polymer was chosen for this analysis due to extensive 

experience and knowledge of its physical properties, including molecular weights, 

solubilities and surface characteristics. 17 

In a typical photoresist experiment, the aqueous polymer solution (most 

commonly 10% concentration by weight) is coated onto a PET substrate using a 

Meier type coating rod. The polymeric film is then irradiated with short wave 

ultraviolet light (254 nm) so as to generate an area of immobilized photocrosslinked 

polymer. The film is then washed thoroughly with water to remove any of the 

unexposed polymer. Taking advantage of the cationic nature of the solubilizing 

monomer, the normally transparent film is then visualized by toning in a bath of 

16 Lloyd-Kindstrand, L.; Warner, J.C. Thymine-containing styrene polymers as environmentally 

benign photoresists. Biopolymers, 2002, 8, 165. 

17 Bianchini, J. R.; Saito, K.; Balin, T. B.; Dua, V.; Warner, J. C. Thymine Based Water Soluble 

Phototripolymers: Their Preparation and Synthesis. J. Polymer Sci., Part A: Polymer Chem. 2007, 

45, 1296-1303. 


338

anionic dye FD&C Red #40. The electrostatic interactions allow for clear 

visualization of the regions of the polyethylene terephthalate film that has 

immobilized polymer remaining, which from this point on will be referred to as the 

photoimage (Figure #.). 

UV Light 

Water-Soluble Polymer 

PET Substrate 

1 

2 

UV-Blocking 

3 

4 

Figure #: Photoresist-toning procedure. 

1.) Irradiation of polymer through UV-Blocking Mask. 

2.) Exposed polymer is crosslinked and rendered immobile. 

3.) Removal of uncrosslinked polymer via aqueous wash to yield the photoimage. 

4.) Toning of photoimage with counterionic dye. 

Commercially available E. coli DNA Photolyase (Trevigen) was exposed to a 

photoimage as a buffered solution. This exposure sought to test the efficacy of the 

enzyme in reversing the UV-induced photocrosslinks. Turnover capacity of the 

enzyme was also explored by reapplying the buffered enzyme solution to unexposed 

regions of the same film. After the desired exposure time had been reached, the film 

was rinsed to remove the enzyme as well as any potentially uncrosslinked polymer 

and subsequently toned via FD&C Red #40 to visualize the immobilized polymer. A 

control of buffer without DNA Photolyase was also applied to the film (Figure #.). 


339

1 

2 

3 

4 

Figure #: Enzymatic Photoreversion Procedure. 

1.) Photoimage is exposed to DNA photolyase. 

2.) Exposed polymer is de-crosslinked and rendered water soluble 

3.) Removal of uncrosslinked polymer via aqueous wash to yield the new 

photoimage. 

4.) Toning of photoimage with counterionic dye. 

The results showed that the regions of enzyme exposure had different color 

densities than the unexposed background and control regions. Indicating a removal 

of vinylbenzyl thymine polymer from the polyethylene terephthalate substrate. The 

resulting color densities of dye in these experiments are summarized in a graph 

created using the color sampling utility found in Adobe Photoshop 7.0 (Figure #.). 

100 

100 98 

75 

% Dye Density 

50 

25 

6 7 

12 

0 

No Enzyme Control Application 1 Application 2 Application 3 

Figure #: Effect of E. coli DNA Photolyase on “toned” dye density of crosslinked 

films. 


340

The buffered solution without any enzyme [control] had a negligible effect on 

the immobilized polymer. Conversely, application of the enzyme solution removed 

nearly the entirety of the immobilized polymer; reducing the color density to 6%. 

Subsequent reuse of this solution a second and then a third time on unexposed 

regions of the film demonstrated that the enzyme remained effective at 7% and 12% 

respectively; nearly 15 minutes after the initial exposure. This difference in color 

could have been due to a variety of factors, including competitive surface binding 

between the lysate and the dye. Further examination was then necessary to insure 

that the above data was indeed due to photoreversion and the subsequent 

solubilizing of the thymine polymer. 

Scanning electron microscopy was used to verify that the thymine polymer 

had been removed from the surface of the substrate. Micrographs of the system 

show the immobilized polymer absent in the regions where the enzyme solution was 

applied (Figure #.). The majority of the above work was subsequently published. 18 

Figure #: SEM of photoresist film showing region of polymer removal (left), 

and remaining polymer (right). 1000X. 

In an attempt to utilize UV-Vis to quantify the removal of vinylbenzyl 

thymine polymer with the enzyme, a novel monomer was created to be incorporated 

into the vinylbenzyl thymine polymer to give it inherent color. Fluoresceinamine 

was reacted with vinylbenzyl chloride to yield vinylbenzyl fluoresceinamine as 

metallic green/rust colored flakes (Figure #.). The new monomer was incorporated 

into a 1:4 VBT:TEQ copolymer via AIBN initiated radical polymerization at 

approximately 1 wt %. The resulting polymer was a light yellow and yielded a 

marigold yellow color upon dissolution in water. This polymer was coated as 

previously with a Meier type coating rod unto a PET substrate. Exposure of this 

film to shortwave (254 nm) UV light demonstrated the immobilization 

18 Whitfield, J.; Morelli, A.; Warner, J.C. Enzymatic Reversal of Polymeric Thymine 

Photocrosslinking with E. coli DNA Photolyase. J. Macromol. Sci. Part A: Pure and App. Chem. 2005, 

42, 1541-1546. 


341

characteristics found in the thymine-based 

polymer systems. Yet due to the film thickness, and subsequent pathlength 

requirements, UV-Vis was unable to quantify the presence of this monomer despite 

its visually faint yellow color versus an uncoated PET substrate control. This of 

course made monitoring the loss of absorbance from the removal vinylbenzyl 

fluoresceinamine as a function of enzyme activity un feasible. 

O 

H 

N 

O 

HO 

O 

OH 

Figure #: Vinylbenzyl fluoresceinamine was incorporated into VBT polymers 

in an effort to quantify enzymatic removal of polymer from PET substrates via UV- 

Vis. 

Despite the apparent success of the E. coli DNA photolyase experiments it 

was not without its shortcomings. Extended exposure of the commercial enzyme to 

room temperatures showed decreased activity. This necessitated cryostorage, and 

short and less flexible experimental runs to preserve the stock material. In addition, 

the literature is saturated with research utilizing the E. coli DNA photolyase. Other 

species or systems may yield more robust mechanisms while simultaneously being 

more rewarding academically. 

C. Extremophiles 

In the 1970’s the discovery of several new species of bacteria challenged the 

boundaries of the environments that scientists believed were necessary to sustain 

life. Organisms were found thriving at temperatures over 65 °C, and pressures over 

400 atm. Since then, discoveries of species of archaebacteria that grow at extreme 

pH, over 100 °C, and even 700 atm have all but dissolved common views. The 

conditions necessary for life are now limited nearly to the extent of the 

imagination. 19,20 

19 Brock, T.D.; Freeze, H. Thermus aquaticus, a nonsporulating extreme thermophile. J. 

Bacteriology 1969, 98, 289-297. 

20 Madigan, M. T.; Marrs, B. L. Extremophiles. Scientific American 1997, 276, 82-87. 


342

These extremophiles are academically intriguing for several reasons. 

Probing the genetic makeup of these organisms shows vast differences when 

compared to more “typical” bacteria. This essentially shattered the Five Kingdom 

system of classification; giving birth to the Three Domain system: Archae, 

Eubacteria, and Eukaryota. The Archae also give a glimpse at how life may have 

spawned on this planet billions of years ago when the conditions for life would be 

what humans would consider being uninhabitable. 

Naturally, since these organisms have evolved to exist in these extreme 

conditions, their proteins and enzymatic systems must have evolved accordingly in 

order for them to survive. These robust enzymes with their inherent thermal 

stability and resistance to otherwise denaturing factors and conditions have made 

them popular research targets as catalysts for novel chemical transformations. One 

of the most well known examples of a successful thermophilic enzyme is Taq DNA 

polymerase. Thermus aquaticus is the source of the Taq DNA polymerase that has 

made PCR (polymerase chain reaction) the indispensable tool it is today. 21 With 

extremophiles in mind, effort was focused on locating a DNA photolyase that would 

function on the vinylbenzyl thymine photopolymer system; while yielding improved 

properties and characteristics versus the E. coli variant. 

D. Thermus thermophilus 

First isolated in 1974, Thermus thermophilus is an aerobic, heterotroph with a 

maximum growth temperature of approximately 85 °C. 22 The genomic sequence 

hints at the thermal stability of this organism. A genomic guanine and cytosine 

content (G+C) of 69.4% lends it self to an extremely stable genome, resistant to 

denaturization under extreme temperatures. 23 For comparison, E. coli has an 

average G+C content of roughly 50%. 24 The reason for this stems from the noncovalent 

hydrogen bonding characteristics of DNA base pairs. Thymine and 

adenine bind together through the forces of two hydrogen bonds, while guanine and 

cytosine do so with three. Therefore a genome with a higher G+C content has a 

greater potential of resisting denaturization due to increased hydrogen bonding 

energy (Figure #.). 

21 Niehaus, F.; Bertoldo, C.; Kahler, M.; Antranikian, G. Extremophiles as a source of novel 

enzymes for industrial application. Appl. Microbiol. Biotechnol. 1999, 51, 711-729. 

22 Oshima, T.; Imahori, K. Description of Thermus thermophilus combination nova, a nonsporulation 

thermophilic bacterium from a Japanese thermal spa. Int. J. Syst. Bacteriology, 1974, 24, 

102-112. 

23 Henne, A.; Brueggemann, H.; Raasch, C.; Wiezer, A.; Hartsch, T.; Liesegang, H.; Johann, A.; 

Lienard, T.; Gohl, O.; Martinez-Arias, R.; Jacobi, C.; Starkuviene, V.; Schlenczeck, S.; Dencker, S.; 

Huber, R.; Klenk, H.; Kramer, W.; Merkl, R.; Gottschalk, G.; Fritz, H. The genome sequence of the 

extreme thermophile Thermus thermophilus. Nature Biotechnology 2004, 22, 547-553. 

24 Blattner, F. R.; Plunkett, G., III; Bloch, C. A.; Perna, N. T.; Burland, V.; Riley, M.; Collado-Vides, 

J.; Glasner, J. D.; Rode, C. K.; Mayhew, G. F.; Gregor, J.; Davis, N. W.; Kirkpatrick, H. A.; Goeden, 

M. A.; Rose, D. J.; Mau, B.; Shao, Y. Complete genome sequence of Escherichia coli K-12. Science 

1997, 277, 1453-1462. 


343

HN 

H 

N H 

O 

N 

O 

H H 

N 

N 

NH 

H N 

HN N 

H 

N 

N 

O 

O 

H N 

N 

H 

Cytosine Guanine Thymine 

Adenine 

N 

N 

H 

Figure #: A larger genomic Guanine-Cytosine (G+C) content 

increases hydrogen bonding energy; increasing resistance to denaturization. 

Thermal stability of a genome often necessitates stability of corresponding 

proteins in thermophilic organisms. In 1997 a thermostable DNA photolyase was 

characterized from T. thermophilus. 25 A protein of approximately 48 kDa was 

isolated and verified for photoreactivation activity. The cofactor utilized by T. 

thermophilus is revealed to be only FAD through the crystal structure in E. coli 

overproduced enzyme. 26 This could be indicative of another cofactor however that 

E. coli may not be able to produce naturally. While the crystal structure of the E. 

coli and T. thermophilus DNA photolyase are quite similar, the thermophilic variant 

is more compact and is missing some of the characteristic extended loops of the E. 

coli enzyme. In addition the active sight of the thermophile’s enzyme appears 

“tighter” and more restrictive. These differences are likely responsible for the 

enzymes’ tolerance to extreme heat (Figure#.). 

25 Kato, R.; Hasegawa, K.; Hidaka, Y.; Kuramitsu, S.; Hoshino, T. Characterization of a 

thermostable DNA photolyase from an extremely thermophilic bacterium, Thermus thermophilus 

HB27. Journal of Bacteriology 1997, 179, 6499-6503. 

26 Komori, H.; Masui, R.; Kuramitsu, S.; Yokoyama, S.; Shibata, T.; Inoue, Y.; Miki, K. Crystal 

structure of thermostable DNA photolyase: Pyrimidine-dimer recognition mechanism. Proc. Natl. 

Acad. Sci. U.S.A. 2001, 98, 13560-13565. 


344

Figure #: T. thermophilus DNA photolyase (right) is more compact than the E. coli 

variant (left). Boxes highlight structure of E. coli DNA photolyase that is 

significantly modified or even missing in T. thermophilus DNA photolyase. The 

MTHF cofactor is present in the E. coli enzyme and absent in T. thermophilus. 

Enzymes visualized with Cn3D with crystal structure data from Entrez’s MMDB. 2627 

28 

- 

There is currently no commercial source for this enzyme. To procure usable 

amounts for testing on the vinylbenzyl thymine polymer systems, it would have to be 

cloned. What follows are the steps involved in this process, from the design of the 

PCR primers to large scale fermentation and isolation. The goal of this work is to 

determine whether or not this enzyme can be a practical and efficient method of 

degrading the thymine based photoimages back to the original water soluble state 

for reuse. 

27 NCBI – Cn3D Homepage. http://130.14.29.110/Structure/CN3D/cn3d.shtml (accessed Mar 2007). 

28 Chen, J.; Anderson, J. B.; DeWeese-Scott, C.; Fedorova, N. D.; Geer, L. Y.; He, S.; Hurwitz, D. I.; 

Jackson, J. D.; Jacobs, A. R.; Lanczycki, C. J.; Liebert, C. A.; Liu, C.; Madej, T.; Marchler-Bauer, 

A.; Marchler, G. H.; Mazumder, R.; Nikolskaya, A. N.; Rao, B. S.; Panchenko, A. R.; Shoemaker, B. 

A.; Simonyan, V.; Song, J. S.; Thiessen, P. A.; Vasudevan, S.; Wang, Y.; Yamashita, R. A.; Yin, J. J.; 

Bryant, S. H. MMDB: Entrez's 3D-structure database. Nucleic Acids Research 2003, 31, 474-477. 


345

E. Cloning of T. thermophilus DNA Photolyase 

The energy requirements of extracting DNA photolyase directly from T. 

thermophilus are potentially prohibitive. The cost differences associated with 

performing a large scale fermentation of an organism that grows optimally at over 

65 °C versus an organism such as E. coli which grows quite well at 35 to 37 °C are 

obvious. In addition to this, there are so many tools available for recombinant 

plasmid cloning in E. coli that there was no question involved as to what would be 

the most facile method of isolating large amounts of T. thermophilus DNA 

photolyase. A pET-24d(+) plasmid system was chosen for this project due to its ease 

of use and well documented success rates. 29,30 This plasmid vector, with its 

multitude of restriction endonuclease sites, kanamycin resistance and IPTG 

(isopropyl--D-thiogalactopyranoside) induction, allows for flexibility in PCR 

primer design and easy transformation screening (Figures # and #). 

Figure #: Map of pET plasmid system. (Novagen) 

29 Moffatt, B.A. and Studier, F.W. Use of bacteriophage T7 RNA polymerase to direct selective highlevel 

expression of cloned genes. J. Mol. Biol. 1986, 189, 113–130. 

30 Mierendorf, R.; Yaeger, K; Novy, R. The pET System: Your Choice for Expression inNovations 

1994, 1, 1-3. 


346

The pET-24d(+) plasmid was chosen for this work and varies from the pET-24a(+) 

only through substitution of an Nde I site for a Nco I. 

1 2 3 4 

Figure #: Transformation screening via antibiotic resitance. 1.) Host E. coli cells 

with no plasmids are combined and transformed with recombinant plasmid 

containing target gene (phr) and antiobiotic resistance (kanamycin). 2.) Cells with 

and without recombinant plasmid are plated onto media containing antibiotic 

(kanamycin). 3.) Only cells containing recombinant plasmid are grown on 

antibiotic containing media. 4.) Colonies are harvested and plasmids analyzed for 

gene insert. 

