John M. S. Bartlett.pdf - Bio-Nica.info

TM 

Methods in Molecular Biology 

Volume 226 

PCR 

Protocols 

SECOND EDITION 

Edited by 

John M. S. Bartlett 

David Stirling

Contents 

1. A Short History of the Polymerase Chain Reaction 3 

John M. S. Bartlett and David Stirling 

2. PCR Patent Issues 7 

Peter Carroll and David Casimir 

3. Equipping and Establishing a PCR Laboratory 15 

Susan McDonagh 

4. Quality Control in PCR 20 

David Stirling 

5. Extraction of Nucleic Acid Templates 27 


6. Extraction of DNA from Whole Blood 29 

John M. S. Bartlett and Anne White 

7. DNA Extraction from Tissue 33 

Helen Pearson and David Stirling 

8. Extraction of DNA from Microdissected Archival Tissues 35 

James J. Going 

9. RNA Extraction from Blood 43 

Helen Pearson 

10. RNA Extraction from Frozen Tissue 45 


11. RNA Extraction from Tissue Sections 47 

Helen Pearson 

12. Dual DNA/RNA Extraction 49 

David Stirling and John M. S. Bartlett 

13. DNA Extraction from Fungi, Yeast, and Bacteria 53 


14. Isolation of RNA Viruses from Biological Materials 55 


15. Extraction of Ancient DNA 57 

Wera M. Schmerer 

16. DNA Extraction from Plasma and Serum 63 


17. Technical Notes for the Detection of Nucleic Acids 65 


18. Technical Notes for the Recovery and Purificationof PCR Products from Acrylamide Gels 77 


19. PCR Primer Design 81 

David L. Hyndman and Masato Mitsuhashi 

20. Optimization of Polymerase Chain Reactions 89 

Haiying Grunenwald 

21. Subcycling PCR for Long-Distance Amplificationsof Regions with High and Low 

Guanine–Cystine Content---- Amplification of the Intron 22 Inversion of the FVIII Gene 

David Stirling 101 

22. Rapid Amplification of cDNA Ends 

i

Xin Wang and W. Scott Young III 105 

23. Randomly Amplified Polymorphic DNA Fingerprinting--The Basics 117 

Ranil S. Dassanayake and Lakshman P. Samaranayake 

24. Microsphere-Based Single NucleotidePolymorphism Genotyping 123 

Marie A. Iannone, J. David Taylor, Jingwen Chen, May-Sung Li,Fei Ye, and Michael P. Weiner 

25. Ligase Chain Reaction 135 

William H. Benjamin, Jr., Kim R. Smith, and Ken B. Waites 

26. Nested RT-PCR in a Single Closed Tube 151 

Antonio Olmos, Olga Esteban, Edson Bertolini, and Mariano Cambra 

27. Direct PCR from Serum 161 

kenji Abe 

28. Long PCR Amplification of Large Fragmentsof Viral Genomes 167 

---A Technical Overview 

Raymond Tellier, Jens Bukh, Suzanne U. Emerson, and Robert H. Purcell 

29. Long PCR Methodology 173 


30. Qualitative and Quantitative PCR-----A Technical Overview 181 


31. Ultrasensitive PCR Detection of Tumor Cells in Myeloma 185 

Friedrich W. Cremer and Marion Moos 

32. Ultrasensitive Quantitative PCR to Detect RNA Viruses 197 


33. Quantitative PCR for cAMP RI Alpha mRNA 205 

---- Use of Site-Directed Mutation and PCR Mimics 


34. Quantitation of Multiple RNA Species 211 

Ron Kerr 

35. Differential Display----- A Technical Overview 217 


36. AU-Differential Display, Reproducibilityof a Differential mRNA Display Targeted to AU Motifs 225 

Orlando Dominguez, Lidia Sabater, Yaqoub Ashhab,Eva Belloso, and Ricardo Pujol-Borrell 

37. PCR Fluorescence Differential Display 237 

Kostya Khalturin, Sergej Kuznetsov, and Thomas C. G. Bosch 

38. Microarray Analysis Using RNA Arbitrarily Primed PCR 245 

Steven Ringquist, Gaelle Rondeau, Rosa-Ana Risques,Takuya Higashiyama, Yi- 

Peng Wang, Steffen Porwollik,David Boyle, Michael McClelland, and John Welsh 

39. Oligonucleotide Arrays for Genotyping 255 

--- Enzymatic Methods for Typing Single Nucleotide Polymorphisms and Short 

Tandem Repeats 

Stephen Case-Green, Clare Pritchard, and Edwin Southern 

40. Serial Analysis of Gene Expression 271 

Karin A. Oien 

41. Mutation and Polymorphism Detection----- A Technical Overview 287 

Joanne Edwards and John M. S. Bartlett 

42. Combining Multiplex and Touchdown PCRfor Microsatellite Analysis 295 

Kanokporn Rithidech and John J. Dunn 

ii

43. Detection of Microsatellite Instability and Lossof Heterozygosity Using DNA 

Extracted fromFormalin-Fixed Paraffin-Embedded Tumor Materialby Fluorescence- 

Based Multiplex Microsatellite PCR 301 


44. Reduction of Shadow Band Synthesis DuringPCR Amplification of Repetitive 

Sequencesfrom Modern and Ancient DNA 309 


45. Degenerate Oligonucleotide-Primed PCR 315 

Michaela Aubele and Jan Smida 

46. Mutation Detection Using RT-PCR-RFLP 

Hitoshi Nakashima, Mitsuteru Akahoshi, and Yosuke Tanaka 319 

47. Multiplex Amplification RefractoryMutation System for the Detectionof 

Prothrombotic Polymorphisms 323 


48. PCR-SSCP Analysis of Polymorphism 328 

--- A Simple and Sensitive Method for Detecting DifferencesBetween Short Segments of DNA 

Mei Han and Mary Ann Robinson 

49. Sequencing---- A Technical Overview 337 


50. Preparation and Direct Automated Cycle Sequencingof PCR Products 341 

Susan E. Daniels 

51. Nonradioactive PCR Sequencing Using Digoxigenin 347 

Siegfried Kösel, Christoph B. Lücking, Rupert Egensperger,and Manuel B. Graeber 

52. Direct Sequencing by Thermal Asymmetric PCR 355 

Georges-Raoul Mazars and Charles Theillet 

53. Analysis of Nucleotide Sequence Variationsby Solid-Phase Minisequencing 361 

Anu Suomalainen and Ann-Christine Syvänen 

54. Direct Sequencing with Highly Degenerateand Inosine-Containing Primers 367 

Zhiyuan Shen, Jingmei Liu, Robert L. Wells, and Mortimer M. Elkind 

55. Determination of Unknown Genomic SequencesWithout Cloning 373 

Jean-Pierre Quivy and Peter B. Becker 

56. Cloning PCR Products for Sequencing in M13 Vectors 385 

David Walsh 

57. DNA Rescue by the Vectorette Method 393 

Marcia A. McAleer, Alison J. Coffey, and Ian Dunham 

58. Technical Notes for Sequencing Difficult Templates 401 


59. PCR-Based Detection of Nucleic Acidsin Chromosomes, Cells, and Tissues 405 

Technical Considerations on PRINS and In Situ PCR and Comparison with In Situ Hybridization 

Ernst J. M. Speel, Frans C. S. Ramaekers, and Anton H. N. Hopman 

60. Cycling Primed In Situ Amplification 425 

John H. Bull and Lynn Paskins 

61. Direct and Indirect In Situ PCR 433 

Klaus Hermann Wiedorn and Torsten Goldmann 

62. Reverse Transcriptase In Situ PCR----New Methods in Cellular Interrogation 445 

Mark Gilchrist and A. Dean Befus 

iii

63. Primed In Situ Nucleic Acid Labeling Combined with Immunocytochemistry to 

Simultaneously Localize DNA and Proteins in Cells and Chromosomes 453 


64. Cloning and Mutagenesis--- A Technical Overview 467 


65. Using T4 DNA Polymeraseto Generate Clonable PCR Products 469 

Kai Wang 

66. A T-Linker Strategy for Modificationand Directional Cloning of PCR Products 475 

Robert M. Horton, Raghavanpillai Raju, and Bianca M. Conti-Fine 

67. Cloning Gene Family Members Using PCRwith Degenerate Oligonucleotide Primers 

Gregory M. Preston 485 

68. cDNA Libraries from a Low Amount of Cells 499 

Philippe Ravassard, Christine Icard-Liepkalns, Jacques Mallet,and Jean Baptiste 

Dumas Milne Edwards 

69. Creation of Chimeric Junctions, Deletions, and Insertions by PCR 511 

Genevieve Pont-Kingdon 

70. Recombination and Site-Directed MutagenesisUsing Recombination PCR 517 

Douglas H. Jones and Stanley C. Winistorfer 

71. Megaprimer PCR---- Application in Mutagenesis and Gene Fusion 525 

Emily Burke and Sailen Barik 

iv

History of PCR 3 

1 

A Short History of the Polymerase Chain Reaction 

John M. S. Bartlett and David Stirling 

The development of the polymerase chain reaction (PCR) has often been likened 

to the development of the Internet, and although this does risk overstating the impact 

of PCR outside the scientific community, the comparison works well on a number 

of levels. Both inventions have emerged in the last 20 years to the point where it is 

difficult to imagine life without them. Both have grown far beyond the confines of 

their original simple design and have created opportunities unimaginable before their 

invention. Both have also spawned a whole new vocabulary and professionals literate 

in that vocabulary. It is hard to believe that the technique that formed the cornerstone of 

the human genome project and is fundamental to many molecular biology laboratory 

protocols was discovered only 20 years ago. For many, the history and some of the 

enduring controversies are unknown yet, as with the discovery of the structure of DNA 

in the 1950s, the discovery of PCR is the subject of claim and counterclaim that has 

yet to be fully resolved. The key stages are reviewed here in brief for those for whom 

both the history and application of science holds interest. 

The origins of PCR as we know it today sprang from key research performed in 

the early 1980s at Cetus Corporation in California. The story is that in the spring of 

1983, Kary Mullis had the original idea for PCR while cruising in a Honda Civic on 

Highway 128 from San Francisco to Mendocino. This idea claimed to be the origin 

of the modern PCR technique used around the world today that forms the foundation 

of the key PCR patents. The results for Mullis were no less satisfying; after an initial 

$10,000 bonus from Cetus Corporation, he was awarded the 1993 Nobel Prize for 

chemistry. 

The original concept for PCR, like many good ideas, was an amalgamation of 

several components that were already in existence: The synthesis of short lengths of 

single-stranded DNA (oligonucleotides) and the use of these to direct the target-specific 

synthesis of new DNA copies using DNA polymerases were already standard tools in 

the repertoire of the molecular biologists of the time. The novelty in Mullis’s concept 

was using the juxtaposition of two oligonucleotides, complementary to opposite strands 

of the DNA, to specifically amplify the region between them and to achieve this in a 

repetitive manner so that the product of one round of polymerase activity was added 

to the pool of template for the next round, hence the chain reaction. In his History of 

PCR (1), Paul Rabinow quotes Mullis as saying: 

From: Methods in Molecular Biology, Vol. 226: PCR Protocols, Second Edition 

Edited by: J. M. S. Bartlett and D. Stirling © Humana Press Inc., Totowa, NJ 

3

4 Bartlett and Stirling 

The thing that was the “Aha!” the “Eureka!” thing about PCR wasn’t just putting those 

[things] together…the remarkable part is that you will pull out a little piece of DNA from 

its context, and that’s what you will get amplified. That was the thing that said, “you could 

use this to isolate a fragment of DNA from a complex piece of DNA, from its context.” 

That was what I think of as the genius thing.…In a sense, I put together elements that 

were already there.…You can’t make up new elements, usually. The new element, if any, 

it was the combination, the way they were used.…The fact that I would do it over and over 

again, and the fact that I would do it in just the way I did, that made it an invention…the 

legal wording is “presents an unanticipated solution to a long-standing problem,” that’s 

an invention and that was clearly PCR. 

In fact, although Mullis is widely credited with the original invention of PCR, 

the successful application of PCR as we know it today required considerable further 

development by his colleagues at Cetus Corp, including colleagues in Henry Erlich’s 

lab (2–4), and the timely isolation of a thermostable polymerase enzyme from a 

thermophilic bacterium isolated from thermal springs. Furthermore, challenges to the 

PCR patents held by Hoffman La Roche have claimed at least one incidence of “prior 

art,” that is, that the original invention of PCR was known before Mullis’s work in the 

mid-1980s. This challenge is based on early studies by Khorana et al. in the late 1960s 

and early 1970s (see chapter 2). Khorana’s work used a method that he termed repair 

replication, and its similarity to PCR can be seen in the following steps: (1) annealing 

of primers to templates and template extension; (2) separation of the newly synthesized 

strand from the template; and (3) re-annealing of the primer and repetition of the cycle. 

Readers are referred to an extensive web-based literature on the patent challenges 

arising from this “prior art” and to chapter 2 herein for further details. Whatever the 

final outcome, it is clear that much of the work that has made PCR such a widely 

used methodology arose from the laboratories of Mullis and Erlich at Cetus in the 

mid-1980s. 

The DNA polymerase originally used for the PCR was extracted from the bacterium 

Escherichia coli. Although this enzyme had been a valuable tool for a wide range of 

applications and had allowed the explosion in DNA sequencing technologies in the 

preceding decade, it had distinct disadvantages in PCR. For PCR, the reaction must 

be heated to denature the double-stranded DNA product after each round of synthesis. 

Unfortunately, heating also irreversibly inactivated the E. coli DNA polymerase, 

and therefore fresh aliquots of enzyme had to be added by hand at the start of each 

cycle. What was required was a DNA polymerase that remained stable during the 

DNA denaturation step performed at around 95°C. The solution was found when the 

bacterium Thermophilus aquaticus was isolated from hot springs, where it survived 

and proliferated at extremely high temperatures, and yielded a DNA polymerase that 

was not rapidly inactivated at high temperatures. Gelfand and his associates at Cetus 

purified and subsequently cloned this polymerase (5,6), allowing a complete PCR 

amplification to be created without opening the reaction tube. Furthermore, because the 

enzyme was isolated from a thermophilic organism, it functioned optimally at temperature 

of around 72°C, allowing the DNA synthesis step to be performed at higher 

temperatures than was possible with the E. coli enzyme, which ensured that the 

template DNA strand could be copied with higher fidelity as the result of a greater 

stringency of primer binding, eliminating the nonspecific products that had plagued 

earlier attempts at PCR amplification.

History of PCR 5 

Fig. 1. Results of a PubMed search for articles containing the phrase “Polymerase Chain 

Reaction.” Graph shows number of articles listed in each year. 

However, even with this improvement, the PCR technique was laborious and slow, 

requiring manual transfer between water baths at different temperatures. The first 

thermocycling machine, “Mr Cycle,” which replicated the temperature changes required 

for the PCR reaction without the need for manual transfer, was developed by Cetus 

to facilitate the addition of fresh thermolabile polymerases. After the purification of 

Taq polymerase, Cetus and Perkin–Elmer introduced the closed DNA thermal cyclers 

that are widely used today (7). 

That PCR has become one of the most widely used tools in molecular biology is 

clear from Fig. 1. What is not clear from this simplistic analysis of the literature is the 

huge range of questions that PCR is being used to answer. Another scientist at Cetus, 

Stephen Scharf, is quoted as stating that 

…the truly astonishing thing about PCR is precisely that it wasn’t designed to solve 

a problem; once it existed, problems began to emerge to which it could be applied. One 

of PCR’s distinctive characteristics is unquestionably its extraordinary versatility. That 

versatility is more than its ‘applicability’ to many different situations. PCR is a tool that 

has the power to create new situations for its use and those required to use it. 

More than 3% of all PubMed citations now refer to PCR (Fig. 2). Techniques have 

been developed in areas as diverse as criminal forensic investigations, food science, 

ecological field studies, and diagnostic medicine. Just as diverse are the range of 

adaptations and variations on the original theme, some of which are exemplified in 

this volume. The enormous advances made in our understanding of the human genome 

(and that of many other species), would not have been possible, where it not for the 

remarkable simple and yet exquisitely adaptable technique which is PCR.

6 Bartlett and Stirling 

Fig. 2. Results of a PubMed search for articles containing the phrase “Polymerase Chain 

Reaction.” Graph shows number of articles listed in each year expressed as a percentage of 

the total PubMed citations for each year. 

References 

1. Rabinow, P. (1996) Making PCR: A Story of Biotechnology. University of Chicago Press, 

Chicago. 

2. Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., and Erlich, H. (1985) Enzymatic 

amplification of beta-globin genomic sequences and restriction site analysis for diagnosis 

of sickle cell anemia. Science 230, 1350–1354. 

3. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986) Specific 

enzymatic amplification of DNA in vitro: The polymerase chain reaction. Cold Spring 

Harbor Symp. Quant. Biol. 51, 263–273. 

4. Mullis, K. and Faloona, F. (1987) Specific synthesis of DNA in vitro via a polymerasecatalyzed 

chain reaction. Methods Enzymol. 155, 335–350. 

5. Saiki, R., Gelfand, D., Stoffel, S., Scharf, S., Higuchi, R., Horn, et al. (1988) Primerdirected 

enzymatic amplification of DNA with a thermostable DNA polymerase. Science 

239, 487– 491. 

6. Lawyer, F., Stoffer, S, Saiki, R., Chang, S., Landre, P., Abramson, R., et al. (1993) Highlevel 

expression, purification, and enzymatic characterization of full-length Thermus 

aquaticus DNA polymerase and a truncated form deficient in 5′ to 3′ exonuclease activity. 

PCR Methods Appl. 2, 275–287. 

7. http://www.si.edu/archives/ihd/videocatalog/9577.htm

PCR Patent Issues 7 

2 

PCR Patent Issues 

Peter Carroll and David Casimir 

1. Introduction 

The science of the so-called polymerase chain reaction (PCR) is now well known. 

However, the legal story associated with PCR is, for the most part, not understood and 

constantly changing. This presents difficulties for scientists, whether in academia or 

industry, who wish to practice the PCR process. This chapter summarizes the major 

issues related to obtaining rights to practice PCR. The complexity of the patent system 

is explained with a few PCR-specific examples highlighted. The chapter also provides 

an overview of the exemption or exception from patent infringement associated with 

certain bona-fide researchers and discusses the status of certain high-profile patents 

covering aspects of the PCR process. 

2. Intellectual Property Rights 

Various aspects of the PCR process, including the method itself, are protected by 

patents in the United States and around the world. As a general rule, patents give the 

patent owner the exclusive right to make, use, and sell the compositions or process 

claimed by the patent. If someone makes, uses, or sells the patented invention in 

a country with an issued patent, the patent owner can invoke the legal system of 

that country to stop future infringing activities and possibly recover money from the 

infringer. 

A patent owner has the right to allow, disallow, or set the terms under which 

people make, use, and sell the invention claimed in their patents. In an extreme 

situation, a patent owner can exclude everyone from making, using, and selling the 

invention, even under conditions where the patent owner does not produce the product 

themselves—effectively removing the invention from the public for the lifetime of the 

patent (typically 20 years from the filing date of the patent). If a patent owner chooses 

to allow others to make, use, or sell the invention, they can contractually control nearly 

every aspect of how the invention is disbursed to the public or to certain companies 

or individuals, so long as they are not unfairly controlling products not covered by 

the patent. For example, a patent owner can select or exclude certain fields of use for 

methods like PCR (e.g., research use, clinical use, etc.) while allowing others. 

There are an extraordinary number of patents related to the PCR technology. For 

example, in the United States alone, there are more than 600 patents claiming aspects 



7

8 Carroll and Casimir 

of PCR. Such patents cover the basic methods itself (originally owned by Cetus 

Corporation and now owned by Hoffmann-LaRoche), thermostable polymerases 

useful in PCR, as well as many non-PCR applications, (e.g., Taq polymerase, Tth 

polymerase, Pfu polymerase, KOD polymerase, Tne polymerase, Tma polymerase, 

modified polymerases, etc.), devices used in PCR (e.g., thermocyclers, sample tubes 

and vessels, solid supports, etc.), reagents (e.g., analyte-specific amplification primers, 

buffers, internal standards, etc.), and applications involving the PCR process (e.g., 

reverse-transcription PCR, nested PCR, multiplex PCR, nucleic acid sequencing, and 

detection of specific analytes). This collection of patents is owned by a wide variety 

of entities, including government agencies, corporations, individual inventors, and 

universities. However, the most significant patents (see Table 1), covering the basic 

PCR method, the most widely used polymerase (Taq polymerase), and thermocyclers, 

are assigned to Hoffmann-LaRoche and are controlled by Hoffmann-LaRoche or 

Applera Corporation (previously known as PE/Applied Biosystems) and are available 

to the public through an intricate web of licenses. 

3. Navigating the PCR Patent Minefield 

The following discussion focuses on issues related to the earliest and most basic 

PCR-related patents. A full analysis of the hundreds of PCR-related patents is not 

practical in an article this size, let alone a multivolume treatise. It is hoped that the 

following discussion will provide a preliminary framework for understanding the broad 

PCR patent landscape. 

The early PCR patents now owned by Hoffmann-LaRoche have been aggressively 

enforced. In particular, the earliest patents intended to cover the basic PCR method and 

the Taq polymerase enzyme (U.S. Patent No. 4,683,202 to Kary Mullis, U.S. Patent 

No. 4,683,195 to Kary Mullis et al., U.S. Patent No. 4,889,818 to Gelfand et al. and 

foreign counterparts) have regularly been litigated and used to threaten litigation, 

even against academic researchers. This aggressive patent stance has created an 

environment of fear, confusion, and debate, particularly at universities and among 

academic researchers. Because of this aggressive patent enforcement, issues with 

respect to these patents are most relevant and are focused on herein. 

3.1. Obtaining Rights to Practice PCR 

In the case of the early PCR patents, Hoffmann-LaRoche, directly and through 

certain designated partners, has made PCR available to the public under specific conditions, 

depending on the intended use of the method (see for availability of licenses and current details). For example, for 

nonsequencing research use, PCR users have two options. They can individually 

negotiate a license from Applera (a proposition that is impractical for many researchers). 

Optionally, they can purchase “certain reagents” from a “licensed supplier” in 

conjunction with the use of “an authorized thermal cycler.” This essentially means 

that the user must purchase thermostable enzymes and thermocyclers from suppliers 

licensed by Hoffmann-LaRoche or Applera. Not surprisingly, the price of these 

products from licensed suppliers greatly exceeds the price of equivalent products from 

nonlicensed suppliers. Indeed, thermostable enzymes from licensed suppliers may


Table 1 

PCR Patents 

U.S. patent Issue Expiration Related international 

number date date patents Claimed technology 

4,683,195 07/28/87 03/28/05 Australia: 591104B Amplification methods 

Australia: 586233B 

Canada: 134012B 

Europe: 200362B 



Japan: 2546576B 

Japan: 2622327B 

Japan: 4067957B 

Japan: 4067960B 

4,683,202 07/28/87 03/28/05 Same as 4,683,195 Amplification methods 

4,965,188 10/23/90 03/28/05 Australia: 586233B Amplification methods using 


thermostable polymerases 



Canada: 1340121B 








Japan: 2502041B 

Japan: many others 

4,889,818 12/26/86 12/26/06 Australia: 632857B Purified Taq polymerase 

(currently Europe: 258017B enzyme 

unenforceable) Japan: 2502041B 

Japan: 2502042B 

Japan: 2719529B 

Japan: 3031434B 

Japan: 5074345B 

Japan: 8024570B 

5,079,352 01/07/92 01/07/09 Same as 4,889,818, Recombinant Taq 

plus 

polymerase enzyme 


and fragments 

Japan: 2511548B 

Japan: 2511548B 

5,038,852 8/13/91 08/13/08 Australia: 612316B Apparatus and method for 


performing automated 


amplification 

Japan: 2613877B


cost more than twice as much as from nonlicensed suppliers (1). This elevated cost 

can place a substantial financial burden on researchers who require heavy PCR usage, 

particularly academic researchers on fixed and limited grant budgets. To the extent 

universities require their researchers to used licensed products, the aggregate cost 

increase for many large research universities is substantial. (For a list of Taq polymerase 

suppliers and prices, including licensed and unlicensed suppliers, see Constans, ref. 2). 

3.2. Bona-Fide Researchers Are Not Infringers 

As mentioned previously, Hoffmann-LaRoche has taken the position that academic 

researchers are infringers of their patents if they are not meeting the prescribed licensing 

requirements (e.g., not purchasing authorized reagents and equipment). At one point. 

several years ago, Hoffmann-LaRoche specifically named more than 40 American 

universities and government laboratories and more than 200 individual scientists as 

directly infringing certain patents through their basic research (3). Voicing the view 

of many researchers, Dr. Arthur Kornberg, professor emeritus at Stanford University 

and Nobel laureate, has stated that the actions by Hoffmann-LaRoche to restrain the 

use and extension of PCR technology by universities and nonprofit basic research 

institutions “violated practices and principles basic to the advancement of knowledge 

for the public welfare.” 

Fortunately for academic researchers, the laws of the United States and other 

jurisdictions agree with Dr. Kornberg. US patent law recognizes an exemption or 

exception from infringement associated with bona-fide research (i.e., not-for-profit 

activities). The experimental use exception to the patent infringement provisions of 

US law has its origins in the notion that “it could never have been the intention of 

the legislature to punish a man, who constructed…a [patented] machine merely for 

philosophical experiments….” (4). An authoritative discussion on the research use 

exception appears in the case Roche Prods., Inc. v Bolar Pharmaceutical Co. (5). 

Even though this case is generally considered to restrict the scope of the research use 

exemption (failing to find noninfringement where the defendant’s acts were “solely 

for business reasons”), the case makes it clear that the exception is alive and well 

where the acts are “for amusement, to satisfy idle curiosity, or for strictly philosophical 

inquiry.” Thus, to the extent that researchers’ use of PCR is not applied to commercial 

applications or development (e.g., for-sale product development, for-profit diagnostic 

testing), the researchers cannot be considered infringers. For example, pure basic 

research, which describes most university research, cannot be considered commercial, 

and the researchers are not infringers. This applied to the PCR patents, as well as any 

other patent. Hoffmann-LaRoche has taken the position that “These researchers…are 

manifestly in the business of doing research in order to…attract private and government 

funding through the publication of their experiments in the scientific literature, create 

patentable inventions, and generate royalty income for themselves and their institutions 

through the licensing of such invention.” However, current US law does not support 

this extraordinarily broad view of commercial activity, and Hoffmann-LaRoche seems 

to be alone in making such broad assertions. 

Although the above discussion relates to the United States, researchers in other 

countries may or may not have the same exemption. The scope of this article does not 

permit a country-by-country analysis. However, it must be noted that many countries


are in alignment with the position taken by US courts or provide an even broader 

exemption. For example, it is not considered an infringement in Canada to construct a 

patented article for the purpose of improving upon it or to ascertain whether a certain 

addition, subtraction, or improvement on it is workable. The Supreme Court of Canada 

spoke on this issue stating that “[N]o doubt if a man makes things merely by way 

of bona fide experiment, and not with the intention of selling and making use of the 

thing so made for the purpose of which a patent has been granted, but with the view of 

improving upon the invention the subject of the patent, or with the view of assessing 

whether an improvement can be made or not, that is not an invasion of the exclusive 

rights granted by the patent. Patent rights were never granted to prevent persons 

of ingenuity exercising their talents in a fair way.” Likewise, UK law provides an 

exemption from infringement for acts that are performed privately and for purposes 

that are not commercial and for acts performed for experimental purposes relating to 

the subject matter of the invention. The experimental purposes may have a commercial 

end in view, but they are only exempt from infringement if they relate to the subject 

matter of the invention. For example, it has been held by the UK courts that trials 

conducted to discover something unknown or to test a hypothesis, to find out whether 

something which is known to work in specific conditions would work in different 

conditions, or even perhaps to see whether the experimenter could manufacture commercially 

in accordance with the patent can be regarded as experiments and exempted 

from infringement. Researchers in any particular country who wish to obtain current 

information about their ability to conduct research projects without incurring patent 

infringement liability should contact the patent office or an attorney in their respective 

countries. Unfortunately, there is very little literature addressing these issues, and 

because the law is constantly changing, older articles may not provide accurate 

information. 

Even with uncertainties, it is clear that in many locations, researchers conducting 

basic research without a commercial end are free to practice in their field without 

fear or concern about the patent rights of others. Researchers at corporations likely 

cannot take advantage of such an infringement exemption. For researchers involved 

in work with a commercial link (e.g., researchers at private corporations, diagnostic 

laboratories reporting patient results for fees, academic research laboratories with 

private corporate collaborations, and the like), a license may be required. Unfortunately, 

each case needs to be evaluated on its own facts to determine whether a license is 

required and no general formula can be given. However, many corporations have 

personnel responsible for analyzing the need for, and acquisition of, patent rights. As 

such, bench scientists can generally go about their work without the burden of worrying 

about patent rights, or at a minimum, need only know the basic principles and issues so 

as to inform the appropriate personnel if potential patent issues arise. 

3.3. Not Every Patent Is a Valid Patent 

In addition to the experimental use exception, researchers, including commercial 

researchers, may obtain freedom from the early PCR patents because of problems with 

the patents themselves. Although issued patents are presumed valid and are enforceable 

until a court of law says otherwise, the early PCR patents have begun to fall under 

scrutiny and may not be upheld in the future such that the basic reagents and methods


are no longer covered by patents. It must be emphasized that at this time most of 

the patents are still deemed valid and enforceable. However, researchers may wish 

to follow the events as they unfold with respect to the enforceability and validity of 

the PCR patents. 

The first blow against the PCR patents was struck by Promega Corporation (Promega; 

Promega Corporation is a corporation headquartered in Madison, Wisconsin that 

produces for sale reagents and other products for the life science community.). 

HoffmannLaRoche filed an action against Promega on October 27, 1992 alleging 

breach of a contract for the sale of Taq DNA Polymerase (Taq), infringement of 

certain patents—the PCR Patents (United States Patent Nos. 4,683,195 and 4,683,202) 

and United States Patent No. 4,889,818—and related causes of action. At issue was 

United States Patent No. 4,889,818 (the ‘818 patent), entitled “Purified Thermostable 

Enzyme.” Promega denied the allegations of the complaint and claimed, among other 

things, that the ‘818 patent was obtained by fraud and was therefore unenforceable. 

After a trial in 1999, a US court held that all of the claims of the ‘818 patent unenforceable 

for inequitable conduct or fraud. The unenforceable claims are provided below. 

1. Purified thermostable Thermus aquaticus DNA polymerase that migrates on a denaturing 

polyacrylamide gel faster than phosphorylase B and more slowly than does bovine serum 

albumin and has an estimated molecular weight of 86,000 to 90,000 Dalton when compared 

with a phosphorylase B standard assigned a molecular weight of 92,500 Dalton. 

2. The polymerase of claim 1 that is isolated from Thermus aquaticus. 

3. The polymerase of claim 1 that is isolated from a recombinant organism transformed with 

a vector that codes for the expression of Thermis aquaticus DNA polymerase. 

The court concluded that Promega had demonstrated by clear and convincing 

evidence that the applicants committed inequitable conduct by, among other things, 

withholding material information from the patent office; making misleading statements; 

making false claims; misrepresenting that experiments had been conducted when, in 

fact, they had not; and making deceptive, scientifically unwarranted comparisons. The 

court concluded that those misstatements or omissions were intentionally made to 

mislead the Patent Office. The court’s decision has been appealed, and a decision from 

the Federal Circuit Court of Appeals is expected shortly. Pending the appeal court 

decision, the ‘818 patent is unenforceable. 

Patents have also been invalidated in Australia and Europe. On November 12, 

1997, the Australian Patent Office invalidated all claims concerning native Taq DNA 

polymerase and DNA polymerases from any other Thermus species, contained in a 

patent held by Hoffmann-La Roche (application no. 632857). The Australian Patent 

Office concluded that the enzyme had been previously purified in Moscow and 

published by Kaledin et al. (6) and that certain patent claims were unfairly broad. 

Although the case has been appealed, as of this writing, the Taq patent in Australia 

is unenforceable. 

In Europe, on May 30, 2001, the opposition division of the European Patent Office 

held that claims in the thermostable enzyme patent EP 0258017B1 (a patent equivalent 

to the ‘818 patent in the United States) were unpatentable because they lacked an 

inventive step in view of previous publications to Kaledin et al. (6) and Chient et al. 

(7), as well as knowledge generally know in the field at the time the patent application 

was filed.


Although it has not been determined yet whether the PCR method patents were 

procured with the same types of misleading and deceptive behavior, the PCR patents 

have been challenged based on an earlier invention by Dr. Gobind Khorana and 

coworkers in the late 1960s and early 1970s. Under US and many international patent 

laws, patent claims are not valid if they describe an invention that was used and/or 

disclosed by others prior to the filing date of the patent. The principle behind such rules 

is to prevent people from patenting, and thus removing from the public domain, things 

that the public already owns. Although the PCR patents make no mention of such work, 

DNA amplification and cycling reactions were conducted many years before the filing 

of the PCR patents in the laboratory of Dr. Khorana. Dr. Khorana’s method, which he 

called “repair replication,” involved the steps of the following: (1) extension from a 

primer annealed to a template; (2) separating strands; and (3) reannealing of primers to 

template to repeat the cycle. Dr. Khorana did not patent this work. Instead he dedicated 

it to the public. Unfortunately, at the time that Dr. Khorana discovered his amplification 

process, it was not practical to use the method for nucleic acid amplification, and the 

technique did not take off as a commercial method. At the time this work was disclosed, 

chemically synthesized DNA for use as primers was extremely expensive and costprohibitive 

for even limited use. Additionally, recombinantly produced enzymes were 

not available. Thus, not until the 1980s, when enzyme and oligonucleotide production 

became more routine, could one economically replicate Dr. Khorana’s methods. 

The validity of the PCR patents was challenged in 1990 by E.I. Dupont De Nemours 

& Co. (Dupont). Based on publicly available records, it appears that Dupont pointed to 

the work from Dr. Khorana’s laboratory, arguing that all of the method steps required 

in the basic PCR method were taught by Dr. Khorana’s publications and were in fact in 

the public domain. Hoffmann-LaRoche (who was positioned to acquire the technology) 

out-maneuvered Dupont by putting the Khorana papers in front of the United States 

Patent and Trademark Office in a reexamination procedure. Under reexamination, the 

patent holder has the ability to argue the patentability of an invention to the patent 

office without any input allowed by third parties, such as Dupont. As shown by 

publicly available records, during the reexamination procedure expert declarations 

were entered to raise doubt about the teaching of the Khorana references. As a result 

(not surprisingly), the Patent Office upheld the patents. Once a patent has issued 

in view of a reference, there is a strong presumption of validity that courts must 

acknowledge in any proceedings that later attempt to invalidate the patent in view 

of the reference. 

In addition to the disadvantage caused by the reexamination procedure, publicly 

available records show that Dupont was not able to use several pieces of compelling 

evidence against the PCR patents. Dupont, although performing clever replication work 

to show the sufficiency of Dr. Khorana’s disclosures (in direct contrast to the expert 

declarations submitted to the Patent Office during reexamination), did not submit 

the data in a timely manner in the proceedings. The judge ruled that the data should 

be excluded as untimely and prejudicial. Dupont also found additional references 

disclosing the earlier invention by Khorana, but did not provide them to the court in 

time and they were not considered. Thus, it seems that validity of the PCR patents 

was never truly tested in view of the work conducted by Dr. Khorana and his colleagues. 

Such a test, as well as others, may come in the near future as part of the 

Promega/HoffmannLaRoche litigation.


Should these or any additional patents be found invalid and unenforceable, the patent 

issues for researchers wishing to practice PCR will be greatly simplified. Interestingly, 

if it is found that one or more of the invalid or unenforceable patents were used to 

suppress competition in the market or to unfairly control the freedom of researchers, 

companies exerting such unfair market control may be subject to laws designed to 

prevent unfair and anticompetitive behavior. If a court were to rule that anticompetitive 

behavior was exercised, the violating patent owner may be forced to compensate those 

that were harmed. Although it is impossible to predict at this time the outcome of future 

court proceedings, researchers may wish to follow the progress of these cases. At a 

minimum, they offer perspective into the patent world and provide important subject 

matter for debate that is extremely relevant to shaping the future of patent public policy, 

an area that will increasingly play a role in the day-to-day lives of scientists. 

References 

1. Beck, S. (1998) Do you have a license? Products licensed for PCR in research applications. 

The Scientist 12, 21. 

2. Constans, J. (2001) Courts cast clouds over PCR pricing. The Scientist 15, 1. 

3. Finn, R. (1996) Ongoing patent dispute may have ramifications for academic researchers. 

The Scientist 10, 1. 

4. Wittemore v Cutter, 29 F. Cas. 1120 (C.C.D. Mass. 1813)(No. 17,600)(Story, J.). 

5. Roche Prods., Inc. v Bolar Pharmaceutical Co., 733 F.2d 858 (Fed. Cir. 1984). 

6. Kaledin, A. S., Sliusarenko, A. G., and Gorodetskii, S. I. (1980) Isolation and properties of 

DNA polymerase from extreme thermophylic bacteria Thermus aquaticus YT-1. Biokhimiia 

45, 644–651. In Russian. 

7. Chien, A., Edgar, D. B., and Trela, J. M. (1976) Deoxyribonucleic acid polymerase from the 

extreme thermophile Thermus Aquaticus. J. Bacteriol. 127, 1550–1557.

Equipping, Establishing a PCR Laboratory 15 

3 

Equipping and Establishing a PCR Laboratory 



Polymerase chain reaction (PCR) is a very sensitive method of amplifying specific 

nucleic acid, but the system is susceptible to contamination from extraneous or 

previously amplified DNA strands (1,2). Many specific copies of DNA are produced 

from each round of amplification (3) with a single aerosol containing up to 24,000 

copies of amplified material (4). The most important consideration when designing 

and equipping a laboratory for PCR is therefore to minimize the risk of contamination 

and ensure accurate results (5,6). To do this, it is necessary to physically separate the 

different parts of the process and arrange them in a unidirectional workflow (4). This 

avoids back flow of traffic and, along with restricted access, will reduce the risk of 

contamination and inaccurate results. 

The way in which the workflow is arranged will depend on the amount of available 

space. If possible, different rooms should be used for reagent preparation, sample 

preparation, PCR (some also separate primary and secondary stages), and post-PCR 

processing (see Fig. 1). Each of these areas should contain dedicated equipment, 

protective clothing, and consumables (1). Disposable gloves should be readily available 

for frequent changing to avoid cross contamination, and control material should be 

included in every run to monitor any contamination problems (3). 

2. Equipment 

A list of basic equipment required for a PCR laboratory is given in Table 1. 

2.1. Thermocyclers 

This is obviously the most important piece of equipment in the laboratory, with 

many products available from different manufacturers. Thermocyclers can be supplied 

with a variety of reaction vessel formats, including 0.2- and 0.5-mL microtubes; strips 

of tubes; microtiter plates containing up to 384 wells; glass slides; and capillaries. 

Temperature ramp rates and uniform heat distribution across the block are important 

for consistent performance. These options, along with the consideration of laboratory 

requirements, are factors when purchasing a machine, and these specifications are obviously 

reflected in the cost. For example, if basic PCR is all that is required, equipment 

from the lower end of the range might suffice. These machines have programmable 



15

16 McDonagh 

Fig. 1. Unidirectional flow in a PCR laboratory. 

blocks, often with a heated lid, and a basic repertoire of cycling capabilities. If high 

throughput using many different protocols is required in a diagnostic setting, then a 

multiblock system with the advantage of adding satellite units may be appropriate. 

More specialized machines with gradient blocks suitable for rapid optimization studies 

or with specialized blocks for in situ PCR are also available. 

Advances in technology have resulted in the development of real-time PCR systems, 

which allow rapid cycling (50 cycles in less than 30 min). These systems are expensive 

but provide benefits, including rapid throughput, efficient optimization, and further 

reducing the risk of contamination with reactions and product analysis occurring in 

a single tube. 

2.2. Additional Equipment 

Dedicated equipment for each area of the laboratory can be purchased from regular 

laboratory suppliers. Contamination can often arise from breaks and spills in equipment, 

such as centrifuges and waterbaths (4); therefore, important considerations include 

the purchase of equipment that can be easily taken apart for decontamination (see 

Note 1). 

All areas require dedicated pipets (1). Plugged tips used with traditional pipets are 

generally cheaper and easier to use than positive displacement pipets (see Note 2). 

Storage space at 4°C and –20°C should be available in each area, along with access 

to –70°C freezer facilities. 

Laminar hoods are not always recommended, except at the sample extraction stage, 

where they are required to protect the worker. Using individual workstations with


Table 1 

Equipment Required 

Reagent Sample 1° 2° 

All preparation preparation PCR PCR Post-PCR 

Pipets Microfuge Microfuge Cyclers Cyclers Electrophoresis tanks 

Refrigerator Vortex Vortex Power packs 

–20°C freezer dH 2 O source Laminar cabinet Microwave 

Work stations Ice machine Gel viewing system 

Balance 

Gel documentation system 

pH meter 

decontamination facilities reduces airflow throughout the laboratory and minimizes 

aerosol dispersal. These may simply consist of a disposable or wipeable tray on 

which the worker completes all operations before treating to remove any potential 

contaminating nucleic acids (1,2) (see Note 3). Some manufacturers produce purposebuilt 

cabinets, which incorporate several decontamination and safety features. 

An ice machine, distilled water supply, balance, and pH meter are required in the 

reagent preparation area, and a microwave is ideal for melting agarose for gel assembly 

in the post-PCR area. 

2.3. Consumables 

Disposable plastics rather than reusable glass should be used wherever possible, 

and high-quality consumables, for example, Rnase-free plasticware, should be used 

throughout the laboratory. It is also important to note that performance may be affected 

by different products from different suppliers, which was demonstrated in a study in 

which varying results were obtained when using microtubes supplied by a number of 

manufacturers (2). Other factors have an inhibitory effect on PCR performance and 

should also be considered. Examples include methods, such as ultraviolet irradiation, 

which can affect reagents such as mineral oil (7), therefore it is important to avoid 

exposure, and powder in gloves, which has been shown to inhibit PCR (2,8); therefore, 

powder-free varieties are recommended (see Note 4). 

3. Laboratory Layout 

Work within the laboratory should be confined to the specific areas identified for 

that part of the procedure. Each of these areas is described below, but several points 

apply to all. These include removal of laboratory coat and gloves before moving into 

another part of the laboratory; provision of gloves for frequent change; avoidance of 

aerosols and drips; and decontamination of working area and equipment before and 

after use (3) (see Note 3). All reagents necessary for each process should be stored 

within the area in which the work is being performed (3). 

3.1. Reagent Preparation Laboratory 

This area should be kept entirely free from samples and other potential sources of 

nucleic acid. Stock solutions and reagents should be made up, or diluted if purchased 

as concentrate, then dispensed in single use aliquots (1,3,4) or small volumes (7) and

18 McDonagh 

stored. This means that that they can be identified and discarded if contamination 

does arise (9). Master mixes are made up here and added to reaction vessels before 

continuing onto the next stage of the process (see Note 5). If necessary, an oil overlay 

can also be added at this stage. 

3.2. Sample Preparation Laboratory 

Laminar flow cabinets are necessary for dealing with samples until they are 

inactivated and extracted, and these and other equipment should be decontaminated 

before and after each procedure (see Note 3). The equipment necessary will depend on 

the extraction methods used, but a microfuge, heating block, and vortex are minimal 

requirements. 

3.3. PCR Laboratory 

Primary and secondary PCR steps should be separated, preferably in different rooms, 

and certainly with separate thermocyclers; however, the layout of this area will depend 

on space and equipment available. Primary reactions containing master mix and nucleic 

acid should be assembled and placed on the appropriate thermocycler. After cycling, 

these are removed to the secondary PCR area, where reactions are assembled and 

placed on cyclers dedicated for this process. Other automated/integrated/single-round 

equipment should be positioned with secondary thermocyclers to reduce the risk of 

contamination (see Note 6). 

3.4. Post-PCR Processing 

All final amplified products should be dealt with in this area, which can be used 

for techniques, including electrophoresis, restriction fragment length polymorphism 

(RFLP), hybridization work, cloning, and sequencing. It is important that nothing from 

this area should go back through other areas involving preliminary steps but should be 

processed through a waste management or discard area. 

4. Notes 

1. For example, hot blocks are easier to decontaminate on a regular basis and are therefore 

a better option than water baths. 