After deciding on a plasmid vector, the sequence of the gene to be cloned had 

to be located in order to efficiently design PCR primers. Since the entirety of the T. 

thermophilus genome had been previously sequenced, 23 the phr gene sequence was 

easily located through the NCBI (National Center for Biotechnology Information) 

genomic database. 31 The phr gene of T. thermophilus contains the genomic 

information necessary for the DNA photolyase protein. It spans 1263 base pairs, 

with the ATG “start” codon at position 1 and the TAG “stop” codon at position 

1261. This particular gene has a G+C content of 72.9%; higher than the average 

genomic G+C content of 69.4% (Figure #.). 23 

1 atgggccccc ttctcgtctg gcaccggggc gacctccgcc tccacgacca cccggccctc 

61 ctggaggccc tggcccgggg gccggtggtg ggcctcgtgg tcctggaccc caacaacctg 

121 aagaccaccc cgaggcggcg ggcctggttc ctggaaaacg tccgggccct gcgggaggcc 

181 taccgggccc ggggcggggc cctttgggtc ctggagggcc tcccttggga gaaggtgccc 

241 gaggcggcga ggcggcttaa ggccaaggcc gtctacgccc tcacgagcca caccccttac 

301 ggccgctacc gggacgggag ggtgcgggag gccctccccg tgcccctcca cctcctcccc 

361 gccccccacc tcctcccccc cgacctcccc cgggcctacc gggtttacac cccctttagc 

421 cgcctctacc ggggggccgc cccgcccctt ccccctcccg aggccctgcc caaggggcca 

481 gaggaggggg aaatcccccg ggaagacccg gggcttcccc tccccgagcc gggggaggag 

541 gcggccctcg cggggcttcg ggccttcctc gaggccaagc tcccccgcta cgccgaggag 

601 cgggaccggc tggacggaga ggggggctcg aggctctccc cctacttcgc cctaggggtc 

661 ctctccccca ggctcgccgc ctgggaggcg gaaaggcggg gcggggaggg agcgaggaag 

721 tgggtggcgg agctcctctg gcgggacttc tcctaccacc tcctctacca cttcccctgg 

781 atggcggaaa ggcccctgga cccgaggttc caggccttcc cctggcagga ggacgaggcc 

841 ctcttccaag cttggtacga ggggaagacg ggcgtccccc tggtggacgc cgccatgcgg 

901 gagctccacg ccacgggctt cctctccaac cgggcccgga tgaacgcggc ccagttcgcg 

31 NCBI Homepage. http://www.ncbi.nlm.nih.gov/ (accessed Mar 2007). 


347

961 gtgaagcacc tcctcctccc ctggaaaagg tgcgaggagg ccttccgcca cctcctcctg 

1021 gacggggacc gggcggtgaa cctccagggc tggcagtggg cggggggcct gggggtggac 

1081 gccgccccct acttccgggt cttcaacccg gtgctccagg gggaaaggca cgaccccgag 

1141 gggaggtggc ttaagcgctg ggccccggaa tacccctcct acgcccccaa ggaccccgtg 

1201 gtggacctgg aggaggcgag aaggcgctac ctgcgcctgg cgagggatct cgcccgaggg 

1261 tag 

Figure #: Genomic sequence of DNA photolyase encoding phr gene of T. 

thermophilus. 

Since the phr gene can not be purchased already amplified and isolated for 

this particular application, PCR primers must be designed to complement the DNA 

on either side of the target material from the bulk of T. thermophilus genomic DNA 

(ATCC -American Type Culture Collection). The goal is to “bookend” the desired 

genomic material (phr gene) and only that from the entire genome of the organism 

in question. To include these guidelines there are also accepted practices involved 

into designing the estimated melting temperature of the primers as well as their 

length. If a primer has too low of a melting temperature, than it will not correctly 

anneal itself to the desired sequence. Additionally, if a primer is too short or long, it 

may not bind specifically enough or you may observe self annealing behavior, 

respectively. A number of tools have been created to predict the melting point of a 

particular primer sequence. 32,33 A melting point (Tm) of over 60 °C is advisable for 

most PCR protocols. The primers were designed to incorporate the “start” and 

“stop” codons as well as Nco I and Xho I restriction endonuclease sites for facile 

ligation into the pET-24d(+) plasmid vector (Figure #.). 

GCGCATGCCATGGGCCCCCTTCTCGTCTGG 

Start Codon 

TACCCTCGAGTGTACCCCCGCCTACCCTGC 

XhoI Site 

NcoI Site 

Stop Codon 

Figure #: PCR primers with incorporated restriction endonuclease sites 

(Invitrogen). Each primer is 30 bp (base pairs) in length. 

32 Schutz, E.; von Ashen, N. Spreadsheet Software for Thermodynamic Melting Point Prediction of 

Oligonucleotide Hybridization with and without Mismatches. Biotechniques 1999, 27, 1218-1222, 

1224. 

33 Chavali, S.; Mahajan, A.; Tabassum, R.; Maiti, S.; Bharadwaj, D. Oligonucleotide Properties 

Determination and Primer Designing: A Critical Examination of Predictions. Bioinformatics 2005, 

21, 3918-3925. 


348

All PCR procedures were performed on an Eppendorf Mastercycler Personal 

thermocycler. PCR methods were not published in any of the relevant publications 

pertaining to T. thermophilus DNA photolyase. A typical method and standard 

concentration loadings were used for the first series of experiments (Tables # & #). 

PCR Method 

Step 

# Temp. (°C) 

Duration 

(min) 

Purpose 

1 95 1 Initial Melt 

2 95 0.5 Melt 

Repeat 

25 

} 

3 68 0.5 Anneal 

4 72 1 Polymerization Times 

5 4 Hold Storage 

Table #: PCR thermocycler initial experimental parameters. 

PCR Tube Loadings 

Contents Loading Description 

Tphr1 1 L Primer 1 

Tphr2 1 L Primer 2 

dNTP 4 L Nucleic Acids 

Vent 1 L DNA Polymerase 

10X 

Buffer 10 L Buffer 

Target 5 L T. thermophilus DNA 

Water 78 L 

Total 

100 L 

Table #: PCR initial tube loadings and contents. 

The products of the PCR procedures were visualized via 1% agarose gel 

electrophoresis in 20% TBE (tris-borate ethylenediaminetetraacetic acid). The 

EDTA is used as a chelating agent. The addition of ethidium bromide to the agarose 

gel solution negated the use of a secondary staining step. A successful PCR 

procedure would be illustrated through the presence of a nucleic acid band at the 

approximate molecular weight of the target material (~1300 bp). A molecular 

weight marker (1 Kb Plus DNA Ladder – Invitrogen) was a used to estimate 

molecular weights of the processed bands. The gels were run at 200 V at 


349

approximately 1 mA. Despite multiple attempts 

with varying concentrations, no identifiable gene product was produced (Figure #.). 

Figure #: Agarose gels of unsuccessful PCR products. 

No gene product can be found at the desired molecular weight. 

Left lane of all three gels is 1 Kb Plus DNA Ladder molecular weight marker. 

It became apparent that a typical PCR procedure was not going to be 

successful with this particular genome. Attempts were made at increasing the 

concentrations of both the genomic DNA and the Taq polymerase in the PCR 

procedure with no success. Divalent magnesium in the form of magnesium sulfate 

(MgSO 4 ) was also added in hopes of increasing the activity of the polymerase, with 

similar unsuccessful results. Finally, it was surmised that the melting temperature 

in the procedure may still not be high enough to separate the double stranded DNA; 

therefore preventing the primers from annealing. By increasing the melting 

temperature to 99 °C, and lowering the loading of the target DNA to only 1 L, a 

nucleic acid band at the appropriate molecular weight was finally obtained (Figure 

#.). Correlations between melting temperature and G+C content are well known. 34 

But it is now apparent to this author that a margin of only a few degrees centigrade 

can be the difference between success and failure when working with a genome with 

such unique thermal properties. 

34 Marmur, J.; Doty, P. Determination of the base composition of deoxyribonucleic acid from its 

thermal denaturation temperature. J. Mol. Biol. 1962, 5, 109-118. 


350

Figure #: 1% agarose gel of PCR product showing presence of a 

nucleic acid band of approximately 1300 bp. 

With the phr gene amplified, the band was extracted directly from the gel 

using a NucleoTrap® Gel Extraction Kit. This kit takes advantage of the fact that 

DNA will adhere to glass beads at pH’s of 8.5 or higher. 35 The agarose gel is 

solubilized and the silica beads (with DNA attached) are centrifuged out of the 

resulting solution. 

With the target DNA ready, the pET-24d(+) plasmid was be prepped for 

ligation. This would constitute being digested by our chosen restriction 

endonucleases. By digesting the plasmid with Xho I and Nco I, it will give the 

plasmid the required “sticky ends” for proper insertion and ligation with the 

amplified phr gene material. In a total reaction volume of only 10 L, the pET- 

24d(+) plasmid as received was combined with a buffered solution containing both 

Xho I and Nco I (New England Biolabs) restriction endonucleases. The reaction was 

incubated at 37 °C for 1 h. A 1% agarose (low melting point) gel was run to 

determine the effectiveness of the digestion. The undigested, supercoiled plasmid 

was run alongside the digested plasmid as a control, and demonstrates the 

effectiveness of this particular procedure (Figure #.). The mobility of the linear 

DNA in the agarose gel clearly contrasts with the supercoiled plasmid. The 

supercoiled plasmid is hindered by its bulkier “secondary” structure and moves 

more slowly than its linear counterpart through the agarose gel media. This 

phenomenon visualizes itself as an apparent difference in molecular weight; despite 

the fact that both samples are indeed identical in sequence. 

35 Joly, E. Purification of DNA fragments from agarose gels using glass beads. Methods in molecular 

biology 1996, 58, 237-240. 


351

Figure #: 1% agarose gel showing difference between digested, linear plasmid 

(middle lane) versus undigested, supercoiled plasmid (right lane). 

The digested plasmid was then purified via the same NucleoTrap® extraction 

procedure as was the PCR gene product. The purified PCR gene product was then 

digested exactly as the plasmid, with the addition of a heat inactivation step. This 

digested target DNA was then combined with the digested plasmid for ligation. 

A T4 DNA ligase (New England Biolabs) was used for the ligation. Though 

the procedure recommended was 1 h at 16 °C; upon transformation of plasmid into 

competent cells (Novagen Competent Cells Singles Kit), no colonies were present via 

kanamycin resistance screening. This result suggested a less than optimal ligation 

procedure. An overnight incubation at 16 °C yielded multiple colonies after 

transformation and screening via kanamycin resistance. 

An overnight shaker flask fermentation of several of these colonies was 

performed to give high yields of plasmid for analysis. A Nucleobond® High Copy 

Plasmid Purification Kit was used. Subsequent digestion of these plasmids to 

analyze for the presence of our phr insert yielded a startling discovery; the presence 

of an insert of approximately 550 bp (Figure #.). While this gel proved that all of 

our procedures worked, there was a problem with the insert. Processing our phr 

gene sequence through a restriction mapping program 36 yielded an Xho I site at 

position 709, which would yield an insert of approximately the size observed. Eco 

RI was not present in the gene however and was present on the pET-24d(+) plasmid. 

A simple substitution of one of the original primers (Figure #.) could ultimately 

produce the desired plasmid insert. 

36 Biotools @ UMass Medical School – WWWtacg. 

http://biotools.umassmed.edu/tacg/WWWtacg.php (accessed Aug 2005). 


352

Figure #: Digestion of recombinant plasmids showing inserts of ~550 bp. 

TACCCTCGAGTGTACCCCCGCCTACCCTGC 

XhoI Site 

TACCGAATTCTGTACCCCCGCCTACCCTGC 

Eco RI Site 

Figure #: Original primer (top). Redesigned, substituted primer (bottom). 

With new primers designed, the PCR procedure was repeated with the new 

primer sequence and ultimately the analysis of the recombinant plasmid showed the 

presence of an insert of the correct molecular weight (Figure #.). What is important 

to notice is that the restriction sites on the primers are “overhanging” the genomic 

DNA; they are not complementary at that point. The completion of a full PCR cycle 

ultimately incorporates the restriction sites into the target material and makes it 

functional upon digestion for plasmid ligation. This allows for the design of any 

type of suitable restriction site into target material, for easy ligation into the desired 

transformation vector. Two different restriction endonuclease types are used on the 

ends of the target material for the obvious reason of avoiding self ligation of “sticky 

ends” of both the plasmid and target DNA material. 


353 

Stop Codon 

Stop Codon

Figure #: Digestion of recombinant plasmid showing plasmid without insert (Lane 

1) and plasmid with insert of ~1300 bp; amplified using redesigned primer sequence 

(Lane 2). 

With a seemingly successful recombinant plasmid ligation, it was time to 

attempt an induction on this cell line to begin synthesis of the desired protein. This 

was accomplished using LB (Luria-Bertani) broth containing kanamycin to promote 

growth of only cells containing the recombinant plasmid. Performed on a 50 mL 

scale, these cells were grown overnight to stationary growth phase and subsequently 

inoculated into sterile broth and grown to log phase (OD ~ .5 / A @ 600nm) and 

induced via IPTG (Figure #.). The IPTG induces the lacZ gene which is responsible 

for the production of the desired DNA photolyase in the pET-24d(+) plasmid system. 

After induction the cells were fermented an additional two hours and subsequently 

frozen for later lysis. 


354

Figure #: Idealized Bacterial Growth Curve. Log phase growth can be extended 

(dashed line) through the use of a biofermentation reactor. The reactor yields the 

ability to monitor and adjust fermentation conditions (pH, dissolved O 2 , 

temperature, etc.), as well as the sterile introduction of essential nutrients. 

Cell lysis was accomplished using a handheld sonicator probe (Branson 

Sonifier 450) while keeping the cells on ice to moderate temperature variations. The 

lysate was spun to separate from cellular debris. The supernatant, now containing 

the majority of the soluble cellular proteins was subjected to a very simple 

purification step. Since the bulk of the proteins in the lysate were native to the E. 

coli host cell, a heat treatment of 10 min at 70 °C was enough to denature and 

precipitate most of host proteins while leaving the T. thermophilus DNA photolyase 

unaltered. 25 A SDS-PAGE gel of the treated and untreated lysate illustrates the 

presence of a higher concentration of protein in the ~ 48 kDa range in the lysate of 

the induced cells. This is indicative of the production of the desired protein (Figure 

#.). 


355

Figure #: SDS-PAGE (NuPAGE® Novex Bis-Tris) gel showing un-induced versus 

induced (left to right) in pairs (12mL loading). Lane 1 is a protein molecular weight 

marker (SeeBlue® Plus2). First pair is lyaste without treatment. Second pair is 

heat treated lysate with removal of denatured proteins. Arrow shows increased 

concentration of protein in induced lysate of ~ 48 kDa. 

F. Testing and Analysis 

Analysis of this lysate for activity was performed in the same fashion as with 

the commercial E. coli DNA photolyase. A non-induced cell lysate, containing the 

same recombinant plasmid was used as a control. (Figure #). 

Figure #: 1:4 VBT-TEQ coated PET film after exposure to un-induced control 

lysate (left) and induced lysate (right). Spots indicate 4, 8 and 12 minutes of 

exposure (left to 

right). 


356

Table #: Activity of T. thermophilus DNA photolyase as a function of toning dye 

saturation. 

The control lysate’s activity on the film could be attributed to E. coli DNA 

photolyase. Despite the minor activity detected in the control, the activity of the 

induced lysate is clearly more pronounced (Table #). In addition to these positive 

results it must also be noted that this lysate was stored at roughly 4 °C, and was 

found to have this same level of activity after several months. This is a stark 

contrast to the E. coli photolyase which needed to be stored at -80 °C. It was these 

encouraging results that prompted the testing of this lysate on other 2 + 2 

photodimerizing polymer systems being synthesized in our laboratories. All of the 

analysis of DNA photolyase and its activity on crosslinked photoimages, had only 

been performed on VBT with the vinylbenzyltriethylammonium chloride (TEQ) 

cationic comonomer. VBT polymers with N-butyl-N,N-dimethyl-(4- 

vinylbenzyl)ammonium chloride (BDMQ) cationic comonomer and 

vinylphenylsulfonate (VPS) anionic comonomer in varying ratios were exposed to 

lysate as previously (Figure #.). 


357

a.) 

b.) 

Cl 

O 

S 

O 

Na 

N 

O 

Figure #: a.) N-butyl-N,N-dimethyl-(4-vinylbenzyl)ammonium chloride (BDMQ) 

cationic monomer. b.) vinylphenylsulfonate (VPS) anionic monomer. 

Multiple combinations of comonomers and comonomer ratios were found to 

be susceptible to the enzymatic decrosslinking. The cationic copolymers appeared to 

be the most susceptible, while the anionic appeared slightly more resistant. An 

increase in anionic charge concentration appeared to negatively effective enzymatic 

activity (Table #.). 

Enzyme Activity on Various VBT Copolymers 

Comonomer Molar Ratio(s) Activity 

Cationic 

TEQ 4 Yes 

TEQ 8 Yes 

TEQ, BDMQ 2,6 Yes 



Anionic 

VPS 1 Some* 

VPS 2 Yes 

VPS 4 No 

Table #: Lysate activity on various copolymers and terpolymers of VBT. The VBT 

molar ratio was kept constant at 1. * - Area of exposure not clearly defined, but 

difference in toning agent color density noted. 

With several different comonomers showing decrosslinking activity upon 

exposure to the lysate, experiments proceeded to test a system using a different 

crosslinking monomer than the well explored VBT (Figure #.). While VBT has 


358

proved to be quite versatile in its potential applications 37 , a monomer with a 

more atom efficient synthesis, decreased feedstock costs, as well as the 2 + 2 

photodimerization characteristics would be quite valuable on a larger scale of 

polymer production. 

O 

N 

N 

Figure #: 4-vinylbenzyl pyridone (VBP 4 ) and 2-vinylbenzyl pyridone (VBP 2 ). 

O 

The vinylbenzyl pyridone polymers have preliminarily shown by another 

member of our research group to be easier to synthesize in the lab, and with a 

greater yield than the vinylbenzyl thymine polymers. 2-Pyridones are known to give 

a 4 + 4 photocycloaddition product predominantly, however 2 + 2 has also 

been shown as a minor product. 38 Their copolymerization with the previously 

mentioned anionic (VPS) monomer yielded a polymer was able to be coated, 

irradiated and toned in the same fashion as the thymine based polymers. Upon 

exposure to the T. thermophilus DNA photolyase containing lysate, positive results 

were observed (Figure #.). 

The structure-activity relationship between this enzyme and its 

substrates is illuminated in several ways by these results. The 4 + 

4photocycloaddition product should be unaffected by this enzyme. Therefore the 

removal of the 2 + 2crosslinks by the enzyme, despite them being a potentially 

minor product of irradiation, is adequate to resolubilize this polymer. Though the 

E. coli DNA photolyase was not tested on the pyridone based substrates, it is 

important to note that even with its more compact and restrictive active site, the T. 

thermophilus DNA photolyase is able to remove the majority photoimage. This 

result points towards a less specific or more “promiscuous” enzymatic specificity. 

37 El-Hayek, R.; Warner, J. C. Bacteriostatic Polymer Film Immobilization. J. Bio. Mat. Res. 2006, 

79(A), 874-881. 

38 Sieburth, S. McN.; Lin, C. Intermolecularly Selective [4+4] Photocycloaddition of 2-Pyridone 

Mixtures. Tetrahedron Letters 1996, 37, 1141-1144. 


359

a.) 

b. 

Figure #: VBP:VPS 1:2 films coated on X4C1 PET film and exposed to lysate: a.) 

VBP of the 2-substituion position, b.) VBP of the 4-substituion position. Each film 

consists of 3 exposure locations. All 3 locations are the same length of exposure (10 

minutes). Anionic films were toned with methylene blue. 

Though the ability of the lysate to resolubilize the vinylbenzyl pyridone 

polymer photoimage is apparent, it appears slightly less effective on this substrate 

than the vinylbenzyl thymine (Figure #.). The remaining vinylbenzyl pyridone 

polymer in the lysate exposed areas of the film may be attributed to non-solubilized 

4 + 4crosslinks. 

Another well known 2 + 2 cycloaddition system is the cinnamates. 39 The 

cinnamates were functionalized with vinyl groups and polymerized in a similar 

fashion to the vinylbenzyl thymine by a member of our research group to render 

them water soluble. They were then shown to have crosslinking and photoimage 

properties similar to the previously listed polymers (Figure #.). 40 

39 van Paesschen, G.; Janssen, R.; Hart, R. Cyclopolymerization of Vinyl Trans-Cinnamate. 

Makromolekulare Chemie. 1960, 37, 46. 

40 Cannon, A. S.; Warner, J. C. (4-Vinylbenzyl)cinnamate: A Useful Monomer for Water-Soluble 

Photopolymers. Journal of Macromolecular Science, Part A: Pure and Applied Chemistry 2005, A42, 

1507-1514. 


360

1 

n 

Cl 

O 

NEt 3 

O 

Figure #: (4-Vinylbenyl)cinnamate copolymerized with TEQ to render the polymer 

water soluble. Upon irradiation with UV-light (254 nm) the cinnamates undergo a 

2 + 2cycloaddition to yield a cyclobutane “crosslink.” 40 

To further test enzyme activity and substrate versatility, a 1:2 copolymer of 

(4-vinylbenyl)cinnamate and vinylbenzyltriethylammonium chloride was coated 

onto a PET substrate as previously and irradiated to yield a photoimage. The 

photoimage was exposed to the lysate in three locations for 10 minutes. In addition, 

lysate from a K-12 E. coli strain that did not carry the recombinant plasmid was 

exposed to the film as a control (Figure #.). 

a.) 

b. 

Figure #: (4-Vinylbenzyl) cinnamate polymer (1:2 VBC:TEQ) photoimage on X4C1 

PET film and exposed to a.) T. thermophilus DNA photolyase containing lysate and 


361

.) control lysate from K-12 E. coli without 

recombinant plasmid. Striations are artifacts of the draw down coating. 

The difference in activity between the recombinant E. coli lysate and the 

control lysate was clearly illustrated through this assay. Qualitatively, the lysate 

showed the most activity on the vinylbenzyl thymine substrate when compared to 

the pyridone and cinnamate based polymers. However, all of the tests demonstrated 

increased activity versus a control lysate. 

To further explore the intriguing properties of this protein on the previously 

mentioned substrates and potentially others, larger amounts of material would be 

necessary. With this in mind, efforts were made to determine feasibility of enzyme 

production on a much larger scale. Methods of lysis, purification, as well as issues 

concerning cell and protein concentration would need to be readdressed in the 

transfer to a larger scale. 

G. Scale-Up 

A 13 liter biofermenter (New Brunswick Scientific– Model SF-116) was used 

to grow a more substantial quantity of the T. thermophilus DNA photolyase 

producing E. coli cells. Growth temperature was modulated to 35 °C, and pH was 

regulated to 7.2 via .1M NaOH solution feedback loop. Glucose was added as 

necessary; typically when dissolved oxygen levels dropped below 70%. The cells 

were induced with IPTG at an OD (600 nm) of 21 and fermented an additional 2 

hours. The OD at the end of the fermentation was approximately 42; yielding an 

average of 108 g/L wet cell weight and therefore a total weight of approximately 1.5 

kg of cells per fermentation. The presence of a highly concentrated protein of 

approximately 45 kDa after IPTG induction points to the success of this procedure 

(Figure #.). 


362

Figure #: SDS-PAGE (NuPAGE® Novex Bis-Tris) gel showing the presence of a 

high concentration of protein in induced lysate with molecular weight 

corresponding to T. thermophilus DNA photolyase. Lane 1 is a molecular weight 

marker. Lane 2 is heat-treated, uninduced lysate of OD ~ 21. Lane 3 is heat-treated, 

IPTG induced lysate of OD ~ 42. 

Lysis for this quantity of cells required a different mechanism. The 

sonication method used for the initial experiments would be prohibitively time 

consuming and inefficient at this volume. A microfluidizer (Microfluidics Corp.) 

was used for the large scale lysis. Using a high pressure hydraulic pump, the 

microfluidizer forces the cells through a customizable pair of interaction chambers 

consisting of different pathways, path diameters, and chamber materials (ceramic, 

diamond, etc.), at pressures up to 30,000 psi. The resulting pressures and shear 

stress are more than adequate to lyse the relatively weak cell wall of the E. coli cells. 

Depending on the type of chambers, pressure utilized, and number of passes 

through the instrument however, a variety of particle sizes and ranges can be 

present in the resulting lysate (Table #.). 

Though the data shows that configurations including the “Z” type 87 m 

diamond interaction chamber yield lysate with the lowest mean particle size (4 and 5 

in Table #.), operations were plagued with constant plugging which resulted in slow 

lysis rates. Configurations including the “Y” type 200 m and 75 m ceramic 

interaction chambers (6,7 and 8 in Table #.) yielded respectable results versus the 

unlysed cells while avoiding the plugging found when using the “Z” type chambers. 

This added up to a far more efficient, large scale lysis operation procedure. 


363

Microfluidizer Lysate Particle Size Analysis 

Mean 

(m) 

Median 

(m) 

S.D. 

(m) 

Figure #: SDS-PAGE (NuPAGE® Novex Bis-Tris) gel showing three fractions of 

flowthrough of the ion exchange media (Toyopearl, Super Q-650M). Lane 1 is a 

molecular weight marker. Lane 2 is heat-treated, IPTG induced lysate with a 

prominent band in the T. thermophilus DNA photolyase range. Lanes 3-5 are 

column flowthrough illustrating the presence of protein in that same 45 kDa 

molecular weight range. 

Although the ion exchange resin appeared to be capable of isolating the 

desired protein from the bulk heat treated lysate, analysis and testing of these 

fractions on VBT films of multiple varieties showed no apparent decrosslinking 

activity. Speculation that the enzyme may have become oxidized during the 

purification was addressed with the addition of -mercaptoethanol to reduce the 

enzyme back to its active state. The results of the activity assay remained 

unchanged. The loss of the FAD cofactor could be responsible for the loss of activity 

and will be the subject of future work. 

I. Conclusions and Future Work 

Using bioinspiration as a model for materials design has led to the ability of a 

thymine derived photopolymer to be degraded and potentially reused using two 

different enzymatic systems. The T. thermophilus DNA photolyase system has 

proven to be effective, robust, and scaleable. The ability of the enzyme to work on 

multiple substrates increases its value as a synthetic tool. To be able to store this 

lysate at only normal refrigeration temperatures increases its potential to be utilized 

over a wide variety of applications. It has also been shown that this lysate can be 

produced in kg quantities using only basic biofermentation equipment. 


365

Though purification through conventional 

means to obtain pure enzyme has proven difficult, a given application may not 

require such measures. However, future work must be performed to elucidate the 

reasons for this loss of activity through purification. In addition, the creation of 

sizeable VBT based materials will give quantifiable means to determine the 

feasibility of reusing the VBT after it has been enzymatically decrosslinked. This is 

currently limited by VBT’s propensity to decompose before melting; making 

extrusion and molding on a large scale difficult. There is currently ongoing research 

in this area in our laboratory. 

Ultimately, the ability to create a material using a thymine based, non-toxic 

polymer, while having an enzymatic mechanism to degrade it back to its original 

state for reuse is an example of green chemistry in its purest form. 


366

28. PHOTONICS CENTER 

2006/2007 Report 

1) Mission Statement 

The Photonics Center at the University of Massachusetts Lowell was 

established in 1994. The Center's mission is to support regional industries, and 

start-ups; train undergraduate and graduate students; perform industrial and 

governmental sponsored research; and form a core of design and fabrication 

technology to support various University initiatives requiring innovative 

semiconductor-based photonic and nanoelectronic device technologies. 

2) Strategic Goals and General Description 

Goals 

● Train undergraduate and graduate students in both the theory and application of state-of-the-art 

photonics, optoelectronics, and nanophotonics/electronics 

● Seek and be granted Federal support for research, development, technology 

conversion and improved manufacturing processes in photonics and nano 

materials for photonic and electronic applications 

● Carry out research into scientific and engineering concepts in photonic 

technologies; this will include the preparation and characterization of new 

materials, the development of new industry compatible processing 

technologies, and the evaluation of photonic and optoelectronic devices, 

systems, and networks 

● Establish a regional resource center in photonics, offering materials, design 

and fabrication technology and system support and provide technical 

expertise and support for start-up companies. 

Description 

The Center is located in a modern 9,000 sq. ft. building located at 720 Suffolk 

Street, Lowell Massachusetts (the Ames building). Currently optics and 

characterization laboratories, an 800 sq. ft. class 100,000 clean room with wet 

stations, a computer room with internet access, a conference room, and office 

areas are operational. Fabrication equipment that has been installed in the clean 

Photonics Center 

367

oom includes photolithography equipment, a rapid 

thermal annealing system, thermal evaporator, e-beam evaporator and solid 

source molecular beam epitaxy system. A new nanomechanical analyzer 

purchased with a 2004 DURIP equipment grant was installed in July 2004 and a 

new laboratory that houses the Center's Riber 3200 MBE machine and the Veeco 

MBE system donated by Corning Lasertron was completed in January 2005. A 

New Tencor IQE surface profiler was installed in July 2006. A new atomic 

hydrogen cleaning gun and Veeco valved Sb 2 cracker source will be purchased 

soon for the Riber 3200 System under a 2006 DURIP grant. 

Facility Capabilities: 

Device Design - The Center's modeling group is actively compiling a library of 

University developed software packages and commercial software 

packages for modeling nanoelectronic, photonic and optoelectronic 

devices. 

Maskmaking - L-Edit maskmaking software along with T-Spice and CMOS 

libraries are available for device layout as is Autocad. 

Crystal Growth - Riber 2300 Series, Riber Series 3200, and Veeco Gen II solid 

source molecular beam epitaxy machines. The systems are currently 

growing InGaAlAs materials for quantum cascade Terahertz lasers and 

long wavelength quantum dot detectors and GaInAlSb materials for 

avalanche photodiodes and antimonide substrate polish qualifications. 

Thickness control -monolayer. 

Etching - Wet etching stations and bromine ion-beam-assisted etching. 

Annealing - Rapid thermal annealing system. 

Thin Films - Metals and dielectrics using thermal evaporation and electron 

beam evaporation . 

Photolithography - UV flood exposure (app. 1.0 µm line widths, Tamarack). 

Kasper contact printer, spinners, ovens, etc. 

Sputtering System - A custom system for DC, pulsed DC, and RF sputtering is 

near completion. 

Hall Measurements - Varian magnet set up with Hall station. 

I-V Probe Station - Probe station with curve tracer and parameter analyzer. 

Photoluminescence - Complete photoluminescence laboratory with 1 and 1/4 

meter spectrometers and variety of laser sources and detectors. 500nm to 

6 micron wavelength range covered by instruments. Systems can also be 

used to characterize waveguides and diode lasers. 

Holography - Grating and cross grating lithographys for producing 

nanostructures . 

Ti-Sapphire Laser - Argon-ion pumped tunable Ti-Sapphire laser system with 

wavelength monitoring system. 

C-V Profiler - C-V profiler station. 

Ellipsometry - Ellipsometer station. 

Bonding - Wedge and Ball Bonders, pull tester station. 

SEM - Amray 1200 Series scanning electron microscope with EDAX and Joel 


368

field emission SEM 

TEM - Lattice imaging TOPCON TEM 

3) Research Groups and Focus Areas 

Theory and Modeling Group: The Center’s device theory and modeling group is 

headed by Prof. Aram Karakashian. Libraries of canned and studentgenerated 

software are maintained in order to support center activities. The 

Center’s approach to thesis work requires all students to work on both 

theory and experiment. The group’s current focus is on terahertz lasers, 

high-speed photodetectors, and micro-electrical-mechanical membranes. 

Experimental Group: The Experimental Group is headed by Prof. William 

Goodhue. Current interests include: 

● Quantum dot nanostructures 

● Optical-optical and optical-electrical spatial light modulators 

● III-V MBE Technology, particularly GaSb and other 0.61 nm III-V 

materials, particularly as they apply to avalanche photo diode 

technology 

● Surface States in Quantum Wells 

● Ohmic Contacts to Antimonide based semiconductors 

● Integrated Waveguide Optics 

● Frequency Selective Materials, Photonic Crystals and Metamaterials 

● Surface-States and gas cluster ion beam smoothing of GaSb 

● Point Defects in Semiconductors 

● Diode, Quantum Cascade, and SHOC Lasers 

● Semiconductor Etching Techniques 

● Fabrication Techniques 

4) Associated Personnel 

Director: 

Prof. William Goodhue, Physics Dept., Molecular Beam Epitaxy, 

Devices, and Advance Fabrication, (978) 934-3785 

William_Goodhue@uml.edu 

Co-Directors: 

Prof. Aram Karakashian, Physics Dept., Optical Properties of Thin 

Films, Optoelectronic Devices and Radiation Damage in Optical 

Materials, (978) 934-3487. Aram_Karakshian@uml.edu 

Dr. Jin Li, Photonics Center, Physics Dept. Photonic Crystals, Diode 

Lasers, Quantum Cascade Lasers, (978) 934-3982. Jin also serves 

as the laboratory manager. Jin_Li@uml.edu 

Faculty/Staff 

Prof. Alkin Akyurtlu (ECE) - Metamaterials (978-934-3336) 


369

Prof. Craig Armiento (ECE) - Optical Networks, 

Device Modeling, and Optics (978-934-3395) 

Dr. Andrew Gatesman, Submillimeter-Wave Technology Laboratory, 

Modeling of Frequency Selective Surfaces, (978) 458-3807 

Prof. Robert Giles (Physics), Submillimeter-Wave Technology 

Laboratory, Modeling of Dielectric Materials, (978) 459-3807 

Prof. Xuejun Lu (ECE) Photonics, Security Using Photonics (978-934- 

3359) 

Prof. Jerry Waldman (Physics) Submillimeter-Wave Technology 

Laboratory, Director, (978) 459-3807. 