2. Normal tips can be used for post-PCR steps. 

3. An ultraviolet irradiation source is valuable in reducing contamination; however, Cimino 

et al. (10) recommend caution when using this method alone. Otherwise, wash down all 

nonmetal surfaces with 0.1 N HCl, or 10% bleach, followed by water. 

4. Nitrile gloves should be used for safety when handling ethidium bromide if used in gel 

electrophoresis. 

5. As kit-based formats become available, reagent and master mix will be supplied, completely 

reducing the need for this area. 

6. This setup will become more difficult as combined extraction/amplification and detection 

equipment become more available. 

References 

1. Wolcott, M. J. (1992) Nucleic acid-based detection methods. Clin. Microbiol. Rev. 5, 

370–386. 

2. Wilson, I. G. (1997) Inhibition and facilitation of nucleic acid amplification. Appl. Environ. 

Microbiol. 63, 3741–3751.


3. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) In vitro application of DNA by the 

polymerase chain reaction, in Molecular Cloning: A Laboratory Manual. 2nd ed., Cold 

Spring Harbor Laboratory Press, New York, pp. 14.14. 

4. Orrego, C. (1990) Organizing a laboratory for PCR work, in PCR Protocols: A Guide to 

Methods and Applications (Innes, M. L., Gelfand, D. H., Sninsky, J. J., White, T. J., eds.), 

Academic Press Inc., San Diego, pp. 447– 454. 

5. Baselski, V. S. (1996) The role of molecular diagnostics in the clinical microbiology 

laboratory. Clin. Lab. Med. 16, 49–60. 

6. Lisby, G. (1999) Application of nucleic acid amplification in clinical microbiology. Mol. 

Biotechnol. 12, 75–79. 

7. Hughes, M. S., Beck, L. A., and Skuse, R. A. (1994) Identification and elimination of DNA 

sequences in Taq DNA polymerase. J. Clin. Microbiol. 32, 2007–2008. 

8. De Lomas, J. G., Sunzeri, F. J., and Busch, M. P. (1992) False negative results by polymerase 

chain reaction due to contamination by glove powder. Transfusion 32, 83–85. 

9. Madej, R. and Scharf, S. (1990) Basic equipment and supplies, in PCR protocols: A Guide 

to Methods and Applications (Innes, M. L., Gelfand, D. H., Sninsky, J. J., White, T. J., 

eds.), Academic Press Inc., San Diego, pp. 455–459. 

10. Cimino, G. D., Metchette, K., Isaacs, S. T., and Zhu, Y. S. (1990) More false positive 

problems. Nature 345, 773–774.

20 McDonagh

Quality Control 21 

4 

Quality Control in PCR 



Polymerase chain reaction (PCR), like any laboratory procedure, can be subject 

to a range of experimental or procedural error. A clear consideration of where such 

potential errors may occur is essential to minimize their impact. Careful quality control 

of equipment and reagents is essential. 

2. Equipment 

The previous chapter dealt with the sort of equipment that is required to perform 

PCR. It is commonplace for an individual laboratory to contain many sets of equipment, 

each bought from different manufacturers, at different times, and subjected to various 

amounts of abuse from students who don’t know any better and laboratory managers 

who do! In an ideal world, and any diagnostic or commercial laboratory, each piece of 

equipment should be serviced and calibrated on a regular basis, with careful records 

being kept of this maintenance. Unfortunately, not every laboratory has funds for fullservice 

contracts on all equipment. There are a few fundamental procedures, however, 

which will reduce errors from equipment problems. 

• Be consistent in the equipment used for any given PCR. If it works on Monday but not 

Tuesday, this may simply be to the result of using a different PCR block. Even the most 

modern and expensive thermal cyclers deteriorate with age. 

• Check pipetting devices on a regular basis (weekly is not excessive) to ensure they pipet 

the correct volume. This is easily performed by pipetting and weighing water. Most 

manufacturers produce inexpensive service packs for their pipettors. 

3. Reagents 

As with all laboratory procedures, it generally pays dividends to use high-quality 

reagents from reputable suppliers. You may well know someone who brews their 

own Taq polymerase in a vat in the garage, but do they control for batch-to-batch 

variability? 

The design of optimum PCR primers will be discussed later. It is important to 

remember, however, that these are single-stranded DNA molecules and are therefore 

relatively labile. Repeated freeze/thawing will cause degradation to shorter products, 



21

22 Stirling 

which will either not anneal, or if the annealing temperature is low enough, will anneal 

promiscuously, yielding multiple products. Simple aliquoting primers into manageable 

volumes will reduce both the scope for contamination and degradation. This practice 

should also be adopted for dNTP stocks for the same reason. 

4. Operator Errors 

Anyone involved in teaching molecular techniques hears the same complaint again 

and again: “These reaction volumes are too small! . . . I can’t see a microliter!” Even for 

those with many years of laboratory experience (perhaps especially for those), it can be 

difficult to adjust to dealing with small volume reactions. Although the obvious answer 

may be to increase the volume, this has both cost and efficiency implications. 

• Use appropriate pipetting devices. A pipettor designed for the 20- to 200-µL range will 

not accurately dispense 10 µL. 

• The use of master mixes not only reduces the dependence on accurately pipetting small 

volumes but also improves the control over reaction contents. 

• Practice with the same reaction until consistent results are obtained. 

5. PCR-Specific Difficulties 

Although much of the above could apply to any analytical laboratory technique, 

PCR also is subject to the confounding problem of contamination. Cross contamination 

of samples is of concern in any discipline, and good laboratory practice, such as 

careful pipetting and the constant changing of disposable pipet tips, will minimize 

the opportunity of this occurring. Where PCR differs from most other procedure is in 

the production of vast quantities of the analyte during the procedure. The presence of 

billions of copies of potential template can create severe problems. These problems can 

be minimized by physically separating the pre- and postamplification processes (ideally 

in different rooms with different pipettors, etc.); however, they should constantly be 

monitored by the inclusion of appropriate controls. 

6. Controls 

• No DNA. Although it can seem extravagant to constantly set up reactions without template, 

this is the best way to monitor for contamination. A separate “no DNA” control should 

be set up for each master mix or each individual reaction. If contamination is discovered, 

the pipettor should be decontaminated (as per manufacturers guidelines), and the reagent 

aliquot should be rechecked or discarded. 

• Positive control. PCR is often used simply to detect the presence of specific sequence. In 

such circumstances, it is essential to include at least one reaction with a template known 

to contain the sequence. 

• Internal control. Even when master mixes have been used to ensure consistency of reaction 

components, and a positive control is used, there is the possibility that template may be 

omitted from individual tubes. This can be addressed by the inclusion within each reaction 

tube of primers, which will amplify a target known to consistently be present in the test 

DNA (see factor IX in Chapter 47 for example). 

7. Regional Quality-Assurance Programs 

In addition to the in-house precautions detailed above, there are a growing number 

of specialist quality-assurance programs that have been developed for most diagnostic 

PCR.

Quality Control 23 

These programs distribute test material to laboratories, who then report their results 

centrally. Results from all participating centers are compared and confidential reports 

issued to each center. If such a program exists in your field, details will probably be 

available on the Internet: join it. If one doesn’t already exist, consider starting one; it 

may generate enough revenue to pay for instrument service contracts!

24 Stirling

Extraction of Nucleic Acid Templates 27 

5 

Extraction of Nucleic Acid Templates 


The following series of short technical descriptions covers the extraction of DNA 

and RNA from various starting materials. We have gathered these together at the 

beginning of this book to provide an easy reference. The polymerase chain reaction 

(PCR) techniques described in the rest of this book are, in the main, worked laboratory 

methods given detailed examples of the procedures used by the authors in their own 

research. However, the aim is to provide the reader with a method that may be translated 

into their own research; thus, although the description of ultrasensitive PCR focuses 

on viral genomes and cancer, this method may of course be equally applied to DNA 

from other sources. Rather than leaving the reader who is interested in applying this 

technique to ancient DNA or DNA from bone, etc., to search through the various 

chapters to find such a technique, we have collected these together for reference here. 

PCR provides a simple method for the amplification and analysis of DNA; however, 

for most applications involving PCR, the DNA (or cDNA for RNA methods) must be 

in a reasonably pure state. Therefore, the first stage of any experimental procedure 

involving PCR based technologies is the provision of a pure suspension of nucleic 

acids, either RNA or DNA. 

Extraction of nucleic acids is a fundamental precursor to almost all the techniques 

described within this volume. Isolation of RNA and DNA from blood and 

fresh tissues can be performed using a variety of techniques, which also form the 

basis of methods of extraction of these substrates from other sources. The sensitivity 

of PCR methods is now such that extraction of DNA and RNA from tissues fixed in 

formaldehyde and buffered formalin is considered routine, and we are now able to 

extract DNA from ancient tissues, feces, and many other sources. Indeed, in forensic 

science, DNA fingerprinting from sources as diverse as residual saliva on food and 

microscopic blood deposits is now possible! Indeed, the description of the extraction 

of DNA/RNA alone could probably fill several major chapters. It has, however, not 

proven desirable or feasible to be exhaustive in our approach to DNA/RNA extraction 

protocols, and we have therefore restricted these to major methods in use in many 

laboratories. Further references (1–7) that provide detailed reviews of methods for 

nucleic acid extraction and some recommended web sites are listed in the reference 

section. 



27

28 Bartlett 

References 

1. US Department of Commerce Molecular Biology Techniques Forum http://research. 

nwfsc.noaa.gov/protocols/methods/ 

2. http://www.stratagene.com/ 

3. http://www.promega.com/tbs/ 

4. http://www.highveld.com/protocols.html 

5. http://www.dynal.no/ 

6. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory 

Manual. Cold Spring Harbor Laboratory Press, New York. 

7. Bartlett, J. M. S., ed. (2000) Ovarian Cancer: Methods & Protocols, Vol. 39, Methods in 

Molecular Biology. Humana Press, Totowa, NJ.

DNA Extraction from Whole Blood 29 

6 

Extraction of DNA from Whole Blood 

John M. S. Bartlett and Anne White 


There are many differing protocols and a large number of commercially available 

kits used for the extraction of DNA from whole blood. This procedure is one we use 

routinely in both research and clinical service provision and is cheap and robust. It 

can also be applied to cell pellets from dispersed tissues or cell cultures (omitting 

the red blood lysis step. 

2. Materials 

This method uses standard chemicals that can be obtained from any major supplier; 

we use Sigma. 

1. Waterbath set at 65°C. 

2. Centrifuge tubes (15 mL; Falcon). 

3. Microfuge (1.5 mL) tubes. 

4. Tube roller/rotator. 

5. Glass Pasteur pipets, heated to seal the end and curled to form a “loop” or “hook” for 

spooling DNA. 

6. EDTA (0.5 M), pH 8.0: Add 146.1 g of anhydrous EDTA to 800 mL of distilled water. 

Adjust pH to 8.0 with NaOH pellets (this will require about 20 g). Make up to 1 L with 

distilled water. Autoclave at 15 p.s.i. for 15 min. 

7. 1 M Tris-HCl, pH 7.6: Dissolve 121.1 g of Tris base in 800 mL of distilled water. Adjust 

pH with concentrated HCl (this requires about 60 mL). CAUTION: the addition of acid 

produces heat. Allow mixture to cool to room temperature before finally correcting pH. 

Make up to 1 L with distilled water. Autoclave at 15 p.s.i. for 15 min. 

8. Reagent A: Red blood cell lysis: 0.01M Tris-HCl pH 7.4, 320 mM sucrose, 5 mM MgCl 2 , 

1% Triton X 100. 

9. Add 10 mL of 1 M Tris, 109.54 g of sucrose, 0.47 g of MgCl 2 , and 10 mL of Triton X-100 

to 800 mL of distilled water. Adjust pH to 8.0, and make up to 1 L with distilled water. 

Autoclave at 10 p.s.i. for 10 min (see Note 1). 

10. Reagent B: Cell lysis: 0.4 M Tris-HCl, 150 mM NaCl, 0.06 M EDTA, 1% sodium dodecyl 

sulphate, pH 8.0. Take 400 mL of 1 M Tris (pH 7.6), 120 mL of 0.5 M EDTA (pH 8.0), 

8.76 g of NaCl, and adjust pH to 8.0. Make up to 1 L with distilled water. Autoclave 15 min 

at 15. p.s.i. After autoclaving, add 10 g of sodium dodecyl sulphate. 



29

30 Bartlett and White 

11. 5 M sodium perchlorate: Dissolve 70 g of sodium perchlorate in 80 mL of distilled water. 

Make up to 100 mL. 

12. TE Buffer, pH 7.6: Take 10 mL of 1 M Tris-HCl, pH 7.6, 2 mL of 0.5 M EDTA, and make 

up to 1 L with distilled water. Adjust pH to 7.6 and autoclave 15 min at 15. p.s.i. 

13. Chloroform prechilled to 4°C. 

14. Ethanol (100%) prechilled to 4°C. 

3. Method 

3.1. Blood Collection 

1. Collect blood in either a heparin- or EDTA-containing Vacutainer by venipuncture (see 

Note 2). Store at room temperature and extract within the same working day. 

3.2. DNA Extraction 

To extract DNA from cell cultures or disaggregated tissues, omit steps 1 through 3. 

1. Place 3 mL of whole blood in a 15-mL falcon tube. 

2. Add 12 mL of reagent A. 

3. Mix on a rolling or rotating blood mixer for 4 min at room temperature. 

4. Centrifuge at 3000g for 5 min at room temperature. 

5. Discard supernatant without disturbing cell pellet. Remove remaining moisture by inverting 

the tube and blotting onto tissue paper. 

6. Add 1 mL of reagent B and vortex briefly to resuspend the cell pellet. 

7. Add 250 µL of 5 M sodium perchlorate and mix by inverting tube several times. 

8. Place tube in waterbath for 15 to 20 min at 65°C. 

9. Allow to cool to room temperature. 

10. Add 2 mL of ice-cold chloroform. 

11. Mix on a rolling or rotating mixer for 30 to 60 min (see Note 3). 

12. Centrifuge at 2400g for 2 min. 

13. Transfer upper phase into a clean falcon tube using a sterile pipet. 

14. Add 2 to 3 mL of ice-cold ethanol and invert gently to allow DNA to precipitate (see 

Note 4). 

15. Using a freshly prepared flamed Pasteur pipet spool the DNA onto the hooked end (see 

Note 5). 

16. Transfer to a 1.5-mL Eppendorf tube and allow to air dry (see Note 6). 

17. Resuspend in 200 µL of TE buffer (see Notes 7 and 8). 

4. Notes 

1. Autoclaving sugars at high temperature can cause caramelization (browning), which 

degrades the sugars. 

2. As will all body fluids, blood represents a potential biohazard. Care should be taken in all 

steps requiring handling of blood. If the subject is from a known high risk category (e.g., 

intravenous drug abusers) additional precautions may be required. 

3. Rotation for less than 30 or over 60 min can reduce the DNA yield. 

4. DNA should appear as a mucus-like strand in the solution phase. 

5. Rotating the hooked end by rolling between thumb and forefinger usually works well. 

If the DNA adheres to the hook, break it off into the Eppendorf and resuspend the DNA 

before transferring to a fresh tube. 

6. Ethanol will interfere with both measurements of DNA concentration and PCR reactions. 

However, overdrying the pellet will prolong the resuspension time.

DNA Extraction from Whole Blood 31 

7. The small amount of EDTA in TE will not affect PCR. We routinely use 1 µL per PCR 

reaction without adverse affects. 

8. DNA can be quantified and diluted to a working concentration at this point or simply 

use 1 µL per PCR reaction; routinely, we expect 200 to 500 ng/µL DNA to be the yield 

of this procedure.

32 Bartlett and White

DNA Extraction from Tissue 33 

7 

DNA Extraction from Tissue 



The following protocol is one of the longest-established methods of DNA extraction 

and works well with a wide range of solid tissues. Proteins are digested with proteinase 

K and extracted with phenol chloroform. DNA is then precipitated with ethanol. The 

resultant DNA (10–50 µg) is of high molecular weight and is a suitable template for 

long polymerase chain reaction (PCR). 

2. Materials 

1. Microfuge tubes (1.5 mL). 

2. Shaking water bath or incubator with rotisserie. 

3. Microfuge. 

4. DNA digestion buffer: 50 mM Tris-HCl, 100 mM EDTA, 100 mM NaCl, 1% SDS, 

pH 8.0. 

5. Proteinase K: 0.5 mg/mL in DNA digestion buffer. 

6. Phenol/chloroform/isoamyl alcohol (25241). 

7. 100% EtOH. 

8. 70% EtOH. 

9. TE buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 

3. Protocol 

1. Place 0.1 to 0.5 g of tissue into polypropylene microfuge tube (see Note 1). 

2. Add 0.5 mL of DNA digestion buffer with proteinase K (see Note 2). 

3. Incubate overnight at 50 to 55ºC with gentle shaking. 

4. Spin tubes for 5 s at 500g to collect mix in bottom of tube. 

5. Add 0.7 mL of phenol/chloroform/isoamyl alcohol (25241). 

6. Mix by inversion for 1 h (do not vortex). 

7. Microfuge at 12,000g for 5 min and transfer 0.5 mL of the upper phase to new microfuge 

tube. 

8. Add 1 mL of 100% ethanol at room temperature and gently invert until DNA precipitate 

forms (approx 1 min). 

9. Microfuge at 12,000g for 5 min and discard supernatant. 

10. Add 1 mL of 70% ethanol (–20ºC) and invert several times. This ethanol wash removes 

excess salt, which may otherwise interfere with PCR. 



33

34 Pearson and Stirling 


12. Spin tubes for 5 s to collect any remaining ethanol in bottom of tube. Remove last drops 

of ethanol with fine pastette. 

13. Air dry at room temperature for 10 to 15 min (any longer will render DNA difficult to 

redissolve). 

14. Resuspend in 100 µL of TE and incubate at 65°C for 15 min to dissolve DNA (see 

Note 3). 

4. Notes 

1. Some tissues contain large amounts of connective tissue and are difficult to digest. These 

can be ground frozen in liquid Nitrogen and ground in a mortar and pestle before being 

digested with proteinase K. 

2. Proteinase K solution can be kept for several days at 4°C. 

3. Repeat pipetting through a narrow gauge tip can help this process.

DNA from Archival Tissues 35 

8 

Extraction of DNA from Microdissected Archival Tissues 

James J. Going 


Many modern analytical methods require little material, and this has made feasible 

biochemical and molecular analyses of small tissue fragments, even individual cells, 

by microdissection of histological sections (1,2). Polymerase chain reaction (PCR) can 

potentially be applied to the analysis of single DNA molecules, as in the analysis of 

single haploid cells, such as spermatozoa (3). This sensitivity requires careful attention 

to technique and proper controls to avoid false-positive or other spurious results. 

Microdissection techniques used by different research groups are diverse, and 

recent articles explore different techniques (4–7). This chapter presents a technique of 

histological microdissection applicable to a variety of tissues. 

Microdissection can be applied to paraffin or frozen sections of human and animal 

tissues, depending on availability, but in human studies, it may be necessary to work 

with formalin-fixed, paraffin-embedded archival tissues. Although fixed tissues have 

disadvantages, particularly the degradation of nucleic acids after fixation, which 

may make successful PCR amplification more difficult, better preservation of tissue 

morphology compensates. This may be important because one purpose of histological 

microdissection is to bring together molecular and morphological analysis of the 

same cells. Fixed tissues sections may be easier to handle than unfixed tissues during 

microdissection. This chapter concentrates on fixed tissues. 

2. Materials 

All reagents should be of molecular biology quality. 

1. Proteinase K from Tritirachium album (Sigma), 20 mg/mL stock solution. Store 50-µL 

aliquots at –20°C, thaw, and dilute to 1 mL with digestion buffer containing 1% Tween to give 

working stock solution of proteinase K, 1 mg/mL for tissue digestion to release DNA. 

2. Proteinase K digestion buffer, pH 8.3. (TRIS-HCl, 2.2 g/L; TRIS base 4.4 g/L; EDTA 

0.37 g/L; separate batches of the buffer should be prepared detergent-free and containing 

1% Tween). 

3. Leica model M mechanical micromanipulator (other micromanipulators may be suitable). 

4. Tungsten wire (0.5 mm in diameter) for dissection needles (or ready-made needles); 

bacteriological loop holders for mounting needles in micromanipulator. 

5. Facility for electrolytic sharpening of tungsten needles (see Subheading 3.5.) 



35

36 Going 

3. Methods 

3.1. Section Cutting 

Careful clean techniques should be used when cutting sections for PCR analysis. 

1. Use a new part of the microtome blade to cut each section to avoid possible the carryover 

of DNA from one tissue block to sections of the next. 

2. Ribbons of sections should be floated out on a clean water bath and no buildup of section 

debris permitted. 

3. Glass slides upon which sections are mounted should be scrupulously clean. Dry mounted 

sections at 56°C for 2 h (see Note 1). 

3.2. Dewaxing and Staining Sections 

Dewax sections completely before microdissection. 

1. Immerse 6- to 7-µm sections in a slide rack for 10 min in xylene. Drain surplus xylene 

thoroughly from the sections to minimize the carryover of dissolved wax and then transfer 

to a second xylene bath for 2 min. Avoid breathing xylene vapor and be aware of the fire 

hazards of organic solvents. 

2. Take sections through two baths of 99% industrial methylated spirits to remove xylene 

and a third bath of 95% industrial methylated spirits. 

3. Transfer sections to distilled or deionized water of a satisfactory standard for preparing 

PCR reagents. Stain by immersion for 30 s in 0.05% w/v toluidine blue in distilled water 

(see Note 2). 

4. Wash in distilled water (see Note 3). 

5. After dissection, dehydrate and mount slides with a coverslip to provide a permanent 

record of the dissection (see Note 4). 

3.3. Microdissection Tools 

Successful dissection can be conducted freehand using sterile curved scalpel blades 

or sterile hypodermic needles, with or without a dissecting microscope. 

1. Take a section for dissection from the water bath immediately before it is needed, drain 

it, and blot any surplus water from around the section with a disposable, lint-free tissue 

(do not touch the section). 

2. Stroke the edge of the scalpel blade decisively across the section to remove a strip of tissue, 

the width of which will vary with the angle between blade and section (see Note 5). 

3. For more precise dissection with the micromanipulator, an electrolytically sharpened 

tungsten needle is ideal (Fig. 1). This tool consists of 25 mm of tungsten wire, 0.5 mm 

in diameter, sharpened and polished electrolytically to a fine point (tip radius several 

microns). 

4. Mount the needle in a collet-type bacteriological loop holder. 

5. Mount the loop holder in the tool holder of the micromanipulator and angle it downward 

25 to 30º. 

3.4. Making and Maintaining Tungsten Microneedles 

Tungsten needles can be obtained ready-made as ohmic probe needles but are easily 

fabricated from plain 0.5-mm tungsten wire (obtainable from suppliers of equipment 

for electron microscopy) This requires an electrolytic cell (see Note 6).


Fig. 1. Microdissection (stills from a video). Frame 1: the needle is placed at the periphery of 

an island of carcinoma cells (colonic carcinoma, paraffin section, toluidine blue stain). Frame 

2: about one-quarter of the island of tumor cells has been separated from the glass slide. 

Frame 3: the whole island is completely detached, shown by slight rotation with respect to the 

position it occupied in the section. The sample is ready for collection, proteinase K digestion, 

and further analysis. 

1. Obtain ~10 cm of platinum wire (e.g., from an old electrophoresis apparatus) and make 

a circular loop in it just small enough to fit inside a standard 20-mL universal container, 

with a “tail” 2 to 3 cm long. 

2. Drill a 1-mm hole in the side of universal container near the base and thread the platinum 

wire tail through it, with the loop neatly placed at the base of the container. Seal the hole 

inside and out with an epoxy resin glue, for example, Araldite. 

3. Almost fill the cell with 0.1 M potassium hydroxide (KOH; 1.2 g in 20 mL) in water 

(caution: KOH is caustic). 

4. Connect the platinum wire cathode to the negative (–) terminal of a standard 9-V radio 

battery (dry cell), and make the tungsten wire, mounted in its bacteriological loop holder, 

the anode (+). Ensure that the cell cannot fall over and spill caustic electrolyte solution. 

5. Complete the circuit by dipping 5 to 10 mm of the tungsten wire vertically into the KOH 

solution. Hydrogen bubbles will appear at the platinum cathode and nascent oxygen will 

remove tungsten from the anode, which sharpens to a fine, polished point. New needles 

are made this way and damaged needles refurbished. If sharpening does not occur, check 

the polarity. 

6. Straighten bent needles by rolling firmly between glass slides, and then polish/resharpen. 

7. Rinse needles with distilled water from a wash bottle after sharpening or resharpening to 

remove droplets of KOH electrolyte. 

8. Store prepared needles in a covered Petri dish with the blunt end pressed lightly into a ring 

of modelling clay or similar. Handle with fine forceps. 

3.5. Performing Microdissection 

1. Retrieve the slide to be dissected from distilled water and dry the back of the slide and 

around the section using a clean disposable laboratory tissue. 

2. Place the section on the microscope stage (see Note 7) and cover with a pool of proteinase 

K lysis buffer (without detergent) from a disposable sterile Pasteur pipet with a rubber-bulb

38 Going 

pipet filler. Spread the pool of buffer until it extends 3 to 4 mm beyond all edges of 

the section and is as deep as possible without spillage. 

3. Center the area of cells in the section to be retrieved for subsequent analysis in the 

microscope field at an appropriate magnification. 

4. Using the coarse motion controls of the micromanipulator, place the needle over the area 

to be dissected. 

5. Lower the needle gently at the edge of the area to be dissected until its tip just touches 

the slide. Stop lowering the needle when a small lateral deflection of the needle tip occurs 

(see Note 8). 

6. Microdissection techniques vary for different specimens. In general, attempt by blunt 

dissection to develop cleavage between groups of cells. Work around the area to be 

dissected, developing a split between the area to be kept and the area to be removed (Fig. 1). 

Then, use the point of the needle gradually to undermine the area to be recovered, pushing 

and pulling with the tip and side of the needle until the area to be retrieved has been peeled 

from the slide and floats freely in the buffer pool. 

7. If it is not clear whether the fragment is still attached to the section, gently agitate the 

slide. Attached fragments do not move freely. 

8. Sometimes a tissue fragment remains attached by a few strands of collagen; a second 

tungsten needle in a bacteriological loop holder, used freehand, will often detach it. 

3.6. Retrieving Dissected Fragments 

1. Bring the tip of the pipet close to the fragment to be retrieved and capture the fragment 

by suddenly releasing the pipet plunger, dragging fragment and a fixed volume of buffer 

into the pipet tip (see Note 9). 

2. Expel the captured specimen into a labeled microcentrifuge tube, ready for further 

processing (see Note 8). 

3. Check that the microdissected specimen is really in the tube. It helps if the fragment 

is easily seen with the naked eye. Use a magnifying lens or the microscope to make 

certain. Toluidine blue stained fragments are easy to see; unstained fragments may be 

practically invisible. 

3.7. Extracting DNA: Proteinase K Digestion 

In a fixed specimen, nucleic acids are present in a dense array of crosslinked proteins. 

Proteinase K digestion appears effectively to release them and make them available 

for subsequent PCR. 

1. Add an equal volume of Proteinase K digestion buffer pH 8.3 containing 1 mg/mL of 

proteinase K and 1 mg/mL Proteinase K to each specimen tube. 

2. Digest microdissected specimen in proteinase K (final concentration 500 µg/mL) at 37°C 

overnight in a water bath or incubator (digestion can continue over a weekend without 

detriment). 

3. Heat specimens in a PCR block (95°C for 10), to inactivate PK. 

4. Spin the specimen down by brief centrifugation. 

5. Specimens are stable at room temperature for subsequent DNA PCR. Store for longer 

periods at 4°C or –20°C. 

6. Accurate labeling is crucial (see Note 10). 

3.8. DNA Purification after PK Digestion 

The 25- or 50-µL sample remaining after PK digestion of a microdissected tissue 

fragment contains only small quantities of nucleic acids (DNA, RNA). One thousand


cells contain about 6 ng of DNA and will contain at most 2000 copies of an amplifiable 

DNA sequence; only 1000 copies of each of two different alleles. An attempt to 

purify such quantities of DNA or RNA risks losing the specimen, although techniques 

have been described. Such purification does not obviously improve subsequent PCR 

amplification. Carefully optimize your PCR using the unpurified digest before you 

conclude that such purification is essential. Several published microdissection studies 

using the techniques described here have used 1-µL aliquots of sample as template 

(8–11). Strategies such as hot start, touchdown, nested, or real-time PCR may to help to 

obtain good PCR results by decreasing amplification of spurious products. 

Techniques exist for whole-genome amplification of DNA from small samples, even 

single cells (12–14), to expand the template pool available for subsequent PCR analysis. 

The possibility of introducing artifacts should be considered, but with appropriate 

controls may be used for projects with scanty material. 

3.9. Frozen vs Paraffin Sections 

Frozen sections are less easy to microdissect than paraffin sections. Unfixed are 

less robust than fixed tissues and stand up less well to the manipulation necessary 

to detach the specimen. 

3.10. Analysis of RNA from Microdissected Material 

RNA from unfixed tissue may be more suitable for analysis than RNA from fixed 

tissue; however, RNA in unfixed tissue may be more susceptible to degradation, 

and RT-PCR of RNA from microdissected fixed tissue fragments can be achieved. 

Rather than performing the microdissection in a guanidinium-containing buffer, which 

removes toluidine blue from the section, performed microdissection in DEPC-treated 

distilled water and transfer fragments subsequently to RT-PCR buffers. 

4. Notes 

1. Drying influences the firmness with which sections adhere to the slide and ease of 

dissection. In general, slides coated with poly-L-lysine or treated with silanes should be 

avoided because it may be difficult to detach tissue from such slides. Conventional 3- to 

4-µm histological sections are a compromise between ease of cutting, depth of staining, 

and visibility of cytological detail. For histological microdissection, slightly thicker 

sections (6–8 µm) contain more nucleic acid per unit area, and their slightly increased 

thickness does not usually cause interpretation problems. With sections over 10 µm, poorer 

visualization of cells is a disadvantage. Cut and dried sections should be stored in dust-free 

conditions. There seems to be no need to store them in a refrigerator or freezer. Disposable 

latex gloves should be worn for all manipulations to reduce contamination. 

2. Staining reveals tissue structure, but unstained sections may be dissectible, especially if 

a serial hematoxylin and eosin section is available for reference. Staining often makes 

dissection easier. Toluidine blue staining is easy and does not seem to interfere with 

subsequent PCR, although this should be verified for particular applications. 

3. Stained sections can be stored in distilled water until dissection. Refrigeration at 4°C 

in water overnight causes some destaining and sections may lift from the slide. Stained 

sections can be stored dry but it is best not to dewax and stain more sections than can be 

used in a single dissecting session. 

4. A serial hematoxylin and eosin section shows what has been removed. A magnified 

photocopy or digital image of such a serial section can be annotated on hard copy or

40 Going 

digitally to record the dissection. Photocopying histological sections through an acetate 

sheet avoids scratching the photocopier glass or smearing it with mounting medium. 

5. A scalpel blade vertically in contact with the section will remove a narrow strip of tissue. 

The blade at a flatter angle will remove a wider strip. Tissue so removed can often be rolled 

into a small ball or pill, picked up on the tip of the scalpel blade or sterile hypodermic 

needle and transferred to a microcentrifuge tube for further processing. Tissue is most 

easily handled when damp but without excess water, in which dispersed tissue fragments 

are hard to retrieve or too dry and brittle. Static electricity may be troublesome. 

6. Bacteriological loop holders and tungsten wire are inexpensive. Either prepare enough 

needles in advance to use a new needle for each microdissection if necessary or briefly 

repolish the needle between samples, which exposes a new tungsten surface. The risk of 

DNA carryover on the needle from one specimen to the next appears largely theoretical. 

In a study of ras mutation in colorectal carcinomas (10), no false positives were detected 

in the analysis of several hundred separate microdissected normal and tumour tissue 

samples. 

7. Any microscope can be used if there is enough space between objective and stage for 

access to the specimen. Ordinary or inverted standard microscopes can be used but a 

stereo dissecting microscope with relatively high maximum magnification (up to ×120) 

is ideal. 

8. If the specimen adheres to the inside of the pipet tip, it can sometimes be dislodged by 

repeated in drawing and expulsion of buffer. It may be picked out with a needle, or the 

pipet tip may be cut off and placed with the tissue fragment in the tube for subsequent 

digestion. Sticking can usually be avoided by coating pipet tips before use with a silicone 

such as Sigmacote. Draw (e.g., 50 µL) of Sigmacote into the tip, expel it again, shake 

off any excess, and allow to dry. Coat tips an hour or two before you need them. Collect 

microdissected fragments for further processing in 500-µL tubes with screw-on lids sealed 

with rubber O rings. The O ring prevents loss of specimen volume by evaporation during 

subsequent processing and 500-µL tubes fit most PCR thermal cycling blocks for heating 

to inactivate Proteinase K after the digestion process is complete 

9. Capture volumes of 12.5 or 25 µL work well. The pipet should be nearly vertical to 

minimize the risk of damaging the section. Use a Gilson-type pipet with a wide-bore 

polypropylene tip. Such tips are in many manufacturer’s catalogs, or you can cut the end 

off an ordinary pipet tip. Steady your hand, holding the pipet, against your fist resting on 

the microscope stage. The fragment may be hard to retrieve if it lies flat on the section or 

slide. Briskly expelling buffer toward the fragment will usually lift the fragment to a level 

from which it may easily be recovered. Retrieval of dissected fragments without damage 

to the section is easier from a deep pool of buffer. The buffer should not contain detergent, 

such as Triton X-100 which, by reducing surface tension, prevents the formation of a 

deep standing pool of buffer. 

10. Labeling must survive overnight incubation in the water bath and subsequent heat 

inactivation in the PCR thermal cycler block, the wells of which often contain oil traces 

which may dissolve even permanent marker pen inks. Write specimen numbers on the lid 

of the container as well. Typing correction fluid on the lid gives a white surface on which 

graphite pencil is permanent. Do not transpose lids. Do not open more than one specimen 

tube at a time, and replace the lid at once. 

References 

1. Schriever F., Freeman G., and Nadler L. M. (1991) Follicular dendritic cells contain a 

unique gene repertoire demonstrated by single-cell polymerase chain reaction. Blood 

77, 787–791.


2. Trumper, L. H., Brady, G., Bagg, A., Gray, D., Loke, S. L., Griesser, H., et al. (1993) 

Single-cell analysis of Hodgkin and Reed-Sternberg cells: Molecular heterogeneity of gene 

expression and p53 mutations. Blood 81, 3097–3115. 

3. Hubert, R., Weber, J. L., Schmitt, K., and Arnheim, N. (1992) A new source of polymorphic 

DNA markers for sperm typing: Analysis of microsatellite repeats in single cells. Am. J. 

Hum. Genet. 51, 985–991. 

4. Emmert-Buck, M. R., Bonner, R. F., Smith, P. D., Chuaqui, R. F., Zhuang, Z. P., Goldstein, 

S. R., et al. (1996) Laser capture microdissection. Science 274, 998–1001. 

5. Moskaluk, C. A. and Kern, S. E. (1997) Microdissection and polymerase chain reaction 

amplification of genomic DNA from histological tissue sections. Am. J. Pathol. 150, 

1547–1552. 

6. Bohm, M., Wieland, I., Schutze, K., and Rubben, H. (1997) Microbeam MOMeNT—Noncontact 

laser microdissection of membrane-mounted native tissue. Am. J. Pathol. 151, 

63–67. 

7. Fend, F., Emmert-Buck, M. R., Lee, J., Cole, K., Chaqui, R. F., Liotta, L. A., et al. (1998) 

Immuno-LCM: laser capture microdissection of immunostained frozen sections for RNA 

analysis. Mod. Pathol. 11, A185. 

8. Murphy, D. S., Hoare, S. F., Going, J. J., Mallon, E. A., George, W. D., Kaye, S. B., et 

al. (1995) Characterization of extensive genetic alterations in ductal carcinoma in situ 

by fluorescence in situ hybridization and molecular analysis. J. Natl. Cancer Inst. 87, 

1694–1704. 

9. Going, J. J. and Lamb, R. F. (1996) Practical histological dissection for PCR analysis. 

J. Pathol. 179, 121–124. 

10. Lamb, R. F., Going, J. J., Pickford, I., and Birnie, G. D. (1996) Allelic imbalance at the 

NME1 locus in microdissected primary and metastatic human colorectal carcinomas is 

frequent, but not associated with metastasis to lymph nodes or liver. Cancer Res. 56, 

916–920. 

11. Al Mulla, F., Going, J. J., Sowden, E. T. H. H., Winter, A., Pickford, I. R., and Birnie, 

G. D. (1998) Heterogeneity of mutant versus wild-type Ki-ras in primary and metastatic 

colorectal carcinomas, and association of codon-12 valine with early mortality. J. Pathol. 

185, 130–138. 

12. Zhang, L., Cui, X., Schmitt, K., Hubert, R., Navidi, W., and Arnheim, N. (1992) Whole 

genome amplification from a single cell: implications for genetic analysis. Proc. Natl. 

Acad. Sci. USA 89, 5847–5851. 

13. Telenius, H., Carter, N. P., Bebb, C. E., Nordenskjold, M., Ponder, B. A. J., and Tunnacliffe, 

A. (1992) Degenerate oligonucleotide-primed PCR: General amplification of target DNA 

by a single degenerate primer. Genomics 13, 718–725. 

14. Grothues, D., Cantor, C. R., and Smith, C. L. (1993) PCR amplification of megabase DNA 

with tagged random primers (T-PCR). Nucleic Acids Res. 5, 1321–1322.

42 Going

RNA Extraction from Blood 43 

9 

RNA Extraction from Blood 

Helen Pearson 


Based on the method of Chomczynski and Sacchi (1), this is an extremely reliable 

method without the requirement for centrifugation over CsCl gradients. As with any 

RNA protocol, extreme care should be taken to exclude RNAse contamination, the 

greatest source of which will be the sample itself. All disposables and reagents should 

be RNAse free. 

2. Materials 


2. Ice bucket. 

3. Microfuge. 

4. Red cell lysis buffer: 1.6 M sucrose, 5% Triton X-100, 25 mM MgCl 2 , 60 mM Tris-HCl, 

pH 7.5; stored at 2–8°C and used cold. 

5. Extraction Buffer: 5.25 M guanidinium thiocyanate, 50 mM Tris-Cl, pH. 6.4, 20 mM 

EDTA, 1% Triton X-100, 0.1 M β-mercaptoethanol (add immediately prior to use). 

6. 2 M sodium acetate, pH 4.0. 

7. Phenol (saturated with 1 M Tris-HCl: 0.1 M EDTA, pH 8.0). 

8. Chloroform:Iso-amyl alcohol (241). 

9. Isopropyl alcohol. 

10. 70% Ethanol. 

11. RNAse-free distilled water. 

3. Method 

1. In a microfuge tube, mix 100 µL anticoagulated blood with 1 mL of red cell lysis buffer 

(see Notes 1–3). 

2. Leave at room temperature with occasional shaking until the red cells have lysed and the 

solution translucent (usually within 5 min). 

3. Microfuge for 30 s at 13,000g to pellet the white blood cells. Remove and discard 

supernatant. 

4. Add 200 µL of extraction buffer and resuspend cell pellet by drawing through narrow 

gauge needle several times. 

5. Add 20 µL of 2 M sodium acetate and mix gently by inversion. 

6. Add 220 µL of phenol and mix gently by inversion. 



43

44 Pearson 

7. Add 60 µL of chloroform/isoamyl alcohol (241) and vortex vigorously. 

8. Place on ice for 15 min. 

9. Microfuge at 12,000g for 5 min and transfer the upper phase to new microfuge tube. 

10. Add 200 µL of ice-cold isopropanol mix and store at –20°C for 30 min. 


12. Resuspend pellet in 200 µL of extraction buffer. 

13. Repeat steps 3 through 9. 

14. Wash pellet with 400 µL of cold 70% ethanol. 


16. Carefully remove last traces of ethanol from tube (folded sterile swab or kimwipe works 

well). 

17. Resuspend in 100 µL of distilled water and incubate at 50°C for 15 min to dissolve RNA 

(see Note 4). 

4. Notes 

1. Blood stored at room temperature or 4°C should be mixed thoroughly prior to aliquots 

being removed. 

2. Frozen blood samples should be allowed to thaw completely and mixed thoroughly before 

aliquots being removed. Although freezing lyses red blood cells, the red cell lysis step 

should still be performed to efficiently remove hemoglobin from the sample. Repeated 

freeze/thaw cycles should be avoided. 

3. Buffy coat contains two to four times the amount of white blood cells per volume compared 

to fresh blood. Therefore, it is advisable to use only 50 µL of buffy coat diluted with 50 µL 

of phosphate-buffered saline as starting material for this protocol. 

4. Repeat pipetting through a narrow gauge tip can help this process. 

References 

1. Chomczynski, P. and Sacchi. N. (1987) Single-step method of RNA isolation by acid 

guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.

RNA Extraction from Frozen Tissue 45 

10 

RNA Extraction from Frozen Tissue 



RNA extraction is fundamental to all aspects of mRNA analysis. We include here a 

simple method that avoids the use of a mortar and pestle. 

2. Materials 

All chemicals, unless otherwise noted, were molecular biology grade and obtained 

from Sigma UK (Poole, Dorset). All glassware was pretreated with di-ethylpyrocarbonate 

(DEPC). All deionized distilled water was pretreated with DEPC and autoclaved 

(DEPC water). DEPC is a potent anti-RNAse agent. 

2.1. DEPC Treatment of Glassware/Distilled Water 

0.1% DEPC was added to distilled deionized water and glassware filled and left to 

stand overnight. The water was decanted and autoclaved (DEPC-treated water) and 

glassware sterilized at 220°C for 2 h (DEPC-treated glassware). DEPC is driven off 

by both procedures. 

2.2. RNA Extraction 

1. Braun Microdismembranator and Teflon vessels (Braun GmBH, Germany). 

2. 3 M lithium chloride/6 M urea: Dissolve in 800 mL of DEPC water and make up to 1 L. 

The solution can be stored at 4°C for 3 to 6 mo. 

3. 10 mM Tris-HCl, 0.5% sodium dodecyl sulphate (SDS) pH 7.5. Prepare stock solutions 

of 10% SDS and 0.5 M Tris-HCl (pH 7.5) in DEPC water. Stocks are stable at room 

temperature for up to 12 mo. 

4. Proteinase K: Prepare 1 mg/mL w/v DEPC water stock and store at –20°C for up to 12 mo. 

Dilute in 10 mM Tris-HCl, 0.5% SDS as required, discard unused diluted enzyme. 

5. Phenolchloroformisoamyl alcohol: phenol is presaturated with 10 mM Tris-HCl, 

pH 7.5. Prepare a mixture of 25241 phenolchloroformisoamyl alcohol (v/v/v). Store 

at room temperature for up to 6 mo, shielding from light. 



45


3. Methods 


1. Tissues should ideally be collected fresh and stored in liquid nitrogen. Routinely samples 

are collected on ice and transported for freezing within 30 to 60 min. 

2. Tissues are disaggregated using a Braun-micro dismembranator. Teflon vessels and steel 

ball bearings are cooled in liquid nitrogen before use. Frozen tissue (50–500 mg) is placed 

in the vessel with a single ball bearing and agitated at 1000 cycles/second for 60 s. The 

vessel is then re-cooled in liquid nitrogen. This process is repeated until tissue is powdered 

(usually 2×; see Note 1). 

3. Immediately after disaggregation of tissue, tissue material is resuspended while frozen 

by adding 1.5 mL of LiCl/Urea and transfer to a separate tube. The vessel is washed a 

further 2× with 1.5 mL of LiCl/Urea and the washing combined with the original sample. 

The resuspended medium is made up to 6 mL in LiCl/Urea and sonicated for 2× 30 s 

at maximum power using a probe sonicator. The sonicated samples are stored overnight 

at 4°C (see Note 2). 

4. Centrifuge at 15,000g, 4°C for 30 min. The supernatant is discarded and the pellet washed 

with a further 6 mL of lithium chloride/urea, recentrifuged (15,000g, 4°C for 30 min) and 

the supernatant again discarded. 

5. The pellet is resuspended in 6 mL of Tris-HCl/SDS with 50 µg/mL proteinase K (Boehringer 

Mannheim, UK) and incubated at 37°C for 20 min. 