370

5) New Faculty Affiliations (last three years) 

The Photonics Center has been very involved with helping new faculty 

establish themselves on the UMass Lowell campus. The following new faculty 

members have been working with the Center over the past year or two: 

Prof. Hongwei Sun (ME) - Dr Sun and Prof Goodhue have recently teamed 

with Physical Sciences, Inc. to win a Phase II STTR in the area of GaAs 

wafer bonding. 

Prof. Joel Therrien (ECE) - Drs Therrien, Akyurtlu, and Goodhue are 

collaborating on functionalizing silicon carbide nanoparticles for 

metamaterial applications 

6) Associated Students and Student Support 

Student Research Status 

Paul Alcorn Antimonide Fabrication (MA) RA G 

Neelima 

Chandrayan Devices (Ph.D.) TA, Summer RA 

G 

Robert Ehasz Fabrication(Physics) UG 

Michael Grzesik Avalance Photodiodes (Ph.D.) G 

RA 

G 

Bahareh Haji-saeed Phase Correction (Doctorate) RA 

Graduated 

Vaibhav Mathur MEMS Devices (Ph.D.) TA/RA G 

(Finished MA) 

Xefeng Quian Quantum Dot Devices (Ph.D.) 

RA 

G 

Troy Ribaudo MEMS (MA) TA/RA G 

Joseph Shahbazian Metamaterials (Ph.D.) Summer RA G 

Krongtip Termkoa Wafer Fusion (Ph.D.) Fellow, Summer RA G 

Adam Tibold Thermoelectrics (MA) RA G 

Shivashankar R. 

Vangala Photodiode growth (Ph.D.) RA G 

Beihong Zhu Terahertz Laser Technology (Ph.D.) RA 

Graduated 

(UG -undergraduate student, G - graduate student) 

Note: All undergraduates received part time support. 


371

7) 2006/2007 Funded Projects 

Development of Long Wavelength Technologies and Devices: Graduate 

student Mike Grzesik, graduate student Shiva Vangala, undergraduate students Brian 

Kretcka and Paul Alcorn, Prof. Karakashian, Prof. Armiento, and Prof Goodhue are 

working with Hanscom SNHC to develop high speed long wavelength photodetectors. 

The Center has set up novel MBE systems for the project. Sponsor - AFRL/SNHC. 

MEMs Based Spatial Light Modulators: The Center is working with Hanscom 

SNHC to develop an optical-optical micro-mechanical based spatial light 

modulator. Students involved include Xefeng Qian, Danniel Potter, and 

Bahareh Haji-saeed. Sponsor - AFRL/SNHC. 

Development of Waveguiding Structures in the Visible Regime Using Nanoscale 

Metamaterials: The Center has begun work to develop visible waveguides with 

Prof Akyurtlu (ECE) with the goal of developing nanoscale metamaterials 

that work in the visible portion of the electromagnetic spectrum. Sponsor – 

AFRL. CFCI funds were used to seed this project. 

Development of Magnetically Based Homogeneous Metamaterials: Profs. Akyurtlu 

and Goodhue are working on developing a new type of homogenious 

metamaterial that can be tuned in a magnetic field. Sponsor - NSF 

THz Sources, Optics and Detectors: The Center is being funded from the Army 

through its sister laboratory, The Submillimeter-Wave Technology laboratory to develop 

quantum cascade THz lasers, THz output couplers, THz quantum dot detectors and THz 

photonic crystal-based devices. Dr. Jin Li, Prof Goodhue and graduate students Beihong 

Zhu and Xefeng Qian worked on the effort. 

MBE Materials for Wright Patterson AFB Applications: Drs Li and Goodhue are 

providing MBE grown materials for AFRL applications. Sponsor - 

AFRL/SNWP. 

Develoment of Long Wavelength Quantum Dot Detectors: Drs. Lu, Li and Goodhue 

are develpoing long wavelenth detectors for DOD applications. Graduate 

student Xefeng Qian is also working on the project. Sponsor - Raytheon. 

Galaxy Phase I SBIR: In conjunction with Galaxy, the Photonics Center is 

measuring the materials properties of very low doped GaSb materials being 

developed for DOD applications. Graduate students Mike Grzesik, Shiva 

Vangala and Adam Tibolt worked on the project. 

Low Temperature GaAs for THz Applications: Low temperature epitaxial layers 

were grown for Foster Miller Inc. for one of their projects. Dr. Li supervised 

the work that wrapped up during the period. 

Low Carrier Concentration GaSb Wafers: This effort involved measuring carrier 

concentrations and mobilities of wafers provided by Galaxy Compound 


372

Semiconductors, Inc. under one of their Phase I 

SBIR efforts. The work is being supervised by Prof. Goodhue. Graduate 

Students Milke Grzesik and Shiva Vangala worked on the project. 

Thermoelectric Materials: Prof. Goodhue and Prof. Whitten of the Chemistry 

Department had a small effort with MIT Lincoln Laboratory in the area of 

thermoelectric PbTe quantum dot materials and devices that wrapped up in 

January 2007. Graduate student Adam Tibolt worked on the project. 

Poled GaAs--- AFOSR Phase I STTR to develop frequency halving optical 

materials for DOD applications. Graduate student Krongtip Termkoa 

worked on the project with Prof. Goodhue and Dr. Li. 

8) Thesis and Recent Publications by Primary Center Faculty/Students 

Thesis 

1) Bahareh Haji-saeed, "Development of Novel Device Assemblies and 

Techniques for Improving Adaptive Optics Imaging Systems," Umass Lowell 

ECE Dept. Doctoral Thesis (Advisor - Goodhue) 2006. 

2) Viabhav Mathur, “Design, Fabrication and FEM Simulation of an Optical- 

MEMS Sensor,” UMass Lowell Physics Dept. Master's Thesis (Advisor - 

Goodhue) 2006. 

3) Biehong Zhu, “Doping Study in Terahertz Quantum Cascade Structures,” 

UMass Lowell Physics Dept. Ph. D. Thesis (Advisor - Goodhue) 2006 

8) Journal Articles and Conference Proceedings 

1. Wongkasem, N., Akyurtlu, A., Marx, K.A., Goodhue, W.D., Li, J., Dong, Q., 

and Ada, E.T., “Fabrication of a Novel Micron Scale Y-structure-Based 

Chiral Metamaterial: Simulation and Experimental Analysis of its Chiral 

and Negative Index Properties in the Terahertz and Microwave Regimes” 

Special Issue on Nanomanufacturing, Microscopy Research and Technique, 

accepted, January 2007. 

2. Wongkasem, N., Akyurtlu, A., Marx, K. A., Dong, Q., Li, J., and Goodhue, W. 

D., “Development of Negative Refractive Index Chiral Metamaterials in the 

Optical Frequency Regime,” Special Issue on Optical and THz Antenna 

Technology, IEEE Transactions on Antennas and Propagation, submitted 

January 2007. 


373

3. Mathur, V., Li, J., and Goodhue, W.D., 

“FEM Simulation of a Micro-Cantilever Optical-MEMs Sensor”, Proceedings 

of the COMSOL Users Conference, Boston, Oct. 22-24, pp 333-338, 2006. 

4. Wongkasem, N., Akyurtlu, A., Li, J., Tibolt, A., Kang, Z., Goodhue, W. D., 

“Novel Broadband THz Negative Refractive Index Metamaterials: Analysis 

and Experiment,” Progress in Electromagnetic Research, PIER 64, pp. 205- 

218, 2006. 

5. Lu, X., Mesiner M., Vaillancourt, J., Li. J., Qian, X., Liu, W., and Goodhue, 

W.D., “A Modulation-doped InAs-InGaAs Quantum Dot Longwave Infrared 

Photodetector with High Photodetectivity”, submitted to Photonics 

Technology Letters, 2006. 

6. J. Khoury, C. L. Woods, Bahareh Haji-saeed, Dana Pyburn, Sandip K. 

Sengupta and J. Kierstead, “A Mapping Approach for Distortion Correction 

in Sinusoidally Scanned Images” Proc. SPIE Vol. 6245, 62450I, Optical 

Pattern Recognition XVII (2006). 

7. “Dynamic range compression deconvolution using A-law and μ-law 

algorithms”, Bahareh Haji-saeed; Sandip K. Sengupta; William D. Goodhue; 

Jed Khoury; Charles L. Woods; John Kierstead, Proc. SPIE Vol: 6574, 

Optical Pattern Recognition XVIII (2007). 

8. “MEMS deformable mirror optical limiter for dynamic range compression 

deconvolution”, Jed Khoury; Charles L. Woods; Bahareh Haji-saeed; Sandip 

K. Sengupta; William D. Goodhue; John Kierstead, Proc. SPIE Vol: 6556, 

Micro (MEMS) and Nanotechnologies for Defense and Security (2007). 

9. “Optically addressed spring-patterned membrane mirror MEMS with 

megahertz response”, Bahareh Haji-saeed; Gregory Griffith; Sandip K. 

Sengupta; William D. Goodhue; Jed Khoury; Charles L. Woods; John 

Kierstead, Proc. SPIE Vol: 6556, Micro (MEMS) and Nanotechnologies for 

Defense and Security (2007). 

10. “Real-time holographic deconvolution techniques for one-way image 

transmission through an aberrating medium: characterization, modeling, 

and measurements”, B. Haji-Saeed, S. K. Sengupta, M. Testorf, W. Goodhue, 

J. Khoury, C. L. Woods, and J. Kierstead, Applied Optics, Vol. 45, 3298-3306 

(2006) 

11. “Photoconductive optically driven deformable membrane for spatial light 

modulator applications that use GaAs substrates”,Bahareh Haji-Saeed, 

Rathna Kolluru, Dana Pyburn, Roberto Leon, Sandip K. Sengupta, Markus 

Testorf, William Goodhue, Jed Khoury, Alvin Drehman, Charles L. Woods 

and John Kierstead, Applied Optics, Vol. 45, 2615-2622 (2006) 


374

12. “Optically driven Micro-Electro-Mechanical-Systems deformable mirror 

under high frequency AC bias”,J. Khoury, C. L. Woods, B. Haji-Saeed, S. K. 

Sengupta, W. Goodhue and J. Kierstead, Optics Letter, Vol. 31, 808-810 

(2006) 

13. “Photoconductive Optically Driven Deformable Membrane Under High 

Frequency Bias: Fabrication, Characterization and Modeling”, B. Haji- 

Saeed, R. Kolluru, D. Pyburn, R. Leon, S. K. Sengupta, M. Testorf, W. 

Goodhue, J. Khoury, A. Drehman, C. L. Woods and J. Kierstead, Applied 

Optics, Vol.45, 3226-3236 (2006) 

14. “Nonlinear dynamic range compression deconvolution”, B. Haji-Saeed, S. K. 

Sengupta, W. Goodhue, J. Khoury, C. L. Woods and J. Kierstead, Optics 

Letter Vol. 31, 1969-1971 (2006). 

15. “A Mapping Approach for Image Correction and Processing for 

Bidirectional Resonant Scanners”, Bahareh Haji-saeed, J. Khoury, C. L. 

Woods, Dana Pyburn, Sandip K. Sengupta and J. Kierstead, Optical 

Engineering Vol. 46 (2007). 

16. “A Spatial Demultiplexing/Multiplexing Approach for Image Correction and 

Processing for Bidirectional Resonant Scanners”, J. Khoury, C. L. Woods, B. 

Haji-saeed, Sandip K. Sengupta, J. Kierstead, Optical Engineering Vol. 46 

(2007). 

17. “A Diffractive Element Design for Resonant Scanner Angular Correction: 

The beam retardation approach”, Jed Khoury, Bahareh Haji-saeed Christian 

P. Morath, Charles L. Woods, , Sandip K. Sengupta and John Kierstead, 

Applied Optics, Vol. 45, 8177-8185 (2006) 

18. “A Diffractive Element Design for Resonant Scanner Angular Correction”, 

Jed Khoury, Charles L. Woods, Bahareh Haji-saeed, Dana Pyburn, Sandip 

K. Sengupta and John Kierstead, Applied Optics, Vol. 45, 6897-6902 (2006). 

19. “Optically Addressed MEMS Driven with High Frequency Modulated Light” 

J. Khoury, C. L. Woods, B. Haji-Saeed, Sandip K. Sengupta, William D. 

Goodhue and J. Kierstead, Applied Optics, Vol. 46, 6897-6902 (2007) 

20. “Patterned Multipixel Membrane Mirror MEMS Optically Addressed 

Spatial Light Modulator with MegaHertz Response”, Gregory Griffith, 

Bahareh Haji-saeed, Sandip K. Sengupta, William. D. Goodhue, J. Khoury, 

C. L. Woods and J. Kierstead, IEEE Photonics technology letter, Vol. 19, 173- 

175 (2007) 


375

21. “Spectrally Variable Two-Beam Coupling Nonlinear Deconvolution”, B. 

Haji-Saeed, S. K. Sengupta, W. Goodhue, J. Khoury, C. L. Woods and J. 

Kierstead, Accepted in Applied Optics 

22. “Avalanche Photodetector Design for the Mid-Infrared using GaSb-Based 

Alloys”, R. Bhatia, M. Grzesik, S. Vangala, K. Vaccaro, W. Goodhue and C. 

Armiento, Progress in Electromagnetics Research Symposium (PIERS 

Proceedings, p2102, March 2007); Beijing, China, March 25-29, 2007 

23. S.R. Vangala, X. Qian, M. Grzesik, C. Santeufemio, W.D. Goodhue, L.P. 

Allen, G. Dallas, H. Dauplaise, K. Vaccaro, S.Q. Wang, D. Bliss, “Molecular 

beam epitaxy and morphological studies of homoepitaxial layers on chemical 

mechanical polished InSb(100) and InSb(111)B Substrates,” J. Vac. Sci. 

Technol. B 24(3), 1634-38, 2006 

24. S.R. Vangala, H. Dauplaise, C. Santeufemio, C. Lynch, P. Alcorn, L.P. Allen, 

G. Dallas, K. Vaccaro, D. Bliss, and W.D. Goodhue, “Atomic Hydrogen 

Cleaning of Epiready InSb (100), (111)B, and GCIB Processed InSb (111)B 

Surfaces,” Digest of papers, International Conference on Compound 

Semiconductor Manufacturing Technology, p113, May 2007 

25. L.P. Allen, G. Dallas, K. Blanchet, S.R. Vangala, C. Santeufemio, 

W.D.Goodhue, E. Roehl, C.E. Jones, J. Barton, B. Zide, V. Difilippo, K.S. 

Jones, “Successful MWIR FPA fabrication using gas cluster ion beam InSb 

surface finishing,” Proceedings of SPIE, Vol. 6542, Infrared Technology and 

Applications XXXIII, May 2007 

9) Conference Presentations 

1. J.H. Shahbazian and A.S.Karakashian, "Propagation of Electromagnetic 

Waves in a One Dimensional Photonic Crystal with DPS/DNG Layers", 

American Physical Society, Annual March Meeting, BAPS.2007.MAR.Y31.5, 

Colorado Convention Center, 2007 

2. Lu, X., Armiento, C., Li, J., and Goodhue, W.D., "A Longwave Infrared 

(LWIR) Photodetector Based on Nonlinear Absorption in InAs/GaAs 

Quantum Dots,” IEEE Proceedings of the International Symposium on 

Biophotonics, Nanophotonics and Metamaterials, Hangzhou, China, Oct. 16- 

18, p. 333, 2006. 

3. “Optically Addressed MEMS Deformable Mirrors Driven via an Array of 

Photodetectors”, Jed Khoury, Kenneth Vaccaro, Charles L. Woods, Bahareh 

Haji-saeed, Sandip K. Sengupta, Craig Armiento, William D. Goodhue, John 


376

4. Kierstead, Andrew Davis and William Clark, SPIE Optics East, Boston 

(October 2006) 

5. “Phase Retardation Symmetric Design of a Refractive and Diffractive 

Element for Linearizing Sinusoidal Scanning”, Bahareh Haji-saeed, Sandip 

K. Sengupta, Jed Khoury, Christian P. Morath, Charles L. Woods, John 

Kierstead, SPIE Optics East, Boston (October 2006) 

6. “A-law/μ-law Dynamic Range Compression Deconvolution”, J. Khoury, C. L. 

Woods, B. Haji-saeed, S. K. Sengupta, W.D. Goodhue and J. Kierstead (2006) 

7. “Beam Propagation Design of Diffractive Element for Linearizing Sinusoidal 

Scanning: Experimental Verification”, Bahareh Haji-saeed, Sandip K. 

Sengupta, Jed Khoury, Charles L. Woods, William Bailey and John 

Kierstead (2006) 

8. “Dynamic Range Compression Deconvolution based on MEMS Deformable 

Mirror Optical Limiter”, B. Haji-saeed, S. K. Sengupta, W.D. Goodhue, J. 

Khoury and C. L. Woods and J. Kierstead (2006) 

9. “Optically Addressed MEMS Deformable Mirrors Driven via an Array of 

Photodetectors”, Bahareh Haji-saeed, Sandip K. Sengupta, Craig Armiento, 

William D. Goodhue, Jed Khoury, Kenneth Vaccaro, Charles L. Woods, John 

Kierstead, Andrew Davis and William Clark (2006) 

10. “MEMS based Optical Limiter”, J. Khoury, C. L. Woods, B. Haji-saeed, S. 

K. Sengupta, W.D. Goodhue and J. Kierstead (2006) 

11. “Beam Retardation Design of Diffractive Element for Linearizing Sinusoidal 

Scanning: Experimental Verification”, Jed Khoury, Charles L. Woods, 

Bahareh Haji-saeed and John Kierstead (2007) 

12. “Interference Design of Diffractive Element for Resonant Scanner Angular 

Correction”, Bahareh Haji-saeed, John Kierstead, Jed Khoury and Charles 

L. Woods (2007) 

13. “Dynamic Range Compression Deconvolution”, B. Haji-saeed, W.D. 

Goodhue, Jed Khoury and Charles L. Woods and J. Kierstead (2007) 

13 “Two-Beam Coupling Nonlinear Deconvolution” , Jed Khoury, Charles L. 

Woods, Bahareh Haji-saeed, William D. Goodhue, and John Kierstead (2007) 

14. “Avalanche Photodetector Design for the Mid-Infrared using GaSb-Based 

Alloys”, R. Bhatia, M. Grzesik, S. Vangala, K. Vaccaro, W. Goodhue and C. 


377

Armiento, Progress in Electromagnetics Research Symposium (PIERS); (to be 

published in the proceedings) Beijing, China, March 25-29, 2007 

15. M. Grzesik, S. Vangala, W. Goodhue, and W. Buchwald, “Evolution of the 

Elastic Modulus and Hardness of Benzocyclobutene During the Curing 

Process,” American Physics Society March Meeting, R1.043, March, 2007. 

10) Intra-University Collaborations 

Quantum Cascade Far-Infrared Laser: Graduate physics students Beihong 

Zhu and Andre Danylov along with Drs. Jin Li and Andrew Gatesman and 

Profs. Goodhue, Karakashian, Ram-Mohan, Giles and Waldman worked on a 

GaAlAs quantum well laser device that is designed to emit in the terahertz. 

Such a device would be of interest in spectroscopy and remote sensing. This is 

a collaboration between the Photonics Center, the Submillimeter-Wave 

Technology Laboratory and WPI. Although previous sponsored by the CFCI 

and DARPA, the work continues with Army funding. 

Photonic Crystals and Metamaterials: Initially the CFCI sponsored research 

applied metamaterials and photonic crystal technology to applications in 

the submillimeter region of the electromagnetic spectrum. The team 

included graduate student Jin Li, Dr. Gatesman and Profs Goodhue, 

Giles, Karakashian, and Akyurtlu. The work has moved to the visible and 

besides being funded by the Air Force is also now funded by NSF. 

Poled GaAs: This Physical Sciences Inc., Air Force Sponsored STTR is a joint 

collaboration between Physical Sciences, Prof Goodhue, Dr. Li and Prof 

Sun of the Mechanical Engineering Dept. 

Quantum Dot Nanostructures: This Raytheon funded team effort between Prof. 

Lu and Dr. Li and Prof. Goodhue continues to develop near and mid 

infrared detectors. The work was originally CFCI funded. 

The Air Force Long Wavelength Detector and MEMS Programs: This work is a 

collaboration between the Photonics Center (Goodhue), CMOS 

(Armiento) and AFRL/SNHC. 

11) Outreach – none 

12) Proposals Submitted/Awarded 2006/2007 

1. DURIP Proposal for a Sb 2 and Atomic Hydrogen Cleaning Gun Package. 

$107,000 - Awarded 

2. Magnetically Tuned Metamaterials. app. $300,000 (National Science 


378

Foundation) - Awarded 

3. SBIR Phase II on Large Area Antimonide Wafers- UMass Portion $72,000 

(Galaxy Compound Semiconductors) - Awarded 

4. MBE Growth Runs for AFRL/SNWP. $27,000 (Wyle Laboratories) - 

Awarded 

5. Long Wavelength Quantum Dot Detectors: $210,000 (Raytheon) - 

Awarded 

6. Commercial Methods for Production of Oriented Patterned GaAs. UMass 

Lowell portion of Phase II STTR app. $133,000 (Physical Sciences, 

Inc.) to be Awarded. 


379

Summary 

29. RADIATION LABORATORY 

Annual Report - July l, 2006 to June 30, 2007. 


2. Associated Faculty and Staff 

2.1. Primary 

2.2. Secondary 

2.3. Post-Doctoral Associates 

2.4. Radiation Laboratory Staff 

3. Student Interaction 

3.1. Ph.D. Recipients 

3.2. Dissertation Students 

3.3. Pre-Dissertation and Undergraduate Students 

3.4. Educational Outreach 

3.5. Education 

4. Extramural Support 

4.1. Industrial Users 

4.2. Federal Government 

4.3. Universities 

4.4. Internal Partnerships 

5. Existing Facilities 

5.1. The Cobalt-60 Irradiation Facility 

5.2. The One Megawatt Research Reactor 

5.3. The 5.5 Megavolt Pulsed Van-de-Graaff Accelerator 

5.4. Analytical and Assaying Facilities 

6. Current Activities 

6.1. Accelerator 

6.2. Research Reactor (UMLRR) 

6.2.1. Facility Enhancements 

6.2.2. Research and Service 

6.3. Gamma Source 

7. Publications, 2005-2006 Academic Year 

7.1. Conference Proceedings 

8. Future Developments 


8.2. Reactor 

8.3. Gamma Source 

9. Proposals, Awards and Contracts 

9.1. Proposal 

9.2. Awards 

9.3. Contracts 

Radiation Laboratory 

380



The Radiation Laboratory (RL) is one of the oldest 

centers at UML. Established in l962 it underwent 

several reorganizations and was restructured in l98l with 

the name Radiation Laboratory. In a very broad sense 

this center counts as its members all in-house users of its 

equipment. More narrowly, members of the RL are 

those who use, operate, and maintain its equipment. 

This equipment consists of a l MW pool type nuclear reactor, Cobalt-60 gamma radiation 

facilities and a 5.5 MV Van-de-Graaff accelerator. 

The Radiation Laboratory's multi-faceted mission has several components: 

Academic Mission: To support the existing degree programs in the sciences, in 

engineering and in other fields, and to foster interdisciplinary academic activity on 

the Lowell campus and within the UMass system. 

Research mission: To support faculty and student research in all related 

interdisciplinary activities and to promote expanded opportunities for faculty and 

staff to obtain external funding. 

Service Mission: To seek actively and to develop industrial partnerships; to 

provide irradiation services and analytical measurements to governmental 

organizations, to other universities, to hospitals, and to industry. 

Outreach Mission: To organize and to support outreach activities for the public on 

issues related to nuclear science and technology, with emphasis on K-12 students 

and educators. 

The Office of Radiation Safety, which supervises the campus-wide use of radiation 

in teaching and research, is attached to the RL. The Radiation Safety Officer, Dr. 

David Medich, reports directly to the UML administration in all matters of 

radiation safety. His mission is quite distinct from that of the RL. It is his 

responsibility to assure that radiation users know about the safe use of radiation and 

follow applicable federal and state laws and regulations. 


381

2. Associated Faculty and Staff 

2.1. Primary 

Gunter H.R. Kegel, Director and Professor, Department of Physics and Applied 

Physics. 

James Egan, Professor, Department of Physics and Applied Physics. 

Mary Montesalvo (adjunct faculty), Department of Physics and Applied Physics. 

Leo Bobek (adjunct faculty), Department of Physics and Applied Physics. 

David Medich (adjunct faculty), Department of Physics and Applied Physics 

Thomas Regan (adjunct faculty), Department of Physics and Applied Physics 

Greg Parker, Accelerator Supervisor 

2.2. Secondary 

Department of Physics and Applied Physics: Profs. P. Chowdhury, C. French, A. Mittler, D. Pullen, W. 

Schier, and M. Tries. J. Antal (Adjunct Prof. and Senior Scienstist) 

Department of Chemistry: Prof. E. Jahngen 

Department of Environmental, Earth, and Atmospheric Sciences: Prof. N. Eby. 

Department of Plastics Engineering: Prof. A. Crugnola., Prof. N. Schott 

Department of Chemical Engineering: Prof. John White 

Center for Advanced Materials: Prof. D. Sandman. 

Center for Atmospheric Research: Prof. B. Reinisch 

2.3. Post-Doctoral Associate 

Sujit Tandel 

2.4. Radiation Laboratory Staff 

Thomas Regan, Reactor Engineer (Chief Reactor Operator) 

Steven Snay, Asst. Radiation Safety Officer (Radiochemistry Technician) 

David Sullivan, Senior Reactor Operator 

James Nelson, Senior Reactor Operator 

Ronald Carmichael, Mechanical Operator 

Lynne Winnett, Administrative Assistant 

3. Student Interaction 

The Ph.D. recipients listed below received research funding from the Radiation Lab. 

For the doctoral candidates, a distinction is made between pre-dissertation students 

and dissertation students. Pre-dissertation students are doctoral candidates who 

have not yet passed the comprehensive exam and have not selected a dissertation 

topic or supervisor. Dissertation students have passed this exam and made the topic 

selection 


382

3.1. Graduate Degree Recipients 

Roldan, Carlos (Ph.D) 

3.2. Dissertation Students 

Dissertation students who received financial support from the RL are identified with 

an * 

*Urmilla Tandel, Hi-Spin Physics 

*Carlos Roldan, Dosimetry 

*Afrim Alimeti, Neutron Physics 

*Chuncheng Ji, Neutron Physics 

3.3. Pre-Dissertation and Undergraduate Students 

The following graduate students are conducting research or working at the RL. 

Students receiving financial support are identified with an *. 

Don Galata 

* Stacey Russell 

*Thomas McKittrick 

Cody Wilson 

*Nasser Rashidifard 

Adam Boehl 

Lakshmi Sadasiv 

*Andrew Knox 

*Steven Sheppard 

*Steven Snay 

The following undergraduate students are involved with projects using the reactor 

or the accelerator: 

Michael Scardone 

*Steven Tremblay 

*Joseph Fish 

*Michael Dunlevy 

Christopher Signori 

Drew Lajeunesse 

Maureen Ingaharro 


383

3.4. Educational Outreach. 

One of the most successful endeavors at the research 

reactor has been the Reactor Sharing Program 

sponsored by the Department of Energy. This 

program, which started at UML in l985, has been 

extremely popular with area schools, grades 7 through 

12. The goal of this program is two-fold: to motivate 

pre-college students into developing an interest in the 

sciences, and to promote an understanding of nuclear energy issues while expanding 

learning opportunities. The program is comprehensive in that it includes lectures, 

hands-on experiments and tours of the UMLRR. Students and teachers may also 

participate via interactive two-way cable and satellite television. During the last few 

years, the emphasis of this program has shifted to a web-based system of 

educational outreach described further in this report. 

3.5. Education. 

The following UML courses use the Radiation Laboratory facilities each year as a 

major or partial component of the curriculum: 

95.411/98.541 Radiochemistry 

96.443 Radiochemistry Laboratory 

96.393/4 Advanced Experimental Physics Laboratory 

96.306/98.506 Nuclear Instrumentation 

96.201/96.301 Health Physics Internship 

96.402/98.502 Radiation Safety and Control II 

99.102 Radiation and Life Laboratory 

98.666 Reactor Health Physics 

10/24.431 Nuclear Reactor Systems and Operation 

10/24.432 Nuclear Systems Design and Analysis 

24.507 Reactor Engineering Analysis 

87.111 Environmental Science 

84.113 General Chemistry 

19.518 Engineering Controls and PPE 

19.517 Physical Agents 

4.1. Industrial Users 

4. Extramural Support 

Most of the companies listed are located in Massachusetts. 

• Microsemi Corporation (Lawrence, MA); International Rectifier 

(Leominster, MA facility); Barr Associates (Westford, MA); Assurance 


384

• Technology Corporation (Chelmsford, MA); Implant Sciences Corporation 

(Wakefield, MA); Radiation Monitoring Devices (Watertown, MA); AEA 

Technologies (Burlington, MA); Fibersense (Canton, MA); Datum (Beverly, 

MA); Cubist Pharmaceuticals (Lexington, MA); SSG Precision Optronics, 

Inc. (Wilmington, MA); Symnetricon (Beverly, MA); Physical Sciences, Inc. 

(Andover, MA); SatCon Electronics (Marlborough, MA); Bristol-Meyers 

Squibb Co. (Billerica, MA); National Technical Systems (Acton, MA); Analog 

Devices, (Norwood, MA); Eyetech Research Center (Lexington, MA); Mitre 

Corporation (Bedford, MA); Passport Systems, Inc. (Acton, MA); Sypris Test 

and Measurement (Orlando, FL); Carboline Co. – R&D (St. Louis, MO) 

Imaging & Sensing Technologies (Horseheads, NY); General Dynamics 

(Scottsdale, AZ); Spectrum Technologies (Schenectady, NY); M.S. Kennedy 

Corporation (Liverpool, NY); Keeler & Long, PPG Industries (Watertown, 

CT); Hunton & Williams, LLP; Nufern (East Granby, CT); Mitre (Bedford, 

MA)Ameron - Amptek - Cabrera Services - Hawkeye Global, Inc. - - Spire 

Corp. –SSG, Precision Optronics - 

4.2. Federal Government 

U.S Department of Energy (DOE), five different grants or contracts. 

1. Neutron scattering studies 

2. Reactor Sharing Program 

3. University reactor instrument upgrade program 

4. Single particle and collective phenomena in nuclei 

Brookhaven National Laboratory - Fast neutron irradiation of semiconductor 

devices 

MITRE Corp. - Gamma irradiations 

Draper Laboratory - Gamma irradiations 

4.3. Universities 

MIT Lincoln Laboratory - Low dose measurements using fiber optics 

Massachusetts Institute of Technology – Neutron Radiography System Development 

4.5. Internal Partnerships 

Center for Advanced Materials: Multi-year collaboration involving radiation 

hardness enhancement of materials. 

Department of Biological Science: Sterilization of soils for bacterial studies. 

Department of Plastics Engineering: Crosslinking studies. 

Biomedical Engineering and Biotechnology: Sterilization of medical implant for 

surgery training. 


385

5.l. Cobalt-60 Gamma Irradiation Facilities 

5. Existing Facilities 

Gamma irradiation is performed at the Radiation Laboratory using various cobalt-60 (Co- 

60) irradiators. The Co-60 source consists of a number of stainless-steel encapsulated Co- 

60 strips used and stored underwater at the bottom of the reactor bulk shielding pool. 

Accurate radiation dosimetry is provided by an EPR (alanine) dosimetry system. A 

Quality Assurance Program meeting the requirements of 10CFR Part 50 Appendix B 

provides for the performance and maintenance of gamma dosimetry calibrations that are 

traceable to the National Institute of Standards and Technology. 

Gamma Cave 

This facility is a large, ventilated, dry-irradiation chamber having an equi-dimensional 

volume of 512 cubic feet. A wide range of dose rates, 1Gray (100 rad) per hour to 

10,000 Gray (1 Mrad) per hour, is achieved by using various specific activity Co-60 

frames and by varying the centerline distance of the sample from the source window. 

Hot Cell 

Originally designed for radioisotope sample preparation, this facility presently 

houses a single Co-60 source contained in a shielded irradiator. The irradiator 

provides up to two gamma beams permitting dose rates 0.1 Gray to 5 Gray per hour 

(10 to 500 Rad/hour). The facility also provides a remote operated overhead crane, 

remote robotic manipulators, a shielded view port, and multiple conduit ports. 

Submersible Canister 

The Submersible Canister (SubCan) is an ambient temperature, watertight chamber, 

having dimensions 20.3 cm (8 in.) I.D. x 30.5 cm (12 in.). When submerged at the 

bottom of the bulk shielding pool, the SubCan is surrounded by up to eight Co-60 frames 

for a maximum dose rate of 20 kGray/hour (2 MRad/hour). 

Enhanced Low Dose Response 

The Enhanced Low Dose Response (ELDRs) test facility is located directly opposite 

to the gamma cave facility on the experimental level of the reactor. It consists of 

four separated irradiation chambers, inside a 3'x3' reactor pool wall penetration. 