6. Samples are extracted with 100% phenol, followed by phenol:chloroform:isoamyl-alcohol. 

After each extraction, the sample is centrifuged at 2000g at room temperature for 10 min 

and the aqueous phase recovered. 

7. After the final extraction, 300 µL of 8 M LiCl and 2.5 volumes absolute alcohol are added 

and samples stored at –20°C for 30 min overnight. RNA is pelleted by centrifugation 

at 4000g, 4°C for 45 min. The supernatant is discarded and the RNA pelleted dried and 

resuspended in DEPC-treated distilled water. Concentrations are estimated by optical 

density at 260/280 nm. 

4. Notes 

1. Disaggregation is critically dependent on tissue structure. Most tissues are readily 

disaggregated in two 60-s bursts. Other tissue types (e.g., fibrous tissues) may require 

longer periods to disrupt tissue. If a mechanical dismembranator is not available, other 

methods of tissue homogenization work equally well, either using a mortar and pestle 

or blade homogenizers. 

2. Other methods can be used to lyse cells, such as passage through a syringe needle, etc. 

Extraction of RNA from solid tissues can be problematic because many of the commercial 

systems available for RNA extraction are validated for extraction of RNA from cell 

culture material or blood lymphocytes. These kits have often been less successful with 

tissue-derived material.

RNA Extraction from Tissue Sections 47 

11 

RNA Extraction from Tissue Sections 

Helen Pearson 


There are two different methods of preparing tissue for histology: paraffin-embedding 

and freeze-embedding. Each has their advantages and drawbacks. Paraffin-embedded 

tissues (PET) produce optimum morphology but have comparatively poor molecular 

preservation and recovery. Although frozen sections have poorer histology, they allow 

excellent recovery of DNA and RNA for analysis. 

Although fixation is performed to preserve the morphology of the living tissue, it 

does not necessarily have a beneficial effect on the DNA and RNA. Formalin, one of the 

most popular fixatives, crosslinks nucleic acids to protein, thus making the molecules 

rigid and susceptible to mechanical shearing. The duration of formalin fixation also 

seems to be important. Studies that have demonstrated DNA recovery around 200 base 

pairs recommend a period of fixation from 16 to 24 h but not any longer (1). 

RNA is a more labile species, and the paraffin-embedding process has been shown 

to greatly harm it. Many studies have shown that formalin fixation has the worst effects 

among commonly used fixatives and ethanol-based fixatives as having the best RNA 

preservation. 

2. Materials 


2. Ice bucket. 

3. Microfuge. 

4. Extraction Buffer: 5.25 M guanidinium thiocyanate, 50 mM Tris-HCl, pH. 6.4, 20 mM 

EDTA, 1% Triton X-100, 0.1 M β-mercaptoethanol (add immediately before use. 

5. Glycogen (10 mg/mL) in distilled water. 


7. Phenol (saturated with 1 M Tris-HCl, 0.1 M EDTA, pH 8.0). 

8. Chloroformiso-amyl alcohol (241). 


10. 70% ethanol. 

11. RNAse-free distilled water. 



47

48 Pearson 

3. Method 

The method of Chomczynski and Sacchi (2) described in the previous protocol 

works well for fixed tissues with only two modifications. 

1. The extraction is initiated by incubating tissue sections or microdissected cells in 500-µL 

extraction buffer for 5 min at room temperature with gentle agitation inverting several 

times. 

2. Add 20 µL of 2 M sodium acetate and mix gently by inversion. 

3. Add 220 µL of phenol and mix gently by inversion. 

4. Add 60 µL of chloroform/isoamyl alcohol (241) and vortex vigorously. 

5. Place on ice for 15 min. 

6. Microfuge at 12,000g for 5 min and transfer the upper phase to new microfuge tube. 

7. Add 1 to 2 µL of glycogen (10 mg/mL). Glycogen is a carrier that is used if RNA quantities 

are less than 1 µg. It also facilitates visualization of the pellet. 

8. Add 200 µL of ice-cold isopropanol mix and store at –20°C for 30 min. 


10. Resuspend pellet in 200 µL of extraction buffer. 

11. Repeat steps 3 through 9. 

12. Wash pellet with 400 µL of cold 70% ethanol. 


14. Carefully remove last traces of ethanol from tube (folded sterile swab or kimwipe works 

well). 

15. Resuspend in 100 µL of RNAse free distilled water and incubate at 50°C for 15 min to 

dissolve RNA (see Note 1). 

4. Notes 

1. Repeat pipetting through a narrow gauge tip can help this process. 

References 

1. Foss, R. D., Guha-Thakurta, N., Conran, R. M., and Gutman, P. (1994) Effects of fixative 

and fixation time on the extraction and polymerase chain reaction amplification of RNA 

from paraffin-embedded tissue. Diagn. Mol. Pathol. 3, 148–155. 

2. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid 

guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.

Dual DNA/RNA Extraction 49 

12 

Dual DNA/RNA Extraction 

David Stirling and John M. S. Bartlett 


It is sometimes desirable to extract both RNA and DNA from the same sample, 

especially when the sample is small. This can be achieved by isolating a total nucleic 

acid fraction that is then divided into two portions, which are treated differentially with 

either Dnase I (to remove DNA and recover RNA) or with RNase A (to selectively 

recover the DNA); however, this wastes half of the DNA and RNA. An alternative 

approach is to sequentially isolate the RNA and DNA fractions from the same sample. 

This protocol based on one reported by Chevillard (1), begins by extracting RNA as in 

Chapter 9, but then re-extracts the DNA from the collected organic phases. The method 

described is for the extraction of both DNA/RNA from tissue but can be modified for 

either blood or cell lines (see Notes 1 and 2). 

2. Materials 

All chemicals, unless otherwise noted, are molecular biology grade and obtained 

from Sigma U.K. (Poole, Dorset). All glassware was pretreated with di-ethylpyrocarbonate 

(DEPC). All deionized distilled water was pretreated with DEPC and autoclaved 

(DEPC water). DEPC is a potent anti-RNAse agent. 

2.1. DEPC Treatment of Glassware/Distilled Water 

0.1% DEPC is added to distilled deionized water and glassware filled and left to 

stand overnight. The water was decanted and autoclaved (DEPC-treated water) and 

glassware sterilized at 220°C for 2 h (DEPC-treated glassware). DEPC is driven off 

by both procedures. 


1. Braun Microdismembranator and Teflon vessels (Braun GmBH, Germany). 

2. 3 M lithium chloride/6 M urea: Dissolve in 800 mL of DEPC water and make up to 1 L. 

This solution can be stored at 4°C for 3 to 6 mo. 

3. 10 mM Tris-HCl, 0.5% sodium dodecyl sulphate (SDS), pH 7.5. Prepare stock solutions of 

10% SDS, 0.5 M Tris-HCl (pH 7.5) in DEPC water. Stocks are stable at room temperature 

for up to 12 mo. 



49

50 Stirling and Bartlett 

4. Proteinase K: Prepare 1 mg/mL w/v DEPC water stock, which can be stored at –20°C 

for up to 12 mo. Dilute in 10 mM Tris-Cl/0.5% SDS as required, and discard unused 

diluted enzyme. 

5. Phenol/chloroform/isoamyl alcohol: Phenol is presaturated with 10 mM Tris-HCl, pH 7.5. 

Prepare a mixture of 25241 phenolchloroformisoamyl alcohol (v/v/v). Store at room 

temperature for up to 6 mo, shielded from light. 

6. TE Buffer, pH 7.6: take 10 mL of 1 M Tris-HCl, pH 7.6, 2 mL of 0.5 M EDTA, and make 

up to 1 L with distilled water. Adjust pH to 7.6. Autoclave 15 min at 15. p.s.i. 

2.3. DNA Extraction (as for RNA Plus) 

1. Dual extraction buffer: 0.1 M NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% SDS. 

Adjust to pH 12.0 with 5 N NaOH immediately before use. 

2. 7.5 M ammonium acetate. 

3. Methods 


1. Tissues should ideally be collected fresh and stored in liquid nitrogen. Routinely samples 

are collected on ice and transported for freezing within 30 to 60 min. 

2. Tissues are disaggregated using a Braun-micro dismembranator. Teflon vessels and steel 

ball bearings are cooled in liquid nitrogen before use. Frozen tissue (50 to 500 mg) is 

placed in the vessel with a single ball bearing and agitated at 1000 cycles/second for 60 s. 

The vessel is then recooled in liquid nitrogen. This process is repeated until tissue is 

powdered (usually twice; see Note 3). 

3. Immediately after disaggregation of tissue, material is resuspended while frozen in 1.5 mL of 

LiCl/Urea and transferred to a separate tube. The vessel is washed a further 2× with 1.5 mL 

of LiCl/Urea and the washing combined with the original sample. The resuspended medium 

is made up to 6 mL in LiCl/Urea and sonicated for 2× 30 s at maximum power using a 

probe sonicator. The sonicated samples are stored overnight at 4°C (see Note 4). 

4. Centrifuge at 15,000g, 4°C for 30 min. The supernatant is discarded and the pellet washed 

with a further 6 mL of lithium chloride/urea, recentrifuged (15,000g at 4°C for 30 min) 

and the supernatant again discarded. 

5. The pellet is resuspended in 6 mL of Tris-HCl/SDS with 50 µg/mL proteinase K (Boehringer 

Mannheim, UK), and incubated at 37°C for 20 min. 

6. Samples are mixed with an equal volume of phenolchloroformisoamyl-alcohol and 

mixed by inversion several times. 

7. After mixing, the sample is centrifuged at 2000g at room temperature for 10 min and 

the aqueous phase recovered for RNA extraction, the organic phase is retained for DNA 

extraction. 

8. Repeat steps 6 and 7. 

9. After the final extraction, 300 µL of 8 M LiCl and 2.5 volumes absolute alcohol are added 

and samples stored at –20°C for 30 min overnight. RNA is pelleted by centrifugation at 

4000g, 4°C for 45 min. 

10. The supernatant is discarded and the RNA pelleted dried and resuspended in 50 µL of TE. 

Concentrations are estimated by optical density at 260/280 nm. 

3.2. DNA Extraction 

1. Combine the organic phases, including the interfaces from step 7 above (both times), in 

a 15-mL polypropylene tube. 

2. Add an equal volume of extraction buffer, vortex for 1 min, and place on ice for 10 min.

Dual DNA/RNA Extraction 51 

3. Centrifuge for 20 min at 10,000g 4°C. 

4. Transfer aqueous phase to fresh tube and add 1/15 volume 7.5 M NH 4 OAc and 2 volumes 

ice-cold EtOH. Incubate at –20°C for at least 1 h. 

5. Centrifuge for 20 min at 10,000g, 4°C. 

6. Carefully decant the supernatant and wash the pellet with 1 mL of 70% ethanol. 

7. Centrifuge briefly to ensure that the pellet remains attached. 

8. Carefully remove the supernatant and air dry pellet for 10 to 15 min. 

9. Resuspend the DNA pellet in 50 µL of TE. Heat 5 min at 55°C then vortex thoroughly 

to dissolve the DNA. 

4. Notes 

1. For extraction from cell lines, scrape cells into 1.5 mL of lithium chloride/urea and then 

proceed from step 3 of the RNA extraction above. 

2. Extraction of DNA/RNA from blood can be achieved by collecting blood in either a heparin 

or EDTA containing Vacutainer by venipuncture. Store at room temperature and extract 

within the same working day. Whole blood (3 mL) is placed in a 15-mL polypropylene 

tube and mixed with 12 mL of red blood cell lysis solution (0.01 M Tris, pH 7.4, 320 mM 

sucrose, 5 mM MgCl 2 , 1% Triton X 100). Blood is then mixed on a rolling or rotating blood 

mixer for 4 min at room temperature. Lymphocytes are recovered by centrifugation at 

3000g for 5 min at room temperature. Then, proceed with RNA extract at step 3 above. 

3. Disaggregation is critically dependent on tissue structure. Most tissues are readily 

disaggregated in two 60-s bursts. Other tissue types (e.g., fibrous tissues) may require 

longer periods to disrupt tissue. If a mechanical dismembranator is not available, other 

methods of tissue homogenization work equally well, either using a mortar and pestle 

or blade homogenizers. 

4. Other methods can be used to lyse cells, such as passage through a syringe needle, etc. 

Extraction of RNA from solid tissues can be problematic because many of the commercial 

systems available for RNA extraction are validated for extraction of RNA from cell 

culture material or blood lymphocytes. These kits have often been less successful with 

tissue-derived material. 

References 

1. Chevillard, S. (1993) A method for sequential extraction of RNA and DNA from the same 

sample, specially designed for a limited supply of biological material. BioTechniques 

15, 22–24.

52 Stirling and Bartlett

DNA Extraction from Fungi, Yeast, Bacteria 53 

13 

DNA Extraction from Fungi, Yeast, and Bacteria 



Although individual microorganisms may well require a unique DNA extraction 

procedure, here we include robust techniques for the preparation of DNA from fungi, 

yeast, and bacteria, which yield DNA suitable for a PCR template. 

2. Materials 

2.1. Fungal Extraction 

1. CTAB extraction buffer: 0.1 M Tris-HCl, pH 7.5, 1% CTAB (mixed hexadecyl trimethyl 

ammonium bromide), 0.7 M NaCl, 10 mM EDTA, 1% 2-mercaptoethanol. Add proteinase 

K to a final concentration of 0.3 mg/mL prior to use. 

2. Chloroformisoamyl alcohol (241). 

2.2. Yeast Extraction 

1. Yeast extraction buffer A: 2% Triton X-100, 1% sodium dodecyl sulphate, 100 mM 

NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Phenolchloroformisoamyl 

alcohol: Phenol is presaturated with 10 mM Tris-HCl, pH 7.5. Prepare a mixture of 

25241 phenolchloroformisoamyl alcohol (v/v/v). This solution can be stored at room 

temperature for up to 6 mo, shielded from light. 

2. Glass beads. Diameter range 0.04–0.07 mm (Jencons Scientific Ltd, UK), suspended as 

500 mg/mL slurry in distiller water. 

3. Ammonium acetate (4 M). 

2.3. Bacterial DNA Protocol 

1. Lysozyme/RNase mixture: 10 mg/mL lysozyme, 1 mg/mL RNase, 50 mM Tris-HCl 

(pH 8.0). Store at –20°C in small aliquots. Do not refreeze after thawing. 

2. STET: 8% sucrose, 5% Triton X-100, 50 mM Tris-HCl (pH 8.0), 50 mM EDTA, pH 8.0. 

3. Filter sterilize and store at 4°C. 



53

54 Stirling 

3. Methods 

3.1. Fungal Protocol 

1. Grind 0.2 to 0.5 g (dry weight) of lyophilized mycellar pad in a mortar and pestle. Transfer 

to a 50-mL disposable centrifuge tube. 

2. Add 10 mL (for a 0.5 g pad) of CTAB extraction buffer. 

3. Gently mix to wet all the powdered pad. 

4. Place in 65°C water bath for 30 min. 

5. Cool and add an equal volume of chloroform/isoamyl alcohol (241). 

6. Mix and centrifuge at 2000g for 10 min at room temperature. 

7. Transfer aqueous supernatant to a new tube. 

8. Add an equal volume of isopropanol. 

9. High molecular weight DNA should precipitate upon mixing and can be spooled out with 

a glass rod or hook. 

10. Rinse the spooled DNA with 70% ethanol. 

11. Air dry, add 1 to 5 mL of TE containing 20 µg/ mL RNAse A. To resuspend the samples, 

place in 65°C bath or allow pellets to resuspend overnight at 4°C. 

3.2. Yeast Protocol 

1. Collect cells from fresh 5 mL culture by centrifugation at 2000g for 10 min and resuspend 

in 0.5 mL of water. 

2. Transfer cells to 1.5-mL microfuge tube and collect by centrifugation at 15,000g for 10 min, 

pour off supernatant and resuspend in residual liquid. 

3. Add 0.2 mL of buffer A, 200 µL of glass beads, and 0.2 mL of phenolchloroformisoamyl 

alcohol (25241). 

4. Vortex for 3 min and add 0.2 mL of TE. 

5. Centrifuge at 15,000g for 5 min and then transfer aqueous to new tube. 

6. Add 1 mL of 100% EtOH (room temperature), invert tube to mix, and centrifuge at 

15,000g for 2 min. 

7. Discard supernatant and resuspend pellet in 0.4 mL of TE (no need to dry pellet). 

8. Add 10 µL of 4 M ammonium acetate, mix, and then add 1 mL of 100% EtOH and mix. 

9. Centrifuge at 15,000g for 2 min and dry pellet. Resuspend in 50 µL of TE. 

3.3. Bacterial DNA Protocol 

1. Collect the bacteria from a 15-mL overnight culture into a 1.5-mL microfuge tube. 

2. Resuspend pellet with 300 µL of STET buffer and add 30 µL of RNAse/lysozyme 

mixture. 

3. Boil for 1 min 15 s. 

4. Centrifuge at 15,000g for at least 15 min. 

5. Take supernatant and phenol extract with 150 µL of STET-saturated phenol. 

6. Spin and take supernatant. Add 1/10 volume 4 M lithium chloride (autoclaved). Let sit 

on ice for 5 to 10 min. 

7. Spin and take supernatant. Add equal volume isopropanol at room temperature and 

incubate for 5 min. 

8. Centrifuge at 15,000g for at least 15 min. No pellet will be visible. 

9. IMPORTANT: wash with 80% ethanol (95% will cause the residual Triton to precipitate). 

10. Resuspend pellet in 50 to 200 µL of TE.

Isolation of RNA Viruses 55 

14 

Isolation of RNA Viruses from Biological Materials 



The successful extraction of viral RNA from biological material requires rapid 

transport and adequate storage of samples because of the unstable nature of RNA. 

Samples should be received and processed within 6 h and the relevant fractions stored at 

–70°C until testing. Also, it is difficult to ascertain the efficiency of sample preparation 

methods; therefore, known standards should be processed alongside samples to assess 

the loss within the system (1), particularly for quantitative applications. 

2. Materials 

Unless stated, all chemicals are supplied by Sigma, Poole, UK, or Merck. All stock 

solutions should be made using RNA-free water. 

2.1. Sample Preparation 

1. TNE-buffer: 0.11 M NaCl, 55 mM Tris (pH 8.0), 1.1 mM EDTA pH 8.0, 0.55% sodium 

dodecyl sulphate [SDS]. 

2. Poly-adenylic acid 2 mg/mL (Poly-A; Pharmacia, Upsala, Sweden). 

3. Proteinase K, 10 mg/mL in water. 

4. Phenol. 

5. Phenolchloroform (11). 

6. Chloroformisoamylalcohol, 501 (v/v). 


8. Ethanol 100% and 80%. 

9. 10% SDS. 

3. Methods 

Because an ultrasensitive system is required, it is necessary to include an ultracentrifugation 

step where serum or plasma is concentrated by centrifugation at 27,000g 

for 1 h. Large volumes of 1 mL or greater can be used, and most of the supernatant 

(900 µL) can be removed before resuspending the pellet in the remaining 100 µL 

(see Notes 1 and 2). 

1. Prepare a solution of TNE buffer, 0.5% SDS, 1 mg/mL proteinase K, and 40 µg/mL poly 

A. Pre-incubate the solution for 10 min at 37°C to inactivate RNases. 



55

56 McDonagh 

2. Add 0.4 mL of TNE buffer with SDS, proteinase K, and poly A to the extraction tubes. 

3. Add 100 µL of concentrated plasma or serum and mix immediately. 

4. Incubate the lysates for 1.5 to 2 h in 37°C water bath. 

5. Phenol extraction: Add 450 µL of phenol to the extraction tubes. Mix extensively and 

centrifuge at 13,000g for 10 min. 

6. Phenol/chloroform extraction: Transfer the upper aqueous layer to a fresh tube and add 

0.45 mL of phenolchloroform (11). Vortex and centrifuge as above. 

7. Chloroform/isoamylalcohol extraction: Transfer the upper aqueous layer to a fresh tube 

and add chloroformisoamylalcohol (501). Vortex and centrifuge as above. 

8. Ethanol precipitation: Transfer the aqueous layer to a fresh tube containing 40 µL of 3 M 

Na-acetate, pH 5.2, and 800 µL of ethanol. Mix and precipitate the nucleic acids at –20°C 

overnight or at –70°C for 30 min. 

9. Collect the nucleic acid by centrifugation at 15,000g for 20 min at 0°C. 

10. Discard the supernatant and wash the pellet with 1 mL 80% (v/v) ethanol. 

11. Dry the precipitate on a dry block and dissolve in 25 µL of RNase-free water. These 

extracts can be stored at –70°C. 

4. Notes 

1. It is important to process the samples alongside any controls and standards to allow 

for the loss of RNA through sample preparation methods. This is especially important 

when preparing template for a limiting dilution curve or when using an external curve 

dilution series. 

2. Although several commercial extraction systems have become available, we have not 

attained similar levels of sensitivity as with the protocol suggested here. However, 

extraction systems using guanidinium thiocyanate alongside phenol/chloroform or silica 

have been successfully used in ultrasensitive assays. 

References 

1. Clementi, M., Menzo, S., Bagnarelli, P., Manzin, A., Valenza, A., and Varaldo, P. E. (1993) 

Quantitative PCR and RT-PCR in virology. PCR Meth. Appl. 2, 191–196.

Extraction of Ancient DNA 57 

15 

Extraction of Ancient DNA 



The DNA extraction process represents one of the critical stages in the analysis 

of degraded or ancient DNA. If polymerase chain reaction (PCR) amplification starts 

from a poor extract containing low template quantities, stochastic variation in the 

amplification of individual alleles may lead to allelic dropout (1), resulting in a high 

risk of false-homozygous typing of a heterozygous sample (2). 

In analyzing repetitive sequences, such as STR loci, besides quantity, the quality 

of the extracted DNA used as template is of particular importance. PCR amplification 

of STR loci is generally accompanied by the generation of so-called shadow bands, 

byproducts that are shortened in length by one repeat unit compared with the allelic 

product (3). Because the accumulation of this artifact is increased with degradation of 

the DNA template (4) when amplifying ancient DNA, the intensity of a shadow band 

can exceed the intensity of the allelic product. As “artifact alleles” (2,5), these products 

may be mistaken for a true allele of the sample, complicating the determination of a 

genotype or even resulting in false genotyping. Because a PCR may not be affected 

each time, independent amplifications of the same sample may result in differing 

genotyping results (e.g., see ref. 6) for the same sample (2,7,8). 

The degree at which these two artifacts occur is related to quantity and quality 

of extracted DNA amplified within a PCR (1,4,8,9). Therefore, an optimized DNA 

extraction, to get the highest possible amount of target DNA with the best possible 

quality (which means with the highest possible reduction of additional degradation 

during the extraction procedure), is an essential precondition for optimal reproducibility 

of STR genotyping in the case of samples containing ancient DNA. 

The protocols presented here are the results of a study with the aim to optimize the 

extraction of ancient DNA from historical skeletal material described by Schmerer et al. 

(10,11). (For further detailed information on this study, also refer to ref. 12.) 

The protocol described in detail represents a consensus protocol developed for the 

extraction of DNA with a wide range in degree of degradation (cf. ref. 10) and may 

be used regardless of the state of DNA preservation present in the skeletal material 

intended for analysis. Additional information on special protocols designed for three 

different degrees of DNA degradation is given in the table (see Note 1) and can be used 

to adapt the protocol in case of known DNA preservation. 



57

58 Schmerer 

2. Materials 

To apply the protocol described in the next section, the following chemicals and 

solutions are required. 

1. 0.5 M EDTA solution (pH 8.3). 

2. Sterile water (Ampuwa ® , Fresenius). 

3. Proteinase K-solution (approx 2 g/mL, e.g. Perkin–Elmer). 

4. 70% phenol/chloroform/water (24251, e.g., Rotipuran, Roth, or Perkin–Elmer) or, 

alternatively, a 5 M solution of sodium perchlorate in sterile water. 

5. Chloroform (100%, e.g., Perkin–Elmer). 

6. 2 M sodium acetate buffer (pH 4.5, Perkin–Elmer). 

7. Isopropanol (abs., Merck). 

8. Silica solution (Glasmilk , Dianova). 

9. Ethanol (abs.). 

3. Methods 

1. To prevent coprocessing of possible adhering contaminations, exposed surfaces of the 

bone sample are removed by the use of a scalpel. Subsequently, the material is exposed to 

ultraviolet light for 15 min on each of the surfaces. 

2. According to the consistency of the material, samples are ground to a fine powder using a 

mixer mill (MM2, Retsch) or a mortar and pestle. 

3. Bone powder (0.3 g) is mixed with 1.5 mL of 0.5 M EDTA-solution (pH 8.3) in a 2-mL 

reaction tube (Eppendorf), vortexed vigorously, and incubated for 96 h in a shaking 

waterbath at 20°C and constant shaking (for decalcification of the bone material). 

4. Residues of the bone powder are pelleted by centrifugation at 3000g for 5 min in a 5415 C 

bench-top centrifuge (Eppendorf) or equivalent. The following steps are performed with the 

supernatants (approx 1.3 mL). These are transferred to an automated DNA extraction system 

(Gene Pure, Perkin–Elmer) or alternatively to a 15-mL tube (e.g., BlueMax , Falcon). 

5. The aqueous supernatants are mixed with 1.3 to 1.8 mL sterile water and incubated with 

380 to 650 µL proteinase K-solution (approx 2 g/mL) at 60°C for 1.5 h. 

6. Two volumes (2× supernatant volume) of 70% phenol/chloroform/water (24251) are 

added to the solution. The suspension is constantly shaken for 6 min at room temperature. 

Alternatively, phenol can be replaced by 2 mL of a 5 M sodium perchlorate-solution (ref. 13, 

see Notes 2 and 3). 

7. Using phenol—to facilitate the process—phase separation is performed at 60°C for 8 min 

and the phenolic layer is removed. Alternatively, the suspension can be separated by 

centrifugation at 4500g for 10 min. Using sodium perchlorate, no phase separation occurs. 

After incubation at 60°C for 8 min, the extraction mix is therefore processed according 

to step 8. 

8. The aqueous phase is mixed with 4.0 to 5.3 mL of chloroform (100%) and the resulting 

suspension shaken for 6 min at room temperature. 

9. Phase separation is performed at 60°C for 8 min and the chloroform phase is subsequently 

removed. Alternatively, the suspension can be separated by centrifugation at 4500g for 

10 min. 

10. DNA precipitation takes place in the presence of 64 to 120 µL of 2 M sodium acetate-buffer 

(pH 4.5) and 2.8 to 3.8 mL of isopropanol (abs.) at room temperature. After mixing these 

components for 1 min, the pH of the extraction mix should be determined. If necessary, 

the pH value should be adjusted to a maximum of 7.5 by further addition of sodium 

acetate buffer to ensure optimal precipitation of DNA (see Note 4). Subsequently 5 µL


Table 1 

Extraction Parameters 

DNA preservation state * 

Intermediate 

Low 

Parameters High degradation degradation degradation 

Time of EDTA incubation (96)–120 h 48 h 24 h 

Temperature of EDTA 20°C (20)–30°C (20)–30°C 

incubation 

Time of proteinase (60)–90 min 90 min 60 min 

K incubation 

Extraction reagent Sodium perchlorate Phenol (sodium Phenol (sodium 

perchlorate) 

perchlorate) 

Amount of sodium acetate 64–117 µL 64–117 µL 64–117 µL 

solution (2 M) to to 

(128–233 µL) (128–233 µL) 

Additional purification Wizard Prep (Wizard Prep) (Wizard Prep) 

* DNA preservation state was determined by PCR amplification success and reproducibility of amplification 

results applying the basic protocol optimization was based upon (2,5,16). 

The preservation state was defined as high degradation when specific products were detectable in up 

to 35% of the amplifications, displaying a low degree of reproducibility (12%) in typing results, and low 

degradation when specific products were detected in 70 to 90% of the amplificates, with a reproducibility 

of 86–91%. 

of silica-solution (Glasmilk , Dianova) is added and the mix is shaken again for 10 min 

at room temperature. 

11. Using a DNA extraction device (Gene Pure, Perkin–Elmer), the mix is removed by pressure 

and the DNA–silica complex is collected on a filter membrane. Alternatively, the mixture 

can be separated by centrifugation at 4500g for 10 min. 

12. The DNA–silica complex is washed with 2.8 to 3.8 mL of ethanol (abs.) for 5 min at 

room temperature. Then, the alcohol is removed by renewed filtration or centrifugation. 

Co-extracted salts may be removed using ethane (80Y). 

13. Using an automated DNA extractor, the silica-bound DNA is manually removed from 

the filter membrane with 500 µL of ethanol (abs.) and transferred to a 2-mL reaction 

tube for further processing. 

14. The DNA-silica complex is pelleted by centrifugation for 4500g for 4 min (Centrifuge 

5804, Eppendorf) and the ethanol is discarded. 

15. The resulting pellet is air-dried for approx 30 min at room temperature, redissolved in 50 µL 

of sterile water (Ampuwa ® , Fresenius), thermally eluted at 50°C for 5 min at constant 

shaking (thermal shaker 5437, Eppendorf), and stored at –20°C for further processing. 

4. Notes 

1. In case the state of DNA preservation of the material worked on is known, please change 

the parameters concerned according to Table 1. 

2. The use of sodium perchlorate may result in an inhibition of DNA polymerase during the 

amplification process and therefore requires a further cleaning of the extracted DNA. For 

this purpose, the Wizard PCR Preps purification system (Promega) following a modified 

protocol (12,14) may be used.

60 Schmerer 

3. The additional purification of the extract necessary when using sodium perchlorate results 

in loss of DNA. The use of sodium perchlorate, therefore, might be beneficial if brownish 

color of the bone meal or the extract indicates the presence of co-extracted polymeraseinhibiting 

substances like humic acids (15). In this case, an additional cleaning step would 

always be necessary and the use of sodium perchlorate instead of phenol (13) would not 

result in further loss of DNA. 

4. Make sure to add the sodium-acetate buffer first, and to adjust the pH before adding 

isopropanol to avoid co-precipitation of salts. 

5. Safety Note 

Phenol and chloroform are aggressive organic solvents (please notice the safety 

data sheets provided by the manufacturers) and volatile even at room temperature, 

especially at the elevated temperature recommended to facilitate phase separation in 

steps 7 and 9. Avoid skin contact and inhalation. The use of a vented chemical hood 

is strongly recommended. 

References 

1. Kimpton, C., Fisher, D., Watson, S., Adams, M., Urquhard, A., Lygo, J., et al. (1994) 

Evaluation of an automated DNA profiling system employing multiplex amplification of 

four tetrameric STR loci. Int. J. Leg. Med. 106, 302–311. 

2. Schmerer, W. M., Hummel, S., and Herrmann, B. (1997) Reproduzierbarkeit von aDNAtyping. 

Anthrop. Anz. 55, 199–206. 

3. Weber, J. L. and May, P. E. (1989) Abundant class of human polymorphisms which can be 

typed using the polymerase chain reaction. Am. J. Hum. Genet. 44, 388–396. 

4. Murray, V., Monchawin, C., and England, P. R. (1993) The determination of the Sequences 

present in the shadow bands of a dinucleotide repeat PCR. Nucleic Acids Res. 21, 

2395–2398. 

5. Schmerer, W. M. (1996) Reproduzierbarkeit von Mikrosatelliten-DNA-Amplifikation und 

Alleldetermination aus bodengelagertem Skelettmaterial. Unpublished diploma-thesis, 

Göttingen. 

6. Ramos, M. D., Lalueza, C., Girbau, E., Perez-Perez, A., Quevedo, S., Turbon, D., et al. 

(1995) Amplifying dinucleotide microsatellite loci from bone and tooth samples of up to 

5000 years of age: More inconsistency than usefulness. Hum. Genet. 96, 205–212. 

7. Schultes, T., Hummel, S., and Herrmann, B. (1997) Recognizing and overcoming inconsistencies 

in microsatellite typing of ancient DNA samples. Ancient Biomol. 1, 227–233. 

8. Ivanov, P. L. and Isaenko, M. V. (1999) Identification of human decomposed remains 

using the STR systems: effect on typing results. In: Proceedings of the Second European 

Symposium on Human Identification 1998. Promega Corporation, Innsbruck, Austria. 

9. Lygo, J. E., Johnson, P. E., Holaway, D. J., Woodroffe, S., Whitaker, J. P., Clayton, T. M., 

et al. (1994) The validation of short tandem repeat (STR) loci for use in forensic casework. 

Int. J. Leg. Med. 107, 77–89. 

10. Schmerer, W. M., Hummel, S., and Herrmann, B. (1999) Optimized DNA extraction to 

improve reproducibility of short tandem repeat genotyping with highly degraded DNA as 

target. Electrophoresis 20, 1712–1716. 

11. Schmerer, W. M., Hummel, S., and Herrmann, B. (2000) STR-genotyping of archaeological 

human bone: Experimental design to improve reproducibility by optimisation of DNA 

extraction. Anthrop. Anz. 58, 29–35. 

12. Schmerer, W. M. (2000) Optimierung der STR-Genotypenanalyse an Extrakten alter DNA 

aus bodengelagertem menschlichen Skelettmaterial. Cuvillier Verlag, Göttingen.


13. Johns, M. B. and Paulus-Thomas, J. E. (1989) Purification of human genomic DNA from 

whole blood using sodium perchlorate in place of phenol. Anal. Biochem. 180, 276–278. 

14. Lassen, C. (1998) Molekulare Geschlechtsdetermination der Traufkinder des Gräberfeldes 

Aegerten (Schweiz). Cuvillier Verlag, Göttingen. 

15. Cooper, A. (1992) Removal of colourings, inhibitors of PCR, and the carrier effect of PCR 

contamination from ancient DNA samples. Ancient DNA Newsletter 1, 31–33. 

16. Burger, J., Hummel, S., and Herrmann, B. (1997) Nachweis von DNA-Einzelkopiesequenzen 

aus prähistorischen Zähen. Liegemilieu als Faktor für den Erhalt von DNA. Anthrop. 

Anz. 55, 193–198.

62 Schmerer

DNA Extraction from Plasma and Serum 63 

16 

DNA Extraction from Plasma and Serum 



There are occasions where the only materiel available on a patient is stored plasma or 

serum samples. In normal individuals, the amount of DNA in these samples is very low 

but sufficient to serve as template for PCRs. Moreover, increased amounts of circulating 

DNA have been found in a variety of disorders, including cancer, autoimmune disease, 

and infection. Additionally, small amounts of fetal DNA have been detected in maternal 

plasma/serum during gestation. We have used the following protocol to successfully 

genotype archival plasma samples. 

2. Materials 

1. 10X SDS /Protein K: (Lauryl sulphate [SDS] 10 g/100 mL, Proteinase K 5 mg/mL). 

2. TE (Tris EDTA) buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 

3. Phenolchloroform (11 v/v). 

4. Glycogen (10 mg/mL). 

5. 7.5 M Ammonium acetate. 



3. Method 

1. Place 1.5 mL of serum or plasma into a 15-mL centrifuge tube. 

2. Add 1.5 mL of 1X SDS proteinase K solution in the tube containing the serum and mix 

well. 

3. Digest overnight at 55°C in water bath. 

4. Add 3 mL of phenol/chloroform solution. 

5. Vortex 30 s and centrifuge for 10 min at 1000g using a swing-out rotor. 

6. Transfer aqueous layer to fresh tube and repeat steps 4 and 5. 

7. Transfer aqueous layer to fresh tube and add 5 µL of glycogen (10 mg/L), 1 mL of 7.5 M 

ammonium acetate, and 8 mL of 100% ethanol. 

8. Mix by inverting and centrifuge at 2500g for 40 min. 

9. Carefully remove supernatant and wash pellet in 10 mL of 70% ethanol. 

10. Centrifuge at 2500g for 10 min. Carefully remove last traces of ethanol, and allow to air 

dry for 10 min before redissolving in 100 µL of TE. 



63

64 Stirling

Detection of Nucleic Acids 65 

17 

Technical Notes for the Detection of Nucleic Acids 



In following any polymerase chain reaction (PCR)-based method, it is usual to 

identify the products of the reaction by some form of detection system. The majority 

of these still rely on size- and charge-based separation systems, although for some 

quantitative PCR applications, either direct measurement of fluorescence or indirect 

Enzyme-linked immunosorbent assay-based systems can be used. In this chapter, we 

summarize some of the most common methods for detection of nucleic acids as a 

handy reference for those seeking to validate their PCR reactions. Although there are 

many variants of these techniques, we have confined our reporting to methods of which 

we have direct experience and which offer broad applicability. Fluorescence detection 

of quantitative real-time PCR requires specialist equipment, and we have therefore 

omitted this from our discussions at present. 

2. Gel Electrophoresis 

By far the most common procedure for the analysis of nucleic acids is gel electrophoresis. 

This is a highly flexible approach that provides information on the size of 

the DNA molecule and under certain conditions can be used to discriminate different 

sequences of the same size. Electrophoresis can also be used to separate and purify 

nucleic acid fragments, to quantify allelic imbalances, etc. For DNA electrophoresis, 

the most common supports used are agarose and polyacrylamide. These are highly 

flexible because varying the concentration, and for polyacrylamide, the degree of 

crosslinking, can markedly alter the size range which can be discriminated. In general, 

polyacrylamide gels are more useful for separating smaller fragments of DNA (under 

300–500 base pairs) and for applications where high resolution is required (such as 

analysis of microsatellites) because they are capable of resolving size differences of 

as little as 1 bp. Polyacrylamide gels can be run faster and at higher temperature 

than agarose gels. However, acrylamide is a neurotoxin and presents a safety hazard. 

Most laboratories now eschew the process of producing their own acrylamide solutions, 

relying instead on commercially prepared materials to circumvent this hazard. 

Polyacrylamide gels are also more difficult to pour and handle than agarose gels. 

Furthermore, using polyacrylamide gels requires, in general, the use of labeled 



65


Table 1 

Recommended Agarose Concentrations 

for DNA Electrophoresis 

Percentage agarose (w/v) 

Molecular weight range 

0.6% 1000 –20,000 bp 

long PCR 

1.0% 1500 –5000 bp 

2% 1100 –2000 bp 

3% 1110 –500 bp 

nucleotides, although silver staining may be applied to these gels the fragility of the 

gel often precludes this. 

Agarose gels, however, are more robust and easy to prepare. Although resolution is 

poorer, some modern forms of agarose claim separations that rival that of acrylamide 

gels. The major strength of agarose-based gels is the greater range of separation. 

Conventional agarose electrophoresis can separate DNAs from 200 to 50,000 bp which 

is more than adequate for PCR-based systems. Adaptations of agarose electrophoresis, 

for example, those using pulsed electric fields, can be used to separate DNA fragments 

of up to 10 Mbp. 

2.1. Selecting Conditions for Agarose Gel Electrophoresis 

Those interested in understanding the electrophysical properties governing migration 

of DNA in agarose supports can refer to a number of molecular biology texts that 

cover these areas or alternatively visit the web (1) for a useful guide to electrophoresis 

with agarose gels. 

2.1.1. Agarose Concentrations 

Table 1 outlines recommended agarose concentrations for gel electrophoresis of 

DNA. Note that modern specialist formulations of agarose may require alterations to 

this table (e.g., Nusieve, etc.). 

2.1.2. Buffers 

Two buffering systems are commonly used for agarose gel electrophoresis of DNA; 

of these, Tris acetate EDTA buffer (TAE) is more widely accepted because it facilitates 

recovery of material from agarose. However, it has a relatively low buffering capacity, 

and recirculation of buffer may be required over long electrophoresis runs (4–6 h). 

Tris borate EDTA (TBE) is preferred for small molecules and longer electrophoresis 

times because of its higher buffering capacity. We have used both with good results. 

Independent of the buffer selected, attention should be paid to the depth of buffer. In 

most systems 3 to 5 mm of buffer should cover the gel. Insufficient buffer may allow the 

gel to dry out during the run, whereas excessive buffer will reduce the current through 

the agarose support, promote heating and decrease DNA motility. Electrophoresis is 

performed applying a voltage of between 1 to 5 V/cm (where cm is the distance in 

centimeters between the electrodes in the gel tank).


2.1.3. Loading Dyes 

Loading dyes serve two purposes: They are usually dense and promote the settling 

of the DNA to the base of the well. They usually contain dyes that migrate with the 

DNA and can be visualized to monitor the process of electrophoresis. Care should 

be taken, however, because the common dyes used (bromophenol blue and xylene 

cyanol) have different motilities in different agarose products, with differing buffers 

and differing gel percentages (see ref. 3). 

2.1.4. DNA Dyes: Before or After? 

Most dyes (ethidium bromide, SYBR green, etc.) that are used to stain DNA do 

so by intercalating into the DNA sequence. As such they, of necessity, alter both the 

structure and motility of the DNA. Although this can give spurious results, for many 

applications (such as confirmation of PCR products before cloning or sequencing) this 

is not a major issue. In these cases, the dye is often added to the loading buffer or gel 

before electrophoresis. Where an accurate determination of product size is required, 

such as in randomly amplified polymorphic DNA (RAPD) or allelotyping, products 

should be separated in the absence of dye and the gel stained thereafter. 

2.1.5. Recovery of DNA from Agarose Gels 

Having identified the product on agarose gels, often there is a requirement to 

sequence or otherwise analyze the product. Recovering DNA from agarose gels is a 

simple procedure that can be attempted in many ways (1). It is important, however, that 

the decision regarding recovery of DNA is taken before electrophoresis is attempted 

as the choice of agarose is probably the most crucial factor in determining DNA yield 

after extraction from agarose. Protocols for recovery of DNA from agarose can be 

accessed from the web (see ref. 1 for a good range of methods). 

2.2. Polyacrylamide Gel Electrophoresis (PAGE) of DNA 

Casting and running polyacrylamide gels is undoubtedly more complex and problematic 

than using agarose electrophoresis. Almost universally, polyacrylamide gels 

are supported between glass plates and must be polymerized by a chemically catalyzed 

reaction with the inherent problems caused by failed reagents from time to time. 

However, PAGE has distinct advantages in terms of resolution, capacity, and purity of 

DNA bands. The resolving power of PAGE is such that molecules of DNA with lengths 

differing by as little as 0.2% (2 bases/Kb) may be separated (although some novel 

agarose preparations can approach this for smaller fragments). PAGE has a higher 

capacity for DNA than agarose, with up to 10 µg of DNA per lane being applied 

without compromising results. DNA recovered from PAGE is extremely pure and has 

been used for microinjection into mouse embryos (2). 

PAGE is equally applicable to separation of double-stranded or single-stranded 

DNA (under denaturing conditions); however, the size range of fragments that can 

be separated is more restrictive than for agarose because of the fragile nature of low 

percentage acrylamide gels (see Table 2). 

PAGE gels are crosslinked using a varying ratio of bis-acrylamide in the monomeric 

solution; generally, the ratio of acrylamide to bis-acrylamide is around 301.


Table 2 

Separation of Double-Stranded DNA: 

What Percentage of Acrylamide? 

Acrylamide (% w/v) 

DNA size range 

13.5 1000 –2000 bp 

15.0 1180 –500 bp 

18.0 1160 – 400 bp 

12.0 1140 –200 bp 

15.0 1125 –150 bp 

20.0 1116 –100 bp 

2.2.1. Nondenaturing PAGE Conditions 

Although both TAE and TBE can be used for PAGE, we recommend use of TBE 

because this generally provides sharper bands on low-percentage gels. Running gels in 

1× TBE under low voltages (1–8 V/cm) will prevent denaturation of DNA caused by 

heating of the gel. Although the electrophoretic mobility of double-stranded DNA 

is inversely proportional to the log(fragment length), this relationship can be altered 

by both GC content and sequence. For this reason, PAGE is not a reliable means of 

sizing DNA fragments. 

2.2.2. Denaturing PAGE 

Denaturing page gels contain a denaturing agent (usually 6–8 M urea) that inhibits 

base pairing in nucleic acids. DNA fragments are loaded after a brief heat denaturation 

and electrophoresis at high voltages (ca 20 V/cm) ensures that high temperatures are 

maintained throughout the electrophoretic process. Denaturing gels are most commonly 

used to analyze sequencing reactions and to recover labeled DNA probes. As one 

would predict from their common use in sequence determination, the motility of DNA 

fragment under denaturing conditions is almost totally unaffected by sequence and 

base composition. 

2.2.3. Recovery of DNA from Polyacrylamide Gels 

In our experience, recovery of DNA from polyacrylamide gels is vastly simpler than 

recovery from agarose, largely because of the fact that much larger quantities of DNA 

are loaded onto the gel. Elution overnight by diffusion can recover 70 to 80% of the 

nucleic acid in Maxim–Gilbert’s solution. 