This facility provides a dose range to 0.01 Rad/s (36 Rad/hr). 

5.2. The One Megawatt Research Reactor. 

The University of Massachusetts-Lowell Research Reactor (UMLRR) has been serving 

the university and surrounding community since 1974. The UMLRR is a one-megawatt, 

steady-state, pool-type reactor. The principal purpose of the UMLRR is to provide a 

multidisciplinary facility for use in nuclear-related education and research. Although the 

main focus of the facility is on intra-university research, use by those outside the 

university is fully welcomed. The UMLRR provides irradiation services benefiting 


386

government agencies and industry, and it supports outreach activities for pre-college 

students that encourage interest in science and engineering careers. The facility is 

regulated by the Nuclear Regulatory Commission and is currently licensed to 2015. 

Various experimental facilities within the UMLRR produce thermal neutrons for 

radio activation purposes and fast (fission spectrum) neutrons for radiation effects 

research. Capabilities include: neutron activation analysis (parts per billion 

sensitivity for most elements), full spectral or enhanced thermal or enhanced fast 

neutron irradiation facilities (for material effects studies), neutron transmission 

measurement (for material properties studies) · radiation detector response and 

calibration to neutron, gamma, and mixed radiation fields; neutron radiography 

(for materials imaging). 

5.3. The 5.5 MV Pulsed van-de-Graaff Accelerator 

The accelerator produces proton, deuteron, alpha particle, or oxygen ion beams in 

the pulsed (width∼15ns) or dc mode. A Mobley pulse compression system can be 

used to obtain subnanosecond proton bursts. The pulse repetition frequency is 5 

MHz. Accelerator accessories include neutron time-of-flight spectrometers, a 

PIXE/RBS station, a thick-lithium-target neutron irradiation station, data 

acquisition systems, electronic modules and other equipment. 

5.4. Analytical and Assaying Facilities 

The facilities utilize several gamma spectrometers provided with computerized 

gamma peak identification codes, including several germanium detectors with lowlevel 

environmental shields to assay low-activity and environmental samples, and 

two-state-of-the-art, high-purity, high-efficiency germanium detector for gamma 

spectra analysis as well as two automated analysis systems for neutron activation 

analysis. 


6. Description of current activities 

Research at the Van de Graaff accelerator covers neutron 

elastic and inelastic scattering cross section measurements 

and fission neutron energy spectroscopy using neutron timeof-flight 

techniques. A PIXE (proton induced x-ray 

emission) spectrometer is used to determine the elemental 

composition (10≤ Z ≤ 82) of complex samples, such as 

minerals, paints, foodstuffs, archeological objects, etc. A 

RBS (Rutherford backscattering spectrometer) station can be applied to the study of 

inhomogeneous surface layers; this technique permits the determination of the thickness 


387

and of the atomic mass of superimposed deposits with thickness in the micron range, e.g. 

copper objects which are nickel and then gold plated. 

Ion beams can be used to implant appropriate targets with selected ions. By 

controlling the ion energy a deposit at a specified depth can be obtained. By 

bombarding a range-thick, metallic lithium target with protons a substantial fluence 

of fast neutrons is obtained, virtually free of slow neutrons and of gamma rays. 

These fluences may be used to study the effects of neutron irradiation upon 

semiconducting materials, plant seeds, radiation-resistant bacteria and other 

objects. For cancer therapy via Boron Neutron Capture Therapy (BNCT) a special 

phantom has been constructed. This device incorporates two detectors to determine 

radiation doses to cancerous and to surrounding healthy tissue. 

Direct proton irradiations have been performed on windows, lenses and mirrors to 

be used on satellites. These components must be able to function flawlessly for 

many years in a hostile outer space environment. The statistical distribution of the 

number of prompt fission gamma rays has been studied both, by theoretical 

considerations and by experiment. 

PIXE techniques have been used to determine trace element distributions in native 

copper samples with the aim of correlating the distributions with the geographic 

origin of the samples. The investigation has been and will be extended to copper 

samples which have been cold worked into decorative artifacts to obtain 

information on the origin of these artifacts, 

6.2. Research Reactor (UMLRR) 

The UMLRR is currently involved with a number of radiation effects research 

projects that include: radiation induced materials enhancement for commercial and 

military applications, radiation resistant electronics testing for commercial, military, 

and NASA applications, and non-destructive evaluations. 

6.2.1. Research and Service. 

MIT-UML-URI Consortium 

Under the DOE INIE program, Asst. Prof. M. Tries (Physics) has been awarded a multiyear 

contract totaling $275,000 to develop a digital imaging system using neutrons 

(neutron radiography). The present neutron imaging system at UMLRR provides users 

with industrial neutron radiographic service meeting ASTM standards using film 

technology. For the first two years of this program, Asst. Prof. Tries, Mr. Regan, and Mr. 

Bobek designed and builta digital neutron radiography system capable of imaging 

materials and components having a wide range of dimensions. The digital imaging 

shortens exposure times to provide almost immediate viewing of the radiographic image 


388

(near real-time), provides the flexibility to scan large areas with ease, provides accurate 

recording of a variety of radiographic details, and permits remote imaging via the 

internet. During the current phase of this funding, efforts are underway to renovate 

Pinanski room 200 to establish a “smart” classroom. 

Remote Education 

As part of our DOE Reactor Sharing Program, Prof. White (Chem. Eng.) is developing a system for making 

real-time and archived research reactor data available to educational users via a standard web browser. 

Virtually any classroom or individual throughout the world will not only be able to access archived 

UMLRR experimental data, but also observe most of the UMLRR control room instrument readings, in 

real-time, in a graphical interface for use in classroom lectures, demonstrations, and experiments. 

Neutron Activation Analysis (NAA) 

Nelson Eby continues to do research associated with instrumental neutron 

activation analysis (INAA) and fission track dating. Since 1990, this work has 

resulted in 28 publications. Fission-track geochronology, utilizing the minerals 

apatite and titanite, has been used to determine the both the age of igneous intrusion 

and the time of unroofing for a number of volcanic and plutonic provinces around 

the world. The most recent work has been the dating of alkaline igneous activity 

(420 Ma) in northern New Jersey and the time of unroofing (115 Ma) for this 

province. INAA has been used to determine the trace element compositions of rocks, 

minerals, soils, coal, atmospheric aerosols, human hair, film negative, and process 

sludge. During the past year this technique has been used to determine the trace 

element chemistry of tree rings (a collaborative project with Lehigh University, the 

data are used to monitor environmental changes), the trace element composition of 

volcanic rocks from Antarctica (a collaborative project with the University of Otago, 

NZ), and trace element compositions of volcanic rocks from central Europe (a 

collaborative project with the Geological Institute of Hungary) 

6.3. Gamma source 

The gamma irradiation source at the Radiation Laboratory has been used 

extensively for food irradiation studies and for developing optimized radiation doses 

for routine medical product sterilization. By far, the greatest use of the gamma 

facilities have and continue to be for radiation effects evaluations on electronic 

components and other materials such as optical components, mirrors, lenses, and 

windows for space applications. Recent biomedical studies have focused on 

radiation induced cross-linked polymers for medical applications in tissue 

engineering and improved prostheses. Other studies involve radiation effects on 

plastics used in the treatment of cancer. 

7.1. Conference Proceedings 



389

J. R. White and L. M. Bobek, “Innovative Use of a Research Reactor for 

Interdisciplinary Engineering Education,” Amer. Soc. Eng. Ed., Annual Conference 

(2007). 

J. R. White and L. M. Bobek, “Reactor Operations Training via Web-based Access 

to the UMass Lowell Research Reactor,” ANS Conference on Nuclear Training and 

Education – CONTE (2007). 

P. Jain, S. Markidis, B. G. Jones, Rizwan-Uddin, J. R. White, and L. M. Bobek, 

“Web-casting of Nuclear Reactor Experiments”, Trans. Am. Nuc. Soc. (Nov. 2006) 

M.L. Woodring, James J. Egan, G.H.R. Kegel, P.A. Staples, and D.J. DeSimone, “Fast 

Neutron Induced Fission Neutron Energy Spectra Below the Incident Energy”, Proceedings 

of the Seventh International Conference on Methods and Applications of 

Radioanalytical Chemistry, Kailua-Kona, Hawaii, 3-7 April 2006, 


8. Future Developments 

A U.S. Department of Energy grant has been used to acquire a new, inclined field 

accelerator tube with stainless steel electrodes. This tube is used at present with the 

older sweeping and focusing input device in order to evaluate focusing properties 

with known input parameters. These studies indicate the advantage of placing an 

electrostatic quadrupole doublet below the accelerator baseplate. This doublet is at 

the design stage. 

Once accelerator operation with the new tube plus doublet meets our requirements 

we plan to install a new sweeping and focusing input device which is now under 

construction. The combined effect of these accelerator improvements will be the 

extension of the accelerator useful life well beyond the year 2007. 

A 2-MeV oxygen beam has been generated and has been used for O-implantation in 

gallium arsenide wafers. It is planned to use this beam also for Rutherford 

backscattering studies of impurities in organic compounds since this technique does 

not detect hydrogen, carbon, or nitrogen. 

An ion source assembly line has been set up; this line includes a source conditioning 

and testing station. 

8.2. Reactor 

Developing work focuses on using the reactor control room upgrades for web-based 

educational instruction using the reactor. Under the most recent DOE Reactor Sharing 


390

grant ($23,000), Prof. John White, Leo Bobek, and Thomas Reganare developing 

applications of distance learning. 

With partial funding from the Department of Energy, a license amendment was 

submitted in August 2006 that will increase the reactor licensed power level to 2 

MW.. An upgrade to 2 MW will require no additional equipment. The UML 

research reactor was originally designed for 5 MW capability and an upgrade to 5 

MW would only require a new high-efficiency heat exchanger and cooling tower, 

and a larger primary cooling pump. The upgrade to 2 MW will double the available 

neutron fluences available for research. The review of this license amendment is 

ongoing by the Nuclear Regulatory Commission. 

8.3. Gamma source 

There is a continuing demand for gamma radiation effects studies on materials and 

electronics. Both the reactor and the gamma source are used increasingly to study 

the effects of prolonged low dose-rate irradiations. These studies are needed to 

understand the deterioration of materials and devices exposed to radiation in outer 

space and to man-made radiation fields. 

9. Proposal and Awards 

Nuclear Power Fundamentals Online Certificate Program, U.S. Nuclear Regulatory 

Commission, John White (PI) and Leo Bobek, Thomas Regan, Gilbert Brown (co- 

PIs), $200,000 – not funded. 

Nuclear Experiential Education and Training Program at the University of Massachusetts 

Lowell, U.S. Nuclear Regulatory Commission, Mark Tries (PI) and Leo Bobek, Thomas 

Regan, Clayton French (co-PIs), $200,000 – awarded, under negotiation. 

High Temperature High Dose Gamma Irradiator, MIT (Department of Energy- 

NERI Consortium), John White (PI) and Leo Bobek, Thomas Regan (co-PIs), 

$268,000 – pending. 

GNEP University Readiness Grant, Department of Energy, Leo Bobek (PI) John 

White, Thomas Regan (co-PIs), $100,000 – pending. 

Correlated Particle Measurements of Fissile Material, Department of Energy, 

Gunter Kegel (UML) and Mitchell Woodring (PNNL), CO-PI, pending, funding 

requested for 

UML $850,000. This application is processed through PNNL. 

Covert Actinide Processing Revealed by Alpha Spectroscopy of Waste Water, 

Department of Energy, Gunter Kegel, Lead PI., $449,329. not funded. 


391

Measurement of Neutron Capture Gamma Ray Spectra, Department of Energy, 

Gunter Kegel end James Egan, CO-PI., $329,016., pending. 

Neutron Irradiation, Perkin-Elmer Corporation, Mary Montesalvo and Gunter 

Kegel, $9454.00 funded 

Neutron Physics Studies, Partha Chowdhury, James Egan, and Gunter Kegel 

Department of Energy, $ 1,778,401.00, not funded. 

Measurement of the Probability Distribution of the number of Neutrons and 

Gamma Rays, National Science Foundation, $1,705,976.00, pending. 

University Reactor Instrumentation Program, Department of Energy, $76,156, L. 

Bobek (PI), M. Tries, T. Regan (CO-PIs), $39,050 funded. 

University Reactor Sharing Program, Department of Energy, $33,874, L. Bobek 

(PI), J. White, M. Montesalvo (CO-PIs), $23,200 funded. 

Innovations in Nuclear Infrastructure and Education Program, MIT/DOE, M. Tries 

(PI), G. Kegel, T. Regan (CO-PIs) $65,000 funded 

9.1 Contracts 

• Contracts Total for July l, 2006 to June 30, 2007: $300,000. 

• Microsemi Corporation (Lawrence, MA); International Rectifier 

(Leominster, MA facility); Barr Associates (Westford, MA); Assurance 

Technology Corporation (Chelmsford, MA); Implant Sciences Corporation 

(Wakefield, MA); Radiation Monitoring Devices (Watertown, MA); AEA 

Technologies (Burlington, MA); Fibersense (Canton, MA); Datum (Beverly, 

MA); Cubist Pharmaceuticals (Lexington, MA); SSG Precision Optronics, 

Inc. (Wilmington, MA); Symnetricon (Beverly, MA); Physical Sciences, Inc. 

(Andover, MA); SatCon Electronics (Marlborough, MA); Bristol-Meyers 

Squibb Co. (Billerica, MA); National Technical Systems (Acton, MA); Analog 

Devices, (Norwood, MA); Eyetech Research Center (Lexington, MA); Mitre 

Corporation (Bedford, MA); Passport Systems, Inc. (Acton, MA); Sypris Test 

and Measurement (Orlando, FL); Carboline Co. – R&D (St. Louis, MO) 

Imaging & Sensing Technologies (Horseheads, NY); General Dynamics 

(Scottsdale, AZ); Spectrum Technologies (Schenectady, NY); M.S. Kennedy 

Corporation (Liverpool, NY); Keeler & Long, PPG Industries (Watertown, 

CT); Hunton & Williams, LLP; Nufern (East Granby, CT); Mitre (Bedford, 

MA) 


392


30. TOXICS USE REDUCTION INSTITUTE 

2006-2007 Annual Report 

The Toxics Use Reduction Institute (TURI) provides the resources and tools to 

help industries, communities and institutions implement toxics use reduction to 

make Massachusetts a safer place to live and work. 


In this multidisciplinary research, education and technical support center, the 

TURI staff of engineers, analysts, educators and support staff provide services in 

the following five areas: 

1. Technology Innovation through supply chain and peer networks and 

grants to academic researchers and industries working on toxics use reduction 

(TUR) technologies and methods. 

2. TUR Planner core training and annual continuing education courses. 

3. Outreach and training in communities through toxics use reduction 

networking, Community Grants and other programs. 

4. Surface Solutions Laboratory testing the performance of non-toxic and 

less-toxic cleaning alternatives for specific, client-defined applications. 

5. Research library and clearinghouse for publications and articles. 


Our research efforts fall into one of two areas, i.e., technical research and 

methodological research. Technical research concerns the development of new 

chemicals and/or processes to replace toxic chemicals in current use by industry. 

For example, the Surface Solutions Laboratory conducts research to develop 

aqueous cleaning systems to replace cleaning systems that use chlorinated 

solvents. Methodological research concerns the development of new techniques 

for analyzing chemical use by industry. For example, we have developed an 

alternatives assessment methodology for industry and policy makers to evaluate 

the feasibility and relative safety of substituting a particular alternative for a toxic 

chemical. 


Michael Ellenbecker 

Elizabeth Harriman 

Janet Clark 

Jack Luskin 

Director 

Deputy Director 

Senior Associate Director for Information 

Senior Associate Director for Learning 

Toxics Use Reduction Institute 

393

Anne Basanese 

Pamela Civie 

Joy Onasch 

Gregory Morose 

Jason Marshall 

Heidi Wilcox 

Rachel Massey 

Alex Brown 

Heather Tenney 

Jan Hutchins 

Robin Gavin 

Malinda Buchannan 

Brenda Wilson 

Kwangseog Ahn 

Manager of Administration & Events 

Industry Research Program Manager 

Community Program Manager 

Project Manager 

Acting Laboratory Director 

Lab Technician/Field Implementation Specialist 

Program Manager 

Systems Administrator 

Program Manager 

Library Manager 

Bookkeeper 

Receptionist 

Office Assistant and Bookkeeper 

Postdoctoral student 

5. New Faculty Affiliations 

Daniel Schmidt, Assistant Professor in Plastics Engineering, and Roger Boggs, 

Director of the Green Chemistry Laboratory, were funded by TURI to perform 

research projects as described below. In addition, Dhimiter Bello, newly hired as 

Assistant Professor in Work Environment specifically to do research on the 

occupational and environmental health impacts of nanotechnology, worked 

closely with Dr. Ellenbecker on the Center for High-rate Nanomanufacturing as 

described below. 

Cora Roelofs, Research Assistant Professor, is working with TURI on a range of 

projects. Currently, she is working on our new smaller toxics users initiative. 

Ed March (CEO in Residence) and William Lazonick (Co-Director of the Center 

for Industrial Competitiveness) worked with Janet Clark and other Institute staff to 

submit a proposal to the Kauffman Foundation. 


CFCI funded: 

Ephraim Massawe 

Sally Edwards 

TURI funded: 

Kwangseog Ahn (postdoc) 

Su-Jung Tsai 

Gowri Dorairaju 

Heidi Wilcox 


394

Noble Francis 

Mukthiar Basha 

Rahul Garwhal 

Daniel Brooks 

Shweta Bansal 

Andrea Cheeseman 

Amanda Covin 

Rahul Mehta 

Aniket Songade 


CFCI Funding 

Funding was received for the Toxics Use Reduction Institute and the Lowell 

Center for Sustainable Production to conduct research on “Initial Exploration of 

Sustainable Product Design.” 

To explore this topic and to develop a funding proposal, literature research was 

conducted as well as interviews with eco designers, government representatives, 

environmental consultants, and representatives of non governmental 

organizations and industry to explore issues and needs in sustainable product 

design. Interviewees included: 

Beto Lopez, Bob Adams and Heidi Kreschmer of IDEO 

Ashley Rosebrook of Aveda 

Mandana McPherson, independent designer. 

Clive Davies, USEPA Design for Environment program 

Lauren Heine, GreenBlue 

Tim Greiner, Pure Strategies. 

Andrew Hutson, Environmental Defense 

Brenda Platt, Institute for Local Self Reliance. 

Katie Friedman, Hasbro 

Linny Doane, Hasbro 

As a result of this research, the Lowell Center and TURI identified toys as a 

product area where there is a consumer demand for information and market 

pressure for businesses to demonstrate environmental and social responsibility 

throughout the supply chain. Building on research for this project, a proposal 

was developed and submitted to the Summit Foundation to fund the Sustainable 

Toys Initiative. Project research has been presented at internal meetings of the 

Lowell Center and TURI as well as at a national meeting with Wal-Mart buyers. 


395

2006-2007 Budget Report 

Ephraim Massawe 7704.06 

Sally Edwards 4800.00 

Total 12,504.06 

Core Funding 

With our core funding from the Massachusetts Toxics Use Reduction Program, 

we are supporting a wide range of research into the reduction in the use of toxic 

chemicals by Massachusetts industries. Some of our largest current projects are 

described below: 

TURA Amendments 

The Toxics Use Reduction Act, initially passed in 1989, was amended for 

the first time last year. TURI began devoting considerable resources to 

the implementation of the changes in the act. The primary tasks were the 

designation of more hazardous and less hazardous chemicals and the 

provision for new alternative planning possibilities for participating 

companies. These activities involved considerable planning and 

coordination with our sister agencies, the Office of Technical Assistance 

for Toxics Use Reduction (OTA) and the Department of Environmental 

Protection (DEP). 

Toxics Use Reduction Community Program. The Toxics Use Reduction 

community education and grant program encourages citizen involvement 

in the State’s TUR Program, fosters collaborative action, and develops 

model projects and materials for other communities to replicate. Each 

year, grants are given to community and municipal organizations to fund 

TUR-related activities. This program has a website offering a compilation 

of projects, materials and policies developed by community organizations 

and local governments as well as extensive links to additional resources. 


396

This year’s ten projects include pesticide 

reduction in parks in Lowell, town property in Townsend, and private 

households in Holliston; scholarships for municipal employees to attend 

organic lawn care seminars put on by the Northeast Organic Farming 

Association; raising awareness about household toxics through youth in 

Worcester and asthmatics in Lynn; healthier product alternatives for 

Brazilian housecleaners in Boston neighborhoods; healthy floor finishing in 

the Vietnamese community in greater Boston; the switch from chemical 

emergency flares to safer 

alternatives on Cape Cod to protect their groundwater; and the start-up of 

a lecture series on toxics and children’s health in the Berkley 

neighborhood. Descriptions of these projects can be found at 

www.turi.org under the Community tab. 

Supply Chains. We are sponsoring a series of supply chains for 

Massachusetts industries, in order to help them compete in the global 

marketplace where chemical restrictions are becoming more 

commonplace. Currently we have two groups in operation, i.e., the Lead- 

Free Electronics Consortium and the Coated Wire and Cable Supply 

Chain. 

The New England Lead-Free Electronics Consortium connects peers in 

industry with their suppliers and markets to address industry challenges 

and build local competitiveness. Several years of testing and experiments, 

as well as supply chain workshops and communication have resulted in a 

large archive of practical presentations, papers, and articles available for 

downloading. Sponsored by TURI, The University of Massachusetts 

Lowell, and the U.S. EPA, the Consortium has been working since 2000 to 

improve the conversion process to lead-free. The Consortium is a 

collaborative effort among companies that represent the entire printed 

wiring board (PWB) supply chain. The goal of Consortium projects is to 

achieve a level of lead-free solder joint manufacture and reliability 

comparable or better to that of leaded solder joints. Consortium members 

working with TURI, university researchers and students ran an exhaustive 

set of experiments to test materials, manufacturing processes and reflow 

strategies. The consortium has also employed six sigma tools (DOE, 

FMEA, etc.) to focus research efforts and enhance the quality of testing 

results. 

The Coated Wire and Cable Supply Chain network brings together raw 

material suppliers, compounders, extruders and OEMs to address 

environmental challenges facing the industry. The wire and cable industry 

faces European, Japanese and US regulatory pressure on a number of 

key wire and cable materials, including: lead, brominated flame retardants, 


397

PVC, and plasticizers. This TURI Network benefits from university 

research on the environmental impact of wire and cable constituents, 

laboratory evaluation of alternative materials, and meetings that draw 

firms from throughout the supply chain together to discuss human and 

environmental impacts, regulatory requirements, new technology 

developments, and business and technical strategy. 

Surface Solutions Laboratory. The SSL provides technical assistance 

to companies looking to reduce the amount of hazardous chemicals used 

for surface cleaning. The Lab does this by testing alternative cleaning 

chemistries on the company’s parts, and quantifying the cleaning ability of 

these alternatives. This year, the Laboratory continued its focus on two 

new research areas critical to SSL’s mission: the assessment of biobased 

products as alternative chemicals/feedstocks and green chemistry. These 

fields will become increasingly important in transitioning from a 

hydrocarbon to a carbohydrate economy that is less dependent on foreign 

energy supplies, both on a local and national level. More information on 

the Lab’s activities can be found at www.turi.org under the Laboratory tab. 

In addition, the SSL was funded by EPA Region I to help small metal 

working companies in Rhode Island to reduce their use of 

trichloroethylene; this work is described more fully below. 

Toxics Use Reduction Planning. The Institute is mandated under the 

Toxics Use Reduction Act to provide basic and advanced toxics use 

reduction training to Toxics Use Reduction Planners. Training programs 

include TUR Planner Training and Professional Continuing Education. 

Offered once per calendar year, the Toxics Use Reduction Planner 

Course provides 42 hours of core sessions over a seven-week period. 

Skills and tools covered are valuable in any production or service context: 

1. Toxics Use Reduction reporting requirements 

2. Process characterization 

3. Materials accounting 

4. Worker health and safety 

5. Options identification and analysis 

6. Regulatory requirements 

7. Financial and implementation issues 

This course is a prerequisite for state certified Toxics Use Reduction 

Planners under the Massachusetts Department of Environmental 

Protection's (DEP) exam track application procedure. 


398

The program also offers specialized continuing 

education workshops for TUR Planners. TURI holds two continuing 

education conferences each year, one in the spring and one in the fall. 

The Institute also offers occasional stand alone full- day workshops. 

Outside Funding 

The following research was performed under outside funding during the 2006-2007 year: 

Center for High-Rate Nanomanufacturing 

TURI is an integral part of this NSF Nanoscale Science and Engineering 

Center, awarded jointly to UMass Lowell, Northeastern University, and the 

University of New Hampshire. TURI is responsible for ensuring the 

environmental and occupational health and safety of all participating labs, 

and for conducting alternatives assessments for all new processes 

developed in the labs. As part of this effort, TURI has initiated a program 

of research into exposure issues involved with the use of nanoparticles. 

Several presentations were made at professional meetings outlining our 

monitoring results to date, as documented in Section 9. During this year, 

Dr. Ellenbecker prepared a guidance document titled “Interim Best 

Practices for Working with Nanoparticles,” and distributed it to the three 

campuses. In addition, Dr. Ellenbecker lectured in two nanoparticle 

courses and gave safety training to students at each of the three 

campuses. 

Veterans Administration 

EPA Region I 

TURI was awarded a contract for $31,000 from the VA to evaluate biobased 

replacements for floor stripping and hard surface cleaning at the 

Bedford VAMC (VA Study Site) against products currently in use at that 

facility. 

TURI was awarded a contract for $16,000 from EPA Region I to work with 

them to identify small metal finishing companies using trichloroethylene 

(TCE) in Rhode Island and to assist those companies in reducing or 

eliminating their TCE use. As part of this project, testing was conducted 

for thirteen companies and overall TCE use by these companies was 

reduced by more than 50%. 

TURI was also awarded another grant from the U.S. EPA, Region 1 

through their Pollution Prevention Grants Program. The funding is for 

Phase IV efforts of the New England Lead Free Electronics Consortium. 

Sammy Shina is the PI and Gregory Morose is the co-PI. The grant was 

awarded in September, 2006 for an amount of $12,100. 


399

8. Publication 

Luskin, J., Special Issue on “Sustainable Production and Consumption—Making 

the Connection,” Journal of Cleaner Production, 15:6, 2006. (co-editor). 

Marshall, J., and Durekee, J., “Vapor Degreasing with Binary Azeotropes, ” 

Process Cleaning Magazine, Vol. 2, No. 2, March/April 2007. 

Marshall, J., and Wilcox, H., “Drop-in Alternatives to Trichloroethylene: Are they 

safe for you? Do they work? Will they work for you?,” Process Cleaning 

Magazine, Vol. 1, No. 5, September/October 2006. 

Massawe, E., K. Geiser, M. J. Ellenbecker, and J. Marshall, “Health, Safety and 

Ecological Implications of Biobased Floor Stripping Products,” J. Env. Health 

69(9): 45-52 (2007). 

McKernan, J. L., M. J. Ellenbecker, Holcroft, C., “Evaluation of a Proposed 

Velocity Equation for Exothermic Process Control,” Annals Occ. Hyg. doi: 

10.1093/annhyg/mem006 (2007). 

McKernan, J. L., M. J. Ellenbecker, Holcroft, C., Petersen, M. R., “Evaluation of a 

Proposed Area Equation for Improved Exothermic Process Control,” Annals Occ. 

Hyg. doi: 10.1093/annhyg/mem016 (2007). 

Morose, Gregory, Farrell, Robert, Russo, Richard, Mazur, Scott, “Transition to Lead-free 

Electronics Assembly Case Study”, Submitted for IPC/JEDEC International Conference on Lead 

free Electronic Assemblies and Components, Montreal, August 2006. 

Morose, Gregory, Farrell, Robert, Russo, Richard, Mazur, Scott, “A Successful 

Transition to Lead-free”, SMT Magazine, August 200 

Morose, Gregory, Farrell, Robert, Russo, Richard, Mazur, Scott, “Transition to 

Lead-free Electronics Assembly Case Study”, IPC Review Magazine, November 

2006. 

Morose, Gregory, Farrell, Robert, Russo, Richard, Mazur, Scott, “Transition to 

Lead-free Electronics Assembly Case Study Part II: Product Reliability and 

Forced Rework”, Submitted for IPC/JEDEC Global Conference on Lead free 

Reliability and Reliability Testing, Boston, April 2007. 


Civie, P. “As the World Turns: How to Stay on your Feet Amidst Changing Global 

Environmental Policies,” International Wire Expo, Cleveland, OH, May 8, 2007. 


400

Civie, P. “National and International Policies and Their Impact on Green 

Engineering”, Worcester Polytechnical Institute, Materials Science, June 6, 2007. 

Clark, Janet, “Fostering Dialogue and Agreement on Economic Evaluations of 

Adopting Safer Alternatives,” US Society for Ecological Economics (USSEE) 

Conference – Creating Sustainability Within Our Midst, New York, NY, June 24, 

2007. 

Ellenbecker, M.J., “Air Monitoring and Engineering Controls for Airborne 

Asbestos,” presented at Current Concepts in Asbestos-Related Lung Disease, 

Harvard Medical School, Boston, MA, 2006. 

Ellenbecker, M.J., “Inhalation Exposure to Nanoparticles,” presented at the 22 nd 

International Conference on Soils, Sediments and Water, Amherst, MA, 2006. 

Ellenbecker, M.J., “Overview of the Environmental and Occupational Health 

Effects of Exposure to Nanoparticles,” Massachusetts Environmental Business 

Council, Waltham, MA, October 2006. 

Ellenbecker, M.J., “Controls and Practices Overview,” keynote address at the 

International Conference on Nanotechnology Occupational and Environmental 

Health and Safety: Research to Practice, Cincinnati, 2006. 

Ellenbecker, M.J., K. Ahn, S. Tsai, “Best Practices for Working Safely with 

Nanoparticles In University Research Laboratories,” presented at the 3 rd 

international Symposium on Nanotechnology, Occupational and Environmental 

Health, Taipei, Taiwan, August 2007. 

Ellenbecker, M., “Five Chemicals Alternatives Assessment Study,” Massachusetts 

Legislature Briefing, Oct., 2006. 

Harriman, E., “Five Chemicals Alternatives Assessment Study,” National 

Environmental Partnership Summit, New Orleans, LA, May 2007. 

Harriman, E., “MA TURI Five Chemical Alternatives Assessment Study - Potential 

for HPV to Serve as a Supplemental Data Source,” Characterizing Chemicals in 

Commerce: Using Data on High Production Volume (HPV) Chemicals, First U.S. 

Conference, Austin, TX, Dec., 2006. 

Harriman, E., “Environmental Issues in the Wire and Cable Industry,” Executive 

Forum, 55 th International Wire and Cable Symposium, Providence, RI, Nov. 2006. 


401

Luskin, J., "Healthy Children in a Healthy Valley: Reducing Exposure to Air Toxics 

- The Final Chapter, Almost," Canadian Pollution Prevention Roundtable, 

Winnipeg, CA, June 2007. 

Marshall, J., “Bio-Based Floor-Stripping Products,” Northeast Assistance and P2 

Roundtable Meeting, Bristol, RI. June 2007. 

Marshall, J., “Pick One: How to Replace Your Current Cleaning Solvent,” Office of 

Technical Assistance seminar titled Cleaner Technology and Energy 

Efficiency: Structuring a Competitive Advantage. Boxborough, MA. April 2007. 

Marshall, J., “Learning from the Experiences of Others - What’s Worked and 

What Hasn’t,” Exchange Monitor Publications & Forums’17th Annual Cleaner, 

Sustainable Industrial Materials & Process Workshop. Monterey, CA. February 

2007. 

Marshall, J., “Time to Get Your Hands Dirty - RI Workshop for Trichloroethylene 

Substitution,” EPA-funded training workshop and on-site assistance for small 

metal working shops. Providence, RI. September 2006. 

Morose, G., “Transition to Lead-free Electronics Assembly Case Study,” 

IPC/JEDEC International Conference on Lead free Electronic Assemblies and 

Components, Montreal, August 2006. 

Morose, G., “Lead-free Electronics,” Surface Mount Technology Association 

(SMTA) Boston Chapter Conference, Hudson, NH, January 23, 2007. 

Morose, G., Keynote Presentation, “The Massachusetts Toxics Use Reduction 

Institute and Lead-free Electronics,” Surface Mount Technology Association 

(SMTA) Conference – Successful Lead-free/RoHS Strategies, Boxborough, MA, 

June 21, 2007. 

Tsai, S., K. Ahn, J. Isaacs, M.J. Ellenbecker, “Monitoring of Airborne 

Nanoparticles in Research Laboratories at the Center for High-Rate 

Nanomanufacturing (CHN),” presented at the American Industrial Hygiene 

Conference & Expo (AIHCE), Philadelphia, June 2007. 

Tsai. S., E. Ada, M.J. Ellenbecker, ”Airborne Nanoparticle Exposures Associated 

with the Manual Handling of Nanoalumina in Fume Hoods,” presented at the 3 rd 

international Symposium on Nanotechnology, Occupational and Environmental 

Health, Taipei, Taiwan, August 2007. 