2.2.4. Radioisotopic Detection and Quantitation 

One of the major advantages of polyacrylamide gels is the ability to dry them 

onto supports and produce autoradiographic images. These can either be analyzed by 

densitometry or used as a template to allow direct counting of the bands of interest. 

Although the latter approach is time consuming, it provides a highly quantitative 

analysis of DNA species in (for example) quantitative PCR (3).


2.2.5. Nonradioisotopic Detection and Quantitation 

The increasing trend in modern molecular applications is away from the use of large 

amounts of radioactivity and to substitute biotinylated or digoxigenin-labeled DNA 

for 32-P- or 33-P-labeled nucleotides. More recently, directly fluorescently labeled 

nucleotides have been released which, with the appropriate systems, can also aid 

detection of nucleic acid. These approaches are largely applicable in northern and 

southern blotting procedures, and although these can be applied to sequencing (blotting 

of sequences) or other DNA gel procedures, they are time consuming and introduce an 

additional potential source of error. Other methods, such as silver staining, are more 

attractive because they do not require blotting, but they are generally less sensitive than 

radioisotopic procedures. With this proviso, they provide a useful and rapid means of 

detecting nucleic acids in situ, before proceeding with experiments. 

2.3. Summary 

It is of course impossible to detail all possible systems for detection of DNA in a 

simple chapter such as this one; however, we have included below examples of the 

major approaches to detection of nucleic acids that can be adapted to suit most needs. 

This is very much a general guide for broad application and other methods can be 

sourced from the references included below. 

3. Materials 

3.1. Agarose Gel Electrophoresis 

1. Low melting point agarose (Sigma). 

2. 50× TAE: 242 g of Trizma Base (Sigma) and 100 mL of 0.5 M EDTA (pH 8.0) are 

dissolved in 800 mL distilled water and autoclaved. Then, 57.1 mL of glacial acetic acid 

is added; make up to 1 L. 

3. Gel loading buffer: 0.25% Bromophenol blue (w/v), 0.25% xylene cyanol FF (w/v), and 

30% glycerol (v/v) in distilled water (see Note 1). 

4. Molecular weight markers (e.g., 100-bp ladder; Gibco). 

5. Gel apparatus and power pack. 

6. Ethidium bromide (10 mg/mL) in water (see Note 2). 

7. Ultraviolet light box and camera. 

8. Activated charcoal. 

3.1.1 Recovery of DNA from Agarose Gels 

1. Scalpel blades. 

2. β-agarose and buffer (Calbiochem, UK). 

3. Phenolchloroform 11 mixture (Sigma, UK). 

4. Ammonium acetate (7.5 M). 


3.1.2. PAGE 

3.1.2.1. NONDENATURING PAGE 

1. 40% Acrylamide (38 g of acrylamide, 2 g of bis-acrylamide, Bio–Rad, UK) in distilled 

water.


2. 5× TBE: 54 g of Tris-base, 27.5 g of boric acid, 20 mL of 0.5 M EDTA (pH 8.0) dissolved 

in 800 mL distilled water; make up 1 L. 

3. 10% w/v ammonium persulphate (make fresh for each use). 

4. TEMED (Bio–Rad). 



6. Molecular weight markers (e.g., 100-bp ladder; Gibco). 

7. Vertical gel electrophoresis system, spacers (1.0 mm; e.g., Bio–Rad Protean II). 

3.1.2.2. DENATURING PAGE 

1. 40% Acrylamide (38 g of acrylamide, 2 g of bis-acrylamide, Bio–Rad, UK) in distilled 

water. 

2. 5× TBE: 54 g of Tris-base, 27.5 g of boric acid, 20 mL of 0.5 M EDTA (pH 8.0) dissolved 

in 800 mL of distilled water; make up to 1 L. 

3. Urea (Sigma, UK). 

4. 10% w/v ammonium persulphate (make fresh for each use). 

5. Temed (Bio–Rad). 

6. Radioactively labeled molecular weight markers: We have used Hinf1-digested plasmids 

labeled with Klenow enzyme (see Note 3). 



8. Vertical gel electrophoresis system, spacers (0.6 mm). 

9. Gel fixative: Prepare 2 L of 10% acetic acid and 10% methanol in distilled water. 

10. Whatmann 3MM Paper. 

11. Gel dryer. 

12. Autoradiographic film and cassettes. 

13. Developer and fixative for above. 

3.1.3. Recovery of DNA from Acrylamide Gels 

1. Maxam & Gilberts solution: 0.5 M ammonium acetate, 0.1% sodium dodecyl sulphate, 

and 1 mM EDTA; store at –20°C. 

2. Transfer RNA (tRNA) 10 mg/mL and store at –20°C (optional). 

3. Absolute ethanol (–20°C). 

4. 70% ethanol (–20°C). 

4. Methods 

4.1. Agarose Gel Electrophoresis 

1. Prepare a clean flat bed electrophoresis tray, with sealed ends (see Note 4) and a comb 

with the appropriate number of samples. Fill tank with 1× TAE. 

2. Dissolve 3 g of low melting point agar in 100 mL of 1× TAE buffer. 

3. Weigh the flask and note weight before microwaving. 

4. Microwave until clear, take care not to over boil (see Note 5). 

5. Allow to cool slightly, weigh, and add sufficient distilled water to make up to premicrowave 

weight. 

6. Cool agarose to approx 50°C before pouring into gel support. Insert comb 0.5 to 1.0 mm 

above the base of the tank, add agarose and allow to set (30 to 60 min). 

7. Remove buffer dams or tape and place gel in electrophoresis tank. Add sufficient buffer 

to cover gel to approx 1 mm.


8. Mix DNA with gel loading buffer by adding 11 DNA solution to gel loading buffer. 

Slowly add approx 5 to 10 µL sample per well. Add 1 µg of DNA molecular weight marker 

to 4 µL of water and 5 µL of gel loading buffer to one lane (see Note 6). 

9. Close the lid of the tank to generate an electrical circuit (see Note 7) and run at a voltage 

of 1 to 5 volts/cm. Check bubbles are arising from the anode and that the dye is migrating 

into the gel. 

10. When migration of markers is complete, remove gel and visualize under ultraviolet light 

and photograph. 

11. Use intensity of bands to estimate DNA concentration; densitometric scanning of the 

photograph can also be used as appropriate. 

4.1.1. Staining of Agarose or Acrylamide Gels 

1. Remove the gel from the electrophoresis tank and stain in 0.5 to 1 µg/mL ethidium 

bromide in sufficient electrophoresis buffer to cover the gel for about 10 to 20 min at 

room temperature. 

2. Destain in distilled water for 2 × 20 min. 

3. Visualize gel (see Note 7). 

4.1.2. Decontamination of Ethidium Bromide Solutions 

Both electrophoresis buffers from ethidium bromide containing gels and staining/ 

destaining of gels should be decontaminated before disposal (see Note 2). 

1. Add 1 g/L activated charcoal. 

2. Stir for 30 to 60 min at room temperature. 

3. Remove charcoal by filtration and discard solution. 

4. Place charcoal and agarose gel into solid waste for incineration (see Note 8). 

4.1.3. Recovery of DNA from Agarose Gels 

Recovery of DNA from agarose gels produces highly variable yields dependent on 

fragment length. Long fragments (5–10 kb and above) are prone to shearing if vortexed. 

We have described here the agarose method that is most widely applicable, in our 

hands; however, postrecovery purification with phenol chloroform greatly improves 

the purity of the DNA and is recommended where postrecovery enzyme modifications 

are planned. The use of TAE buffer is recommended and care should be taken not 

to overload the gel. 

1. After running the gel, visualize the band of interest under ultraviolet light and excise using 

a scalpel (see Note 9). Remove the band as cleanly as possible; the lower the amount of 

agar present in the gel slice, the better the recovery. 

2. Transfer up to 200 mg of agarose gel slice to a microcentrifuge tube and melt at 75°C 

(5–10 min. see Note 10) then cool to 45°C. 

3. Estimate volume of melted gel and add 2% 50× agarose buffer and mix gently (see 

Note 11). 

4. Add β-agarose (add 3–4 units per 100 mg of a 1% agarose gel), mix gently (see Note 11), 

and incubate at 45°C for 3 to 4 h (see Note 12). 

5. Add an equal volume of phenolchloroform and mix by gentle inversion 10 to 20 times. 

6. Centrifuge at 3000g for 5 to 10 min.


7. Remove upper aqueous layer to a new microfuge tube and add 20 µL of 7.5 M ammonium 

acetate and 2 volumes of ice cold 100% ethanol. Mix by gentle inversion 10 to 20 times 

and let stand for 30 min (see Note 13). 

8. Centrifuge at 15,000g for 10 min and discard supernatant. 

9. Allow pellet to air dry and resuspend in distilled water. 

4.2. PAGE 

Many applications using PAGE are based on radiolabeling of DNA; however, we 

have successfully used this system also for silver-stained and ethidium bromide-stained 

gels. 

4.2.1. Nondenaturing PAGE 

1. Prepare a 6% (see Note 14) acrylamide gel by mixing 7.5 mL of 40% acrylamide, 

10 mL of 5×TBE, and 32.5 mL of distilled water (50 mL total, sufficient for 2 × 20 cm 

protean II gels). 

2. The protean II system is supplied with a gel-pouring apparatus, the vertical clamps seal the 

sides of the gel, and a rubber cushion seals the base. Add 25 µL of TEMED and 250 µL of 

fresh ammonium persulphate solution to the acrylamide and pour gels immediately (see 

Note 15). Insert combs and leave to polymerize for 30 to 60 min. 

3. Remove combs and wash wells with 1× TBE (see Note 16). Prepare electrophoresis 

equipment and add 1× TBE to top and bottom buffer chambers. Cool electrophoresis 

equipment by passing water through central core (see Note 17). 


Slowly add approx 5 to 10 µL of sample per well. Add 1 µg of DNA molecular weight 

marker to 4 µL of water and 5 µL of gel loading buffer to one lane (see Note 6). 

5. Electrophorese at 30 mA for 2 to 3 h. 

6. Carefully remove the top gel plate and thoroughly wet gloves and gel with 1× TBE. 

Gently remove gel onto a prewetted support prior to visualization under ultraviolet light 

(see Note 18). 

4.2.2. Denaturing PAGE 

Although nondenaturing PAGE is applicable to both unlabeled and labeled DNA, 

the fragile nature of the thin gels commonly used for denaturing PAGE makes radioactive 

labeling more common. We have, however, successfully used silver staining to 

visualize DNA on PAGE (see ref. 1). We have, however, described here conventional 

radioactive detection of single-stranded DNA. 

1. To make a 6% denaturing gel: weigh 42 g of urea and add 15 mL of 40% acrylamide, 

20 mL of 5× TBE, and 30 mL of distilled water. Stir at room temperature until urea 

dissolves completely. 

2. Prepare vertical gel electrophoresis system for gel pouring, ensuring that the plates are 

clean (see Note 19), and seal with sleek tape. 

2. Add 80 µL of TEMED and 800 µL of fresh ammonium persulphate solution to the 

acrylamide and pour gel immediately (see Note 15), tapping vigorously during pouring to 

free any air bubbles. Insert comb and leave to polymerize for 30 to 60 min. 

3. Place the gel in a vertical electrophoresis tank and fill the upper and lower chambers 

with 1× TBE. 


Slowly add approx 1 to 3 µL of sample per well. Heat samples to 85°C for 5 min and cool


on ice before loading. Add 1 µg of radioactively labeled DNA molecular weight marker to 

1 µL of gel loading buffer in one lane. 

5. Electrophorese at 30 mA for 2 to 3 h or at constant temperature (see Note 20). 

6. Remove gel from the electrophoresis tank and discard radioactive buffer. 

7. Place gel plates on tissue paper and insert a scalpel between the back plate and spacers. 

Remove the backplate trying to ensure that the gel remains on the front plate (see Note 

21). 

8. Immerse gel, on plate, in gel fixation solution and fix for 15 to 30 min. Carefully remove 

the gel, on the plate, from the fixative, drain, and cover with a dry piece of Whatman 

3MM filter paper. 

9. Either invert the gel and carefully lift the glass plate away from the paper or lift the paper 

gently from the glass plate. The gel should stick to the paper. 

10. Dry on a gel dryer for 60 min at 80°C under vacuum (see Note 22). 

11. Cover gel with clingfilm and place autoradiography film directly over the gel and expose 

at –70°C (see Note 23). 

4.2.3. Recovery of DNA from Acrylamide Gels 

Recovery of DNA from acrylamide is a relatively simple procedure because of the 

higher amounts of DNA that can be loaded on acrylamide gels, with yields of around 

50 to 60% sufficient DNA recovered for most applications. We have only applied this 

technique to unfixed gels stained with ethidium bromide. 

1. After running the gel, visualize the band of interest under ultraviolet light and excise using 

a scalpel (see Note 9). Remove the band as cleanly as possible; the lower the amount of 

acrylamide present in the gel slice, the better the recovery. 

2. Transfer to a microcentrifuge tube and add 400 µL of Maxam & Gilberts solution. 

2. Vortex and incubate overnight at 37°C. 

3. Spin down the gel by pulse centrifugation for 30 s at 5000g in a bench-top centrifuge. 

4. Remove supernatant to a separate Eppendorf tube (approx 350 µL). 

5. Add 1 µL of 10 mg/mL tRNA (optional, omit if required). 

6. Add 2.5 volumes of ice-cold 100% ethanol and mix gently. 

7. Stand for 20 min and centrifuge for 10 min at 15,000g. 

8. Decant supernatant and add 300 µL of 70% ethanol, mix gently. 

9. Centrifuge for 10 min at 15,000g. 

10. Decant supernatant and air dry pellet. 

11. Resuspend in 20 µL of distilled water. 

5. Notes 

1. For some applications, lower concentrations of dyes can give better results, for example, 

when the DNA fragment runs close to one of the dyes. In this case, dilute loading buffer 

15 in 30% glycerol. 

2. Ethidium bromide is a carcinogen, teratogen, and mutagen. Handle with respect. 

3. Digesting plasmids with enzymes such as HinfI leaves 5′ overhangs that can be labeled 

with Klenow using the following reaction: 1 µg of digested plasmid in 5 µL of distilled 

water, 2 µL of 10 × repair buffer supplied with Klenow); 1 µL of a mixture containing 

2 mM each of dGTP, dCTP, and dTTP; 2 µL of 35 S-dATP (approx 0.5 µCi), and 1 µL of 

Klenow fragment of DNA polymerase (5–10 units) in a total volume of 20 µL. Incubate 

for 30 min at room temperature and stop reaction by adding 2 µL of 0.25 M EDTA. Store 

at –20°C and use 0.5 to 1 µL per gel.


4. Many modern electrophoresis tanks are equipped with seals or with buffer dams to allow 

pouring of the gel or, alternatively, one can tape over the end of the tray with autoclave 

tape. Ensure gels are poured on a level surface. 

5. Undissolved agarose appears as small lens-shaped flecks in the solution; reheat until the 

solution is clear. Take care not to superheat the solution because it may boil over. 

6. Modern electrophoresis equipment will not allow circuits to be completed until the tank is 

sealed. If you have an older tank without this safety feature, discard it! 

7. If the bands appear faint, with a dark background the gel is understained, return to buffer 

containing ethidium bromide and repeat. If the bands appear faint with a bright background 

the gel is overstained, destain in excess electrophoresis buffer (without ethidium bromide) 

for 10 to 20 min and revisualize. 

8. Standard incineration is sufficient to decontaminate ethidium bromide. 

9. Ultraviolet light produces strand breaks in DNA. Even exposure for short periods (30 s) 

can compromise DNA recovery. Ensure recovery of bands as quickly as possible. Where 

multiple bands are to be recovered, we have blocked the ultraviolet from parts of the gel 

using cardboard under the gel support. Some protocols recommend the addition of 1 mM 

guanosine or cytidine to the gel and electrophoresis buffers to protect DNA at the 

transillumination stage. 

10. Ensure the agarose is completely melted to optimize digestion. 

11. Vortexing can shear large DNA fragments, take care. 

12. Although recommended incubation times are shorter, we have found extending the 

incubation time can improve the yield and ensure complete digestion of the agarose. 

13. If the expected DNA concentration is less than 50 ng/µL, we recommend the addition of 

5 µg of tRNA to enhance precipitation. 

14. We have successfully worked with 4 to 20% acrylamide gels for various applications. Use 

of low concentration acrylamide is only possible in our experience where supports for the 

gels (Whatman paper) is provided and this limits the use to radioactive applications. 

15. Polymerization will commence as soon as these catalysts are added and is temperature and 

time dependent, work quickly but carefully. 

16. Wells will frequently contain small amounts of acrylamide solution that has notolymerisind 

because of contact with air (oxygen inhibits polymerization). Washing the wells prevents 

this from sinking to the base of the well and polymerizing giving uneven well depths. 

17. The protean system is cooled by circulation of water through a central core. This is helpful 

when rapid results are required, but not essential. 

18. Acrylamide gels, especially low percentage gels, are extremely fragile and tear easily, and 

handling them is an art learned through practice (and much frustration!). Siliconization 

of glass plates can aid removal of gels, but in our experience, providing the plates are 

clean separation is relatively easy. If your gel sticks to the glass, clean them thoroughly 

before use. 

19. A common cause of tearing of gels and problems with pouring is dirty glass plates. Before 

use, scrub glass plates with concentrated detergent, rinse extensively with tap water and 

distilled water, and then with methylated spirits. Dry thoroughly before use. Clean spacers 

and combs by wiping with methylated spirits. 

20. Modern powerpacks provide the option of running gels at constant temperature (usually 

65°C), and we have found this to provide more consistent results. 

21. The use of a silicon solution on the backplate after washing can facilitate separation. Be 

pragmatic: If the gel sticks to the back plate remove the front plate. When silver staining 

is to be used, stain the gel in situ on the plates. 

22. If the gel cracks into a “crazy paving” type pattern while drying, this is indicative of poor 

fixation. Extend fixation period. This approach can be used with thicker gels (1–1.5 mm),


and higher percentage gels (up to 20%), longer fixation and drying times are needed. For 

high percentage gels adding 10% glycerol to the fixative helps preserve the gel. 

23. If using 35-S, the use of enhancer screens is essential. Also, omit the cling film to ensure 

exposure. However, be careful to avoid moisture or the gel will stick to the film. 

References 

1. http://www.protocol-online.org 

2. Sanbrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory 

Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring, New York. 

3. Bartlett, J. M. S., Hulme, M. J., and Miller, W. R. (1996) Analysis of cAMP RI-alpha 

messenger-RNA expression in breast cancer—Evaluation of quantitative polymerase 

chain-reaction for routine use. Br. J. Cancer 73, 1538–1544.

76 Bartlett

Recovery of PCR Products from Gels 77 

18 

Technical Notes for the Recovery and Purification 

of PCR Products from Acrylamide Gels 



Although the best way of obtaining pure polymerase chain reaction (PCR) product 

will always be to optimize reaction conditions to yield only one product, there are 

still circumstances where DNA has to purified from gels. Several good commercial 

products exist for the recovery of DNA from agarose. Here, we present a reliable 

method of recovering DNA from polyacrylamide gels. 

2. Materials 

1. Sterile scalpel blade. 

2. Microfuge tubes (0.5 and 1.5µL). 

3. Sterile narrow-gauge needle (23-guage). 

4. Tris-HCl EDTA buffer: 10 mM Tris-HCl, 10 mM EDTA, pH 8.0. 

5. 3 M sodium acetate (pH 4.0). 



3. Method 

1. Stain the gel with ethidium bromide, visualize the band of interest, and dissect with 

scalpel blade. 

2. Pierce hole in the bottom of a 0.5 ml Microfuge tube with narrow gauge needle. 

3. Place 0.5 mL of TE in a 1.5-mL microfuge tube. 

4. Place the acrylamide slice with the dissected DNA band into a 0.5-mL tube (with hole) and 

place inside the 1.5-mL tube (the lip will prevent it touching the bottom). 

5. Microfuge the two-tube combination at 12,000g for 5 min. The acrylamide will be forced 

through the hole in the bottom of the 0.5-mL tube into the TE. 

6. Discard the empty 0.5-mL tube. 

7. Cap the 1.5-mL tube, vortex for 30 s, then incubate for 2 h overnight at 37°C. 

8. Microfuge at 12,000g for 5 min. 

9. Transfer supernatant to fresh tube. 

10. Add 1/10 volume 3 M sodium acetate and 2 volumes 100% ethanol. 



77

78 Stirling 

11. Store at –20°C for at least 30 min. 

12. Microfuge at 12,000g for 20 min at room temperature. 

13. Discard supernatant and wash pellet in 70% ethanol. 

14. Dry pellet and redissolve in 25 µL of TE. 

15. If concentration of DNA is insufficient for further processing, re-amplify 1 µL in a second 

round of PCR.

PCR Primer Design 81 

19 

PCR Primer Design 

David L. Hyndman and Masato Mitsuhashi 


The selection of primers for a given polymerase chain reaction (PCR) can determine 

the efficiency and specificity of the PCR. Although in many cases successful PCR 

primers have been selected with little understanding of the principles involved, PCR 

can often only be achieved by using primers that are designed appropriately. Here, 

we give general recommendations for PCR primer selection and various aspects to be 

considered when designing primers. 

2. General Primer Considerations 

2.1. Location 

The location of PCR primers is sometimes dictated by the purpose of the experiment. 

If the experiment is simply intended to identify the presence or absence of the sequence, 

then the location is of no consequence, so long as the amplification works well. If, 

however, the experiment is part of an assay for a particular allele of a gene, then the 

amplicon would be required to contain that region of interest. 

2.2. Amplicon Size 

In general, amplicons are from 100 to 1000 bp in length. The lower limit is caused 

by the typical need to be able to visualize the amplicon on an agarose gel. The upper 

limit of 1000 bp is the result of difficulties in amplifying large sequences. If an assay 

that does not require a minimum amplicon size is used, there is no theoretical minimum 

amplicon size. 

2.3. Guanine/Cytosine (G/C) Content 

Defined as the proportion of bases in the primer that are either G (guanine) or 

C (cytosine), good PCR primers are generally selected to have a G/C content between 

40 and 60%. However, there is no well-defined reason for this, only that it has been 

considered preferable. 

3. Considerations for Optimal PCR 

The issues concerning PCR primer design can be divided into two categories: 

efficiency and specificity. Both of these are important to consider in most applications, 

but often the factors that promote one of these will adversely affect the other. 



81

82 Hyndman and Mitsuhashi 

3.1. Efficiency 

Efficiency can be viewed as the proportion of templates that are used to synthesize 

new strands with each round of PCR, assuming the PCR primers are in a high 

abundance. A situation in which efficiency is the primary concern is the amplification 

of a purified template in which there is no chance of nonspecific PCR amplifications, 

so the main issue is that of primer binding to its target. 

3.1.1. Melting Temperature 

Melting temperature, or Tm, is defined for a given DNA duplex as the temperature 

at which half of the strands are hybridized and half of the strands are not hybridized. 

The original definition of T m implied that the two complementary strands were in equal 

proportions. In cases where the two strands are not in equal proportions, such as a 

primer hybridizing to its target in PCR, the definition of Tm must be altered. Because 

in a PCR primer concentrations will be orders of magnitude higher than template 

concentrations, the interpretation is that the Tm is the temperature at which a primer is 

hybridized to half of the template strands. The T m of a given primer/template combination 

depends on primer concentration, template concentration, and salt concentration. 

Generally, the template concentration is considered to be negligible compared with the 

primer concentration, so the formula for calculating Tm is simplified such that it does 

not contain a parameter for template concentration. 

T m can be expressed as follows: 

∆H 

T m = ————— –273.15 + 16.6 log [Na + ] (1,2) 

∆S + Rln(c) 

The primer concentration is c; the ∆H and ∆S refer to the total enthalpy and entropy 

of hybridization, respectively; and [Na + ] is the sodium ion concentration but can 

refer to the total concentration of most monovalent cations (such as K + ). If there is 

Mg 2+ or other divalent cations such as Mn 2+ , the conversion is generally accepted 

as follows: 

Na + = 4 × [Mg 2+ ] 2 (3) 

3.1.2. Calculating T m with the Nearest Neighbor Model 

The accurate calculation of T m from a given sequence requires determining the 

∆H and ∆S of the hybridization. The most successful method for this is through the 

use of the nearest neighbor model (4–7). With the nearest neighbor model, every pair 

of adjacent base pairs makes a specific contribution to the overall ∆H and ∆S of the 

duplex. The total ∆H and ∆S are calculated by adding all of the component values 

plus a value for initiation of duplex formation. A table of ∆H and ∆S nearest neighbor 

values is shown in Table 1 (5). 

3.1.3. Efficient PCR Primers and T m 

The most important issue for designing efficient PCR primers is that they must bind 

to the target site efficiently under the conditions of the PCR. This generally means not 

only that they bind at the annealing temperature but that if the annealing temperature


Table 1 

Nearest Neighbor Thermodynamic Values 

for DNA Base Pairs 

Base Pair ∆H ∆S ∆G 

aa/tt 1–8.4 –23.6 –1.21 

at/ta 1– 6.5 –18.8 – 0.73 

aa/at 1– 6.3 –18.5 – 0.61 

ca/gt 1–7.4 –19.3 –1.38 

gt/ca 1–8.6 –231. –1.43 

ct/ga 1– 6.1 –16.1 –1.16 

ga/ct 1–7.7 –20.3 –1.46 

gc/cg –11.1 –28.4 –2.28 

gg/cc 1– 6.7 –15.6 –1.77 

is so low that the thermostable DNA polymerase is not active, the primer must be 

bound at the temperature at which the polymerase becomes active in order to begin 

extension. 

3.1.4. Typical Three-Step PCR 

As an illustration, let us examine a typical PCR cycle, where there is a dissociation 

step of 30 s at 95°C, an annealing step of 1 min at 37°C, and an extension step of 3 

min at 72°C. If the T m of the primer, in the conditions of the reaction, is 65°C, then 

the following will happen. As the temperature decreases from 95°C to 37°C, at some 

point the primer will hybridize to the template. At this temperature, however, the 

thermostable DNA polymerase may be almost totally inactive. As the temperature rises 

towards 72°C, at some point the polymerase becomes active and will start to extend the 

primer along the template. As the temperature rises above 65°C, some of the primers 

will dissociate if they haven’t been extended. Those that have extended sufficiently, 

however will form a more stable duplex as a result of their added base pairs from the 

extension, and they will not dissociate before reaching 72°C. During the extension at 

72°C, the primers still hybridized will be fully extended to generate new strands. 

Let’s now imagine that with this scenario the T m of the primer is 75°C. In this 

case, as the temperature rises from annealing to extension, even primers that have 

not extended will not dissociate. In this scenario, there will be almost total extension 

of every possible target strand. Therefore, this PCR would have a high degree of 

efficiency. 

3.1.5. Two-Step PCR 

PCR is sometimes performed in two steps without a discrete annealing step. In this 

case, the annealing takes place at the same temperature as the extension. This requires 

that the primers will hybridize to some degree at the extension temperature. If the 

extension temperature is 72°C, then a primer with a T m of 72°C would be an efficient 

primer. Because the definition of T m is the point at which half of the templates are in 

a duplex, a short time after reaching 72°C, half of the templates will be bound by a 

primer. Shortly after that, a large percentage of those templates will be extended by


Fig. 1. Hairpin structures. 

the polymerase and thereby taken out of the equilibrium between bound and unbound 

templates. Because the primer concentration will essentially be unchanged, half of the 

remaining templates will then be bound by primers and extended. In this way, most 

templates can be extended if the extension is done at the T m of the primer. 

If, however, the T m of the primer is a few degrees below the extension temperature, 

only a small percentage of the primers will be hybridized, and the PCR will not be 

efficient. Therefore, very efficient and specific PCR can be performed with two-step 

cycling, but a sufficiently high primer T m is very important. 

3.1.6. Hairpins 

A hairpin is a structure formed by a single DNA molecule in which a portion on 

one part of the DNA hybridizes to a complementary portion within the same DNA 

strand, forming a structure resembling a hairpin (Fig. 1A). When a PCR primer forms 

a hairpin, it adversely affects the primer’s ability to bind and extend at the target site. 

In the worst case, the hairpin includes a base pair of the 3′-end and an overhang of the 

5′-end (Fig. 1B). Such a structure allows the extension by DNA polymerase along the 

primer and will result in the formation of a primer that will not be complementary to 

the template and will not be extended if hybridized (Fig. 1C). In addition to removing 

primers from the mixture, this also will prevent native primers from binding as target 

sites that are bound by the extended primers. To avoid this, primers should be selected 

that do not have any possible hairpin structures if possible. 

3.1.7. Primer-Dimer Formation 

The hybridization of two primers together is referred to as a primer-dimer (Fig. 2A). 

There are two possibilities for these, homodimers and heterodimers. Homodimers are 

formed from the hybridization of the same species of primer together. Heterodimers 

are the duplex of two different primer sequences hybridizing together. The result of 

either of these is that the primers will not be as efficient in hybridizing to the target.


Fig. 2. Dimer structures. 

As with hairpins, the worst case is that in which the 3′-end of one of the primers is 

base paired and there is a 5′ overhang (Fig. 2B). In this case, the primer will extend, 

using the other primer as a template, rendering the extended primer unable to prime 

the desired template (Fig. 2C). Even worse than with hairpins, this situation leads to 

amplification of the primer dimers and rapid depletion of useable primers. To prevent 

this, primer pairs should be chosen such that primer-dimer formation is minimal. 

3.1.8. 3′-Terminal Stability 

3′-terminal stability can loosely be defined as the relative hybridization strength 

of the 3′-end of the primer. If the 3′-end of the primer has a low stability, it may not 

efficiently prime because of the transient fraying of the end of the duplex. Therefore, a 

higher 3′-terminal stability will improve priming efficiency. As will be mentioned later, 

however, this high stability can have an undesirable affect on specificity. 

3.2. Specificity 

Specificity can generally be defined as the tendency for a primer to hybridize to its 

intended target and not to other, nonspecific, targets. There are a few ways in which 

poor specificity can impair PCR. First, if primers are hybridizing to many locations 

nonspecifically, they will not be available to prime the target sequence. Second, if such 

nonspecific hybridization were to occur, priming could also occur at those nonspecific 

locations, which would effectively remove the primers from the reaction permanently. 

Finally, by priming nonspecifically, it can be possible to generate aberrant amplicons. 

This will not only obfuscate an assay for successful PCR, but will very rapidly consume 

the primers to remove them from the reaction for amplifying the intended target. 

3.2.1. Specificity, T m , and PCR Conditions 

With respect to the annealing and extension temperatures chosen for the PCR 

reaction, there is a balance that must be reached between considerations of efficiency 

and specificity. As discussed previously, a more efficient PCR will result from having 

primer T m equal to or above the extension temperature of the reaction. However, 

having a primer with a high T m can often result in poor specificity. In such 

cases, partial hybridization of the primer may be likely and extension can occur from 

nonspecific sites. Such issues are less critical if highly specific primers can be selected 

as discussed here.


Fig. 3. Hybridization simulation data. 

3.2.2. Hybridization Simulation 

The most precise way to view the specificity of a PCR primer is by hybridization 

simulation (8). Hybridization simulation is the computer simulation of a hybridization 

of a primer with a specified database. This in silico analysis will identify all hybridization 

sites within the database for a candidate primer, allowing the user to select primers 

that will be the most specific. 

It is important to realize that hybridization simulation is qualitatively different 

from a homology or similarity analysis (9). Hybridization simulation uses a thermodynamic 

model with nearest neighbor values to calculate the mismatch Tm of hybridization 

for all hybridization sites. An example of hybridization simulation data is 

shown in Fig. 3. 

Currently, hybridization simulation is only available from a single commercially 

available program, the HYBsimulator . HYBsimulator allows for the screening of a large 

set of candidate primers and selection based on the hybridization simulation data. 

3.2.3. Statistical Determination of Specificity 

Various mathematical models exist in which the specificity of a given primer can 

be estimated based on the frequency of its constituent smaller sequences. One such 

method uses a table of frequencies of 6 mers found within a given genomic database


(10,11). The entire statistical frequency of the entire oligonucleotide is calculated 

based on the constituent 6-mers by starting with the 5′ terminal 6-mer frequency and 

multiplying the relative frequency of the 5-mer on the 3′-end of that 6 mer having the 

next nucleotide. This is repeated until the end of the oligonucleotide is reached. 

For example, to calculate the frequency (f) of the 8-mer: CATAGCCT 

f(CATAGCCT) = 

4 f(ATAGCC) 

f(CATAGC) × ——————————————————————— 

f(ATAGCT) + f(ATAGCG) + f(ATAGCC) + f(ATAGCT) 

f(CATAGC) 

4 f(TAGCCT) 

f(CATAGC) × ——————————————————————— 

f(TAGCCA) + f(TAGCCG) + f(TAGCCC) + f(TAGCCT) 

where f(CATAGC) denotes the frequency of the 6-mer, CATAGC. 

3.2.4. 3′-Terminal Effects 

Partial hybridization of the primer at the 3′-terminus can permit extension by DNA 

polymerase. This could result in depletion of primers as well as possible nonspecific 

amplification; therefore, this type of partial hybridization should be minimized as 

much as possible. 

There are two considerations for decreasing the chance of partial hybridization of 

the 3′-terminal: frequency and stability. 

3.2.5. 3′-Terminal Frequency 

If the 3′-terminal region has a sequence that has many occurrences in the DNA 

that will be in the reaction, then the likelihood of partial hybridization is greater. To 

minimize this, the primers can be selected such that the 3′-terminal region does not 

have a high frequency of occurrence within the genome of interest. 

3.2.6. 3′-Terminal Stability 

If the 3′-terminal region has a strong hybridization energy, then 3′-terminal partial 

hybridizations will be relatively more stable. More stable 3′-terminal hybridization will 

allow more false priming. Therefore if the primers are chosen such that the 3′-terminal 

has a low hybridization strength (also referred to as terminal stability), the primer is 

less likely to be priming as a result of such partial hybridization. 

Note that in the efficiency section above, a stronger 3′-terminal stability is said 

to improve efficiency. Whether one should select primers with high or low terminal 

stability would depend on factors, such as the nature of the experiment (i.e., whether 

there will be a large amount of other DNA) and the nature of the gene (whether highly 

specific primers can be found). 

3.2.7. Specificity Within the Target Sequence 

If the primer is able to partially hybridize to a nonspecific region of the template, 

particularly undesirable effects can occur. If the nonspecific hybridization allows 

extension along the template such that a PCR product can be formed in conjunction 

with one of the primers binding at one of the actual binding sites, nonspecific amplicons


can be generated. This problem is compounded if the nonspecific binding site is within 

the amplicon itself. For this reason, primers should be checked for nonspecific alternate 

hybridization sites within the target sequence. 

4. Selecting Primers for Multiplex PCR 

Multiplex PCR, in which several primer sets amplify several amplicons in the same 

reaction, add a degree of complexity to designing optimal primers. The additional 

issues to consider are those of possible heterodimer formation between all of the 

candidate primers and possible alternate hybridization sites within any of the target 

sequences. Some of the available primer design software provides functions for these 

types of designs. 

5. Primer Design Software 

Several programs are available for PCR primer design. As mentioned above, we 

think HYBsimulator is the most powerful such program and does provide PCR primer 

selection based on all criteria mentioned in this chapter. Other popular programs 

are Oligo and Primer Premier , which provide a subset of these functions but are 

slightly easier to use. 

References 

1. Breslauer, K. J., Frank, R., Blocker, H., and Marky, L. (1986) Predicting DNA duplex 

stability from the base sequence. Proc. Natl. Acad. Sci. USA 83, 3746–3750. 

2. Freir, S. M., Kierzed, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Neilson, T., and 

Turner, D. H. (1986) Improved free-energy parameters for predictions of RNA duplex. 

Biochemistry 83, 9373–9377. 

3. Wetmer, J. (1991) DNA probes: Applications of the principles of nucleic acid hybridization. 

Crit. Rev. Biochem. Mol. Biol. 26, 227–259. 

4. Sugimoto, N., Nakano, S., Katoh, M., Matsumura, A., Nakamuta, H., Ohmichi, T., et al. 

(1995) Thermodynamic parameters to predict stability of RNA/DNA hybrid duplexes. 

Biochemistry 34, 11,211–11,216. 

5. SantaLucia, J., Allawi, H. T., and Seneviratne, P. A. (1996) Improved nearest-neighbor 

parameters for predicting DNA duplex stability. Biochemistry 35, 3555–3562. 

6. SantaLucia, J., Kierzed, R., and Turner, D. H. (1990) Effects of GA mismatches on the 

structure and thermodynamics of RNA internal loops. Biochemistry 29, 8813–8819. 

7. Sugimoto, N., Kierzed, R., Freier, S. M., and Turner, D. H. (1986) Energetics of internal GC 

mismatches in ribooligonulceotide helix. Biochemistry 25, 5755–5759. 

8. Hyndman, D., Cooper, A., Pruzinsky, S., Coad, D., and Mitsuhashi, M. (1996) Software 

to determine optimal oligonucleotide sequences based on hybridization simulation data. 

BioTechniques 20, 1090–1096. 

9. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) Basic local 

alignment search tool. J. Mol. Biol. 215, 403– 410. 

10. Han, J., Hsu, C., Zhu, Z., Longshore, J., and Finley, H. (1994) Over-representation of 

the disease associated (CAG) and (CGG) repeats in the human genome. Nucleic Acids 

Res. 22, 1735–1740. 

11. Han, J., Zhu, Z., Hsu, C., and Finley, W. (1994) Selection of antisense oligonucleotides on 

the basis of genomic frequency of the target sequence. Antisense Res. Devel. 4, 53–65.

Optimization of PCRs 89 

20 

Optimization of Polymerase Chain Reactions 

Haiying Grunenwald 


The polymerase chain reaction (PCR) is a powerful method for fast in vitro enzymatic 

amplifications of specific DNA sequences. PCR amplifications can be grouped into 

three different categories: standard PCR, long PCR, and multiplex PCR. Standard PCR 

involves amplification of a single DNA sequence that is less than 5 kb in length and 

is useful for a variety of applications, such as cycle sequencing, cloning, mutation 

detection, etc. Long PCR is used for the amplification of a single sequence that is longer 

than 5 kb and up to 40 kb in length. Its applications include long-range sequencing; 

amplification of complete genes; PCR-based detection and diagnosis of medically 

important large-gene insertions or deletions; molecular cloning; and assembly and 

production of larger recombinant constructions for PCR-based mutagenesis (1,2). The 

third category, multiplex PCR, is used for the amplification of multiple sequences 

that are less than 5 kb in length. Its applications include forensic studies; pathogen 

identification; linkage analysis; template quantitation; genetic disease diagnosis; and 

population genetics (3–5). Unfortunately, there is no single set of conditions that is 

optimal for all PCR. Therefore, each PCR is likely to require specific optimization for 

the template/primer pairs chosen. Lack of optimization often results in problems, 

such as no detectable PCR product or low efficiency amplification of the chosen 

template; the presence of nonspecific bands or smeary background; the formation of 

“primer-dimers” that compete with the chosen template/primer set for amplification; 

or mutations caused by errors in nucleotide incorporation. It is particularly important 

to optimize PCR that will be used for repetitive diagnostic or analytical procedures 

where optimal amplification is required. The objective of this chapter is to discuss the 

parameters that may affect the specificity, fidelity, and efficiency of PCR, as well as 

approaches that can be taken to achieve optimal PCR amplifications. 

Optimization of a particular PCR can be time consuming and complicated because 

of the various parameters that are involved. These parameters include the following: (1) 

quality and concentration of DNA template; (2) design and concentration of primers; 

(3) concentration of magnesium ions; (4) concentration of the four deoxynucleotides 

(dNTPs); (5) PCR buffer systems; (6) selection and concentration of DNA polymerase; 

(7) PCR thermal cycling conditions; (8) addition and concentrations of PCR 

additives/cosolvents; and (9) use of the “hot start” technique. Optimization of PCR 



89

90 Grunenwald 

may be affected by each of these parameters individually, as well as the combined 

interdependent effects of any of these parameters. 

2. Materials 

1. Template DNA (e.g., plasmid DNA, genomic DNA). 

2. Forward and reverse PCR primers. 

3. MgCl 2 (25 mM). 

4. dNTPs (a mixture of 2.5 mM dATP, dCTP, dGTP, and dTTP). 

5. 10× PCR buffer: 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 25°C. 

6. Thermal stable DNA polymerase (e.g., Taq DNA polymerase). 

7. PCR additives/cosolvents (optional; e.g., betaine, glycerol, DMSO, formamide, bovine 

serum albumin, ammonium sulfate, polyethylene glycol, gelatin, Tween-20, Triton X-100, 

β-mercaptoethanol, or tetramethylammonium chloride). 

3. Methods 

3.1. Setting Up PCR 

The common volume of a PCR is 10, 25, 50, or 100 µL. Although larger volumes are 

easier to pipet, they also use up a larger amount of reagents, which is less economical. 

All of the reaction components can be mixed in together in a 0.5-mL PCR tube in 

any sequence except for the DNA polymerase, which should be added last. It is 

recommended to mix all the components right before PCR cycling. Although it is not 

necessary to set up the PCR on ice, some published protocols recommend it. 

For each PCR, the following components are mixed together: 

1. Template DNA (1–500 ng). 

2. Primers (0.05–1.0 µM). 

3. Mg 2+ (0.5–5 mM). 

4. dNTP (20–200 µM each). 

5. 1× PCR buffer: 1 mM Tris-HCl and 5 mM KCl. 

6. DNA polymerase (0.5–2.5 U for each 50 µL of PCR). 

As a real-life example, the following PCR was set up to amplify the cII gene from 

bacteriophage lambda DNA (total volume = 50 µL): 

1. 1 µL of 1 ng/µL lambda DNA (final amount = 1 ng). 

2. 1 µL of 50 µM forward PCR primer (final concentration = 1 µM). 

3. 1 µL of 50 µM reverse PCR primer (final concentration = 1 µM). 

4. 5 µL of 25 mM MgCl 2 (final concentration = 2.5 mM). 

5. 4 µL of 2.5 mM dNTPs (final concentration = 200 µM). 

6. 5 µL of 10× PCR buffer (final concentration = 1×). 

7. 0.25 µL of 5 U/µL Taq DNA polymerase (final amount = 1.25 U). 

3.2. PCR Cycling 

A common PCR cycling program usually starts with an initial dissociation step at 

92 to 95°C for 2 to 5 min to ensure the complete separation of the DNA strands. Most 

PCR will reach sufficient amplification after 20 to 40 cycles of strand denaturation 

at 90 to 98°C for 10 s to 1 min, primer annealing at 55 to 70°C for 30 s to 1 min, 

and primer extension at 72 to 74°C for 1 min per kilobase of expected PCR product. 

It is suggested that a final extension step of 5 to 10 min at 72°C will ensure that


all amplicons are fully extended, although no solid evidence proves that this step is 

necessary. For example, the cycling program used to amplify the previously described 

lambda cII gene is as follows: initial denaturation for 4 min at 94°C, followed by 30 

cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C, then held at 4°C. 

3.3. Verifying PCR Amplification 

To measure the success of a PCR amplification, 5 to 10 µL of the final PCR product 

is run on a 1 or 2% agarose gel and visualized by staining with ethidium bromide. The 

critical questions are as follows: (1) Is there a band on the gel? (2) Is the band at the 

expected size? (3) Are there any nonspecific bands beside the expected PCR band on 

the gel? (4) Is there smear on the gel? A successful PCR amplification should display a 

single band with the expected size without nonspecific bands and smear. 

4. Notes 

1. The quality and concentration of DNA templates can directly affect the outcome of PCR 

amplifications. To achieve satisfactory amplification, certain baseline conditions may be 

used as a starting point for optimizing a PCR amplification. For a typical PCR, 10 4 to 10 7 

molecules of template DNA is recommended. For long PCR (>5 kb), 10 7 to 10 8 molecules 

of a high copy number template DNA (e.g., 1–10 ng of lambda DNA) is recommended. 

For amplification from genomic DNA, use 100 to 500 ng of template DNA. In multiplex 

PCR, two- to fivefold more DNA template than what is needed for a typical PCR should 

be used. 

There are several methods for purifying DNA for PCR amplification, including commercially 

available kits, as well as standard methods (6). Long PCR amplification has 

the most stringent requirement for the quality of template DNA. Care should be taken to 

prevent template DNA damages from nicking, shearing, and depurination (7). Analysis by 

pulsed-field agarose gel electrophoresis is typically recommended for template DNA used 

in long PCR to assure its purity and integrity. 

2. Appropriate primer design, as well as use of the proper primer concentration, is critical 

for successful PCR amplification. There are a variety of computer programs available for 

designing primers and they vary significantly in selection criteria, comprehensiveness, and 

user-friendliness (8–11). The purpose of primer design is to achieve a balance between 

the specificity and efficiency of an amplification. Specificity defines how frequently 

mispriming occurs, whereas efficiency represents the increase of the amount of PCR 

product over a given number of cycles. The following guidelines should be considered 

when designing primers. The optimal primer size is usually between 18 and 28 bases. 

Shorter primers are generally less specific but may result in more efficient PCR, whereas 

longer primers improve specificity yet can be less efficient. Primers from both directions 

should have melting temperatures (T m , defined as the dissociation temperature of the 

primer/template duplex) that are within 2 to 5°C of each other. This will assure that the 

proper annealing temperature for both primers is achieved. For primers shorter than 20 

bases, an estimate of T m can be calculated as T m = 4 (G + C) + 2 (A + T) (12). However, 

for longer primers, correct estimation of T m requires a “nearest-neighbor” calculation, 

which takes into account thermodynamic parameters of a chosen primer and is used by 

most of the available computer programs for primer design (13,14). Avoid complementary 

sequences within a primer or between the two primers. This will reduce formation of 

primer-dimers that can compete with the amplification of the desired PCR product, as well 

as the formation of secondary structures within a primer. Primers with T m higher than

92 Grunenwald 

50°C will generally provide specific and efficient amplifications. For long PCR, a T m of 62 

to 70°C is recommended. In addition, a GC content of 40 to 60% is desirable for primers 

because this assures a higher T m and therefore increases specificity. If AT content is high, 

use primers of 28 to 35 bases in length for long PCR. Also, avoid continuous stretches 

of purines or pyrimidine, as well as multiple repeats of thymidine residues at the 3′ end 

of the primer. It is extremely critical when designing primers for multiplex PCR to make 

sure that all primers have similar melting temperatures and do not contain sequences 

complementary to each other. Concentrations of primers used in PCR will also influence 

amplification specificity and efficiency. In general, primer concentrations between 

0.05 to 1.0 µM (or 0.5–100 pmol) are routinely used in 100 µL of PCR depending on the 

specific application. Higher primer concentrations can result in nonspecific priming and 

formation of primer-dimers, whereas lower primer concentrations may adversely affect 

PCR efficiency. Use the primers at a 11 concentration ratio to assure specificity and 

efficiency of amplifications. Lower concentrations of primers are more desirable for 

multiplex PCR because of the number of primer sets present in the reaction. 

3. Magnesium concentration is critical to the success of PCR amplification because it may 

affect DNA polymerase activity and fidelity, DNA strand denaturation temperatures of both 

template and PCR product, primer annealing, PCR specificity, and primer-dimer formation. 

Excess magnesium results in accumulation of nonspecific amplification products seen 

as multiple bands on an agarose gel, whereas insufficient magnesium results in reduced 

yield of the desired PCR product. Common magnesium concentrations used in PCR are 

between 0.5 to 5 mM. It is important to optimize the magnesium concentration used for 

each individual PCR because DNA polymerases require free magnesium for their activity 

in addition to that bound by template DNA, primers, and dNTPs. Also, trace amounts 

of EDTA or other chelators may be present in primer stock solutions or template DNA. 

Therefore, each PCR should contain 0.5 to 2.5 mM magnesium over the total dNTP 

concentrations (15). A simple way to optimize magnesium concentration is to first perform 

a series of reactions in which the magnesium concentration is varied between 0.5 and 5 mM 

in 0.5-mM increments. After the concentration range is narrowed, perform a second round 

of reactions and vary the magnesium concentration in 0.2- to 0.3-mM increments. 

4. Concentration of dNTPs can affect the yield, specificity, and fidelity of a PCR amplification. 

Concentrations of 20 to 200 µM of each dNTP has been used to obtain successful 

PCR amplifications. Stock solutions of each dNTP are adjusted to pH 7.0 and diluted 

to a 10 mM final concentration. Commercially available premixed dNTP solutions with 

concentrations of 2.5 mM or individual dNTP stock solutions of 10 mM may be used. 

Lower concentrations of dNTPs minimize mispriming and reduce the likelihood of 

extending misincorporated nucleotides, which in turn increase specificity and fidelity 

of PCR amplifications (16). Because dNTPs are typically added in excess to a PCR, 

one should determine the lowest dNTPs concentration appropriate for the length and 

composition of the target sequence. Although 250 µM of each of the dNTPs appears to be 

sufficient for long PCR (17), amplifications of sequences longer than 20 kb may require 

dNTP concentrations as high as 400 to 500 µM each in a given 50-µL reaction. It is critical 

not to use a large excess of dNTP because higher dNTP concentrations increase the error 

rate of DNA polymerases. In fact, millimolar concentrations of dNTPs actually inhibit 

Taq DNA polymerase (18). 

5. Standard PCR amplifications using Taq DNA polymerase are performed in 10 mM Tris- 

HCl (pH 8.3–8.4 at 20–25°C) and 50 mM KCl. For Tth and Tfl DNA polymerases, and 

DNA polymerases with proofreading activity (for example, Pwo, Pfu, Tli, and Vent DNA 

polymerases (New England Biolabs), a buffer system of 50 mM Tris-HCl (pH 9.0 at 25°C) 

and 20 mM (NH 4 ) 2 SO 4 is normally used. These standard buffer systems are available


commercially and have been shown to produce satisfactory PCR amplifications in most 

cases. However, long PCR requires a different buffer system. For example, 20 to 25 mM 

Tricine (pH 8.7 at 25°C) and 80 to 85 mM potassium acetate (pH 8.3–8.7 at 25°C) 

(19), as well as 25 mM Tris-HCl (pH 8.9 at 25°C) and 100 mM KCl (2), have been 

used successfully in long PCR amplifications when used in conjunction with rTth DNA 

polymerase (Perkin–Elmer). The use of less temperature-sensitive buffers, such as Tricine, 

may enhance the ability to obtain long PCR amplifications. 

6. The most common enzyme used for PCR amplification is Taq DNA polymerase because 

of its thermostability and processivity (i.e., the number of nucleotides replicated before 

the enzyme dissociates from the DNA template). It was originally purified from the 

gram-negative thermophilic bacterium Thermus aquaticus (20). Highly purified Taq DNA 

polymerase exhibits a temperature optimum of 75 to 80°C (21). The half-life of Taq 

DNA polymerase is 40 min at 95°C, which is sufficient to remain active over 30 or more 

cycles, during which the enzyme is transiently exposed to extremely high denaturation 

temperatures. Taq DNA polymerase has an extension rate of 35 to 100 nucleotides per 

second at 72°C (16), which is the most common extension temperature for PCR amplifications. 

A recommended concentration range for Taq DNA polymerase is between 1 and 

2.5 units per 100 µL of PCR. However, different concentrations of Taq DNA polymerase 

may be required with respect to individual target template sequences or primers. Increasing 

the amount of Taq DNA polymerase beyond the 2.5 units/reaction can in some cases 

increase PCR efficiency. However, adding more Taq DNA polymerase can sometimes 

increase the yield of nonspecific PCR products at the expense of the desired product. When 

optimizing the Taq DNA polymerase concentration for a particular PCR, testing a range 

of 0.5 to 5 units per 100 µL of reaction in 0.5-unit increments is recommended, followed 

by analysis of the PCR products by gel electrophoresis to determine the amplification 

specificity and efficiency. 

The other important property of Taq DNA polymerase is its fidelity, which is measured 

as error rate. The error rate for Taq DNA polymerase, which lacks proofreading 3′ → 5′ 

exonuclease activity, is estimated at approx 1 to 2 × 10 –5 errors (or mutation frequency) 

per nucleotide per duplication (22–24). For many applications, this does not present 

any problems. However, for some sequencing, cloning, and long PCR applications, it is 

essential to have few, or no incorporation errors. In situations where “high fidelity” is 

required, DNA polymerases with 3′ → 5′ proofreading activity (for example, Pfu or Pwo 

DNA polymerases) are recommended. The estimated error rates for these proofreading 

enzymes is approx 1 to 2 × 10 –6 errors per nucleotide per duplication (23,24), representing a 

10-fold improvement over standard Taq DNA polymerase. It is important to note that these 

proofreading enzymes with lower error rates also have lower extension rates, resulting 

in lower PCR efficiency. Therefore, more amplification cycles are required to achieve 

adequate amount of amplified DNA. 

DNA polymerase characteristics, such as extension rate, processivity, fidelity, thermostability, 

and thermal activity profile, are important in long PCR. PerkinElmer ’s 

rTth DNA polymerase (the recombinant form of the DNA polymerase from T. thermophilus) 

has been shown to perform consistent long PCR at 0.5 to 2.5 units per 50 µL 

of reaction (17). Use of a mixture of Taq DNA polymerase with a proofreading enzyme, 

such as Pfu DNA polymerase, at a 201 ratio (2.5 units per 50 µL of reaction) will also 

enhance the reliability of long PCR amplifications. 

7. Optimization of PCR thermal cycling conditions includes determination of cycle number, 

the temperature and incubation time period for template denaturation, primer annealing, 

and primer extension. The optimum number of cycles depends mainly on the starting 

concentration of template DNA. Because many PCRs start with very limiting amount

94 Grunenwald 

of template DNA, a sufficient number of cycles are required to achieve satisfactory 

amplifications. However, PCR amplification is not an unlimited process. A common 

mistake is to execute too many cycles. The exponential amplification of PCR will continue 

up until the point when the product reaches about 10 –8 M (about 10 12 molecule in a 100-µL 

reaction). The reaction enters a linear phase where exponential accumulation of the product 

is attenuated. This is termed the plateau effect (25). In most PCRs, amplifications plateau 

after about 20 to 40 cycles. The other major limitation of standard PCR is the amount of 

DNA polymerase included in the reaction. The combination of thermal inactivation of the 

DNA polymerase after each denaturation step, reduction in denaturation efficiency, and 

the reduced efficiency of primer annealing (caused by increasing competition from the 

template), will cause the reaction to terminate. Although too few cycles of PCR result 

in low product yield, most PCR amplifications are performed for no more than 20 to 

40 cycles. 

It is often helpful to precede the first cycling denaturation step with an initial dissociation 

step at 92 to 95°C for 2 to 5 min to ensure the complete separation of the DNA strands. 

Template denaturation temperatures range 90 to 98°C. The duration of denaturation ranges 

from 10 s to 1 min. Although it only takes a few seconds to denature DNA at its strandseparation 

temperature, it is appropriate to use a higher denaturation temperature and a 

longer incubation time for some templates, such as those templates with high GC content, 

to achieve complete denaturation. Although a higher temperature and a longer incubation 

period result in a more complete denaturation of the DNA template, it can also cause 

depurination of the DNA template, which in turn reduces amplification efficiency. It is 

also important to note that higher denaturation temperatures will reduce the amount of 

active DNA polymerase available for amplification. The half-life of Taq DNA polymerase 

activity is more than 2 h at 92.5°C, 40 min at 95°C, and 5 min at 97.5°C. 

The optimal primer annealing temperature for a particular PCR amplification depends 

on the base composition, nucleotide sequence, length, and concentration of the primers 

(26). A typical primer annealing temperature is 5°C below the calculated Tm of the primers. 

Annealing temperatures from 55 to 70°C generally yield the best results. Increasing the 

annealing temperature enhances discrimination against incorrectly annealed primers and 

reduces mis-extension of incorrect nucleotides at the 3′ end of primers. Therefore, a 

higher annealing temperature increases amplification specificity. For these reasons, when 

using primers with higher T m s such as for long PCR, a higher annealing temperature (i.e., 

60–70°C) should be used. It is also important to note that at typical primer concentrations 

of 200 µM each, annealing requires only a few seconds. However, incubation times from 

30 s to 1 min are generally recommended to assure successful primer annealing. 

Primer extension time depends on the length and concentration of the target sequence, 

as well as the extension temperature. Taq DNA polymerase extends at a rate of 0.25 nucleotides 

per second at 22°C, 1.5 nucleotides per second at 37°C, 24 nucleotides per second 

at 55°C, greater than 60 nucleotides per second at 70°C, and 150 nucleotides per second 

at 75 to 80°C (18). Therefore, at the commonly chosen extension temperature of 72°C, 

Taq DNA polymerase is expected to extend at the rate of greater than 3500 nucleotides 

per minute. Thus, as a general rule, an extension time of 1 min per kilobase is more 

than sufficient to generate the expected PCR product. For PCR products up to 2 kb in 

length, an extension time of 1 min at 72°C is sufficient. A final extension step of 5 to 

10 min at 72°C may be added in order to ensure that all amplicons are fully extended. 

In addition to the conventional three-step cycling programs, two-step cycling programs 

that combine primer annealing and extension in one step are also widely used. Annealing 

and extension can be combined because most thermostable DNA polymerases can actively 

extend off the primers over the entire range of commonly chosen annealing and extension


temperatures. Two-step cycling programs are generally applied when a high annealing 

temperature is used, such as 65 to 70°C. Because a higher annealing temperature improves 

amplification specificity, it is argued by some investigators that better PCR results may be 

obtained using a two-step cycling program (27). Here is an example of a typical two-step 

cycling program: initial denaturation at 94°C for 2 min, followed by 30 cycles of 1 min at 

94°C and 1 min at 68°C, then held at 4°C. 

It is reasonable to follow the above rationale in defining optimal cycling conditions 

for long PCR. However, there are a few rules that must be considered when performing 

long PCR. Use moderate denaturation temperatures and short incubation time periods 

to maintain the integrity of the long DNA templates. Choose primers with a high Tm 

so that a higher annealing temperature can be used to increase specificity. Two-step 

cycling programs are more frequently used than three-step cycling programs. For example, 

denaturation at 92 to 95°C for 10 to 30 s, followed by annealing and extension at 65 to 

68°C for 1 min per kilobase will increase the probability of obtaining the desired product. 

Programming an increase in extension time automatically in later cycles may also improve 

the yields of the amplification. Because DNA polymerases extend primers discontinuously 

through a succession of reactions, increasing the extension time in each of the later PCR 

cycles could increase the likelihood of synthesizing long PCR products. For example, 

perform the extension at 1 min per kilobase for the first 10 cycles, then lengthen the 

extension time 10 to 20 s for each of the next 20 cycles. Here is an example of a typical 

cycling program used to amplify a 10-kb PCR product: initial denaturation at 94°C for 

2 min, followed by 16 cycles of 30 s at 94°C and 10 min at 68°C, then 12 cycles of 30 s at 

94°C and 10 mins at 68°C with a 15-s extension per cycle, then held at 4°C. 

8. The majority of PCR amplifications can be successfully performed after optimizing the 

above parameters. However, there are some PCR amplifications, for example, those using 

templates with high guanine/cytosine content or stable secondary structures, that may still 

amplify inefficiently, resulting in little or no desired product and/or nonspecific products. 

Incorporation of the nucleotide analog 7-deaza-2′-deoxyguanosine triphosphate (c7dGTP) 

in addition to deoxyguanosine triphosphate (dGTP) helps destabilize secondary structures 

of DNA and reduces the formation of nonspecific products (28). However, the most 

effective and frequently used strategy is addition of various organic additives or cosolvents. 

The most commonly used cosolvents and their concentration ranges are: dimethyl 

sulfoxide (DMSO; 1–10%), glycerol (5–20%), formamide (1.25–10%), bovine serum 

albumin (10–100 µg/mL), ammonium sulfate (NH 4 ) 2 SO 4 ; 15–30 mM), polyethylene 

glycol (5–15%), gelatin (0.01%), non-ionic detergents (such as Tween 20 and Triton 

X-100; 0.05–0.1%), β-mercaptoethanol, tetramethylammonium chloride(TMAC), and 

N,N,N-trimethyglycine (betaine) (1–3 M) (15,17,29–34). 

The mechanisms underlying enhancement of PCR by many of these cosolvents are not 

well defined. It is suggested that some cosolvents, such as DMSO, formamide, glycerol, 

and polyethylene glycol, may affect the Tm of the primers, the thermal activity profile of 

Taq DNA polymerase, as well as the degree of product strand separation (18). Gelatin, 

bovine serum albumin, and nonionic detergents, such as Tween-20 and Triton X-100, 

are thought to stabilize DNA polymerases (18). TMAC is used to eliminate nonspecific 

priming (34). (NH 4 ) 2 SO 4 may increase the ionic strength of the reaction mixture, altering 

the denaturation and annealing temperatures of DNA, and may affect polymerase activity. 

Betaine has been shown to increase the thermostability of DNA polymerases, as well 

as to alter DNA stability such that GC-rich regions melt at temperatures more similar 

to AT-rich regions (29). 

It is important to carefully choose the appropriate cosolvents and correct concentrations 

to effectively improve PCR amplifications. Cosolvent concentrations should be no greater

96 Grunenwald 

than absolutely necessary for optimal amplification, as they may reduce DNA polymerase 

activity. For example, DMSO at a final concentration of 10% can reduce Taq DNA 

polymerase activity by up to 50% (15). In addition to improving standard PCR, multiplex 

PCR performance has also been shown to improve when using DMSO (34), Tween-20 and 

Triton X-100 (32), β-mercaptoethanol (33), TMAC (34), and betaine (35). Long PCR has 

been enhanced using glycerol, gelatin (17), DMSO (19), and betaine (36). 

9. The “hot start” technique enhances PCR specificity by eliminating the production of 

nonspecific products and primer-dimers during the initial steps of PCR (36). This is 

because even a brief incubation of a PCR mix at temperatures significantly below the Tm 

can result in primer-dimer formation and nonspecific priming. The purpose of a hot start 

is to withhold one of the critical components from the reaction until the temperature 

in the first cycle rises above the annealing temperature. There are various methods of 

performing a hot start. Manual hot start is performed by withholding one of the reaction 

components, such as the DNA polymerase or magnesium, and adding it only after the 

reaction temperature rises above 80°C during the first denaturation step. Wax-mediated 

hot start involves addition of a wax layer separating the component being withheld from 

the remainder of the reaction mix. During the temperature increase in the first denaturation 

step, the wax melts and the withheld component is mixed with the rest of the reaction 

components, starting the amplification reaction. The beads for wax layer can be made in 

the laboratory (37,38) or purchased commercially (Ampliwax PCR Gems, PerkinElmer). 

Hot start Taq DNA polymerase is constructed through the addition of an anti-Taq DNA 

polymerase antibody (TaqStart Antibody, Clontech). The antibody will prevent the 

DNA polymerase activity until the temperature rises during the initial denaturation step. 

The increased temperature dissociates and degrades the bound antibody, initiating PCR 

amplification. Hot start is commonly used for multiplex and long PCR amplifications. 

10. In addition to all of the PCR optimization strategies discussed above, there are also 

commercially available buffer systems for fast and easy PCR optimization. Companies, 

such as Boehringer Mannheim, Stratagene, Invitrogen, and Epicentre Technologies, offer 

various buffer systems for PCR optimization. These buffer systems can be divided into 

two categories. One category (e.g., PCR optimization kit from Boehringer Mannheim) 

contains a set of 16 buffers that combine different pH (8.3, 8.6, 8.9, and 9.2) and various 

concentrations of magnesium (1.0, 1.5, 2.0, and 3.5 mM). There are also four different 

cosolvents, DMSO, glycerol, gelatin, and (NH 4 ) 2 SO 4 , provided separately for additional 

optimization. Because the cosolvents are not premixed in the buffers, inclusion of these 

cosolvents will require a second set of optimization reactions. The other category of 

buffer system (e.g., PCR optimization kits from Epicentre Technologies) contains variable 

concentrations of magnesium (1.5, 2.5, and 3.5 mM) and a betaine-containing enhancer. 

Because all necessary reaction components, including the cosolvent (betaine), are premixed 

in this buffer system, only one set of optimization reactions are performed. 

11. The following conditions may lead to less than optimal PCR amplifications. The possible 

solutions for each condition are discussed. 

If little or not desired PCR product is detected: 

a. Too little DNA template is present in the reaction. Increase the amount of template 

DNA. 

b. The template DNA is damaged or degraded. Assure the purity and integrity of the DNA 

template by minimizing damage from nicking and shearing. 

c. Insufficient DNA polymerase is present in the reaction. Increase the DNA polymerase 

concentration in increments of 0.5 units per 100 µL of reaction. 

d. Insufficient number of cycles was performed. Increase cycle number by 5 to 10 cycles. 

e. Check for inhibitor(s) during template DNA preparation. Repurification of the DNA 

template may remove some inhibitors of PCR.


f. Magnesium concentration is too low. Increase magnesium concentration in increments 

of 0.1 mM. 

g. The denaturation time is too long or too short. Adjust denaturation time in increments 

of 5 s. 

h. Add cosolvents that enhance PCR amplification. 

i. The denaturation temperature is too high or too low. Change denaturation temperature 

in increments of 1°C. 

j. The primer annealing temperature is too high. Lower annealing temperature in increments 

of 2°C. 

k. The primer extension period is too short. Increase extension time in increments of 

1 minute. 

l. Re-amplify dilutions (110 to 11000) of the first round of PCR amplification using 

nested primers. 

m. Perform hot start. 

n. Perform Touchdown (TD)/Stepdown (SD) PCR cycling program. TD or SD PCR uses 

a temperature cycling protocol that is performed at decreasing annealing temperatures. 

The cycling program begins at an annealing temperature a few degrees above the 

calculated Tm of the primers. This ensures that the first primer-template hybridization 

events involve only those sequences with the greatest specificity. The annealing 

temperature is decreased 1 to 4°C every other cycle to approx 10°C below the calculated 

Tm to permit exponential amplification (39). Here is an example of a typical TD/SD 

cycling program: initial denaturation at 94°C for 1 mi followed by 20 cycles of 10 s at 

92°C and 20 s at 70°C with an 0.5°C decrease of temperature per cycle, then another 

20 cycles of 10 s at 92°C and 30 s at 60°C with a 1-s extension per cycle and hold at 

4°C. Hot start must be used with these cycling programs. 

o. Review primer design and composition. Design new primers and try PCR again. 

If multiple product bands or smear is detected: 

a. Too much DNA template is present in the reactions. Decrease the amount of DNA 

template in the reaction mix. 

b. Annealing temperature is too low. Increase annealing temperature in increments of 

2°C. 

c. DNA polymerase concentration is too high. Decrease enzyme concentration in increments 

of 0.5 units per 100-µL reaction. 

d. Magnesium concentration is too high. Decrease the magnesium concentration in 

increments of 0.1 mM. 

e. Denaturation time is too short. Increase the denaturation time in increments of 5 s. 

f. Denaturation temperature is too low. Increase the denaturation time in increments 

of 1°C. 

g. Cycle number is too high. Reduce the cycle number by 5 to 10 cycle. 

h. Perform hot start. 

i. Alter concentrations of cosolvents. 

j. Perform TD/SD PCR. 

k. Extension time is too long. Reduce the extension time in increments of 1 min. 

l. Check for carry-over contamination. Set up PCR in a different area. 

m. Review primer design and composition. Design new primers and try PCR again. 

References 

1. Higuchi, R. (1989) Using PCR to engineer DNA, in PCR Technology: Principles and 

Applications for DNA Amplifications (Erlich, H. A., ed.), Stockton Press, Inc., New York, 

pp. 61–70.

98 Grunenwald 

2. Foord, O. S. and Rose, E. A. (1995) Long-distance PCR, in PCR Primer (Dieffenback, 

C. W. and Dveksler, G. S., ed.), Cold Spring Harbor Laboratory Press, Cold Spring, NY, 

pp. 63–77. 

3. Edwards, A., Civitello, A., Hammond, H. A., and Caskey, C. T. (1991) DNA typing and 

genetic mapping with trimeric and tetrameric tandem repeats. Am. J. Hum. Genet. 49, 

746–756. 

4. Edwards, A., Hammond, H. A., Jin, L., Caskey, C. T., and Chakroborty, R. (1992) Geneticvariation 

at five trimeric and tetrameric tandem repeat loci in four human population 

groups. Genomics 12, 241–253. 

5. Klimpton, C. P., Gill, P., Walton, A., Urquhart, A., Millican, E. S., and Adams, M. (1993) 

Automated DNA profiling employing multiplex amplification of short tandem repeat loci. 


6. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A laboratory 

Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 

7. Lindahl, T. and Nyberg, B. (1972) Rate of depurination of native deoxyribonucleic acid. 

Biochemistry 11, 3610–3618. 

8. Rychlik, W. and Rhoads, R. E. (1989) A computer program for choosing optimal oligonucleotides 

for filter hybridization, sequencing and in vitro amplification of DNA. Nucleic 

Acids Res. 17, 8543–8551. 

9. Lowe, T. M. J., Sharefkin, J., Yang, S. Q., and Dieffenback, C. W. (1990) A computer 

program for selection of oligonucleotide primers for polymerase chain reaction. Nucleic 

Acids Res. 18, 1757–1761. 

10. O’Hara, P. J. and Venezia, D. (1991) PRIMGEN, a tool for designing primers from multiple 

alignments. CABIOS 7, 533–534. 

11. Montpetit, M. L., Cassol, S., Salas, T., and O’Shaughnessy, M. V. (1992) OLIGOSCAN: 

A computer program to assist in the design of PCR primers homologous to multiple DNA 

sequences. J. Virol. Methods 36, 119–128. 

12. Suggs, S. V., Hirose, T., Myake, D. H., Kawashima, M. J., Johnson, K. I., and Wallace, R. B. 

(1981) Using purified genes, ICN-UCLA Symp. Mol. Cell. Biol. 23, 683–693. 

13. Breslauer, K. J., Ronald, F., Blocker, H., and Marky, L. A. (1986) Predicting DNA duplex 

stability from the base sequence. Proc. Natl. Acad. Sci. USA 83, 3746–3750. 

14. Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Neilson, T., 

et al. (1986) Improved free-energy parameters for predictions of RNA duplex stability. 

Proc. Natl. Acad. Sci. USA 83, 9373–9377. 

15. Innis, M. A. and Gelfand, D. H. (1990) Optimization of PCRs, in PCR Protocols: A Guide 

to Methods and Applications (Gelfand, D. H., Sninsky, J. J., Innis, M. A., and White, H., 

eds.), Academic Press, San Diego, CA, pp. 3–12. 

16. Innis, M. A., Myambo, K. B., Gelfand, D. H., and Brow, M. A. D. (1988) DNA sequencing 

with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain 

reaction-amplified DNA. Proc. Natl. Acad. Sci. USA 85, 9436–9440. 

17. Ohler, L. and Rose, E. A. (1992) Optimization of long distance PCR using a transposonbased 

model system. PCR Methods Appl. 2, 51–59. 

18. Gelfand, D. H. (1989) Taq DNA polymerase, in PCR Technology: Principles and Applications 

for DNA Amplification (Erlich, H. A., ed.), Stockton Press, New York, pp. 17–22. 

19. Cheng, S. (1995) Longer PCR amplifications, in PCR Strategies (Innis, M. A., Gelfand, D. 

H., and Sninsky, J. J., eds.) Academic Press, San Diego, CA, pp. 313–324. 

20. Brock, T. D. and Freeze, H. (1969) Thermus aquaticus gene, a non-sporulating extreme 

thermophile. J. Bacteriol. 98, 289–297. 

21. Giebel, L. B. and Spritz, R. A. (1990) Site-directed mutagenesis using the double-stranded 

DNA fragment as a PCR primer. Nucleic Acids Res. 18, 4947.


22. Saike, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R. Horu, G. T., Mullis, 

K. B., and Erlich, H. A. (1988) Primer-directed enzymatic amplification of DNA with a 

thermostable DNA polymerase. Science 239, 487– 491. 

23. Flaman, J.-M., Frebourg, T., Moreau, V., Charbonnier, R., Martin, C., Ishioka, C., et al. 

(1994). A rapid PCR fidelity assay. Nucleic Acids Res. 22, 3259–3260. 

24. Cline, J., Braman, J. C., and Hogrefe, H. H. (1996) PCR fidelity of Pfu DNA polymerase 

and other thermostable DNA polymerases. Nucleic Acids Res. 24, 3546–3551. 

25. Sardelli, A. D. (1993) Plateau effect-understanding PCR limitations, in Amplifications: A 

Forum for PCR Users. Perkin–Elmer Corp., Norwald, CT, pp. 1. 

26. Saiki, R. K. (1989) The design and optimization of the PCR, in PCR Technology (Erlich, 

H. A., ed.), Stockton Press, New York, pp. 7–16. 

27. Kim, H. S. and Smithies, O. (1988) Recombinant fragment assay for gene targeting based 

on the polymerase chain reaction. Nucleic Acids Res. 16, 8887–8903. 

28. McConlogue, L., Brow, M. D., and Innis, M. A. (1988) Structure-independent DNA 

amplification by PCR using 7-deaza-2′-deoxyguanosine. Nucleic Acids Res. 16, 9869. 

29. Mytelka, D. S. and Chamberlin, M. J. (1996) Analysis and suppression of DNA polymerase 

pauses associated with a trinucleotide consensus. Nucleic Acids Res. 24, 2774–2781. 

30. Pomp, D. and Medrano, J. F. (1991) Organic solvents as facilitators of polymerase chain 

reaction. BioTechniques 10, 58–59. 

31. Newton, C. R. and Graham, A. (1994) PCR, Bios Scientific, Publishers Ltd., Oxford. 

32. Levinson, G., Fields, R. A., Harton, G. L., Palmer, F. T., Maddleena, A., Fugger, E. F., 

et al. (1992) Reliable gender screening for human preimplantation embryos, using multiple 

DNA target-sequences. Hum. Reprod. 7, 1304–1313. 

33. Chamberlain, J. S., Gibbs, R. A., Ranier, J. E., Nguyen, P. N., and Caskey, C. T. (1988) 

Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA 

amplification. Nucleic Acids Res. 16, 11,141–11,156. 

34. Uggozoli, L. and Wallace, B. (1992) Application of an allele-specific polymerase chain 

reaction to the direct determination of ABO blood group genotypes. Genomics 12, 

670–674. 

35. Henke, W., Herdel, K., Jung, K., Schnorr, D., and Loening, S. A. (1997) Betaine improves 

the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957–3958. 

36. Hengen, P. N. (1997) Optimizing multiplex and LA-PCR with betaine. Trends Biochem. 

Sci. 22, 225–226. 

37. Bassam, B. J. and Caetano-Anolles, G. (1993) Automated “hot start” PCR using mineral 

oil and paraffin wax. BioTechniques 14, 30–34. 

38. Wainwright, L. A. and Seifert, H. S. (1993) Paraffin beads can replace mineral oil as an 

evaporation barrier in PCR. BioTechniques 14, 34–36. 

39. Rous, K. H. (1995) Optimization and troubleshooting in PCR, in PCR Primer (Diefferbach, 

C. W. and Dveksler, G. S. eds.), CSH Press, New York, pp. 53–62.

100 Grunenwald

Subcycling PCR 101 

21 

Subcycling PCR for Long-Distance Amplifications 

of Regions with High and Low Guanine–Cystine Content 

Amplification of the Intron 22 Inversion of the FVIII Gene 



Hemophilia A is an X-linked disorder caused by mutations in the factor VIII gene. 

Around 50% of all patients with severe hemophilia A share a common mutation. This 

intron 22 inversion results from homologous recombination of a sequence within 

intron 22 of the factor VIII gene and identical sequence around 500 kb telomeric to 

the gene. Although this inversion could be detected by Southern blotting, the development 

of a long polymerase chain reaction (PCR) assay, and its subsequent improvement 

by subcycling PCR (S-PCR), greatly facilitated the provision of diagnostic 

services (1,2). 

In S-PCR, the annealing/elongation step is composed of subcycles of shuttling 

between a low and a high temperature. S-PCR produces consistent amplification of the 

various segments produced by wild-type, mutant, and carrier individuals. S-PCR is a 

robust variant of PCR, which may be of use in amplification of long segments in which 

the guanine–cytosine (GC) content varies among the segments, multiplex amplification 

of long segments, and multiplex amplification of short segments in which the GC 

content varies among the segments. We have also found it greatly improves the success 

of amplification from partially degraded templates. 

2. Materials 

Except where otherwise stated, all reagents are from Sigma Chemical Company, 

Poole, UK. 

1. Thermal cycler. 

2. Expand Long Template PCR System (Roche). 

3. Dimethyl sulfoxide. 

4. DNTP (Promega) Supplied separately (dATP, dCTP, dGTP, dTTP) at concentrations of 

100 mM. Use at 10 mM. Aliquot 10 µL of stock dNTP into labeled tubes containing 90 µL 

of sterile distilled water. Store at –20°C. 

5. 7-Deaza GTP (Roche). 



101

102 Stirling 

Table 1 

Thermal Cycler Program for Subcycling PCR 

Step Temp/command Time (mm:ss)/repetitions 

11 95 2:00 

12 94 00:10 

13 63 00:05 

14 68 5:00 

15 Go to step 3 4 items 

16 Go to step 2 15 times 

17 94 00:10 

18 63 00:10 

19 68 6:00 (+ 10s per cycle) 



12 68 30:00 

13 End 

6. Oligonucleotides: INT22-P (5′-GCC CTG CCT GTC CAT TAC ACT GAT GAC ATT ATG 

CTG AC-3′); INT22-Q (5′-GGC CCT ACA ACC ATT CTG CCT TTC ACT TTC AGT 

GCA ATA-3′); INT22-A (5′-CAC AAG GGG GAA GAG TGT GAG GGT GTG GGA 

TAA GAA-3′); and INT22-B (5′-CCC CAA ACT ATA ACC AGC ACC TTG AAC TTC 

CCC TCT CAT A-3′). The oligonucleotides are diluted to 100 pmol/µL for storage. 

Subaliquot to minimize freeze-thaw cycles and store at –20°C. 

7. PCR Mastermix 1. For each reaction to be run, the following are included: 10× buffer 2 

(2.5 µmL); TAQ mix (0.94 µL); and water (5.69 µL). 

8. PCR Mastermix 2. For each reaction to be run, the following are included: 10 mM aATP 

(1.25 µL); 10 mM aTTP (1.25 µL); 10 mM aACP (1.25 µL); 10 mM aGTP (0.625 µL); 

10 mM deaza aGTP (0.625 µL); P/Q primer mix (5 µL); A (or B) primer mix (5 µL); 

100% DMSO (1.875 µL). 

3. Procedure 

1. Remove reagents from freezer and allow to thaw fully then mix thoroughly and briefly 

centrifuge before pipetting. Reagents to be thawed: buffer 2 from Expand Long Template 

PCR Kit, dNTPs, and deaza dGTP. 

2. Label 0.2 mL of flat-cap PCR tubes with the DNA number and primer grouping, if 

applicable (e.g., APQ). 

3. Using sterile pipet tips, pipet 0.5 µL of each DNA sample into the appropriately labeled 

tube. Ensure that the DNA is pipetted directly into the bottom the tube. If concentration of 

DNA is very low, 1 µL of DNA should be added. Place tubes on ice. 

4. Prepare 1 in 50 dilution of A oligo, 1 in 50 dilution of B oligo, and 1 in 25 dilution of 

P and Q oligo pairing. The number of samples being tested will determine the actual 

quantities required. 

5. Prepare PCR mastermix 1 and 2 for appropriate number of tests: Place both mastermixes 

on ice! 

6. For each reaction, aliquot 14.9 µL of Master Mix 2 into the labeled PCR tubes (which 

already contain the DNA template). Keep on ice. 

7. Immediately before amplification, add 9.2 µL of Master Mix 1. Spin briefly and proceed 

to PCR step immediately.

Subcycling PCR 103 

8. Place tubes in thermal cycler and start the program (see Table 1). 

9. When cycle is complete, remove PCR products and keep in fridge prior to electrophoresis. 

10. Dilute 4 µL of each PCR product into 6 µL of sterile distilled water. This initial dilution 

may need adjusting depending on electrophoresis results picture. 

11. Electrophorese 1 µL of this diluted DNA on an 0.8% agarose gel. 

12. The inversion is associated with a band of 11 kb; the normal allele is associated with a 

band of 12 kb. An upper 12-kb band only indicates the inversion is not present; a lower 

11-kb band only indicates the inversion is present in an affected male; and bands at both 

11 kb and 12 kb indicate a female carrier of the inversion. 

References 

1. Liu, et al. (1998) Single tube polymerase chain reaction for rapid diagnosis of the inversion 

hotspot mutation in haemophilia A (letter). Blood 92, 1458–1459. 

2. Liu and Sommer (1998) Sub-cycling PCR for multiplex long distance amplifications of 

regions with High and Low GC content: Application to the inversion hotspot in the FVIII 

gene. BioTechniques 25, 1022–1028.

104 Stirling

Rapid Amplification of cDNA Ends 105 

22 

Rapid Amplification of cDNA Ends 

Xin Wang and W. Scott Young III 


The identification and isolation of full-length cDNAs can be a frustrating and timeconsuming 

experience, especially for genes with a low abundance of expression or with 

large transcripts. Traditionally, full-length cDNAs are obtained from cDNA libraries 

by hybridization with radioisotope-labeled probes. This labor-intensive and tedious 

procedure often produces incomplete sequences and sometimes includes intronic 

sequence. To obtain full-length cDNAs, investigators had to rescreen libraries with 

larger numbers of clones (or upstream probes), not always successfully. The combination 

of rapid amplification of cDNA ends (RACE) and long-distance polymerase chain 

reaction (PCR) with high fidelity makes it possible to obtain full-length cDNAs quickly 

without constructing or screening a cDNA library. 

The principle of RACE is simple and elegant: An anchor sequence is added to the 

end of the cDNA to be used as PCR primer binding template. A universal primer 

complementary to the added anchor template is coupled with a gene-specific primer 

(based on a single short known sequence within the mRNA of interest) in a PCR to 

amplify regions with unknown sequence. Several strategies have been developed to 

isolate full-length cDNA using this anchored PCR technology, each using a unique way 

to add the anchor sequence to the end of the cDNA. In the first generation of RACE, 

homopolymeric tails (G or A) are added to 3′ end of cDNA to be used as an anchor 

sequence using the enzyme terminal deoxynucleotidyl transferase (1). The second 

generation of RACE technique is based on the ability of T4 RNA ligase to ligate 

a single-stranded anchor sequence to the 3′ end of the first-strand cDNA (2). Both 

methods are difficult to optimize because of inefficient enzymatic reactions. The third 

generation of RACE uses T4 DNA ligase to add a double-stranded anchor sequence to 

both ends of double-stranded cDNAs (3), thus the resulting anchored cDNAs are suitable 

for both 5′- and 3′-RACE. A commercial kit called Marathon cDNA amplification 

kit has been built around this approach (Clontech Laboratories, Inc.). 

In this chapter, the application of this third-generation RACE method to the isolation 

of several pineal-specific cDNAs ranging from 1.4 to 8.0 kb in size is outlined. In 

one case, a full-length 2.0-kb cDNA for a pineal-specific cDNA, PG25, was obtained 

by 5′-RACE using gene-specific primers based on 260 base pairs of known sequence 

located in the 3′ terminus of the mRNA (4). In another case, two different versions of 



105

106 Wang and Young 

full-length cDNAs for a pineal-specific gene, PG23, were obtained in a single 5′-RACE 

reaction because the antisense gene-specific primer used was derived from the common 

3′ portion of the mRNAs (277 bp known sequence from differential display PCR or 

DD-PCR, this chapter). This approach is suitable for cloning full-length cDNA quickly 

based on a short sequence information from the 3′ end of mRNA, such as that obtained 

by the DD-PCR technique (5) or expressed sequence tags (6). PG10.2 is a gene (8 kb 

mRNA) expressed only in the pineal gland and the outer nuclear layer of the retina (7). 

Two 4-kb cDNA fragments were obtained by 5′-RACE and 3′-RACE using primers 

derived from only a 145-bp known sequence. Thus, this approach is suitable for cloning 

full-length cDNA based on a short known sequence located anywhere on the mRNA, 

whether derived from arbitrarily primed PCR (AP-PCR RNA fingerprinting technique 

(8) or suppression subtractive hybridization (SSH) technology (Clontech, ref. 9). In 

the case of PG10.2, a traditional 3′-RACE protocol was used to obtain the 3′ portion 

of unknown sequence. Then, an anchored cDNA pool constructed using an antisense 

gene-specific primer for reverse transcription was used to obtain the 5′ portion of 

unknown sequence. This approach is especially reliable and useful for isolating fulllength 

cDNAs for large transcripts (such as 8 kb for PG10.2) with low and restricted 

expression. It may take only a few weeks to go from identification of differentially 

expressed sequence tags (by DD-PCR, AP-PCR, or SSH technology) to full-length 

cDNA by this long-template PCR-based RACE. In the following sections, both 

5′-RACE and 3′-RACE protocols using the above model systems will be described. 

The efficiency of described RACE approaches are very satisfactory for obtaining 

full-length cDNAs quickly. The choice of method is dependent on the available 

resources and relevant experience. For some genes, the use of more than one method 

may be necessary. Another excellent approach for full-length cDNA cloning is using 

biotin-tailed oligonucleotide probes to capture full-length cDNA clones from a wellconstructed 

cDNA library (Invitrogen). A commercial kit called GeneTrapper cDNA 

Positive Selection System has been built around this capture technology (Invitrogen). 

2. Materials 

1. RNA from source tissue (see Note 1): pineal gland and retina tissues were dissected 

from Sprague–Dawley rats (male, 200–250 g, Taconic Farms). Total cellular RNA was 

isolated using TRIzol Reagent (Invitrogen) according to the manufacturer’s instructions. 

For preparation of double-stranded cDNA, poly (A)+ RNA was purified from 500 µg total 

RNA using a Poly (A) Quik mRNA isolation kit (Stratagene, La Jolla, CA). 

2. dNTP mixture: an aqueous solution of each dNTP (dGTP, dATP, dTTP, and dCTP) from 

any reputable vendor of molecular biology reagents. 

3. First-strand cDNA synthesis: SuperScript II (RNAse H-) reverse transcriptase (Invitrogen) 

was used with manufacturer supplied 5 X reverse transcription buffer (see Note 2). 

4. cDNA synthesis primer: this may be a universal oligo-dT primer (5′-CACTATAGGC 

CATCGAGGCC(T) 20 MN-3′) for 5′-RACE and/or 3′-RACE (see Subheading 3.2.1.) or an 

antisense gene-specific primer (5′-RACE only, see Subheading 3.4.2.) complementary to 

the rare mRNA of interest or located upstream on a large transcript (see Note 3). 

5. Second-strand cDNA synthesis: a 20× second-strand enzyme mixture, 5× second-strand 

buffer and T4 DNA polymerase supplied in the Marathon cDNA amplification kit (Clontech 

Laboratories, Inc.). Combining the following enzymes makes extra second-strand enzyme 

mixture: Escherichia coli DNA polymerase I, E. coli DNA ligase, and E. coli RNAse H 

(see Note 4).


6. Adaptor (anchor sequence) ligation: A specially designed partially double-stranded adaptor 

supplied in the Marathon cDNA amplification kit (Clontech Laboratories, Inc.). 

7. Oligonucleotide primers: gene-specific primers should be about 25 nucleotides long and 

around 50% guanine–cytosine. Primers with a melting temperature between 65 and 70°C 

give sufficient binding specificity (see Note 5). For some difficult genes, primers with 

70°C melting temperature or higher should be used in a touchdown PCR (see Note 6). 

Anchor primers (AP) complementary to the adaptor sequence (for 5′-RACE or 3′-RACE) or to 

the tailing sequence on the cDNA synthesis oligo-dT primer are coupled with GSP to amplify 

the unknown sequences flanked by the paired primer set. AP-1 (5′-CCATCCTAATACGACT 

CACTATAGGGC-3′) and AP-2 (nested within the AP-1, 5′-ACTCACTATAGGGCTC 

GAGCGGC-3′) are supplied in Clontech’s Marathon cDNA Amplification Kit. 

8. PCR machine: all experimental data presented in this paper were carried out on a 

thermocycler from MJ Research, Inc (see Note 7). 

9. DNA Polymerase: Expand PCR system (Boehringer-Mannheim). There are three buffer 

systems supplied by the manufacturer. Buffer 1 is sufficient for RACE PCR of expected 

product size of less than 10 kb. 