Tsai, S., K. Ahn, E. Ada, M.J. Ellenbecker, “Workplace Nanoparticle Exposure 

Measurement at University Research Centers,” presented at the 3 rd international 


402

Symposium on Nanotechnology, Occupational and Environmental Health, Taipei, 

Taiwan, August 2007. 

Tsai, S., K. Ahn, E. Ada, M.J. Ellenbecker, M.F. Hallock, J. Isaacs, “Workplace 

Nanoparticle Exposure Measurement at University Research Centers,” presented 

at the Campus Safety Health and Environmental Management Association 

annual meeting, Boston, July 2007. 



We collaborated with the Lowell Center for Sustainable Production (LCSP) on 

several fronts. The work funded by the CFCI is described above. In addition to 

the projects listed below, we continued to work closely with LCSP in a process of 

strategic planning to help define the future activities of the two centers and to 

prepare major funding proposals to foundations. 

Janet Clark is an advisor to the Toward Tomorrow Project (LCSP), and met 

with stakeholders for planning. 

Pam Civie and Greg Morose collaborated with the LCSP on their Clean 

Tech project. 

Heather Tenney and Liz Harriman collaborated with LCSP on the High 

Production Volume Chemical grant project for US EPA and NEWMOA. 

Rachel Massey contributed a chapter on communication of chemical 

information through the supply chain, to the LCSP’s compilation of issues 

around chemicals policy. 

The Institute and the Lowell Center also continue to collaborate on 

methodology development for alternatives assessment, and state 

chemicals policy initiatives. 

Plastics Engineering Department and the Nanomanufacturing Center for 

Excellence 

TURI has been an integral part of the university’s nanomanufacturing activities, 

as described above. 

Plastics Engineering Department 

The TURI Sustainable Research Fellows program awarded Prof. Daniel Schmidt 

$20,000 for his project titled “Green(er) PVC: The Development of Lead- and 

Phthalate-Free Formulations with Practical Utility.” 


403

Green Chemistry Program 

The TURI Sustainable Research Fellows program awarded Dr. Roger Boggs 

$17,000 for his project titled “Biobased Plasticizers: Towards the Reduction of 

the Use of DEHP.” 

Other Collaborations 

Jack Luskin collaborated with faculty in Art, English, Economics, Nursing, and 

Management Departments to incorporate TUR concepts into interdisciplinary 

courses. 

Janet Clark Chaired the UML Sustainability Team. In her role as Chair she 

organized the 2006 campus Discussion Dinner, met and coordinated with many 

centers and individuals throughout the year. This included working with faculty 

in Computer Science, Management, Regional Social and Economic Development 

and Biology on student projects and submitting a successful proposal to the EPA 

for a sustainability project dashboard. (see below) 

Michael Ellenbecker worked closely with other faculty members engaged in 

nanoparticle research in his roles as an investigator for the NSF Center for High- 

Rate Nanomanufacturing and a member of the Executive Committee of the 

Nanomanufacturing Center of Excellence. 


Toxics Use Reduction Institute Conferences and Workshops 

TUR Planner Course September 21 to October 31, 2006. Seven day training 

presented over 7 weeks. Sixteen people attended. 

TUR Planner Continuing Education Conference held on November 9, 2006. One 

hundred and eight people attended. Six sessions were offered including: 

Surface Cleaning; Process of Changing, 

New Technologies and On Site Renewable Energy, 

Industry Research Consortia; a Model with Results, 

Innovations in Cleaning; New Chemistries and Technologies, 

Measuring Progress, or “Who Stole My BRI?” 

Nanotechnology; Challenges and Opportunities. 

Internal Auditing Environmental Management System training presented on 

March 15, 2007 to 24 people. 

TUR Planner Continuing Education Conference held on April 12, 2007 in 


404

Sturbridge. Six sessions presented to 138 people. Sessions included: 

Become a Web Wizard, 

Pick One; How to Select an Alternative Cleaning Product, 

International and State Chemical Policy, 

Improving Chemical Plant Security via Greener Process Technology, 

Alternative Resource Conservation Planning, 

The TURA EMS Alternative. 

Multiplying Lean Benefits- Seeing All Wastes held on May 20, 2007 in Sturbridge. 

Twenty-six people attended. 

Pam Civie convened and managed the 10th TURI working group on 

Environmental Management Systems hosted at Teradyne and M/A-Com for 7 

sessions, with regular participation from six other companies and other state 

government staff. 

Dr. Ellenbecker helped organize, and TURI co-sponsored the workshop “Risk 

Assessment for Nanomaterials: Current Developments and Trends,” which was 

held at MIT on May 29, 2007. Dr. Ellenbecker presented a lecture on the 

inhalation exposure risk for nanoparticles. One hundred and eleven people 

attended. 

State Government Collaboration 

The Institute works closely with other state agencies on TUR, but this has been 

particularly true in response to new legislation. Our collaborations with the 

Executive Office of Energy and Environmental Affairs, the Department of 

Environmental Protection and the Office of Technical Assistance involve weekly 

meetings and joint publications, training and sector programs. 

Other Outreach 

“Reducing Toxics in Your Life” Presented by Joy Onasch at the following events:– 

Toxics Action Center annual conference: March 2007 

Lowell Watershed Congress – Youth event: May 2007 

Rhode Island Sustainable Living Conference: June 2007 

TURI wrote, published and distributed two pamphlets specifically aimed at 

community groups, title "10 Tips for a Healthy, Pesticide Free Lawn" and "10 


405

Ways to Find Safer Cleaners". The Community Program also attended several 

community events to raise awareness such as the Lawrence and Lowell Earth 

Day festivals. 

TURI honored our industry and community partners at a large statehouse event 

in June. 

Janet Clark served as Advisor for the NEWMOA (New England Waste 

Management Officials Association) Energy and Materials Flow and Cost Tracker 

(EMFACT) Project. 

Janet Clark arranged for Marcia Deegler (Massachusetts Environmentally 

Preferable Purchasing Program manager) to offer a workshop for TURI, LCSP 

and UML teams 

Janet Clark participated in the Distinct Identity Campaign of the University 

President's Office; she also lectured at Clark University on TUR. 

Our Community Grant Boy Scout, Michael Browne, received Field and Stream 

Magazine’s Hero of Conservation Award for his work to eliminate lead fishing 

sinkers in Massachusetts. 

Articles in the Popular Press 

UML bestows grants to eco-minded organizations 

9/2/07 Lowell Sun article about TURI's 2008 Community Grant Recipients 

URL: http://www.lowellsun.com/ci_6786307 

UMass Lowell Helps Tech Firms Get the Lead Out 

7/27/07 article in Mass High Tech about the New England Lead Free 

Consortium work, including quotes from Greg Morose, TURI project manager. 

URL: http://www.bizjournals.com/masshightech/stories/2007/07/30/story12.html 

Pb-free PTH Rework on a Thick, Heavy Assembly 

August 2007 Cover Story in Circuits Assembly magazine about the New 

England Lead Free Consortium's rework on lead-free boards with minimal 

copper dissolution. 


406

URL: http://circuitsassembly.com/cms/content/view/5201/95/ 

Go green, make green 

6/6/07 article in the Worcester Business Journal about Pam Civie of TURI 

presenting at a symposium. 

URL: http://wbjournal.com/j/index.php?option=com_content&task=view&id=1852&Itemid=129 

Upcoming Boston Lead-Free Conference 

May 24th article in Surface Mount Technology magazine, Greg Morose of TURI 

is the keynote speaker at SMTA's "Successful Lead-free/RoHS Strategies" 

conference, June 20–21 in Boxborough, Mass. 

URL: http://smt.pennnet.com/display_article/293601/35/ARTCL/none/HMST/Upcoming- 

Boston-Lead-free-Conference/&reason=0 

TURI Seeks to Help Firms Find Chemical Alternatives 

3/21/07 article in the Lowell Sun about how TURI can help companies and 

community groups reduce toxic use. 

URL: http://www.uml.edu/Media/News%20Articles/TURI_seeks_to_help_f.html 

Clearing Air on Industrial Chemicals 

12/8/06 Letter to the Editor of the Boston Globe from Michael Ellenbecker about the 

Danvers chemical explosion. 

URL: 

http://www.boston.com/news/globe/editorial_opinion/letters/articles/2006/12/08/clearing_air_on_industrial_chemicals/ 


12/06 issue of Environmental Health Perspectives discusses TURI and the new 

cleaner solutions database. 

URL: http://www.ehponline.org/docs/2006/114-12/forum.html 

Toxics Use Reduction Institute offers database of green cleaning products. 

10/6/06 article in Facilities Management News about the TURI cleaner solutions 

database. 


407

URL: http://www.fmlink.com/News/Articles/news.cgi?catid=1008&display=article&id=21757 

Watertown auto shops receive grants to go "greener" 

11/16/06 article in the Boston Globe about TURI awarding the Town of 

Watertown a community grant. 

URL: http://www.boston.com/news/globe/west/2006/11/auto_shops_rece.html 

Seven Community Projects Tackle Toxic Chemical Use 

11/06 Article in the University of Massachusetts Lowell Shuttle Newsletter. 

URL: http://www.uml.edu/media/enews/print_1_110745_110745.html 

Toxics Use Reduction Institute (TURI) Launches New Solvent Substitution Database 

10/5/06 ChemAlliance.org 

URL: http://www.chemalliance.org/news/news_detail.asp?StoryID=2021 

New Online Cleaning Database Help Manufacturers Switch to Safer Chemistries 

9/28/06 Article in GreenBiz.com 

URL: http://www.greenbiz.com/news/news_third.cfm?NewsID=34077 


Toxics Use Reduction Program core funding, Commonwealth of Massachusetts, $1,324,000 

(awarded). 

Regional Mobile Surface Cleaning Laboratory, submitted to EPA, $91,000. 

A proposal to conduct long-term reliability testing for lead-free and halogen-free 

printed wiring boards used in the electronics industry. U.S. EPA Source 

Reduction Assistance Grants Program, $50,000. 

Support for Wet Cleaning Demonstration Project, submitted to National Grid, 

$5,000. 

Supporting Entrepreneurial Opportunity in Innovation for Safer Product Design, 

submitted to the Ewing Marion Kauffman Foundation, $70,000. 


408

Creating a Sustainable Project Dashboard, submitted to the EPA, $10,000 

(awarded). 

Veterans Administration, evaluate bio-based replacements for floor stripping and 

hard surface cleaning, $31,000 (awarded). 

EPA Region I, identify small metal finishing companies using trichloroethylene 

(TCE) in Rhode Island and to assist those companies in reducing or eliminating 

their TCE use, $14,000 (awarded). 


409

31. TSONGAS INDUSTRIAL HISTORY CENTER 

Annual Report 

2006-2007 

1. Mission Statement of Center/Institute: The Tsongas Industrial History Center is a 

cooperative educational project of the UMASS Lowell Graduate School of 

Education and Lowell National Historical Park. Within the overall mission of 

UMASS Lowell to assist in sustainable regional, economic and social 

development, the mission of the Tsongas Industrial History Center is to assist K- 

12 teachers and students in the study of the causes and consequences of industrial 

development, decline, and renewal through visits to Lowell National Historical 

Park. In addition, we assist National Parks to expand their educational 

partnerships and programs. 

2. General Description and Goals: The Tsongas Industrial History Center is a unique 

partnership between a University and a National Park to (1) implement all Park 

educational programs for schools by engaging more than 60,000 students annually 

in experiential learning experiences organized around industrial history themes 

carefully linked with national and state curriculum standards at specified grades; 

(2) serve as a lab school for teachers in training and a professional development 

center for teachers by providing graduate courses on industrial history and 

curriculum development, and (3) serve as model of an educational partnership and 

as a training center for leaders anxious to expand education programs and 

partnerships in National Parks. 

3. Research and Programming Focus Areas: 

• Support for a Greater Lowell Regional Environmental Education Alliance to 

expand environmental programming for Merrimack Valley students in grades 

5-12 

• Support for after school programming at the Rogers School 

• Support for the expanded outreach to position the Tsongas Center as a STEM 

resource 

• Service Learning Project with the College of Engineering and the 

development of science programming within Industrial History themes 

4. Associated Personnel (Faculty, Staff) in 2006-2007: 

Graduate School of Education: Dr. Anita Greenwood, Dr. Patricia Fontaine, Dr. 

JoAnn Brewer, Dr. Michelle Scribner-McLean, Dr. Judith Boccia, Dr. 

Brenda Jochums-Slez (emerita); 

History Department: Dr. Chad Montrie 

College of Engineering: Dr. John Duffy, Dr. David Kazmer, Dr. Robert Tuholski 

English and American Studies: Dr. Melissa Pennell and Dr. Diana Archibald 

Environmental, Earth, and Atmospheric Sciences: Dr. Arnold O’Brien 

Tsongas Industrial History Center 

410

Toxics Use Reduction Institute: Joy Onasch 

RESD: Dr. William Maas, Dr. Bob Forrant 

5. New Faculty Affiliations: Dr.Jack Luskin, TURI; Dr. Bridgett Marshall, English 

Department; Paula Haines, ESL. 

6. Students Supported: Since the Tsongas Center is a University Service Center, CFCI 

funding was not used to support graduate students, but rather to support a grantfunded 

project assistant, Dr. Timothy LaVallee who developed and coordinated an 

after school program on environmental stewardship for Rogers School which total 

reached 20 students during the regular after school program and 200 people at Earth 

Fest, April 28 th , the culminating event. Dr.LaVallee was also supported in his role as 

the coordinator of the Merrimack Watershed Youth Congress, and various outreach 

environmental activities at local schools, Woburn, Greater Lowell Regional Tech, 

Lowell schools, reaching approximately 500 students. 

7. Current Research Projects: The Tsongas Center is working with Lowell High 

School to pilot a 9 th grade science program that meets their need for physics based 

programming by combining two of our existing programs. 

8. Publications in 2007: Francis Saves the City, a biography of James B. Francis for 

children. Francis was the chief engineer for the Lowell textile industry for whom the 

UML College of Engineering is named. 

9. Presentations: 

• New England Groundwater Institute- 23 teachers from New England states 

• Museum Institute for Teaching Science – 6 teachers K – 8. 

• National Endowment for the Humanities Institute – 130 teachers representing 27 

states. 

• Teacher to Teacher Institute – collaboration with national Department of 

Education with 75 tachers attending from 12 states. 

• Tri-tech Teachers Institute – 26 teachers from Malden, Medford, Everett and 

Revere. 

10. Collaboration with other Centers/Institutes and/or Departments: 

• Engineering- SPLICE service learning project 

• CITA: Hosted the CITA Conference 

• Center for Family, Work, and Community: facilitating a collaboration between the 

River Ambassadors and Lowell National Historical Park 

• Planning with TURI for teachers’ institute for 2008, Toxics, Health and 

Sustainability 


Government Agencies, schools, etc.): 

• Served 60,000 teachers and students through educational programs. Special 

events, and teacher institutes in partnership with Lowell National Historical Park 


411

• Lowell Public Schools and UML Publications Office: Teacher Institutes and 

development of a “Save Our History Acre Family Activity Guide;” 

• UML Community-University Partnership Task Force 

• Teacher Institutes funded by the National Endowment for Humanities 

• Museum Institute for Teaching Science summer teacher institute 

Proposals Awarded 2006-2007 (selection): 

• National Endowment for the Humanities October 2006-September 07 

$224,000 

Plan, Implement, Evaluate 3 National Institutes for 135 teachers: 

Inventing America - Lowell and the Industrial Revolution Summer 2007 

• Massachusetts Cultural Council 7/1/05-6/30/08 $18,000 

Operating Support ($6000 per year) 

• Fish Foundation and Cape Cod Five 2006 $15,000 

TIHC, UML, LNHP Strategic Planning 

•Essex National Heritage Commission 2006 $2,000 

Outreach to Lawrence Schools 

•Tritec US Spet of Education Teaching American with Malden and other 

districts 

Summer 2007 Teacher institute $20,000 

• Museum Institute for Teaching Science Summer 2007 $9, 800 

Summer Teacher institute 

•National Park Service Providing Technical Assistance, Developing 

Curriculum Materials, special programs for Lowell National Historical 

Park $300,000 

• Greater Lowell Community Foundation, $4,800 – Support for environmental 

activities. 

• National Endowment for the Humanities, Oct 07-Sept 08 Plan, Implement, 

Evaluate 3 National Institutes for 135 teachers: $224,000. 

Proposals submitted pending: 

Institute for Museum and Library Services (IMLS) Ethnicity, Identity and Culture: 

RE-inventing Lowell’s museums and libraries for the 21 st century—Immigration 

Project Planning Grant: $30,000. 


412

CFCI - University of Massachusetts Lowell

Create successful ePaper yourself

Delete template?

Save as template?