10. PCR fragment purification: QIAEX II from QIAGEN Bioscience Corporation. 

11. TA cloning: pGEM-T vector system (Promega Corporation). 

12. Other general molecular laboratory equipment and reagents. 

13. All reagents, including enzymes, should be mixed briefly immediately before use. 

3. Methods 

3.1. The Relative Abundance of the Transcript in the Source Tissue 

1. A good understanding of expression profile is essential for the successful isolation of the 

full-length cDNA of interest. The efficiency of RACE PCR amplification largely depends 

on the relative abundance of the mRNA of interest in the poly (A)+ RNA sample extracted 

from the target tissue. RACE PCR should be performed on the tissue where the expression 

is most abundant. The higher the copy number of the mRNA in the cDNA pool, the better 

chance the full-length cDNA can be amplified to a critical mass visible on agarose gel 

(see Note 8). 

2. PG23 is a pineal-specific gene identified using DD-PCR (unpublished data). In this case, 

we had no choice but to use pineal as our target tissue for 5′-RACE. Northern blot analysis 

revealed a mRNA doublet about 2.0 kb and 2.4 kb for PG23 (Fig. 1A, lane 1). The size of 

mRNA serves as a useful guide in identifying the correct RACE bands (Fig. 1B, lanes 1 

and 2). In a similar fashion, another 2.0-kb full-length pineal-specific cDNA (PG25) was 

obtained using the RACE protocol outlined for PG23 (Fig. 3B in ref. 4). 

3. PG10.2 is a gene (8 kb mRNA) expressed only in the pineal gland and the outer nuclear 

layer of the retina (7). In this case, retina was used as target tissue source because PG10.2 

has a much higher expression level in retina than in pineal even though it is only expressed 

in the outer nuclear layer of the retina (Fig. 3 in ref. 7). This report will describe the 

application of a traditional 3′-RACE (see Subheading 3.3.) and a gene-specific 5′-RACE 

(see Subheading 3.4.) to the isolation of the large transcript of PG10.2 (8.0 kb). A general 

strategy is schematically depicted in Fig. 2. 

3.2. 5′-RACE Using a Universal Oligo-dT Primer for cDNA Synthesis 

(see Note 9) 

1. First-strand cDNA synthesis: 1 µg of high-quality poly (A)+ mRNA isolated from fresh 

rat pineal was reverse-transcribed to first-strand cDNA in a 10-µL reaction containing 

1 µL of 10× first-strand synthesis buffer, 1 µL of 0.1 M dithiothreitol, 1 µL of 10 mM


Fig. 1. (A) Northern blot analysis: 10 µg of total RNA were loaded in each lane; Pineal 

(lane 1), brain (lane 2), lung (lane 3), and kidney (lane 4). (B) RACE PCR: full-length 

cDNAs (1.4 kb and 2.0 kb) were obtained using a long template PCR-based RACE technique. 

Two primers, AGSP (5′- GGAACAGTCTGAGCTCTAAGCTAGG-3′, lane 1) and NAGSP 

(5′-CTAGAAGGATAAGTTCACGAGGGCC-3′, lane 2), were designed using a 277-bp 

sequence information from a sequenced DD-PCR product (Fig. 2) and coupled with AP-1 

for 5′-RACE PCR. 

dNTP, 1 µL of 10 µM oligo-dT primer (5′-CACTATAGGCCATCGAGGCC(T)20MN-3′), 

and 1 µL of SuperScript II (RNase H-) reverse transcriptase (added last; see below). The 

reaction was performed in a thermocycler with the following parameters: 70°C for 10 min, 

42°C for 50 min, and 50°C for 15 min. SuperScript II RNase H- reverse transcriptase 

(1 µL) was added to the reaction mixture after a 5-min incubation at 42°C. The reaction 

mixture was placed on ice before the next step. 

2. Second-strand cDNA synthesis: The following components for second-strand cDNA 

synthesis were added to the above 10-µL first-strand reaction mixture: 48.4 µL of highquality 

H 2 O, 16 µL of 5× second-strand buffer, 1.6 µL of 10 mM dNTP mixture, and 4 µL 

of 20× second-strand enzyme cocktail. After mixing the contents briefly with gentle pipetting, 

the reaction was placed in the thermocycler for incubation at 16°C for 1.5 h. Then, 2 µL of 

T4 DNA polymerase was added and mixed well, and incubation continued at 16°C for 

another 45 min to create blunt end. Finally, 4 µL of the EDTA/Glycogen mixture (glycogen 

helps bring down the cDNA in a later precipitation) was added to stop the reaction. 

3. Purification of blunt-ended double-stranded cDNA: For efficient recovery of the relatively 

small amount of the cDNA, the general phenol/chloroform extraction was performed twice 

using 100 µL of phenolchloroformisoamyl alcohol (25241). The supernatant plus 

0.5 volume of 4 M ammonium acetate and 2.5 volumes of 100% ethanol were placed at –20°C 

for at least 1 h and centrifuged for 10 min at 4°C. The recovered DNA pellet was washed in 

1 mL of 75% ethanol and resuspended in 10-µL high-quality water after air-drying. 

4. Adaptor ligation: A partially double-stranded adaptor was ligated to both ends of the 

above-purified double-stranded cDNA. Ten microliters of ligation mixture containing 

5 µL of purified blunt-ended double-stranded cDNA, 2 µL of adaptor, 2 µL of 5× ligation


Fig. 2. Schematic representation of 5′- and 3′-RACE for the 8.0 kb cDNA of PG10.2. (A) 

The 145-bp sequence of PG10.2 is located in the middle of the 8-kb mRNA. (B) 3′-RACE. 

SGSP coupled with the anchor primer (complementary to the tail sequence of oligo-dT cDNA 

synthesis primer) for 3′-RACE. (C) 5′-RACE. AGSP2 coupled with the AP-1 anchor primer 

for 5′-RACE. 

buffer, and 1 µL of T4 DNA ligase were incubated at 16°C overnight. The mixture was 

heated at 70°C to inactivate the ligase. 

5. Primer design for PG23 5′-RACE: A short known sequence located at the 3′ end region 

of the gene is required for designing antisense gene-specific primers (AGSP) and a 

nested antisense gene-specific primer (NAGSP) for 5′-RACE. In the case of PG23, AGSP 

(5′- GGAACAGTCTGAGCTCTAAGCTAGG-3′) and NAGSP (5′-TCTAGAAGGATA- 

AGTTCACGAGGGCC-3′) were designed based on the 277-bp sequence information just 

upstream of the poly (A) tail as shown in Fig. 3. 

6. PCR was performed in a 50-µL reaction containing the following components: 5 µL of 

10× PCR buffer 1, 5 µL of the 1:100 diluted adaptor-ligated cDNAs, 1 µL of 10 mM 

dNTP, 1 µL of 10 µM AP-1 linker primer, 1 µL of 10 µM GSP, and 0.75 µL of DNA 

polymerase mixture (added last). The DNA polymerase mixture was added to the reaction 

after denaturation at 94°C for 1 min to reduce nonspecific amplification (see Note 10).


Fig. 3. Expressed sequence tag of PG23. Sequence information of 277 bp was derived 

from a cloned DNA fragment using the DD-PCR method (5). Double-strand sequences are shown 

for easy identification of primer’s location (underlined). A 10-nucleotide primer (5′-GATCT- 

GACTGC-3′) and an olio-dT primer (5′-TTTTTTTTTTTTCA-3′) were used in DD-PCR for 

the original cloning of PG23. AGSP (5′- GGAACAGTCTGAGCTCTAAGCTAGG-3′) and 

NAGSP (5′-TCTAGAAGGATAAGTTCACGAGGGCC-3′) were designed for the 5′-RACE of 

full-length cDNA of PG23. 

The sample was then subjected to 30 cycles of PCR on a thermocycler using the following 

parameters: 94°C for 30 s, 60°C for 30 s, and 68°C for 3 min. For RACE PCR of GC rich 

mRNAs, addition of some co-solvent may increase PCR efficiency (see Note 11). 

7. Agarose gel electrophoresis of 5′-RACE PCR products: The above AGSP and NAGSP 

were used in two independent RACE PCR. Then, 20 µL was loaded on a 1% agarose gel 

and electrophoresed in 1× TAE buffer at 75 volts for 2 h. Each of these antisense primers 

produced bands of expected size on ethidium bromide stained agarose gels when coupled 

with the AP-1 primer (Fig. 1B, lanes 1 and 2). The band produced by the NAGSP (Fig. 1B, 

lane 2) is slightly smaller compared with the one generated by AGSP (Fig. 1B, lane 1), 

confirming that the bands are true RACE products. When only AGSP, NAGSP, or AP-1 

were used in PCRs, these sharp bands disappeared (data not shown). The DNA bands of 

proper size were excised from agarose gel with a clean, sharp scalpel. DNA was extracted 

from the gel using the QIAEX II kit according to the manufacturer’s instruction. A 15-µL 

elution was saved for later use. 

8. The gel-purified DNA (5 µL) was used for cloning into the pGEM-T vector. Sequence 

information for PG23 mRNAs of 1.4 kb and 2.0 kb was subsequently determined (data 

not shown). 

9. Nested second PCR: If the first PCR with AGSP and AP-1 is insufficient to produce a 

visible band(s) of expected size, a second round of PCR with NAGSP and AP-2 (nested 

within AP-1 primer) could be performed using 2.5 µL of 1:100 dilution of the first-PCR 

product as template. This second round of PCR usually yields defined fragments of 

expected size on ethidium bromide stained agarose gel. Sometimes no visible band


Fig. 4. 5′- and 3′-RACE of PG10.2. An antisense gene-specific primer 2 (AGSP2 of PG10.2, 

5′-GGCAGTTCATCCACACTCAGGTACCCAG-3′) and AP-1 primer amplified a faint but 

sharp band of about 3.5 for 5′-RACE of PG10.2 (lane 1). Either AGSP2 (lane 2) or AP-1 

(lane 3) alone failed to produce the band. A sense gene-specific primer (SGSP of PG10.2, 

5′-GAGTGAGAAGCAAAGTGCAAATGCC-3′) and an anchor primer (5′-CCAAGCTATT- 

TAGGTGACACTATAGGCCATCGAGGCC-3′, priming at the end of the newly synthesized 

second-strand cDNA) amplified a band of 4 kb for the 3′-RACE (lane 4). 

appeared even after a second round of PCR using nested primer set. This may due to nonoptimized 

RACE PCR conditions or to an extremely low level of expression of the gene. 

Other methods could be used to identify the correct RACE clones (see Note 12). 

3.3. 3′-RACE Using Tailed Oligo-dT Primer for cDNA Synthesis 

(see Note 9) 

1. Northern analysis revealed a mRNA of 8.0 kb in size for PG10.2. Only 145 bp of sequence 

information for this DD-PCR fragment was available to be used as template for RACE 

primer design. After failing to find any positive cDNAs for PG10.2 in screens of two 

cDNA libraries, we suspected that this was probably caused by the relatively far upstream 

location of the 145 bp probe (Fig. 4 in ref. 7, underlined) and truncated clones in the cDNA 

libraries we examined. In order to obtain this potentially large 3′ portion of unknown 

sequence, we used a traditional 3′-RACE protocol outlined below to do 3′-RACE for 

PG10.2. In general, the extended sequence information would provide a much broader 

region for 5′-RACE primer design.


2. First-strand cDNA synthesis: same as above (see Subheading 3.2.). 

3. Second-strand cDNA synthesis: same as above (see Subheading 3.2.). T4 DNA Polymerase 

was not used because blunt ending of cDNA was unnecessary in this case. 

4. Purification of double-stranded cDNA: same as above (see Subheading 3.2.). 

5. Primer design for PG10.2 3′-RACE: A sense gene-specific primer (SGSP of PG10.2, 

5′-GAGTGAGAAGCAAAGTGCAAATGCC-3′) was designed based on the known 145 bp 

sequence information of PG10.2. An anchor primer (5′-CCAAGCTATTTAGGTGACAC- 

TATAGGCCATCGAGGCC-3′) was designed to prime at the end of the newly synthesized 

second-strand cDNA (Fig. 2). This end sequence on the newly synthesized second-strand 

cDNA is complementary to the 5′ tailing part of the oligo-dT primer used for first-strand 

cDNA synthesis. 

6. PCR was performed as described (see Subheading 3.2.) with SGSP of PG10.2 and the 

above-mentioned anchor primer. The PCR product was electrophoresed on a 1% agarose 

gel. A 4-kb fragment 3′ to the 145 bp known sequence was amplified very efficiently by 

this 3′-RACE PCR (Fig. 4, lane 4). 

7. The band was purified (as in Subheading 3.2.) and ligated into pGEM-T vector (as in 

Subheading 3.2.). 

3.4. 5′-RACE Using Gene-Specific Primer for cDNA Synthesis 

(see Note 9) 

1. To clone the full-length cDNA for the large transcript (8.0 kb mRNA) of PG10.2, a 

gene-specific RACE cDNA was generated and used as described below. 

2. First-strand cDNA synthesis was performed essentially as described (see Subheading 3.2.) 

except that an antisense gene-specific primer (AGSP1 of PG10.2, 5′-TTCAAGGGCCAGT- 

CAGGCCGTAGGTCACAGACACTTTGAC-3′) based on 145-bp sequence information 

for PG10.2 was used for first-strand cDNA synthesis. The cDNA generated by this cDNA 

synthesis primer (GSP) is only suitable for 5′-RACE of this specific gene. 

3. Second-strand cDNA synthesis: same as above (see Subheading 3.2). 

4. Purification of double-stranded cDNA: same as above (see Subheading 3.2). 

5. Adaptor ligation: same as above (see Subheading 3.2.). 

6. Primer design for PG10.2 5′-RACE: An antisense gene-specific primer2 (AGSP2, 

5′- GGCAGTTCATCCACACTCAGGTACCCAG-3′) based on 145 bp sequence information 

was designed for 5′-RACE of PG10.2. Notably, this primer was designed to be 

upstream of the AGSP1 used for cDNA synthesis (see Subheading 3.4.). In this design, 

AGSP2 is a nested primer relative to AGSP1 (Fig. 2). 

7. PCR was performed as described (see Subheading 3.2). Agarose gel electrophoresis 

showed that the AGSP2 of PG10.2 coupled with AP1-linker primer (Clontech, complementary 

to the sequence of the ligated-adaptor) amplified a unique band of about 3.5 kb 

in size upstream of the 145-bp known sequence of the PG10.2 fragment (Fig. 2, lane1). 

When only the AGSP2 of PG10.2 or AP-1 was used in PCRs, this faint but sharp band 

disappeared (Fig. 4, lanes 2 and 3). 

8. The band was purified (see Subheading 3.2.) and ligated into pGEM-T vector (as in 

Subheading 3.2.). 

9. The 4368-bp sequence, including the entire 5′-RACE product and the 5′-portion of the 

3′-RACE product, was determined (Fig. 4 in ref. 7). 

4. Notes 

1. Template purity (free of DNA) and integrity (minimum degradation) are critical for 

effective isolation of full-length cDNA of interest. One should place the dissected 

tissue immediately on dry ice before isolating total and poly (A)+ RNAs. All standard


precautions for handling RNA should be followed carefully (10). TRIzol Reagent 

(Invitrogen) performs well with small quantities of tissue. Total RNA has been successfully 

extracted from punches of rat supraoptic and paraventricular nuclei and used to clone a 

gene preferentially expressed in the supraoptic and paraventricular nuclei of the brain 

by DD-PCR (unpublished data). High-quality poly (A)+ mRNA can be obtained from 

companies such as Clontech Laboratories, Inc. 

2. Reverse transcriptase and related buffers supplied in the Marathon cDNA amplification 

(Clontech) may be used for the first-strand synthesis to meet most full-length cDNA 

cloning needs. SuperScript II (RNAse H-) reverse transcriptase (Invitrogen) is a preferred 

reverse transcriptase to generate longer first-strand cDNAs. 

3. The oligo-dT primer (5′-TTCTAGAATTCAGCGGCCGC(T) 30 MN-3′) supplied in the 

Marathon cDNA amplification kit (Clontech) is suitable as a universal cDNA synthesis primer. 

The two degenerate nucleotides (where M=A, G or C; N=A, G, T or C) place the oligo-dT 

primer at the beginning of the poly(A) tail and thus eliminate 3′-heterogeneity (11). 

4. Combine 25 µL of E. coli DNA polymerase I (10.0 units/µL, Invitrogen), 3 µL of E. coli 

DNA ligase (10.0 units/µL, Invitrogen), 3 µL of E. coli RNase H (2.1 units/µL, Invitrogen), 

and 10 µL of high-quality H 2 O to make 20× second-strand enzyme mixture. 5× secondstrand 

buffer contains 500 mM KCL, 50 mM ammonium sulfate, 25 mM MgCL 2 , 0.75 mM 

beta-NAD, 100 mM Tris (pH 7.5), and 0.25 mg/mL bovine serum albumin (Clontech’s 

Marathon cDNA Amplification Kit). 

5. The primer’s melting temperature is an important parameter that greatly influences PCR 

specificity by reducing nonspecific priming events. High-melting point primers with 

melting temperatures between 65 and 70°C allow the use of higher annealing temperatures 

to enhance reaction specificity. The estimated melting temperature [(G+C) × 4 + (A+T) × 2] 

are not exact under PCR conditions but can be used as a starting point. Sense primers are 

used for 3′-RACE whereas anti-sense primers are used for 5′-RACE. 

6. Touchdown PCR may help eliminate extraneous bands and increase yield. The first round 

of touchdown PCR has an annealing temperature 5 to 10°C higher than what is usually 

used. In each subsequent round, the annealing temperature is dropped a degree until the 

standard annealing temperature is reached. 

7. GeneAmp PCR System 9600 (Applied Biosystems) gives more satisfactory amplification 

efficiency, especially for low abundant genes. Applied Biosystems GeneAmp 0.5-ml PCR 

tubes are preferred PCR tubes for critical PCR amplification. 

8. Northern analysis is the most preferred method to provide an expression profile and 

size estimation of the mRNA. If northern data is not readily available, a quick reversetranscription 

PCR survey using two GSPs (to produce a sizable PCR fragment) could be 

used to identify the best tissue source for the actual RACE PCR. 

9. The 5′-RACE outlined in Subheading 3.2. is essentially as described in the Marathon 

cDNA amplification kit (Clontech Laboratories, Inc.) and the Expand PCR system 

(Boehringer Mannheim Biochemicals) except an oligo-dT primer (5′- CACTATAGGCCATC 

GAGGCC(T) 20 MN-3′) was used for first-strand cDNA synthesis. The adaptor-ligated 

cDNA pool is essentially an uncloned cDNA library, which can be used to isolate fulllength 

cDNAs for many different genes using gene-specific primers. These two-sided 

(5′ and 3′) anchored cDNAs permit 5′- and 3′-RACE PCR to be performed with the same 

cDNA pool. If the known sequence information is far upstream from the 3′ end of the 

mRNA (poly A tail), especially for the large transcript of the gene, the 3′-RACE protocol 

described in Subheading 3.3. is a preferred strategy to obtain this potentially long (often 

untranslated) region quickly and reliably. Although the ligation of the double-stranded 

adaptor using T4 DNA ligase is much more efficient compared to the inefficient tailing or 

the single-stranded anchor ligation, the adaptor actually tags only a portion of cDNAs. The


3′-RACE outlined in Subheading 3.3. is more efficient because it relies on the sequence 

introduced by the tail sequence 5′ of the oligo-dT sequence as the template for anchor 

primer binding. The cDNA pool always provides more template for this kind 3′-RACE 

than the one available from ligated adaptors, hence giving more robust 3′-RACE efficiency. 

In general, the newly extended sequence information provides a larger region for design 

of 5′-RACE primers. This is especially important if the available sequence information for 

primer design is very limited. The gene-specific 5′-RACE protocol outlined in Subheading 

3.4. is useful for obtaining full-length cDNAs of large transcripts or those expressed 

at low levels. The cDNA produced by this protocol is only suitable for RACE PCR of 

unknown sequence upstream of the gene-specific primer that was used for first-strand 

cDNA synthesis. 

10. Hot start PCR. The DNA polymerase is withheld from the reaction until the temperature 

of reaction tube is above the annealing temperature. This hot-start PCR is used to improve 

the specificity and sensitivity of the RACE PCR. 

11. Co-solvent addition. For some primer/template systems such as GC-rich sequences, the 

addition of glycerol and/or DMSO to a final concentration of 5% has been found to 

enhance PCR yield and/or specificity. 

12. The RACE PCR product may be cloned into pGEM-T vector even if agarose gel electrophoresis 

fails to show a visible band(s). One dozen to one hundred colonies could be 

screened for positive clones in colony hybridization using oligodeoxynucleotide probes 

downstream from the RACE primer used for RACE PCR. 

Acknowledgments 

All experimental data presented in this chapter were performed in the former 

Laboratory of Cell Biology, National Institute of Mental Health/National Institutes 

of Health. We would like to acknowledge Dr. Michael J. Brownstein for invaluable 

advice and generous support. We thank Dr. Herman E. Brockman for critical reading 

of the manuscript. 

References 

1. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Rapid production of full-length 

cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide 

primer. Proc. Natl. Acad. Sci. USA 85, 8998–9002. 

2. Edwards, J. B. D. M., Delort, J., and Mallet, J. (1991) Oligodeoxyribonucleotide ligation 

to single-stranded cDNAs: A new tool for cloning 5′ ends of mRNAs and for constructing 

cDNA libraries by in vitro amplification. Nucleic Acids Res. 19, 5227–5232. 

3. Chenchik, A., Diatchenko, L., Moqadam, F., Tarabykin, V., Lukyanov, S., and Siebert, 

P. D. (1996) Full-length cDNA cloning and determination of mRNA 5′ and 3′ ends by 

amplification of adaptor-ligated cDNA. BioTechniques 21, 526–532. 

4. Wang, X., Brownstein, M. J., and Young, W.S., III (1997) PG25, a pineal-specific cDNA, 

cloned by differential display PCR (DDPCR) and rapid amplification of cDNA ends 

(RACE). J. Neurosci. Methods 73, 187–191. 

5. Liang, P. and Pardee, A. B. (1992) Differential display of eukaryotic messenger RNA by 

means of polymerase chain reaction. Science 257, 967–971. 

6. Sikela, J. M. and Auffray, C. (1993) Finding new genes faster than ever. Nat. Genet. 3, 

189–191. 

7. Wang, X., Brownstein, M. J., and Young, W. S., III (1996) Sequence analysis of PG10.2, 

a gene expressed in the pineal gland and the outer nuclear layer of the retina. Mol. Brain 

Res. 41, 269–278.


8. McClelland, M., Ralph, D., Cheng, R., and Welsh, J. (1994) Interactions among regulators 

of RNA abundance characterized using RNA fingerprinting by arbitrarily primed PCR. 

Nucleic Acids Res. 22, 4419– 4431. 

9. Diatchenko, L., Lau, Y.-F. C., Campbell, A. P., Chenchik, A., Moqadam, F., Huang, B., et 

al. (1996) Suppression subtractive hybridization: A method for generating differentially 

regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. USA 93, 

6025–6030. 


Manual, 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. 

11. Borson, N. D., Salo, W. L., and Drewes, L. R. (1992) A lock-docking oligo(dT) primer for 

5′ and 3′ RACE PCR. PCR Methods Appl. 2, 144–148.

116 Wang and Young

RAPD Fingerprinting 117 

23 

Randomly Amplified Polymorphic DNA Fingerprinting 

The Basics 

Ranil S. Dassanayake and Lakshman P. Samaranayake 


The study of genetic polymorphism among diverse populations of organisms is 

a complex task. However, this can be accomplished by using newer tools, such as 

randomly amplified polymorphic DNA (RAPD). RAPD is a polymerase chain reaction 

(PCR) technique that relies on the generation of amplification products for a given 

nucleic acid using an amplification-based scanning technique driven by arbitrary 

priming oligonucleotides. The result is the generation of amplification products 

(amplicons) that represent a multiplicity of anonymous sites that are characteristic of 

the studied genome (Fig. 1A,B). 

In RAPD, the first few cycles are performed at a low stringency, which ensures the 

generation of products by priming with mismatches between the primer and the template. 

The subsequent PCR cycles are performed at a higher stringency (see Note 1), 

yielding products that have ends complementary to the primer. The amplified region 

consists of unstructured, hypervariable, mostly noncoding sequences that vary in length 

from one species to another. As the arbitrary priming depends upon the complimentary 

regions in the DNA template, differences in these regions lead to uniquely characteristic 

fingerprinting patterns (1). These differences permit any organism to be characterized 

at the species or the strain level. However, it is noteworthy that the clarity of the species 

or strain discrimination, fingerprint complexity, and detection of DNA polymorphism 

are dependent on the primer that is selected for the RAPD assay. 

A single primer approx 10 bp in size (40–70% guanine–cytosine content) is generally 

used in PCR fingerprinting. For the amplification of the target region, the distance 

between priming regions has to be not more than 3 to 4 Kb. Specificity in RAPD is 

defined as the ability to produce “consensus” fingerprints on multiple occasions as 

a result of a multiplicity of targeted arbitrary sites. To achieve such consensus and 

“stringent” fingerprints in arbitrary priming protocols, a decrease in primer length (2) 

or blocking of the interactions between amplicons by incorporating a mini-hairpin at 

the 5′ terminus of the oligonucleotide is required (3). 

There are a number of limitations in the routine use of RAPD profiles for detailed 

evaluation of the genomes of organisms. The necessarily short primers require stringent 



117

118 Dassanayake and Samaranayake 

conditions for reproducible PCR (4), because variable or absent PCR products may 

result depending on the purity, quantity, or the quality of the DNA templates (5). 

The reproducibility of the RAPD technique can also be affected by minor changes in 

methodological aspects, such as the differences in the primer-to-template concentration 

ratio (see Note 2), variations of primer annealing temperatures, the cation concentration 

of PCR buffer, and magnesium ions in the reaction mixture (6, see Note 3). These 

parameters can dramatically affect the presence of low-intensity bands as well as the 

position and intensity of high-intensity bands. Moreover, some have reported that 

different lots of Taq polymerases (see Note 4) and the brand of the thermocycler used 

(see Note 5) can also affect the RAPD patterns, especially the low-intensity bands (7). 

Furthermore, in some situations, the bands that show equal electrophoretic mobility 

may not be homologes, and missing bands may not necessarily reflect homology 

because they can be lost by nucleotide substitutions in either the PCR priming sites 

or by length mutations. These complications of identity can be resolved either by 

sequencing the homologous bands or using a band-specific probe. Such strategies have 

been used in several recent studies (8–10). 

Our studies are mostly focused on the genomic analysis of the human fungal 

pathogen Candida albicans, and the following protocol is based on this experience. 

However, the principles guiding RAPD analyses are similar, and the following methods 

with minor variations would be applicable in general for many other organisms. 

2. Materials 

1. Thermocycler. 

2. Agarose gel electrophoresis apparatus. 

3. Ultraviolet transilluminator, Power supply (200 V and 150 mA). 

4. Spectrophometer for determining DNA concentration. 

5. Photographic unit that can capture ethidium bromide stained gel (e.g., Polaroid camera 

or digital image capture system, such as a CCD camera, a computer, and image analysis 

software for clear resolution of the gel image). 

6. 10× PCR buffer: 100 mM Tris-HCl, 500 mM KCl, 15 mM MgCl 2 , 0.01% (w/v) gelatin, 

pH 8.3. 

7. 25 mM Magnesium chloride. 

8. High-quality sterile, deionized water (more than 10 megaohm/cm) must be used for the 

preparation of all reagents and premixes. 

9. Deoxynucleotide triphosphate stock solution (dNTP): 2 mM each of dGTP, dATP, dCTP, 

and dTTP. Ready-made dNTP (100 mM) solution (obtainable from Sigma, Pharmacia, 

Promega, etc.). Make aliquots, preferably 10 mM, and store in –20°C. If dNTP solutions 

are made from dry reagents, the pH of the solution should be adjusted to 7.5 with 0.1 M 

Tris or 0.1 M NaOH using a pH meter or strip of pH paper. 

10. Primers: Lyophilized primers (5′GCGATCCCCA3) should be prepared at 100 µM and 10 µM 

concentration with deionized water; Store at –20°C. 

11. Taq DNA polymerases: Taq DNA polymerase (5 U/µL; Sigma), Ampli Taq (5 U/µL; 

PerkinElmer), Stoffel fragment of Taq DNA polymerase (10 U/µL; Perkin–Elmer), or any 

other high-quality Taq polymerase is preferred. 

12. Template DNA: 10 to 25 ng/µL stock solution containing good-quality, protein-free, 

nonsheared DNA; DNA can be resuspended in high-quality sterile, deionized water or TE 

(Tris-EDTA) pH 8.0. RNase (20 ng per 1 ng of DNA) treatment can increase amplification 

several-fold. RNase added should be DNase-free. 

13. Sterile mineral oil.


14. GeneAmp ® Thin-Walled Reaction Tubes (0.6 mL), designed for optimal fit in the DNA 

thermal cycler or DNA cycler 480 sample block. 

15. Agarose (Sigma or similar product). 

16. Ethidium bromide to visualize DNA 

17. TBE buffer: 1 M Tris, 0.9 M boric acid, 0.01 M EDTA, pH 8.3. 

18. Loading dye (6× concentration: 0.25% bromophenol blue, 0.25% xylene cyanol FF, and 

40% (w/v) sucrose in water, keep at 4°C. 

19. Electrophoretic size standards: PCR marker, 50–2000 bp, 123-bp DNA ladder, Supercoiled 

DNA ladder [2–16 kb], Sigma. 

3. Methods 

Programming of the thermal cycler for RAPD analysis is described first, followed 

by the PCR conditions used for the reaction. 

3.1. RAPD PCR Programming 

Program the thermal cycler (PerkinElmer model 480, which is a thermocycler with an 

average ramp speed) to denature for 1 min at 94°C, anneal for 2 min at 27°C (see Note 1), 

and allow primer extension for 2 min at 72°C for the first five cycles. Then, program 

for 45 cycles of 1 min denaturation at 94°C, 2 min of annealing at 32°C (see Note 

1), and 2 min primer extension at 72°C. Set the final extension period for 15 min 

at 72°C. With a thermocycler with a faster ramp speed, like the PerkinElmer model 

9600, a shorter protocol can be used, such as 45 cycles of 15 s at 94°C, 30 s at 27°C, 

and 1 min at 72°C. 

3.2. Setting Up the PCR for RAPD Analysis 

The following protocol is particularly suitable for RAPD analysis of C. albicans. 

Minor modifications of this method are useful for RAPD analysis of other Candida species. 

The components and procedure of the RAPD reaction mixture are listed as follows: 

1. Thaw the PCR buffer, MgCl 2 solution, dNTPs, and primer solutions on ice and mix 

properly before use. 

2. Prepare the PCR master mix in GeneAmp Thin-Walled Reaction Tubes containing 

approximately 50 ng of C. albicans genomic DNA (see Note 6), 5 µL of 10× PCR standard 

buffer, 200 µM dNTPs, 5 µL of 25 mM MgCl 2 (see Note 3), 1 µM of primer, 1.5 U Taq 

polymerase (Sigma, see Note 4), and make up to 50 µL of final reaction volume with 

double distilled deionized sterile water. 

3. Mix these reagents well by vortexing and then overlay with mineral oil (40 µL) to prevent 

evaporation and internal condensation. Spin for a short period before amplification until a 

smooth interface appears between the aqueous and the mineral oil layer. 

4. Preparation of the agarose gel is as follows: Separate the amplified products in 2% agarose 

gel because the molecular weight of the resultant amplicons are in the range of 0.3 to 4.2 kb 

(agarose has to be dissolved in the same electrophoresis running buffer, generally, 1× TBE. 

Include 0.5 µg/mL ethidium bromide during the preparation of the gel). 

5. Sample preparation for gel loading is as follows: Retrieve amplified products by adding 

150 µL of chloroform and pipetting out the aqueous droplet or by placing the reaction 

mixture over a piece of parafilm. Then, mix well the retrieved aqueous amplification 

mixture (12.5 µL) with the loading buffer (1.5 µL) and load into wells in an agarose 

gel together with an appropriate DNA size marker (ranging in size from 50 to 6 Kb) in 

a standard manner.


5. Electrophorese amplified products under 5 to 10 V/cm for 2 to 2.5 h. When the bromophenol 

blue travels three quarters of the length of the gel, visualize the gel under ultraviolet 

light and photograph. 

4. Notes 

1. Annealing temperature: This is an important parameter that needs optimization in RAPD 

and depends on primer length and sequence. The melting temperature (Tm) of a primer 

is proportional to both its length and the G + C content. Tm for primer template can be 

determined using the formula given below. 

Tm = [(number of A+T) × 2°C + (number of G + C) × 4°C] 

However, optimal annealing temperature for a primer should be adjusted empirically. 

Generally, in RAPD, the first few cycles are performed at a low annealing temperature 

(`5°C below the calculated Tm) and subsequent cycles are performed at a high annealing 

temperature (`5°C above the calculated Tm). 

2. Primer-template ratio: This is one of the important variables in the amplification reaction. 

Generally, moderate primer:template mass ratios ranging from 0.5 to 5000 are used. 

3. Ionic composition: The concentration of ionic components is critical for RAPD. Of 

these, magnesium is important because different thermostable polymerases have different 

affinities for magnesium. Generally, the higher the concentration of the magnesium ions, 

the lower is the specificity, and vice versa. In our hands reproducible fingerprints for 

C. albicans isolates were obtained with magnesium ion concentrations of 2.5 mM. It is noteworthy 

that when DNA is dissolved in TE buffer, the magnesium ion concentration has to be 

increased (~3 mM) to obtain reproducible patterns. This is probably caused by the chelation 

of magnesium ions by EDTA, which lowers the effective ionic concentration in the reaction 

mixture. Further, Weaver et al. (11) reported that excess primer and template DNA could 

also modulate the activity of magnesium by sequestrating free magnesium ions and thus 

dampening the amplification reaction. The dNTP concentration also has a direct effect 

on the magnesium ion concentration in the reaction mixture as a result of the interaction 

between the mononucleotide and magnesium. Thus, a higher concentration of magnesium 

ions is necessary for amplifications with a higher concentration of dNTPs (12). On the 

contrary, high magnesium ion concentrations can lead to primer–template mismatching 

and thus decrease amplification stringency. Furthermore, magnesium ions can tightly bond 

with the sugar backbone of nucleotides and nucleic acids and therefore variation in the 

magnesium concentration has strong and complex effects on nucleic acid interactions. 

4. DNA polymerase: The activity of polymerases is highly variable (13) and therefore, subtle 

differences in the specificity of these enzymes can influence the fingerprint profiles, and the 

multiplex ratio (14,15). The polymerase activity is regulated to a great degree by the buffer 

components and, thus, a recommended buffer has to be used for a particular polymerase. 

We have observed that the variations in the combinations of buffers and polymerases lead 

to inadequately resolved and incomplete fingerprints. Highly variable results are obtained 

in particular when different eubacterial DNA polymerases are used in the RAPD technique. 

On the contrary, Thermal aquatics Stoffel fragment is a truncated DNA polymerase that 

has wide magnesium tolerance and thermal stability and produces well-defined low 

molecular weight products (less than 500 bp) in general. RAPD with truncated DNA 

polymerases are known to produce good yields. Generally, Taq polymerase concentrations 

of 1 to 1.25 U/50 µL-reaction is used in RAPD. However, the reaction mixture of more 

than 2 U/µL can generate nonspecific products (16). 

5. Thermal cycling parameters: These are of critical importance for optimization of the 

RAPD reaction (17). Thermal cycling parameters include template denaturation and


Fig. 1. RAPD fingerprinting of 15 clinical Candida parapsilosis isolates (P1 to P10 superficial 

and P11 to P15 systemic) with primers RSD12 (5′ GCA TAT CAA TAA GCG CAG GAA 

AAG 3′) (A) and RSD6 (5′ GCG ATC CCC A 3′) (B) obtained after electrophoretic separation 

on 1.2% agarose gel. M, PCR marker (Sigma). Sizes of bands indicate the number of base 

pairs (18). 

annealing temperatures, cycle number and time duration of denaturation, annealing and 

primer extension period, and the type of thermal cycler used (4). Different varieties of 

thermocyclers, with intrinsic inhomogeneneities in rates of cooling and heating, can elicit 

incongruent fingerprints despite identical program settings and or reaction components. 

Similarly, subtle changes in the temperature within the same heat block can alter the 

mode of amplification. Annealing temperature also impacts the quality of the fingerprints 

produced and their reproducibility. It is noteworthy that the lifetime of a polymerizing agent 

can be extended considerably by reducing the duration of the denaturation temperature. 

6. Template: It is well known that the purity of the template is critical for producing 

reproducible fingerprinting patterns; thus, DNA devoid of proteins and RNA must be used 

at all times. For instance, impurities, such as phenol remnants in DNA, can be removed by 

repeated washing in 70% ethanol. Also DNA isolation methods that lead to degradation 

of DNA and inhibit the activity of DNA polymerase should be avoided. Furthermore, 

the RAPD technique cannot be reproducibly used to amplify DNA beyond a minimal 

threshold (less than 5 ng) or at the other extreme, a very high concentration of template 

DNA (higher than 1 µg). Such attempts invariably lead to production of either “smears” 

or poor resolution of the amplicons. In general, 50 to 100 ng of DNA can be used for 

50 µL of PCR reaction mixture (17).


References 

1. Williams, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and Tingey, S. V. (1990) 

DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic 

Acids Res. 18, 6531–6535. 

2. Caetano-Anolles, G., Bassam, B. J., and Gresshoff, P. M. (1992). Primer-template interactions 

during DNA amplification fingerprinting with single arbitrary oligonucleotides. Mol. 

Gene Genet. 235, 157–165. 

3. Caetano-Anolles, G. and Gresshoff, P. M. (1994). DNA amplification fingerprinting using 

arbitrary mini-hairpin oligonucleotide primers. Biotechnology (NY) 12, 619–623. 

4. Penner, G. A., Bush, A., Wise, R., Kim, W., Domier, L., Kasha, K., et al. (1993) Reproducibility 

of random amplified polymorphic DNA (RAPD) analysis among laboratories. PCR 

Methods Appl. 2, 341–345. 

5. Kubelik, A. R. and Szabo, L. J. (1995). High-GC primers are useful in RAPD analysis of 

fungi. Curr. Genet. 28, 384–389. 

6. Ellsworth, D. L., Rittenhouse, K. D., and Honeycutt, R. L. (1993) Artifactual variation in 

randomly amplified polymorphic DNA banding patterns. BioTechniques 14, 214–217. 

7. Meunier, J. R. and Grimont, P. A. (1993). Factors affecting reproducibility of random 

amplified polymorphic DNA fingerprinting. Res. Microbiol. 144, 373–379. 

8. Burt, A., Carter, D. A., Koenig, G. L., White, T. J., and Taylor, J. W. (1996) Molecular 

markers reveal cryptic sex in the human pathogen Coccidioides immitis. Proc. Natl. Acad. 

Sci. USA 93, 770–773. 

9. Graser, Y., Volovsek, M., Arrington, J., Schonian, G., Presber, W., Mitchell, T. G., et 

al. (1996) Molecular markers reveal that population structure of the human pathogen 

Candida albicans exhibits both clonality and recombination. Proc. Natl. Acad. Sci. USA 

93, 12,473–12,477. 

10. Mondon, P., Brenier, M. P., Symoens, F., Rodriguez, E., Coursange, E., Chaib, F., et al. 

(1997) Molecular typing of Aspergillus fumigatus strains by sequence-specific DNA primer 

(SSDP) analysis. FEMS Immunol. Med. Microbiol. 17, 95–102. 

11. Weaver, K. R., Caetano-Anolles, G., Gresshoff, P. M., and Callahan, L. M. (1994) Isolation 

and cloning of DNA amplification products from silver-stained polyacrylamide gels. 


12. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., and Nowotny, V. (1993) PCR buffer 

optimization with uniform temperature regimen to facilitate automation. PCR Methods 

Appl. 2, 234–240. 

13. Bej, A. K., Mahbubani, M. H., Boyce, M. J., and Atlas, R. M. (1994). Detection of 

Salmonella spp. in oysters by PCR. Appl. Environ. Microbiol. 60, 368–373. 

14. Bassam, B. J., Caetano-Anolles, G., and Gresshoff, P. M. (1992) DNA amplification 

fingerprinting of bacteria. Appl. Microbiol. Biotechnol. 38, 70–76. 

15. Schierwater, B. and Ender, A. (1993) Different thermostable DNA polymerases may 

amplify different RAPD products. Nucleic Acids Res. 21, 4647– 4648. 

16. Saiki, R. K. (1989) The design and optimization of the PCR, in PCR Technology: Principles 

and Applications for DNA Amplification. (Erlich, H. A., ed.), Stockton Press, New York, 

pp. 7–16. 

17. Yu, K. and Pauls, K. P. (1992) Optimization of the PCR program for RAPD analysis. 

Nucleic Acids Res. 20, 2606. 

18. Dassanayake, R. S. and Samaranayake, L. P. (2000). Characterization of the genetic 

diversity in superficial and systemic human isolates of candida parapsilos by randomly 

amplified polymorphic DNA (RAPD). APMIS 108, 153–160.

Microsphere-Based SNP Genotyping 123 

24 

Microsphere-Based Single Nucleotide 

Polymorphism Genotyping 

Marie A. Iannone, J. David Taylor, Jingwen Chen, May-Sung Li, 

Fei Ye, and Michael P. Weiner 


Single nucleotide polymorphisms (SNPs) are single base differences in genomic 

DNA (1). These single-base mutations, estimated to occur every 1000 bases, are 

thought to represent the most common form of genetic variation in the human genome 

(2). Several million SNPs have been identified (3). High-throughput analysis of these 

variations will be required to understand their contribution to disease. We outline a 

method that uses solution-based oligonucleotide ligation assay (OLA) (4) or singlebase 

chain extension (SBCE) (5,6) for allele discrimination followed by hybridization 

to fluorescently encoded microspheres. Flow cytometric analysis of the microspheres’ 

fluorescent profile yields rapid and accurate SNP genotyping (7,8). 

Allele discrimination by OLA or SBCE uses (1) polymerase chain reaction (PCR)- 

amplified genomic DNA that encompasses the SNP to be queried (‘target’ DNA); (2) 

a synthetic “capture” oligonucleotide probe; and (3) a fluorescent “reporter” (Fig. 1). 

In the allele discrimination reaction, an enzyme is used to covalently couple a reporter 

molecule to the capture probe in a target-dependent fashion. Each capture probe contains 

a sequence that is complementary to the target sequence and a ZipCode sequence that 

will associate the genotype result with a specific microsphere population. In OLA, a 

DNA ligase covalently couples the fluorescent reporter (a short oligonucleotide) to the 

capture probe if the capture and reporter probes correctly match the target DNA. In 

SBCE, a DNA polymerase adds a labeled dideoxynucleotide to the capture probe. 

After thermal cycling to amplify the signal on the capture probes, the enzymatically 

reacted capture probes are incubated with a suspension of up to 100 populations of 

fluorescently encoded microspheres where each population is uniquely identified by 

its fluorescent profile (9–11). Each microsphere population is covalently coupled to a 

different complementary ZipCode (cZipCode) oligonucleotide sequence that associates 

it with a capture probe and specific SNP allele. Flow cytometric analysis of the 

microspheres simultaneously identifies both the microsphere type and the fluorescent 

signal associated with the SNP genotype. 



123

124 Iannone et al. 

Fig. 1. Diagram of microsphere-based SNP genotyping by OLA or SBCE. Allele discrimination 

by OLA or SBCE uses PCR-amplified genomic DNA that encompasses the SNP (target 

DNA), synthetic capture oligonucleotide probe (capture probes extend up to the polymorphic 

base for OLA and end prior to the polymorphic base for SBCE), and a fluorescent reporter. 

Each capture probe contains both a sequence that is complementary to the target sequence and a 

unique 25-base ZipCode sequence that will link the genotyping result to a specific microsphere 

population. For OLA, the reporter is a short target-complementary oligonucleotide sequence 

that ends with a fluorescein molecule. If there is base pairing between the reporter and capture 

probe, DNA ligase will covalently couple the fluorescent reporter to the capture molecule. For 

the SBCE example shown above, the reporter is a fluorochrome or biotin-coupled ddTTP (or 

ddUTP) or ddCTP (each labeled ddNTP is used in a different tube). The DNA polymerase 

extends the capture probe by one base. In each case, the probes are thermally cycled to amplify 

the signal on the capture probes. A suspension of cZipCode-coupled microsphere populations 

is added and the capture probes are hybridized to the microspheres through their ZipCode tails. 

After washing, the fluorescent profiles of the microspheres are analyzed by flow cytometry. The 

OLA example shows a multiplexed reaction of a single SNP using two microsphere populations, 

one for each allele. More extensive multiplexing of SNPs can be conducted by combining more 

probes with complimentary microsphere populations. The SBCE reaction shows two uniplexed 

reactions (one for each allele). The SBCE reaction may be multiplexed by combining probes 

for different SNPs and assaying all A or G alleles in a single tube. 

The three fluorescent colors associated with each microsphere (two to identify the 

microsphere population and one for the genotyping result) are determined by flow 

cytometry. We describe two different flow cytometric systems for SNP genotyping. 

The first uses a standard bench-top cytometer (FACSCalibur, BD Biosciences, San 

Jose, CA) with a 488-nm laser excitation source. Sixty-four individual popula-


tions of microspheres, manufactured by the Luminex Corporation (Austin, TX), are 

identified by their orange and red fluorescent profile. Reporter fluorescence is green. 

The second system uses a microsphere-dedicated flow cytometer, also manufactured 

by the Luminex Corp., called the LX-100. The two-laser system of the LX-100 

uses a red laser (635 nm) to identify the microspheres (red and near infrared emission) 

and a green laser (532 nm) to excite the reporter fluorochrome (orange emission). 

One hundred individual microsphere populations are available for this system. The 

system is available with an XY platform for sampling directly from 96-well microtiter 

plates. 

2. Materials 

2.1. SNP Genotyping by OLA with Readout 

on a FACSCalibur Flow Cytometer 

1. 2-[N-morpholino] ethenesulfonic acid (MES; Sigma, St. Louis, MO). 

2. Microspheres, which are polystyrene beads with a carboxylated surface. Each population 

of microsphere has a unique profile of red and orange fluorescence (Luminex Corp., 

Austin, TX). Use 2.5 × 10 6 microspheres in 62 µL of 0.1 M MES (each population in 

a separate volume). 

3. 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Pierce, Rockford, 

IL). 

4. Water containing 0.1% sodium dodecyl sulphate. 

5. Water containing 0.02% Tween-20. 

6. Tris [hydroxymethyl] aminomethane hydrochloride (10 mM)/ethylenediamine-tetraacetic 

acid (1 mM), pH 8.0 (TE). 

7. 3.3× SSC: 0.5 M NaCl, 0.05 M Na Citrate, pH 7.0. 

8. Template DNA (human genomic DNA, 10–20 ng, lyophilized). 

9. Target probe primers. These should be designed to yield 150- to 500-bp products (see 

Table 1). 

10. AmpliTaq Gold (Applied Biosystems, Foster City, CA), 5 U/µL. 

11. 10× PCR buffer I (Applied Biosystems, Foster City, CA). 10× buffer: 500 mM KCl, 100 mM 

Tris-HCl (pH 8.3), 15 mM MgCl 2 , 0.01% gelatin (w/v). 

12. dNTPs (Applied Biosystems, Foster City, CA); 10 mM total (2.5 mM of each dNTP). 

13. Taq DNA ligase (40 U/µL) and 10× ligase buffer (New England BioLabs Inc., Beverly, 

MA). 10× buffer: 200 mM Tris HCl (pH 7.6), 250 mM K acetate, 100 mM Mg acetate, 

100 mM dithiothreitol, 10 mM NAD, and 1% Triton X-100. 

14. Oligonucleotides (see Table 1 and Notes section): cZipCodes (Oligos etc, Bethel, ME); 

reporters (Oligos etc, Bethel, ME, or Biosource/Keystone, Camarillo, CA); captures 

(Biosource Keystone, Camarillo, CA); and fluorescein-labeled luciferase complement 

(Biosource Keystone, Camarillo, CA). 

15. NaCl (5 M). 

16. 12 × 75-mm polystyrene test tubes (Becton Dickinson Labware, Franklin Lakes, NJ). 

17. FACSCalibur flow cytometer (BD Biosciences, San Jose, CA) equipped with Luminex 

Lab MAP hardware and software (Luminex Corp., Austin, TX). 

18. FlowMetrix Calibration Microspheres (Luminex Corp., Austin, TX). 

19. Quantum Fluorescence Kit for MESF units of FITC calibration particles (Sigma, St. 

Louis, MO). Add one drop from each of five separate populations of microspheres (each 

population has a different known amount of fluorescein molecules) to 1 mL of phosphatebuffered 

saline. 

20. QuickCal software (Sigma, St. Louis, MO).

Table 1 

Oligonucleotides 

Description Size (nt) Modifications Sequence *,† 

SNP 7 amplicon 188 None GTCCCAAGCT GCATGATTGC TCTTTCTCCT TCTTCCCTGA GTCTCTCTCC 

ATGCCCCTCA TCTCTTCCTT TTGCCCTCGC CTCTTCCATC CAYGTCTTCC 

AAGGCCTGAT GCATTCATAA GTTGAAGCCC TCCCCAGATC CCCTTGGAGC 

CTCTGCCCTC CTCCAGCCCG GATGGCTCTC CTCCATTT 

Forward PCR primer for SNP 7 120 None GTC CCA AGC TGC ATG ATT GC 

Reverse PCR primer for SNP 7 120 None AAA TGG AGG AGA GCC ATC CG 

cZipCode 14 with 20 nt Luciferase tag 145 5′ amino, C15 spacer CAG GCC AAG TAA CTT CTT CGG GAT TGC ACC GTC AGC ACC 

ACC GAG 

Complement to Luciferase tag 120 5′ biotin or FITC CGA AGA AGT TAC TTG GCC TG 

OLA reporter for SNP 7 114 5′ PO4, 3′ FITC GTC TTC CAA GGC CT 

OLA capture probe for C allele with 150 None CTC GGT GGT GCT GAC GGT GCA ATC CTT TTG CCC TCG CCT 

ZipCode 14 CTT CCA TCC Ac 

OLA capture probe for T allele with 150 None CTC GGT GGT GCT GAC GGT GCA ATC CTT TTG CCC TCG CCT 

ZipCode 14 CTT CCA TCC At 

SBCE capture probe with ZipCode 14 149 None CTC GGT GGT GCT GAC GGT GCA ATC CTT TTG CCC TCG CCT 

CTT CCA TCC A 

* All sequences are written 5′ to 3′. 

† The polymorphic base at the 3′ end of the OLA capture probe sequence is shown in lower case. 

126 Iannone et al.


2.2. SNP Genotyping by SBCE with Readout 

on the LX-100 Flow Cytometer 

1. Microspheres (as described in Subheading 2.1.). 

2. Template DNA (as described in Subheading 2.1.). 

3. Target Probe Primers (as described in Subheading 2.1.). 

4. Oligonucleotides (see Table 1 and Notes section): cZipCodes (as described in Subheading 

2.1.); captures (as described in Subheading 2.1.); and biotin-labeled luciferase 

complement: (Keystone Biosource, Camarillo, CA). 

5. Shrimp alkaline phosphatase (2 U/µL) (Amersham Biosciences, Piscataway, NJ). 

6. Escherichia coli Exonuclease I (10 U/µL) (Amersham Biosciences, Piscataway, NJ). 

7. 2× SBCE reaction mix: (Use 10 µL per reaction) 160 mM Tris-HCl (pH 9.0), 4 mM MgCl 2 , 

50 nM of each capture probe, 2.4 units of AmpliTaq FS (Applied Biosystems, Foster 

City, CA), 2 µM of the allele-specific biotin-labeled ddNTP (PerkinElmer Life Sciences, 

Inc., Boston, MA), and 2 µM each of the other three unlabeled ddNTPs (Amersham 

Biosciences, Piscataway, NJ). 

8. 1× SSC containing 0.02% Tween-20. 

9. Streptavidin R-phycoerythrin conjugate, 0.1 mg/mL in phosphate-buffered saline, pH 7.2 

(SA-PE, Molecular Probes, Eugene, OR). 

10. LX-100 flow cytometer (Luminex Corp., Austin, TX), equipped with an XY plate 

sampler. 

11. Instrument calibration particles for the LX-100 (CL1/CL2 and Reporter Calibrator 

Microspheres; Luminex Corp., Austin TX). 

3. Methods 

3.1. Coupling of cZipCodes to Microspheres (for Microspheres Analyzed 

on Either the FACSCalibur or the LX-100) 

1. Combine 50 µL of microspheres (2.5 × 10 6 microspheres in 0.1 M MES) with 1 µL of 

amino-modified cZipCode oligonucleotide (1 mM in water). 

2. At two separate times, add 10 µL of 30 mg/mL EDC in water to the microsphere mixture 

(at the beginning of the incubation and then after 30 min). 

3. Incubate for 60 min at room temperature with occasional mixing and sonication to keep 

the microspheres unclumped and in suspension. 

4. Add 200 µL of water containing 0.1% SDS. Vortex and centrifuge 5 min at 1100g. 

Carefully remove the supernatant. Add 200 µL of water containing 0.02% Tween 20. 

Vortex and centrifuge at 1100g. 

5. Remove the supernatant and resuspend the microspheres in 200 µL of TE and store at 

4°C (stable for 6 mo). 

3.2. Determination of cZipCode Coupling Efficiency (for Microspheres 

Analyzed on Either the FACSCalibur or the LX-100) 

1. Combine 10,000 coupled microspheres with 3 pmol of fluorescein-labeled luciferase 

complement (for microspheres to be run on a conventional cytometer) or biotin-labeled 

luciferase complement (for microspheres to be run on the LX-100) in 0.1 mL of 3.3× SSC. 

The different microsphere populations may be multiplexed at this point. 

2. Heat the microsphere suspension for 2 min at 96°C to denature any secondary structure. 

3. Incubate for 30 min at 45°C. 

4. Add 200 µL of 1× SSC containing 0.02% Tween-20. Vortex and centrifuge 3 min at 

1100g. Carefully remove the supernatant and resuspend in 300 µL of 1× SSC containing 

0.02% Tween-20.


5. For microspheres to be analyzed on the LX-100, incubate an additional 30 min with 5 µL 

of SA-PE reagent at room temperature in the dark. Analyze orange fluorescence associated 

with the microspheres on the LX-100 without washing. Effective coupling reactions 

analyzed on our LX-100 yield 2000 to 4000 mean fluorescent intensity (MFI) units. 

6. For analysis of green fluorescence associated with the microsphere populations, analyze on 

the FACSCalibur flow cytometer and convert MFI values to molecules equivalent soluble 

fluorochrome of fluorescein (MESF) (see Subheading 3.7.). Effective coupling reactions 

yield >100,000 MESF after background fluorescence contributed by the microspheres 

alone has been subtracted. The corrected MESF value will determine the number of 

molecules of cZipCode coupled per microsphere. 

3.3. Generation of Target Probes by PCR Amplification 

(for Either OLA or SBCE) 

1. In a Polyfiltronics 96-well plate, amplify 10 to 20 ng of genomic DNA per well in 15- to 

30-µL reaction volumes. Each PCR reaction should contain 1.5 units of AmpliTaq Gold, 

400 µM dNTPs, 200 µM forward PCR primer, and 200 µM reverse PCR primer in 1× PCR 

buffer I (Applied Biosystems, Foster City, CA). PCR amplifications are uniplexed. 

2. Set the thermal cycler to heat 10 min at 95°C min to activate the DNA polymerase, 

followed by 40 three-temperature amplification cycles holding at 94, 60, and 72°C for 30 s 

each and ending with an additional 5-min extension at 72°C. 

3. Hold samples at 4°C following completion of the reaction. 

3.4. OLA 

1. Incubate the following in a total volume of 10 µL: 1× ligase buffer, 0.1 pmol of each 

capture oligonucleotide, 5 pmol of each reporter oligonucleotide, 3 to 20 ng of each 

dsDNA target probe (as determined by Picogreen staining, Molecular Probes, Eugene, 

OR), and 10 U Taq DNA ligase. Ligation reactions are multiplexed. 

2. Incubate in a thermal cycler by heating to 96°C for 2 min, followed by 30 cycles of a 

two-step reaction (denaturation at 94°C for 15 s followed by ligation at 37°C for 1 min). 

3. Hold samples at 4°C when the cycles are complete. 

3.5. Hybridization of Capture Probes to Microspheres after OLA 

1. Add cZipCode-coupled microsphere populations (5000 microspheres of each population) 

to the ligation reaction (microsphere populations are combined at this step). 

2. Adjust the salt concentration to 500 mM NaCl by adding a small volume of 5 M NaCl. 

3. Heat the mixture to 96°C for 2 min in a thermal cycler and incubate at 45°C from 2 h 

to overnight. 

4. Wash microspheres with 200 µL of 1× SSC containing 0.02% Tween-20 by centrifuging 

at 1100g for 5 min. 

5. Resuspend the microsphere suspensions in 300 µL of 1× SSC containing 0.02% Tween-20 

just before flow cytometric analysis. 

3.6. Flow Cytometric Analysis of Microspheres Hybridized 

to OLA Products on the FACSCalibur 

1. Transfer the microsphere suspensions to 12 × 75-mm polystyrene test tubes. 

2. Optimize the settings on the flow cytometer to analyze the microspheres using FlowMetrix 

Calibration Microspheres in conjunction with Luminex software. 

3. Acquire a minimum of 100 microspheres from each population per tube. 

4. Analyze a separate tube of calibration particles (Quantum Fluorescence Kit for MESF 

units of FITC) using the same instrument settings.


3.7. Analysis of FACSCalibur Data 

1. Convert all green fluorescence measurements from MFI to MESF by either manually 

creating a calibration curve from the fluorescent intensities of the calibration particles 

or by using QuickCal software. 

2. Adjust raw MESF values by subtracting the microsphere alone control MESF values 

to eliminate microsphere-contributed background fluorescence. This is necessary, because 

each microsphere population in the 64-microsphere set emits a small amount of fluorescence 

in the green reporter channel. Microsphere corrections range from 1000 to 

30,000 MESF, depending on the microsphere population. 

3. To adjust for tube-to-tube variability in the wash step, one may include a microsphere 

population with no cZipCode attached. Subtract the adjusted MESF (as described previously) 

of this negative control microsphere from the MESF of every microsphere type in 

that particular tube to normalize the data. 

4. Merge the data from the two corresponding alleles and graph the results as x-y coordinates. 

3.8. SBCE 

1. PCR amplification of target probes is performed as described in Subheading 3.3. 

2. To degrade the excess PCR primers and dNTPs before the SBCE assay, add 1 unit of 

shrimp alkaline phosphatase and 2 units of E. coli Exonuclease I directly to 10 µL 

of pooled PCR products (10 to 20 ng of each amplicon) and mix thoroughly. 

3. Incubate at 37°C for 30 min and then for 15 min at 80°C to inactivate the enzymes. 

4. For each SNP, set up similar reactions differing only by the choice of labeled ddNTP. 

Add 10 µL of pooled, treated PCR products to 10 µL of SBCE reaction mix (160 mM 

Tris-HCl, pH 9.0; 4 mM MgCl 2 ; 50 nM of each capture probe; 2.4 units of AmpliTaq 

FS; 2 µM of the allele-specific biotin-labeled ddNTP; and 2 µM each of the other three 

unlabeled ddNTPs). 

5. Denature the reactions at 96°C for 2 min and follow with 30 amplification cycles at 94°C 

for 30 s, 55°C for 30 s, and 72°C for 30 s. 

6. Hold reactions at 4°C. 

3.9. Hybridization of Capture Probes to Microspheres after SBCE 

1. To the wells of a standard 96-well microtiter plate in a total volume of 30 µL, add 1000 

of each cZipCode-coupled microsphere population to 20 µL of SBCE reaction mixture. 

Adjust salt concentration to 500 mM NaCl and 13 mM EDTA. 

2. Incubate the mixture at 40°C for 1 h. 

3. Wash the microspheres with 150 µL of 1× SSC containing 0.02% Tween 20. 

4. Centrifuge for 5 min at 1100g and remove the supernatants. 

5. Resuspend microspheres in 60 µL of 1× SSC containing 0.02% Tween 20. 

6. Add 5 µL of SA-PE to the microsphere-hybridized SBCE reaction products. 

7. Incubate the mixture for 30 min at room temperature. 

3.10. Flow Cytometric Analysis on the LX-100 and Data Analysis 

1. Optimize the settings on the LX-100 to analyze the microspheres using Luminex calibration 

particles in conjunction with Luminex software. 

2. For each microtiter well, analyze a minimum of 30 microspheres of each population. 

3. Adjust the raw MFI values for microsphere background fluorescence by subtracting microsphere 

alone control MFI values from the MFI value of each corresponding microsphere sample. 

This is necessary because each microsphere population in the 100-microsphere set emits 

a small amount of fluorescence into the orange reporter channel. Microsphere corrections 

range from 1 to 100 MFI, depending upon the microsphere population.


4. To adjust for well-to-well variability in the wash step, each well may contain a microsphere 

population with no cZipCode attached. Subtract the adjusted MFI (as described above) 

of this negative control microsphere from the MFI of every microsphere type in that 

particular well. 

5. Merge the data from the two corresponding alleles and graph the results as x-y coordinates. 

4. Notes 

1. Oligonucleotide probes for OLA: (1) cZipCodes. We have designed our 58 different 

cZipCode sequences to include: (a) 5′ amine group, an 18-atom spacer (CH 3 CH 2 O) 6 

to minimize any potential interactions between the oligonucleotide sequence and the 

microsphere surface; (b) a common 20-base sequence from luciferase cDNA (5′-CAG 

GCC AAG TAA CTT CTT CG-3′) to test for oligonucleotide coupling efficiency; and 

(c) a 25-base, non-crossreacting cZipCode sequence derived from the Mycobacterium 

tuberculosis genome (7,8) to link each allele of SNP to a particular microsphere population. 

The cZipCode sequences have GC-contents between 56 and 72% and predicted Tm values 

of 61 to 68°C. Although this chapter does not outline the methodology, biotinylated 

cZipCodes may be coupled to Lumavidin-coated microspheres. (2) Reporters. These 

oligonucleotides are designed to hybridize to the target sequence immediately downstream 

of the capture probe. They are generally 8 to 20 bases in length and contain a 5′ phosphate 

group and a 3′ fluorescein modification. The phosphate group is required as a substrate 

for the ligase enzyme. Reporter probe Tm range from 36 to 40°C. (3) Captures. The 5′ 

end of each capture probe contains a 25-nucleotide ZipCode sequence and the 3′ end 

contains a 20 to 25 base target-specific sequence that extends to the polymorphic base. 

This orientation insures optimal ligase fidelity (12,13). Because each SNP has a minimum 

of two polymorphic bases, each SNP will require at least two different OLA capture 

probes. If the alleles are assayed in the same reaction volume, these capture probes will 

also require different ZipCode sequences. Target-specific capture sequences have a Tm 

of 51 to 56°C. (4) Fluorescein-labeled luciferase complement. A 5′ fluoresceinated oligo 

complementary to the 20 nucleotides of luciferase sequence in each cZipCode. 

2. We have found that only 58 of the 64 red–orange populations Luminex provides could be 

run on our FACSCalibur with the Luminex software. The number of useable populations 

of microspheres may vary depending upon the cytometer model being used. We have used 

all 100 microsphere populations on the LX-100. 

3. We have successfully multiplexed over 50 SBCE reactions. 

4. Oligonucleotide probes for SBCE: (1) cZipCodes (same as OLA); (2) Captures. Similar to 

OLA captures with the exception that target-specific component of SBCE capture probes 

is designed to stop just short of the polymorphic base. For SBCE, each SNP will require 

only one capture probe. Different alleles are assayed in different reaction volumes. Each 

volume will have a different biotin-labeled ddNTP plus the other three unlabeled ddNTPs. 

(3) Biotin-labeled luciferase complement. A 5′ biotin-modified oligo complementary to 

the 20 nucleotides of luciferase sequence found in each cZipCode. 

5. Figure 2 shows representative SNP genotyping results from approx 100 patients for 6 A/G 

SNPs analyzed by SBCE on the LX-100. Homozygous and heterozygous clusters are 

readily discernible. 

Fig. 2. (see facing page) SNP genotyping by SBCE with analysis on the LX-100. SNP 

genotyping results from approx 96 patients for 6 A/G SNPs. Biotinylated ddNTPs were used 

(one plate for G alleles, one for A alleles) followed by incubation with SA-PE. The results shown 

come from an experiment where 35 SNPs were genotyped in two microtiter plates. The points in 

the lower left corner represent either negative controls or failed PCR reactions.


131


6. Target concentration has a direct impact on signal intensity. Each panel in Fig. 2 includes 

one negative control point. Additional points shown in the lower left are most likely the 

result of PCR failure. 

7. High salt concentrations help hybridization efficiency. However, we have found that 

when analyzing samples on the LX-100, salt concentrations ≥400 mM result in optical 

disturbances. This may be caused by the different refractive indices of the high ionic 

strength core stream and the low ionic strength sheath fluid (14). 

8. We have reserved one microsphere population and its associated cZipCode for use 

with an SBCE positive control. Each SBCE reaction includes a short (40mer) synthetic 

oligonucleotide target with a 4-fold degenerate position near its center and a complementary 

capture probe to insure incorporation of reporter signal for any nucleotide assayed. Use 

of this positive control in every SBCE assay well provides an excellent internal standard 

to assess well-to-well reaction variability and can be used to normalize signal intensities 

generated across a plate of 96 samples (14). 

9. We have also used Rhodamine-6G (R6G)-labeled ddNTPs with the SBCE system on the 

LX-100. Although using this directly coupled fluorochrome saves an additional wash and 

incubation step, the fluorescent intensities were not as bright as PE. This is not unexpected 

since the quantum efficiency of PE is much better than R6G. 

10. Genotyping by OLA permits allele multiplexing and has no requirement for shrimp 

alkaline phosphatase and Exonuclease I pretreatment of PCR target probes. The advantage 

of SBCE is that only one capture probe is required for each allele, thus saving on costs. 

The accuracy of genotyping using OLA or SBCE is >99% (7,8). 

11. The inclusion of the detergent Tween 20 in the buffer helps reduce the loss of microspheres 

during wash steps. 

12. Because the LX-100 uses a dual-laser system for microsphere identification and reporter measurement, 

spectral compensation is not required on the LX-100 as on the FACSCalibur. 

13. Our current automated genotyping facility uses SBCE with 52 microsphere populations. 

Enhanced throughput may be realized by incorporating multiplexed PCR amplifications. 

14. Conversion of MFI to MESF, although not required, offers several advantages. These 

advantages include (1) the use of a standard fluorescence unit; (2) the ability to compare 

data between experiments and instruments; and (3) normalization of signal variability in an 

instrument over time (caused by laser power shifts or PMT decline). Although not outlined 

in this chapter, data from the LX-100 may also be converted to MESF using calibration 

microspheres for PE. We have used QuantiBRITE PE beads from BD Biosciences for 

this purpose. 

15. Although this chapter focuses on the use of Luminex microspheres for multiplexed analysis, 

there are other products available for developing multiplexed assays using a conventional 

bench-top flow cytometer such as the FACSCalibur (see http://www.spherotech.com, 

http://www.bangslabs.com). These products use one fluorescent parameter for the identification 

of the microsphere populations and have a more limited level of multiplexing. For 

manual acquisition of multiplexed assays on a conventional bench-top cytometer, (1) make 

sure microspheres can be seen in forward versus side scatter and gate to exclude doublets; 

(2) set the PMTs of fluorescent parameters to log acquisition; (3) adjust the PMT settings 

of fluorescent parameters so that unstained and brightly stained microspheres are not offscale; 

and (4) adjust compensation settings to subtract reporter fluorescence from the other 

fluorescent channels. When properly compensated, microsphere populations with bright 

reporter staining will not move out of the regions that identify their population. 

16. Microsphere-based SNP genotyping by OLA or SBCE is an accurate and rapid method 

for the analysis of SNPs.


References 

1. Landegren, U., Nilsson, M., and Kwok, P. Y. (1998) Reading bits of genetic information: 

Methods for single-nucleotide polymorphism analysis. Genome Res. 8, 769–776. 

2. Cooper, D. N., Smith, B. A., Cooke, H. J., Niemann, S., and Schmidtke, J. (1985) An 

estimate of unique DNA sequence heterozygosity in the human genome. Hum. Genet. 

69, 201–205. 

3. Marshall, E. (1999) Drug firms to create public database of genetic mutations. Science 

284, 406– 407. 

4. Abravaya, K., Carrino, J. J., Muldoon, S., and Lee, H. H. (1995) Detection of point 

mutations with a modified ligase chain reaction (Gap-LCR). Nucleic Acids Res. 23, 

675–682. 

5. Syvanen, A. C. (1999) From gels to chips: “Minisequencing” primer extension for analysis 

of point mutations and single nucleotide polymorphisms. Hum. Mutat. 13, 1–10. 

6. Syvanen, A. C., Aalto-Setala, K., Harju. L., Kontula, K., and Soderlund, H. (1990) A 

primer-guided nucleotide incorporation assay in the genotyping of apolipoprotein E. 

Genomics 8, 684–692. 

7. Iannone, M. A., Taylor, J. D., Chen, J., Li, M.-S., Rivers, P., Slentz-Kesler, K. A., et al. 

(2000) Multiplexed single nucleotide polymorphism genotyping by oligonucleotide ligation 

and flow cytometry. Cytometry 39, 131–140. 

8. Chen, J., Iannone, M. A., Li, M-S., Taylor, J. D., Rivers, P., Nelson, A. J., et al. (2000) A 

micropshere-based assay for multiplexed single nucleotide polymorphism analysis using 

single base chain extension. Genome Res. 10, 549–557. 

9. Fulton, R. J., McDade, R. L., Smith, P. L., Kienker, J. J., and Kettman, J. R. (1997) Advanced 

multiplexed analysis with the FlowMetrix system. Clin. Chem. 43, 1749–1756. 

10. Kettman, J. R., Davies, T., Chandler, D., Oliver, K. G., and Fulton, R. J. (1998) Classification 

and properties of 64 multiplexed microsphere sets. Cytometry 33, 234–243. 

11. McDade, R. L. and Fulton, R. L. (1997) True multiplexed analysis by computer-enhanced 

flow cytometry. Med. Dev. Diag. Indust. 19, 75–82. 

12. Husain, I., Tomkinson, A. E., Burkhart, W. A., Moyer, M. B., Ramos, W., Mackey, Z. B., et 

al. (1995) Purification and characterization of DNA ligase III from bovine testes. Homology 

with DNA ligase II and vaccinia DNA ligase. J. Biol. Chem. 270, 9683–9690. 

13. Luo, J., Bergstrom, D. E., and Barany, F. (1996) Improving the fidelity of Thermus 

thermophilus DNA ligase. Nucleic Acids Res. 24, 3071–3078. 

14. Taylor, J. D., Briley, D., Nguyen, Q., Long K., Iannine, M. A., Li, M. S., et al. (2001) 

Flow cytometric platform for high-throughput single nucleotide polymorphism analysis. 

Bioechniques 30, 661–669.

134 Iannone et al.

Ligase Chain Reaction 135 

25 

Ligase Chain Reaction 

William H. Benjamin, Jr., Kim R. Smith, and Ken B. Waites 


The ligase chain reaction (LCR) is one of many techniques developed in recent years 

to detect specific nucleic acid sequences by amplification of nucleic acid targets. The 

LCR has been used for genotyping studies to detect tumors and identify the presence 

of specific genetic disorders such as sickle cell disease caused by known nucleotide 

changes that occur as a result of point mutations and has now become widely used 

in infectious disease detection, both in the diagnostic and research settings, primarily 

focusing on infections caused by microbes that have proven difficult to detect by 

traditional culture techniques. The LCR is now recognized as the method of choice 

for detection of urogenital infections due to Chlamydia trachomatis because of its 

greater sensitivity as compared to traditional cell culture or nonamplified DNA probes 

or antigen-detection assays. Other uses of the LCR have also been reported (1–8). When 

used for detection of infectious diseases, amplification tests such as the LCR have the 

additional advantages in that they do not require viable organisms in a specimen, a 

single specimen can be used to detect multiple different pathogens, provided suitable 

primers are available, and easily obtained specimens such as urine can be used for 

diagnostic purposes, making screening of large numbers of persons practical, as well as 

facilitating research to better understand the epidemiology of specific diseases. 

Ligation of adjacent oligonucleotides while hybridized to a template was first 

investigated by Besmer et al. in 1972 (9). The first use of ligases to join oligonucleotides 

as a means to differentiate sequence variants was reported in 1988 (10,11) and the first 

“real” LCR utilizing cyclical denaturation hybridization and ligation of two pairs of 

oligomers was described in 1989 (12). Thermostable ligases that eliminate the necessity 

of adding ligase after each denaturation step were introduced by Barany in 1991 (1). 

Simple LCR consists of two complementary oligonucleotide pairs (four oligonucleotides 

20–35 nucleotides each) that are homologous to adjacent sequences on the 

target DNA, as opposed to two used in the polymerase chain reaction (PCR) assay. 

The adjacent pairs are ligated when they hybridize to the complementary sequence 

next to each other in a 3′ to 5′ orientation on the same strand of the target DNA. 

The 5′ nucleotide of the ends of the primers to be ligated must be phosphorylated. 

Newly ligated oligonucleotides become targets in subsequent cycles so logarithmic 



135

136 Benjamin, Smith, and Waites 

amplification occurs. The two complementary pairs can also, at low frequency, be blunt 

end ligated to each other and serve as template for amplification even though no target 

sequence was present in the original sample. Early work showed at least 10-fold greater 

efficiency of ligation of perfectly matched compared to a mismatched nucleotide at 

the ligation junction (1,8,12). 

LCR-based systems have some advantages over the PCR-based amplification systems. 

Because there is no newly synthesized DNA, misincorporated nucleotides are not 

replicated in the product allowing amplification of a different sequence than that found 

in the target nucleic acid. The LCR reactions are also more specific for the 3′ nucleotide 

allowing for higher discriminatory power against mismatches at a single chosen site (1,3). 

Thus, LCR is very useful for determining the nucleotide at a specific site such as a single 

base change, e.g., single-nucleotide polymorphisms (SNPs) used in mapping complex 

genomes. The LCR cycle has only two short steps allowing for shorter amplification 

times. The usually small target of LCR, 36 to 60 nucleotides, does not require highquality 

large fragment nucleic acids (13). The commercial LCR kit, the Abbott LCx 

System (Abbott Diagnostics, Abbott Park, IL, USA) is less affected by inhibitors in some 

specimens, such as fresh urines compared to PCR (14). However, the LCR is still subject 

to contamination that is at least as much of a problem as for the PCR. 

There are several modifications to the simple LCR that have been used to overcome 

some of the problems that are inherent in this method. Owing to the specificity of the 

ligase reaction for perfect matches that is complicated by the blunt end ligation of 

double stranded probes PCR, the Ligase Detection Reaction (LDR) was developed 

(15). The amplification step for LDR is PCR using outside primers, then only one 

pair of adjacent primers is used to detect the proper sequence in the PCR product 

(1,7). Because there are no double stranded oligonucleotides to blunt end ligate, the 

background is very low and the linear detection of the PCR amplified sequence can 

be detected using ligation of oligonucleotides. Gap LCR utilizes a few base pair gaps 

between the two pair of oliogonucleotides on the primer, thus requiring a thermostable 

polymerase (Taq polymerase) to fill in the gap before ligation of adjacent primers can 

occur. The Gap LCR prevents amplification of the blunt end ligated primers because the 

oligonucleotide pairs cannot be amplified on blunt end ligated products (16,17). 

1.1. Ligase 

There are four thermostable ligases that can be used in LCR reactions. Taq ligase 

was the first described and is commercially available from New England Biolabs 

(www.uk.neb.com/neb/index.html) (Beverly, MA). Stratagene (www.stratagene. 

com) (La Jolla, CA) produces Pfu which is advertised as having higher ligation 

specificity and lower background than Tth that is marketed by Abbott Diagnostics 

(www.abbottdiagnostics.com) (Abbott Park, IL) and is used in their LCx diagnostic kit. 

Amplicase is sold by Epicenter Technologies (www.epicentre.com) (Madison, WI). 

1.2. Probe Design 

The most successful probes are 18 to 30 bases in length. Probes with high GC 

content or those that form stable secondary structures or dimers should be avoided 

if possible. It is difficult to predict activity, so empiric testing is still necessary (18). 

The 5′ nucleotide of the adjacent end must be phosphorylated to promote ligation.


The probe candidates must be tested for sensitivity by determining the lower level of 

detection of samples containing organisms of interest or their DNA. Specificity must 

be determined by testing related organisms, as well as other organisms likely to be 

found in specimens to be tested. 

1.3. Target Sequence Selection 

The sequence should be unique to the organism to be detected and multiple copies 

per organism increases sensitivity. If the ligase reaction is to be used to discriminate 

between single base pairs, the ultimate 3′ base is most sensitive, whereas the 5′ base 

is also relatively sensitive. Allele-specific PCRs used to detect single nucleotide 

polymorphisms are often not discriminating enough to differentiate between SNPs, 

whereas the ligase reactions are more discriminating against mismatches, especially 

on either side of the ligation site (1). All of the possible mismatches are discriminated 

against, but G-T and T-T less well, 1.5% as efficient as the matching nucleotide, while 

other mismatches were 80%. When the mismatch was 

on the 5′ side the previous two and A-C, A-A, C-A, G-A and T-T, all were all less 

discriminated against than when on the 3′ side, same patterns as were found with T4 

ligase. Intentionally introducing a mismatch in the third site from the 3′ end of the 

probes increased the discriminating power. Nucleotide analogs in the probes in the 

2 and 3 location from the 3′ end also increased discriminatory power. Site-directed 

mutagenesis was used on Tth and mutants that increased discriminating power 4- and 

11-fold were found by Luo et al. (3). 

1.4. Detection of Amplification Products 

Multiplex LCR using a mixture of probes differing by the 3′ nucleotide involved 

in the ligation, that are labeled by being one or two extra bases on the nonligating 

5′ end, allows polyacrylamide gel electrophoresis (PAGE) differentiation of the one 

or two base changes by differences in migration in PAGE (1). The probes can also be 

labeled with several different, easily detected labels such as: 32P, fluorescent labels, 

immunologically detectable haptens (digoxigenen), (Roche Molecular Diagnostics, 

Indianapolis, IN) and after amplification and electrophoresis the signal is detected 

by Southern blot to determine if ligation has taken place. Ligated products can also 

be detected by having immuno-capture of one of the probe ends and after washing, 

detecting the second probe with an enzyme conjugate. Only ligated product will be 

captured and also have the end with the ligand for which the enzyme conjugated 

antibody is specific, IMx (Abbott) utilizes this method. The latter method is also 

employed in the commercially sold Abbott LCx for C. trachomatis and N. gonorrhoeae. 

The comparison of eight different nonradioactive methods of detecting the LCR 

products was reported by Winn-Deen (19). 

1.5. Contamination Control 

One problem with LCR is that the target is amplified, resulting in a contamination 

risk. The method commonly used to inactivate PCR products does not work because of


the small size of the amplicon in LCR. The potential for contamination requires strict 

adherence to physical separation of setup and detection areas and other containment 

methods such as bleach treatment of lab benches, Ultraviolet irradiation of setup areas, 

unit premixes for setup, as well as use of aerosol barrier pipet tips. The commercial 

LCx instrument injects a binary inactivating agent that is capable of inactivating small 

amplicons by a factor of up to 109. 

1.6. Inhibitors 

LCR is less prone to problems with inhibitors from urogenital specimens than PCR 

for detection of Chlamydia (14,20). Freeze-thawing and dilution decreased the falsenegative 

rate of PCR (21). Possible inhibitors of LCR were removed by a mildly acid 

wash to remove CaHPO4 from concentrated specimens being tested for the presence of 

acid fast bacteria (22). Potential effect of inhibitors on amplification results mandates 

rigorous quality control for all steps of the procedure as described in the technical 

procedures presented here. 

1.7. LCR Applications 

1.7.1. Noncommercialized Methods 

Over the past few years, numerous publications have appeared that describe a 

number of potential applications of the LCR procedure, each with its own particular 

modifications of the basic procedure, using the varied available ligases, probe designs, 

relative positions, and detection methods. Table 1 shows references and lists the 

methods used for several diverse applications. A basic LCR procedure that can be 

adapted to detect nucleic acid of a variety of etiologic agents as well as eukaryotic 

polymorphisms, especially SNPs, is presented in further detail in Subheading 2. 

1.7.2. Commercially Available LCR Kits* 

As an artifact of the way the companies interested in molecular diagnostics have 

carved up the field, mostly driven by the ownership of rights to specific procedures, 

in the United States, LCR is primarily used to diagnose the sexually transmitted 

diseases caused by C. trachomatis and N. gonorrhoeae. Abbott Diagnostics markets 

a commercial LCR kit, the LCx, in which four oligonucleotide probes target and 

hybridize with a specific complementary single-stranded nucleotide sequence within 

the multicopy cryptic plasmid gene present in all serovars of C. trachomatis that is 

exposed during sample preparation in which the heating process causes the release 

of single-stranded DNA, leaving a gap of a few nucleotides between the probes (23). 

Polymerase then fills the gap with nucleotides in the LCR reaction mixture. Once 

the gap is filled, thermostable ligase covalently joins the pair of probes to form an 

amplification product that is complementary to the original target sequence that then 

serves as an additional target sequence for further rounds of amplification. Amplification 

occurs when the LCR reaction mixture and sample are incubated in a thermal 

cycler. During thermal cycling, the temperature is raised above the melting point of 

*Abbott Diagnostics, which marketed the LCx Uriprobe that was FDA approved in 1994, is to be 

discontinued in June 2003 and after that time no commercial kits will use the LCR technology.


the hybridized amplification product causing it to dissociate from the original target 

sequence. Lowering the temperature allows more of the oligonucleotide probes to 

hybridize to the targets now available and to be ligated. The temperature continues to 

be cycled until sufficient numbers of target amplification product have accumulated. 

Ligated product is captured by antibody immobilized onto the surface of microparticles 

using a ligand attached to the end of one primer and then detected by an enzymeconjugated 

antibody directed at a second reporter molecule at the distal end of the 

other primer. Only ligated product with both haptens covalently attached will generate 

a chemiluminescent signal. The amplification product accumulates exponentially and 

is detected by chemiluminescence on the automated Abbott LCx or IMx Analyzers. 

Specimens that can be used include cervical swabs and urethral swabs as well as urine 

from either men or women (24–26). The LCx kit also has the advantage of being 

multiplexed for the detection of N. gonorrhoeae in the same genitourinary specimen. 

The LCx target in N. gonorrhoeae is a 48 base pair DNA sequence in the multicopy Opa 

gene that is conserved in all strains studied to date and is specific to N. gonorrhoeae. 

There are mixed results on the sensitivity of LCx compared to other methods of 

amplification for detection of urogenital infections. One report found PCR more 

sensitive than LCx. (27), whereas a second study found LCx more sensitive (28). Stary 

et al. compared the sensitivity and specificity of LCx and the Transcription Mediated 

Amplification (TMA) assay (GenProbe, Inc., San Diego, CA) using several different 

urogenital specimens. They found comparable results with endocervical and vulval 

swab samples, male urethral swabs and urine, but found a lower sensitivity with the 

TMA method for female first void urine (29). Carroll et al. found the overall sensitivity 

of LCx was better than GenProbe PACE 2 for chlamydia with very good specificity 

for both (30). 

Abbott Diagnostics also makes a Mycobacterium (M.) tuberculosis LCx kit that is 

approved for diagnostic use in some European countries but not in the United States 

at present. This product is a Gap LCR assay with a few nucleotides that must be filled 

before ligation. It targets the protein antigen b genes of M. tuberculosis. This LCx 

kit has been evaluated in comparison to culture and/or other amplification methods 

such as the Roche PCR and the TMA with generally favorable results. Overall, most 

evaluations have found the LCx to perform better for detection of M. tuberculosis in 

smear-positive as opposed to smear-negative respiratory specimens (31–34). However, 

one investigation (35) found similar high sensitivity and specificity values for the LCx, 

exceeding 90% for smear-positive as well as smear-negative specimens, suggesting 

that the LCx assay has potential utility as a screening test for the rapid diagnosis of 

tuberculosis in high-risk patients. 

2. Materials 

2.1. Equipment 

1. Microcentrifuge capable of speeds of ≥9000g. 

2. Vortex mixer. 

3. 20°C freezer for sample storage if not processed immediately. 

4. LCx Analyzer or other detection system with appropriately labeled reagents specific for 

the system employed. 

5. LCx Thermocycler. 

6. LCx dry bath capable of heating from 60° to 100°C.


2.2. Supplies and Reagents 

1. LCx kit (if commercial assay is being used, otherwise individual components as listed 

in Table 1 and Steps 2–9). 

2. Taq ligase or other type as described in Subheading 1.1. with appropriate buffers from 

same supplier. 

3. Custom probes with primers chosen according to criteria outlined in Subheadings 1.2. 

and 1.3. 

4. Proteinase K (final concentration 200 µg/ml). 

5. Mineral oil. 

6. Specimen or analyte. 

7. Specimen Collection and Transport System (Uriprobe) containing 0.5 ml transport buffer. 

8. Sterile, preservative-free plastic screw-top containers for collection and transport of 

specimen (if using commercial LCx). 

9. 100 µL aerosol barrier pipet tips and pipets. 

3. Methods 

3.1. Procedural Precautions 

1. Work in laboratory using DNA amplification methods should always flow in a one-way 

direction beginning in the specimen preparation and processing area (Area 1), then moving 

to the amplification and detection area (Area 2). Do not bring any materials or equipment 

from Area 2 into Area 1. 

2. Surface cleaning using a 1% (v/v) sodium hypochlorite solution followed by 70% (v/v) 

ethanol should be performed on bench tops and pipets prior to beginning the LCR Assay. 

3. Chlorine solutions may pit equipment and metal. Use sufficient amounts or repeated 

applications of 70% ethanol until chlorine residue is no longer visible. 

3.2. Prototype LCR Technique for Detection of Neisseria gonorrhoeae 

The type of materials required for LCR assays varies greatly according to the ligase, 

amplification, and detection systems used, as well as the primers required that must be 

specific for the desired target. Table 1 summarizes major types of LCR procedures and 

the various materials and equipment needed to perform the assays, including primers, 

ligases, buffers, templates, test conditions, targets, and detection systems. A more 

detailed description of the Neisseria gonorrhoeae detection LCR that was eventually 

modified and incorporated into the Abbott LCx system is described in Subheadings 

3.2.1.–3.3.9. These methods were originally developed by Birkenmeyer and Armstrong 

and described in 1992 (36). Although this procedure was developed specifically for the 

detection of N. gonorrhoeae DNA, the basic principle can be adapted for the detection 

of other microbial agents, provided specific oligonucleotide primers are designed. 

3.2.1. Primer Selection 

1. Primers should be designed to be homologous to conserved sequences in N. gonorrhoeae 

that have mismatches with N. meningitidis, the species most homologous to N. gonorrhoeae. 

Because of the empiric nature of developing LCR, multiple primer sites should be 

developed. The site demonstrating the best sensitivity and specificity should be chosen and 

this must be validated as described previously in Subheading 1.2. In the example given, 

three sites were chosen corresponding to sequences immediately upstream of several of 

the opa gene family (Opa-2 and Opa-3) and a site downstream of several of the pil gene 

family (Pilin-2) (36).

Table 1 

Examples of Various Applications and Methods for the Ligase Chain Reaction 

References Barany (1) Jurinke (2) Khanna (5) Abravaya (38) Day (7) Reyes (8) 

Wilson (37) Luo (3) 

Zirvi (6) 

Ligase Taq 15 U Pfu 4 U Tth 25 fmol Tth 5000 U Tth 10 U Amplicase 1.5 U 

Buffers 20 mM/7.6 20 mM/7.5 20 mM/7.6 10 mM/7.5 20 mM/8.3 

Tris 

EPPS 50 mM/7.8 

KCl 100 mM 20 mM 100 mM 20 mM 50 mM 25 mM 

MgCl 2 10 mM 10 mM 10 mM 30 mM 10 mM 10 mM 

NaCl 400 mM 

EDTA 

1 mM 

NAD+ 10 mM 1 mM 10 µm 0.5 mM 

DTT 10 mM 1 mM 10 mM 

NP-40 0.10% 

Triton X-100 0.01% 

Primers 40 fmol 3.3 pmol 500 fmol (38) 30 nm 600 fmol 3.6 nm 

Template 1 fmol (1); 0.74 fmol 500 fmol (3); 100 molecules 10–100 ng 250 ng 

6–60 µg (37) 100 fmol (5); in 500 ng genomic 

50 fmol (6) DNA 

Conditions 

Denaturation 94°C, 1 min 92°C, 20 sec 94°C, 15 sec 85°C, 30 sec 95°C, 15 sec 91°C, 30 sec 

Lgation 64°C, 4 min 60°C, 40 sec 65°C, 4 min 60°C, 30 sec 65°C, 4 min 55°C, 6 min 

No. cycles 20–30 25 20 25 5 (LDR) a 27 

Target Sickle cell mutation E. coli lacI Human eIF-4E (3); HIV AZT-resistant Human gene Sickle cell 

(1); p53, Ha-ras (37) K-ras (5); human mutants; Chlamydia CYP21 mutation 

microsatellites (6) cryptic plasmid 

Differential Size-labeled primers Size-labeled Fluorescent-labeled Microparticles Size-labeled Arbitrary 

detection (1); 32 P label (37) primers; primers; coated with primers; sequence on 

matrix-assisted microparticles anti-hapten; sandwich fluorescent primer for 

laser coated with immunoassay labeled capture 

desorption/ anti-hapten performed primers; detection hybridization; 

ionization using the Abbott in Perkin–Elmer biotinylated 

time-of- IMx automated GeneScan primer 

flight-mass analyzer sequencing system streptavidinspectrometry 

alkaline 

phosphatase 

conjugate 


a Ligase detection reaction uses ligase chain reaction to detect previously amplified product.


2. The primers for this technique are designed to have a gap of 4 to 5 Gs that would be 

filled by adding the single deoxynucleotide dGTP and Taq polymerase that would not add 

more nucleotides than are needed to fill the gap. The Pilin-2 locus has 6 bp of nontargeted 

DNA added to one end that are complementary to the related primer. 

4. The ends of the primers are labeled with fluorescein on one pair of homologous primers (one 

5′ one 3′) and biotin on the other nonligating ends of the other two primers. The sequences 

of the primers are described in the original publication describing this technique (36). 

5. The ligating 5′ ends are phosphorylated to facilitate ligation after the gap is filled. 

6. All of the modifications of the oligonucleotides can be ordered from numerous companies 

that will custom synthesize oligonucleotides for specific purposes and targets. 

3.2.2. Clinical Specimens 

1. The type of specimen should be chosen according to the site that the organism is most likely 

to be detected in association with disease. For N. gonorrhoeae, urethral or endocervical 

swabs are collected and placed into 500 µl of specimen buffer containing 50 mM EPPS 

buffer [N-(2-hydroxyethyl)piperazine-N′-(3-propanesulfonic acid)] and 5 mM EDTA 

(pH 7.8). The tube can be maintained up to 24 to 48 h at room temperature if necessary 

for transport to the laboratory. The swabs are vigorously vortexed prior to removal and the 

sample is then frozen at -20°C until DNA extraction. 

2. Organism lysis to release DNA is accomplished by adding proteinase K to a final 

concentration of 200 µg/ml and incubating for 1 h at 60°C. 

3. Boiling for 10 min inactivates the proteinase K, further lyses the bacteria and denatures 

the DNA. 

4. The cell debris is pelleted by centrifuging for 10 min at 4°C at 13,000g. 

5. The supernatants can be stored at –20°C until used. 

3.2.3. Amplification and Detection 

1. Each 50 µl amplification mixture will contain 4 µl of sample, and a final concentration of: 

20 mM Tris-HCl (pH 7.6 @25°C) 25 mM potassium acetate, 10 mM magnesium acetate, 

10 mM DTT, and 1 mM NAD and 0.1% Triton X-100. This buffer supplied as 10X the 

concentrations needed can be purchased commercially (New England Biolabs, Beverly, 

MA) along with the Taq ligase. 

2. Each of the four oligonucleotides within a set should be diluted in advance and the 

appropriate volumes of each added to obtain the 830 fmol of each of the four in a set 

in each reaction tube. 

3. This mixture is overlaid with sterile mineral oil and heated for 3 min in a boiling water 

bath to ensure complete denaturation. After cooling, 1 unit of Amplitaq DNA polymerase 

(Perkin-Elmer Cetus, Norwalk, CT) and 15 units of Thermus aquaticus (Taq) DNA ligase 

(New England Biolabs) is added. 

4. A positive control consisting of 270 cell equivalents of N. gonorrhoeae DNA in 80 ng/µl 

human placental DNA (Sigma Chemicals, Saint Louis, MO) and a negative control must 

be included in each run. 

5. Gap LCR is performed in a thermocycler. The prototype technique for N. gonorrhoeae 

used 27 cycles (Opa-2), 33 cycles (Opa-3) or 31 cycles (Pilin-2). Each cycle consists of a 

denaturation step 85°C for 30 s and a hybridization, gap filling, ligation step of 60°C for 

Opa-2 and Pilin-2 and 53°C for Opa-3) for 1 min. When developing a new LCR procedure 

it is necessary to empirically test different numbers of cycles to determine the optimum 

for detection and specificity for each primer pair. 

6. Detection is performed on 40 µl of each LCR reaction in the automated Abbott Imx, 

which uses anti-fluorescein-coated microparticles to capture the products of the gap LCR.


If ligation has taken place, the biotin on the other end of the product is detected by antibiotin 

conjugated to alkaline phosphatase. Alkaline phosphatase is detected by adding 

methylumbelliferone phosphate that, when the phosphatase acts on the phosphate, yields a 

fluorescent product that is detected by the IMx. (36). The amount of fluorescence produced 

is proportional to the ligated oligonucleotides. 

7. Of the many methods used to detect ligation products, automated methods such as the 

IMx are the most labor efficient. Details and requirements regarding the actual use of 

automated systems for LCR detection are instrument-specific and must be performed with 

the manufacturers in order to ensure the validity and accuracy of the results. 

3.3. Abbott LCx Commercial Automated Neisseria gonorrhoeae 

Detection System 

The materials listed here and the procedures described in the subsequent section are 

based on what is needed for performance of the commercially sold Abbott LCx assay 

for detection of N. gonorrhoeae from urogenital swabs or voided urine from men or 

women. Due to the proprietary nature of the LCx technology, use of these specific 

materials, including specimen transport systems and oligonucleotide primers that must 

be purchased from the manufacturer in kit form is necessary for the successful performance 

of this type of LCR assay. Strict adherence to the manufacturer’s instructions for 

sample collection, storage, and processing is necessary for satisfactory results. The LCx 

kits for C. trachomatis and M. tuberculosis follow the same general principles. Some 

modifications are necessary for the M. tuberculosis assay due to the nature of the different 

specimen types (respiratory secretions vs urogenital swabs or urine). It is possible to 

perform the LCR assay using other commercially available ligases and methods for 

detection of amplicons as described earlier, but the principles of the Abbott LCx and the 

notes regarding its performance are generally relevant for any type of LCR assay. 

3.3.1. Specimen Collection 

1. 15–20 mL of first-void urine should be collected into a sterile plastic, preservative-free 

container. It is desirable to obtain specimens from patients who have not urinated within 

1 h prior to collection. 

2. Swab specimens should be collected using the LCx swab collection and transport kit. For 

endocervical specimens in females, excess cervical mucus should be removed prior to 

sampling using the large-tipped cleaning swab provided in the collection system. When 

sampling the cervix, the small-tipped swab should be inserted into the endocervix and 

rotated for 15–30 s to ensure adequate sampling. In males, the small-tipped swab should 

be inserted 2–4 mm into the urethral meatus and rotated for 3 to 5 s. Swabs are then 

inoculated into the transport tube, broken off at the score line and then the cap is screwed 

securely onto the tube. 

3.3.2. Specimen Storage 

1. Time and temperature conditions must be adhered to for storage and transport of specimens. 

Swabs in the transport system can be stored at 2–30°C. If more than 24 h will elapse 

before processing, the swabs should ideally be refrigerated at 2–8°C or frozen at –20°C 

or below. 

2. Urine specimens should be refrigerated immediately at 2–8°C and can be held at this 

temperature for up to 4 d before processing. If longer storage is necessary, swab or urine 

specimens can be frozen at –20°C or below for up to 60 d. Do not thaw urine until ready 

for testing.


3.3.3. Urine Specimen Preparation and Processing 

1. Allow urine specimen to completely thaw if frozen. Mix urine in the urine collection cup 

by swirling to resuspend any settled material. 

2. Using a pipet with aerosol barrier pipet tips, transfer 1 mL of mixed urine into the Urine 

Specimen Microfuge Tube from the Urine Specimen Preparation Kit. 

3. Centrifuge at >9000g for 15 min in a microcentrifuge. 

4. Using a fine-tipped, plastic disposable pipet, gently aspirate all of the urine supernatant. Be 

cautious not to contact or dislodge the pellet, which may be translucent. The time between 

centrifugation and removal of supernatant must not exceed 15 min. 

5. Using a pipettor with aerosol barrier pipet tips, add 1 mL of LCx Urine Specimen 

Resuspension Buffer. Close lid of microfuge tube and resuspend the pellet by vortexing 

until the pellet is resuspended. 

6. Secure tube closure with a cap lock until it clicks into place. 

7. Insert specimen tubes in preheated dry bath wells. After the temperature of the heat block 

is stabilized at 97°C, heat specimens for 15 min. 

8. Remove the specimen from the dry bath and allow to cool at room temperature for 15 min. 

Remove cap lock and discard. 

9. Pulse-centrifuge the processed urine specimen in a microcentrifuge for a minimum of 

10–15 s immediately before inoculating the LCx amplification vials. 

10. The amplification reagent level in the LCx amplification vial should measure approx 

two-thirds of the conical part of the vial. If necessary, the vial may be pulse centrifuged 

in a microcentrifuge for 10–15 s. 

11. Using a pipet with aerosol barrier pipet tips, add 100 µL of each processed urine specimen 

to the appropriately labeled LCx Amplification Vial, making sure each vial is securely 

closed and that only one at a time is open. The vial can now be transferred to Area 2 and 

placed immediately in the Thermal Cycler for amplification. 

3.3.4. Swab Specimen Preparation 

1. Allow specimen to completely thaw, if frozen. 

2. Insert specimen tubes in preheated dry bath wells. After the temperature of the heat block 

is stabilized at 97°C, heat specimens for 15 min. Failure to reach 97 + 2°C could limit 

release of the DNA in the specimen causing false negative results. 

3. Remove the specimen from the dry bath and allow to cool at room temperature for 

15 min. 

4. Unscrew cap and express swab along the side of the tube so that liquid drains back into the 

solution at the bottom of the tube. Discard swab and original closure, replacing with a new 

swab tube closure that is screwed on until it clicks into place. 

5. The amplification reagent level in the LCx amplification vial should measure approx 

two-thirds of the conical part of the vial. 

6. Using a pipet with aerosol barrier pipet tips, add 100 µL of each processed specimen to 

the appropriately labeled LCx Amplification Vial, making sure each vial is securely closed 

and that only one at a time is open. The vial can now be transferred to Area 2 and placed 

immediately in the Thermal Cycler for amplification. 

7. The LCx negative control and calibrator must be prepared in conjunction with specimens 

to be tested and run in duplicate with each carousel of clinical specimens. 

3.3.5. Quality Control Procedures 

1. Negative control and calibrator preparations must take place in the dedicated Specimen 

Preparation Area (Area 1).


2. The LCx procedure requires that the negative control and the calibrator be run in duplicate 

with each carousel of specimen. 

3. The negative control and calibrator are activated by the addition of 100 µL of LCx 

activation reagent. It is important to make sure correct volume is added or the run may 

be invalid. After addition, the contents of the bottles are then recapped and vortexed for 

20 s. Each bottle of activated negative control or calibrator is designed to be used up to 

48 h if stored at 2–8°C. 

4. A positive control that monitors the entire assay procedure including the specimen 

processing step should be tested. A known positive urine specimen can be processed in 

parallel and tested with unknown specimens. The positive control should give a positive 

assay value (S/CO ratio >1.00). Each laboratory should establish a target value and limits 

from each control batch using statistical control rules. These target values and limits should 

be maintained throughout storage. Alternative choices for a positive control are type strains 

of the microorganism targeted in the assay, e.g., N. gonorrhoeae. 

3.3.6. LCx Amplification Procedure 

1. Turn the LCx Thermal Cycler on for at least 15 min prior to use. 

2. Collect all LCx amplification vials containing samples, negative control and calibrator 

from Area 1 and transfer to Area 2 for thermal cycling. 

3. LCx thermal cycling conditions should be edited to the following amplification parameters: 

93°C for 1 s, 59°C for 1 s, 62°C for 1 min, 10 s for 40 cycles. 

4. Place the amplification vials into the thermal cycler, and initiate run. After completion 

of the thermal cycler run, amplification product may remain at 15–30°C for up to 72 h 

prior to LCx detection. 

3.3.7. Detection of Amplification Product 

1. Refer to the LCx Analyzer Operations Manual for detailed instrument operation procedures. 

Before running the LCx Analyzer, check to see that LCx Inactivation Diluent (1) contains 

a minimum of 100 mL and the LCx System Diluent (2) contains a minimum of 250 mL. 

Remove the LCx Amplification Vials from the LCx Thermal Cycler. 

2. Place LCx Reaction Cells into a Carousel; lock the carousel. 

3. Pulse-centrifuge the LCx amplification vials in a microcentrifuge for 10–15 s before 

placing into the LCx reaction cells. 

4. Place the amplification vials into the LCx reaction cells in the following order: negative 

controls in positions 1 and 2, calibrators in positions 3 and 4, and specimens in the 

remaining positions. 

5. Place the carousel into the LCx Analyzer. 

6. Lock the amplification vial Retainer. 

7. Remove the LCx detection reagent Pack from 2–8°C storage, gently invert it five times, 

and open the reagent pack bottles in the numeric order: 1, 2, 3, 4. 

8. Look for any film that may have formed over the opening of the reagent bottles. If present 

burst the bubble. 

9. Place the LCx detection reagent pack into the LCx Analyzer. 

10. Press Assay, then sample management to log in samples for the run. Press RUN on the LCx 

Analyzer control panel. Final assay results will be printed in approx 60 min. 

11. Store the detection reagent pack at 2–8°C in original packaging, decontaminated with 1% v/v 

hypochlorite or separate from unopened LCx kits. 

12. Remove the Carousel, individually remove the LCx reaction cells, and dispose appropriately. 

Rinse the carousel with water after each use.


3.3.8. Calculation of Results 

1. N. gonorrhoeae. The LCx Assay uses MEIA detection on the LCx Analyzer to detect 

DNA. All calculations are performed automatically. 

2. The presence or absence is determined by relating the LCx Assay results for the specimen 

to the Cutoff value. The Cutoff value is the mean RATE (c/s/s) of the LCx calibrator 

duplicates multiplied by 0.25. 

3. Calculation of the Cutoff value: 

Cutoff value = 0.25 × (Mean of LCx Gonorrhea Calibrator RATES) 

The S/CO value is determined by calculating a ratio of the sample RATE to the Cutoff value 

S 

CO 

Sample RATE 

Cutoff Value 

3.3.9. Interpretation of Results 

N. gonorrhoeae 

S/CO Ratio Result Report 

>1.20 LCx positive N. gonorrhoeae DNA detected, and positive for 

N. gonorrhoeae by LCR amplification and MEIA 

detection. 


of contamination. 

3. When using LCx tests for detection of microorganisms in urogenital specimens, the 

presence of excessive mucus or blood in the swab or urine specimen as well as use of 

feminine powder sprays can interfere with the assay and cause false negative results, thus 

proper specimen quality must be monitored. 

4. In addition to the usual quality controls, reproducibility of LCx assays can be monitored 

by repeating random samples on a frequent basis. 

5. Further quality control testing and recording is detailed for the LCx analyzer and 

thermocycler in the respective manuals for the equipment. 

6. Failure to reach 97°C before amplification could limit release of the DNA in the specimen 

causing false negative results. 

7. Test the processed urine specimen immediately, or store for up to 60 d at 2–8°C or –20°C 

prior to testing. If the processed urine specimen is stored frozen, it must be completely 

thawed prior to addition to the LCx Amplification Vial. 

8. The LCx Analyzer first verifies that the assay results of the negative controls and calibrator 

are within the specified ranges of the LCx assay parameters by comparing the assay results 

of the negative control and calibrator to the values listed in the assay parameters. A run is 

valid when the individual and average results are within the values listed for CAL HIGH, 

CAL LOW, CAL AVE HIGH, CAL AVE LOW, NEG LOW, NEG HIGH, NEG AVE HIGH, 

and NEG AVE LOW parameters in the LCx assay parameters. 

9. In the event of an invalid negative control or calibrator assay result, the assay results 

printout will identify the out-of-range result, the S/CO ratio of the specimen will not be 

calculated and a flag indicating an invalid result will occur in the NOTE column of the 

printout. Ensure the LCx Negative Controls and Calibrators are in the correct order on the 

MEIA carousel to avoid an invalid run. 

10. Environmental quality control screening is also recommended. The laboratory should be 

monitored for the presence of amplification product by saturating one of the small-tipped 

swabs in transport buffer, then using it to wipe the desired area, including equipment, 

and processing according to the LCx procedures. If a positive reaction is detected, the 

decontamination steps using 1% sodium hypochlorite followed by 70% ethanol should be 

performed. The operation manual should be consulted for decontaminating equipment. 

References 

1. Barany, F. (1991) Genetic disease detection and DNA amplification using cloned thermostable 

ligase. Proc. Natl. Acad. Sci. USA 88, 189–193. 

2. Jurinke, C., van den Boom, D., Jacob, A., Tang, K., Worl, R., and Koster, H. (1996) 

Analysis of ligase chain reaction products via matrix-assisted laser desorption/ionization 

time-of-flight-mass spectrometry. Anal. Biochem. 237, 174–181. 

3. Luo, J., Bergstrom, D. E., and Barany, F. (1996) Improving the fidelity of Thermus 

thermophilus DNA ligase. Nucleic Acids Res. 24, 3071–3078. 

4. Khanna, M., Park, P., Zirvi, M., Cao, W., Picon, A., Day, J., et al. (1999) Multiplex 

PCR/LDR for detection of K-ras mutations in primary colon tumors. Oncogene 18, 27–38. 

5. Khanna, M., Cao, W., Zirvi, M., Paty, P., and Barany, F. (1999) Ligase detection reaction for 

identification of low abundance mutations. Clin. Biochem. 32, 287–290. 

6. Zirvi, M., Bergstrom, D. E., Saurage, A. S., Hammer, R. P., and Barany, F. (1999) Improved 

fidelity of thermostable ligases for detection of microsatellite repeat sequences using 

nucleoside analogs. Nucleic Acids Res. 27, e41. 

7. Day, D. J., Speiser, P. W., White, P. C., and Barany, F. (1995) Detection of steroid 

21-hydroxylase alleles using gene-specific PCR and a multiplexed ligation detection 

reaction. Genomics 29, 152–162.


8. Reyes, A. A., Carrera, P., Cardillo, E., Ugozzoli, L., Lowery, J. D., Lin, C. I., et al. (1997) 

Ligase chain reaction assay for human mutations: the Sickle Cell by LCR assay. Clin. 

Chem. 43, 40– 44. 

9. Besmer, P., Miller, R. J., Caruthers, M. H., Kumar, A., Minamoto, K., Van de Sande, J. H., 

et al. (1972) Studies on polynucleotides. CXVII. Hybridization of polydeoxynucleotides 

with tyrosine transfer RNA sequences to the r- strand of phi80psu + 3 DNA. J. Mol. Biol. 

72, 503–522. 

10. Landegren, U., Kaiser, R., Sanders, J., and Hood, L. (1988) A ligase-mediated gene 

detection technique. Science 241, 1077–1080. 

11. Alves, A. M. and Carr, F. J. (1988) Dot blot detection of point mutations with adjacently 

hybridising synthetic oligonucleotide probes. Nucleic Acids Res. 16, 8723. 

12. Wu, D. Y. and Wallace, R. B. (1989) The ligation amplification reaction (LAR)— 

amplification of specific DNA sequences using sequential rounds of template-dependent 

ligation. Genomics 4, 560–569. 

13. Morre, S. A., van Valkengoed, I. G., de Jong, A., Boeke, A. J., van Eijk, J. T., Meijer, C. 

J., and van den Brule, A. J. (1999) Mailed, home-obtained urine specimens: a reliable 

screening approach for detecting asymptomatic Chlamydia trachomatis infections. J. Clin. 

Microbiol. 37, 976–980. 

14. Chernesky, M. A., Jang, D., Sellors, J., Luinstra, K., Chong, S., Castriciano, S., and Mahony, 

J. B. (1997) Urinary inhibitors of polymerase chain reaction and ligase chain reaction and 

testing of multiple specimens may contribute to lower assay sensitivities for diagnosing 

Chlamydia trachomatis infected women. Mol. Cell Probes 11, 243–249. 

15. Prchal, J. T. and Guan, Y. L. (1993) A novel clonality assay based on transcriptional analysis 

of the active X chromosome. Stem Cells 11 (Suppl. 1), 62–65. 

16. Marshall, R. L., Laffler, T. G., Cerney, M. B., Sustachek, J. C., Kratochvil, J. D., and 

Morgan, R. L. (1994) Detection of HCV RNA by the asymmetric gap ligase chain reaction. 


17. Lee, H. H., Chernesky, M. A., Schachter, J., Burczak, J. D., Andrews, W. W., Muldoon, 

S., et al. (1995) Diagnosis of Chlamydia trachomatis genitourinary infection in women by 

ligase chain reaction assay of urine. Lancet 345, 213–216. 

18. Dille, B. J., Butzen, C. C., and Birkenmeyer, L. G. (1993) Amplification of Chlamydia 

trachomatis DNA by ligase chain reaction. J. Clin. Microbiol. 31, 729–731. 

19. Winn-Deen, E. S., Batt, C. A., and Wiedmann, M. (1993) Non-radioactive detection of 

Mycobacterium tuberculosis LCR products in a microtitre plate format. Mol. Cell Probes 

7, 179–186. 

20. Gaydos, C. A., Howell, M. R., Quinn, T. C., Gaydos, J. C., and McKee, K. T., Jr. (1998) 

Use of ligase chain reaction with urine versus cervical culture for detection of Chlamydia 

trachomatis in an asymptomatic military population of pregnant and nonpregnant females 

attending Papanicolaou smear clinics. J. Clin. Microbiol. 36, 1300–1304. 

21. Berg, E. S., Anestad, G., Moi, H., Storvold, G., and Skaug, K. (1997) False-negative results 

of a ligase chain reaction assay to detect Chlamydia trachomatis due to inhibitors in urine. 

Eur. J. Clin. Microbiol. Infect. Dis. 16, 727–731. 

22. Leckie, G. W., Erickson, D. D., He, Q., Facey, I. E., Lin, B. C., Cao, J., and Halaka, F. G. 

(1998) Method for reduction of inhibition in a Mycobacterium tuberculosis-specific ligase 

chain reaction DNA amplification assay. J. Clin. Microbiol. 36, 764–767. 

23. Buimer, M., van Doornum, G. J., Ching, S., Peerbooms, P. G., Plier, P. K., Ram, D., and 

Lee, H. H. (1996) Detection of Chlamydia trachomatis and Neisseria gonorrhoeae by 

ligase chain reaction-based assays with clinical specimens from various sites: implications 

for diagnostic testing and screening. J. Clin. Microbiol. 34, 2395–2400.


24. Stary, A. (1999) Correct samples for diagnostic tests in sexually transmitted diseases: which 

sample for which test? FEMS Immunol Med Microbiol 24, 455– 459. 

25. Stary, A., Najim, B., and Lee, H. H. (1997) Vulval swabs as alternative specimens for ligase 

chain reaction detection of genital chlamydial infection in women. J. Clin. Microbiol. 

35, 836–838. 

26. Schepetiuk, S., Kok, T., Martin, L., Waddell, R., and Higgins, G. (1997) Detection of 

Chlamydia trachomatis in urine samples by nucleic acid tests: comparison with culture and 

enzyme immunoassay of genital swab specimens. J. Clin. Microbiol. 35, 3355–3357. 

27. Dubuis, O., Gorgievski-Hrisoho, M., Germann, D., and Matter, L. (1997) Evaluation of 

2-SP transport medium for detection of Chlamydia trachomatis and Neisseria gonorrhoeae 

by two automated amplification systems and culture for chlamydia. J. Clin. Pathol. 50, 

947–950. 

28. Hook, E. W., III, Smith, K., Mullen, C., Stephens, J., Rinehardt, L., Pate, M. S., and Lee, H. 

H. (1997) Diagnosis of genitourinary Chlamydia trachomatis infections by using the ligase 

chain reaction on patient-obtained vaginal swabs. J. Clin. Microbiol. 35, 2133–2135. 

29. Stary, A., Schuh, E., Kerschbaumer, M., Gotz, B., and Lee, H. (1998) Performance of 

transcription-mediated amplification and ligase chain reaction assays for detection of 

chlamydial infection in urogenital samples obtained by invasive and noninvasive methods. 

J. Clin. Microbiol. 36, 2666–2670. 

30. Carroll, K. C., Aldeen, W. E., Morrison, M., Anderson, R., Lee, D., and Mottice, S. (1998) 

Evaluation of the Abbott LCx ligase chain reaction assay for detection of Chlamydia 

trachomatis and Neisseria gonorrhoeae in urine and genital swab specimens from a sexually 

transmitted disease clinic population. J. Clin. Microbiol. 36, 1630–1633. 

31. Garrino, M. G., Glupczynski, Y., Degraux, J., Nizet, H., and Delmee, M. (1999) Evaluation 

of the Abbott LCx Mycobacterium tuberculosis assay for direct detection of Mycobacterium 

tuberculosis complex in human samples. J. Clin. Microbiol. 37, 229–232. 

32. Moore, D. F. and Curry, J. I. (1998) Detection and identification of Mycobacterium 

tuberculosis directly from sputum sediments by ligase chain reaction. J. Clin. Microbiol. 

36, 1028–1031. 

33. Ausina, V., Gamboa, F., Gazapo, E., Manterola, J. M., Lonca, J., Matas, L., et al. (1997) 

Evaluation of the semiautomated Abbott LCx Mycobacterium tuberculosis assay for direct 

detection of Mycobacterium tuberculosis in respiratory specimens. J. Clin. Microbiol. 

35, 1996–2002. 

34. Lindbrathen, A., Gaustad, P., Hovig, B., and Tonjum, T. (1997) Direct detection of 

Mycobacterium tuberculosis complex in clinical samples from patients in Norway by ligase 

chain reaction. J. Clin. Microbiol. 35, 3248–353. 

35. Fadda, G., Ardito, F., Sanguinetti, M., Posteraro, B., Ortona, L., Chezzi, C., et al. (1998) 

Evaluation of the Abbott LCx Mycobacterium tuberculosis assay in comparison with culture 

methods in selected Italian patients. New Microbiol. 21, 97–103. 

36. Birkenmeyer, L. and Armstrong, A. S. (1992) Preliminary evaluation of the ligase chain reaction 

for specific detection of Neisseria gonorrhoeae. J. Clin. Microbiol. 30, 3089–3094. 

37. Wilson, V. L., Wei, Q., Wade, K. R., Chisa, M., Bailey, D., Kanstrup, C. M., et al. (1999) 

Needle-in-a-haystack detection and identification of base substitution mutations in human 

tissues. Mutat. Res. 406, 79–100. 

38. Abravaya, K., Carrino, J. J., Muldoon, S., and Lee, H. H. (1995) Detection of point 

mutations with a modified ligase chain reaction (Gap-LCR). Nucleic Acids Res. 23, 

675–682.

150 Benjamin, Smith, and Waites

Nested RT-PCR in a Single Closed Tube 151 

26 

Nested RT-PCR in a Single Closed Tube 

Antonio Olmos, Olga Esteban, Edson Bertolini, and Mariano Cambra 


There are several methods now in widespread use for detecting and characterizing 

specific RNA targets. These methods include in situ hybridization, Northern blotting, 

dot or slot blot, RNase protection assay, and reverse transcription coupled to polymerase 

chain reaction (RT-PCR). However, when the amount of RNA target is limited or 

restricted in its cellular or tissue distribution, the extreme sensitivity of the PCR 

allows the detection of minute quantities of RNA when coupled to an initial step that 

converts single-strand RNA to cDNA (1–4). Nevertheless, when RT-PCR is applied 

for diagnostic purposes, the sensitivity usually afforded by this technique in routine 

detection tests is similar, or only slightly higher, to conventional enzyme-linked 

immunosorbent assay or hybridization techniques. This is frequently observed when 

dealing with poor-quality samples containing inhibitors of RT-PCR. The presence of different 

components of plant or animal origin, as well as specific RT-PCR conditions, may 

inhibit the reverse transcription and amplification by a number of mechanisms (5). 

Approaches have been developed to overcome these problems, including a previous 

immunocapture phase (6–8), the immobilization of RNA targets on plastic surfaces (9) or 

on paper membranes by a direct printing or squashing of the sample (10–12), preparation 

of crude extracts in simple buffers and subsequent dilution in sterile water, and other 

different protocols to prepare RNA targets free from interfering substances. Moreover, 

there are interesting alternatives to crude extracts or total nucleic acid preparations based 

on the use of commercially available resin- (13) or silica- (14) based kits. 

Sensitivity and specificity problems associated with RT-PCR may be overcome by 

using nested RT-PCR. The process is based on two consecutive rounds of amplification 

(15,16), the first round being an RT-PCR and the second a conventional PCR. The 

RT-PCR is performed using a pair of external primers. The 3′ end external primer (Pe1 

in Fig. 1) is used for RT reaction and the 3′ and 5′ end (Pe2 in Fig. 1) primers are 

used to perform the first PCR. The resulting amplification product is transferred to 

another Eppendorf tube containing a second pair of nested primers (nested PCR) 

that are internal to the initial pair. Alternatively, one of the external primers and a 

single nested primer (heminested PCR) can also be used. The larger amplification 

fragment produced during the first reaction is used as a target for the second (nested or 

heminested) PCR. The concept is illustrated in Fig. 1. 



151

152 Olmos et al. 

Fig. 1. RT-heminested/nested-PCR scheme. Phase I (reverse transcription and first PCR): 

RNA target is copied in a cDNA form by the reverse transcriptase that uses the 3′ end external 

oligo (Pe1) as the reaction primer. Subsequently, the first PCR is performed using Pe1 and the 

5′ end external primer (Pe2) to produce as intermediate product that will act as the target in the 

second PCR amplification. Phase II (heminested or nested-PCR): a second PCR using a 5′ end 

internal primer (in the example Pi3) combined with one of the external primers (in the example 

Pe1; heminested-PCR) or two internal primers, the 3′ end internal primer (Pi1), and the 5′ 

end internal primer (Pi2; nested PCR). Note that the internal primers could be used for typing 

purposes of the larger fragment amplified in the first reaction.


Fig. 2. Compartmentalized Eppendorf tube that allows capture (if necessary), reverse 

transcription, and nested PCR in a single closed tube. Cocktail A for the reverse transcription 

and first PCR mix is added to the bottom of the tube. Cocktail B for the second amplification 

mix is added into the pipet tip cone. 

Several reports illustrate the potential of heminested and nested PCR in different 

fields (11,12,17–19). However, the use of two rounds of amplification in different 

tubes enhances the risk of contamination, especially when the method is used on a 

large scale. To prevent this problem, some authors proposed single-tube nested PCR 

protocols (20–22). However, a limitation to these approaches of nested RT-PCR is the 

need to accurately establish the ratio between an external and internal pair of primers 

and the use of limiting amounts of external primers to avoid its interference during the 

second amplification. Moreover, the external primers must be designed to anneal at 

a higher temperature than the internal primers. Figure 2 illustrates a simple device 

based on the use of a compartmentalized Eppendorf tube (Spanish patent P9801642 

of July 31, 1998) that allows RT reaction and nested PCR in a single closed tube in 

one manipulation. A small cone (the end of a standard 200-µL plastic pipet tip) is 

introduced into a 0.5-mL PCR tube allowing for the physical separation of the two 

different PCR cocktails in the same Eppendorf tube. The RT-PCR mix containing the 

external primers is added to the bottom of the tube and the PCR mix for the second 

amplification (heminested or nested) is added into the cone, where it remains as the 

result of capillary action (see Note 1). After RT-PCR, the Eppendorf tube is centrifuged 

to mix the products of the first reaction with the cocktail containing the internal primers. 

After this second round of PCR, the tube is finally opened to analyze the amplicons 

produced. The final result of this nested or heminested RT-PCR is a yield at least 100 

times higher than a conventional RT-PCR. 

The main advantages of this new approach of nested RT-PCR are the high sensitivity 

afforded without risk of contamination and the possibility of using external primers 

with the lowest annealing temperature and internal primers with the highest, in contrast 

to previously described protocols.


This nested RT-PCR protocol coupled with a preparation of squashed or printed 

samples on paper (10) would allow the detection of RNA targets from a number of 

viruses in individual insect vectors, as well as in plant materials, animal fluids, or 

tissues. The increased sensitivity provided with this method permits the amplification of 

RNA targets from individual viruliferous aphids carrying stylet-borne (nonpersistent) 

and semipersistent plant viruses (11,12) without the need of a preliminary purification 

of nucleic acids. 

Conditions for multiplex nested RT-PCR can be easily established using the device 

described in Fig. 2. The simultaneous amplification of four RNA viruses and a 

bacterium from olive trees by multiplex nested RT-PCR without interference among 

primers has been successfully achieved in our laboratory (23). This system can include 

the use, if necessary (see Note 2), of an immunocapture (IC) phase in the same tube 

(IC-nested RT-PCR) (12). Recently, a new technique (called co-operational PCR/ 

Co-PCR) for amplification of nucleic acids targets, based on a simple tetraprimer 

reaction has been described, with a sensitivity similiar to nested RT-PCR (24). 

2. Materials 

1. Eppendorf tubes (see Notes 2 and 3) (Cultek, Thermowell tubes cat no: 6530). 

2. Sterile 200-µL pipet tip cones (see Fig. 2 and Notes 1 and 4)(Daslab, cat. no: 16-2001). 

3. 10× RT-PCR buffer: 500 mM KCl, 100 mM Tris-HCl (pH 9.0 at 25°C), 1% Triton X-100 

(supplied with Taq DNA polymerase). 

4. Triton X-100 (Merck, Art. 8603). 

5. DMSO (Sigma, cat. no. D8418). 

6. MgCl 2 (25 mM; supplied with Taq DNA polymerase). 

7. dNTPs (5 mM, Pharmacia, cat. no. 27-2035-02). 

8. AMV reverse transcriptase (Pharmacia, cat. no. M5108). 

9. Taq DNA polymerase (Promega, cat. no. M1865). 

10. Primers for citrus tristeza virus (CTV) detection (see Subheading 3.2., step 1a): 

External primers (100 µM) 

• PEX1 (5′ TAA ACA ACA CAC ACT CTA AGG 3′) 

• PEX2 (5′ CAT CTG ATT GAA GTG GAC 3′) 

Internal primers (100 µM) 

• PIN1 (5′ GGT TCA CGC ATA CGT TAA GCC TCA CTT 3′) 

Primers for plum pox virus (PPV) detection (see Subheading 3.2., step 1b): 

External primers (100 µM 

• P10 (5′ GAG AAA AGG ATG CTA ACA GGA 3′) 

• P20 (5′ AAA GCA TAC ATG CCA AGG TA 3′) 

Internal primers (100 µM) 

• P1 (5′ ACC GAG ACC ACT ACA CTC CC 3′) 

• P2 (5′ CAG ACT ACA GCC TCG CCA GA 3′) 

11. Micropipets (Gilson, pipetman P10, P20, P100, P200). 

12. Microfuge (Heraeus, Biofuge PICO). 

13. Thermal cycling machine with a heated lid (Techne, PHC-3). 

14. Electrophoresis system (Bio–Rad, sub-cell gt/powerpac 300 power supply system Cat. 

No. 165-4350). 

15. Ethidium bromide (10 µg/mL in water; AppliChem, A1152,0025). 

16. Transilluminator (TDI, Sepctroline Model TC-312A 312 nm UV).


Table 1 

Volume and Concentration of Reactives for CTV Detection by Nested RT-PCR 

Ingredients Cocktail A (RT-PCR) Cocktail B (nested-PCR) 

10X RT-PCR buffer to 13.00 µl to 11.00 µl 

MgCl 2 (25 mM) to 13.60 µl – 

dNTPs (5mM each) to 12.25 µl – 

Triton ® X-100 (4%) to 12.50 µl – 

3′ external primer (100 µM) to 10.15 µl 3′ internal primer (100 µM) to 10.80 µl 

(Pe1 in Fig. 1) (Pi1 in Fig. 1) 



DMSO (100%) to 11.50 µl – 

H 2 O to 30.00 µl to 10.00 µl 

AMV (10 U/µl) to 10.20 µl – 

Taq Pol (5 U/µl) to 10.20 µl – 

3. Methods 

3.1. Primer Design (see Note 5) 

Sequenced regions of each RNA target can be recovered using the Nucleotide 

Sequence Search program located in the Entrez Browser program provided by the 

National Center for Biotechnology Information (NCBI) (http://www3.ncbi.nlm.nih.gov/ 

Entrez; Bethesda, MD). Conserved regions for each target can be studied using the 

similarity search Advanced BLAST 2.0, with the blast program designed to support 

analysis of nucleotides (http://www3.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=1) (25). 

The alignment view could be performed as master-slave with identities to analyze 

significant nucleotide homologies in the molecular data retrieved from NCBI’s 

integrated databases, GenBank, EMBL, and DDBJ. Specific nucleotide regions should 

be selected. Different specific primers with similar annealing temperature can be 

subsequently designed for the target of interest, based on Oligo software utility 

(http://www.lifescience-software.com/oligo.htm; LRS, Long Lake, MN). By using 

this methodology, appropriate PCR primers to different RNA targets can be easily 

and properly designed. 

3.2. Nested PCR Product Generation 

1. RT-PCR and nested PCR cocktail preparation (see Fig. 2). 

a. When the annealing temperatures between external and internal primers are very 

different (external 45°C and internal 60°C) and the external primers do not anneal at 

60°C (for example, CTV detection), see Table 1. 

b. When the annealing temperatures of the external and internal primers are similar 

(external 50°C and internal 60°C) and the external primers anneal at 60°C (for example, 

PPV detection), see Table 2. 

2. Add 30 µL of cocktail A for reverse transcription and external amplification to the bottom 

of an 0.5-mL Eppendorf tube. 

3. Introduce the small plastic cone (see Fig. 2 and Notes 1 and 4) and add 10 µL of cocktail 

B into the cone.


Table 2 

Volume and Concentration of Reactives for PPV Detection by Nested RT-PCR 

Ingredients Cocktail A (RT-PCR) Cocktail B (nested-PCR) 

10X RT-PCR buffer to 13.00 µl to 11.00 µl 

MgCl 2 (25 mM) to 13.60 µl – 

dNTPs (5 mM each) to 12.25 µl – 

Triton ® X-100 (4%) to 12.50 µl – 





DMSO to 11.50 µl – 

H 2 O to 30.00 µl to 10.00 µl 

AMV (10 U/µl) to 10.20 µl – 

Taq Pol (5 U/µl) to 10.20 µl – 

4. RT-PCR (see Note 6): 42°C for 45 min (reverse transcription), 94°C for 2 min (denaturation 

and reverse transcriptase inactivation), 20 to 25 cycles (92°C for 30 s [denaturation], 45 or 

50°C (see Subheading 3.2., step 1) for 30 s [annealing], and 72°C for 1 min [extension], 

and final elongation at 72°C for 10 min. 

5. Vortex the Eppendorf tube and centrifuge (pulse at 6000g for 2 s) to mix the second 

cocktail with the RT-PCR products. 

6. Nested-PCR (see Notes 7–9): 35 to 40 cycles (92°C for 30 s [denaturation], 60°C [see 

Subheading 3.2., step 1] for 30 s [annealing], and 72°C for 1 min [extension] and final 

elongation at 72°C for 10 min. 

7. Electrophoresis (see Fig. 3): Load 10 µL of amplification products onto a 3% agarose 

gel in 0.5× TAE and perform electrophoresis at 100 V for 30 min. Stain the agarose 

gel with ethidium bromide (0.5 µg/mL) for 15 min and visualize the amplicons under 

ultraviolet light. 

4. Notes 

1. The nested and heminested RT-PCR in a single closed tube described in this protocol 

is based on the use of a simple device (see Fig. 2). Other patented compartmentalized 

Eppendorf tubes with pockets could be commercialized by the industry in the near future, 

consequently avoiding the need to prepare cones. Accidental flow of the second PCR mix 

from the tip device might be caused by an incorrect manipulation of the device or by the 

use of pipet tips wider than standard. This can be solved by closing (heating) the tip end. 

In this case, after the RT-PCR it will be necessary to invert the tube, vortex to mix the 

reagents, and centrifuge to collect all components in the bottom of the tube. 

2. A previous capture step (immunocapture or print capture) improves the detection of some 

RNA targets by RT-PCR. Conventional immunocapture is usually performed by pre-coating 

Eppendorf tubes with 100 µL of carbonate buffer (pH 9.6) containing immunoglobulins 

(2 µg/mL) of a known specificity (6–8). Normal immunoglobulins from nonimmunized 

rabbits, bovine serum albumin, or skimmed milk can be also successfully used in this capture 

phase. However, because of the high sensitivity of nested or heminested RT-PCR, this step 

can usually be omitted. In this case, the detection of RNA targets can be performed by direct 

incubation of 100 µL of the sample (crude extract or tissue print Triton X-100 extracts from


Fig. 3. Analysis of RT-nested-PCR products by agarose gel electrophoresis. (A) Detection 

of PPV targets from infected plant material. Lane 1: 100 bp molecular weight markers (Gibco 

BRL). Lanes 2 through 5: amplification products (243 bp) obtained from PPV-infected GF305 

peach seedlings. Lanes 6 and 7: samples from healthy GF305 peach seedlings. (B) Detection of 

CTV targets from infected aphid vectors. Lane 1: pUC19DNA/MspI(HpaII) molecular weight 

markers 23 (MBI Fermentas). Lanes 2 through 6: amplification products (131 bp) obtained from 

individual Aphis gossypii fed on CTV-infected Washington Navel sweet orange. Lane 7: Sample 

from Aphis gossypii fed on healthy Washington Navel sweet orange. 

paper; ref. 10) for 3 h at 37°C or overnight at 4°C in an uncoated Eppendorf tube. Before 

RT-PCR, the tube is washed twice with 150 µL of phosphate-buffered saline–0.05% Tween 

20 (washing buffer). However, it may be useful to assay the ability of different plastic tubes 

to trap RNA targets in order to select the most appropriate for RT-PCR. 

3. There are several commercially available thin-walled Eppendorf tubes for PCR. The 

protocol describes the use of 0.5-mL tubes because they are more easily compartmentalized 

with the end of a pipet tip (see Fig. 2). 

4. The reaction must be performed in a thermal cycler with a heated lid to prevent the 

requirement for oil-overlay during the cycling events. The selected thermal cycler must 

allow the maintenance of cocktail B (see Fig. 2) in the cone during the cycling. If 

evaporation occurs close the tip device as in Note 3 and/or adjust the lid temperature to 70 

to 80°C during the first reaction (RT-PCR). 

5. Primer design is critical to the success in amplifying RNA targets by conventional 

nested RT-PCR but it is even more critical when a multiplex nested strategy is used. The 

recommended primer design (see Subheading 3.1.) allows an optimal design of primers. 

The size of the amplified product should be small to ensure a good efficiency of the 

reaction and high sensitivity (26,27). Primers with a broad range of specificity must be 

designed from highly conserved genome sequences. Degenerate primers must be used for a 

universal detection of RNA targets belonging to a group. For characterization or typing of 

RNA targets, primers must be designed from discriminating or specific regions. 

6. The goal of the first round of PCR after RT is to obtain a yield of the amplification product 

just enough to ensure adequate target for the second (nested or heminested) amplification. 

For this reason, the number of cycles can be as low as 20 to 25. 

7. The goal of the second round of PCR (nested or heminested) is to achieve a high sensitivity 

and simultaneous specificity (if the method has been designed for typing RNA targets). 

The optimum number of cycles ranges from 35 to 40.


8. The sensitivity of nested RT-PCR in a single closed tube can be compared with the 

sensitivity obtained by conventional RT-PCR using internal or external primers. 

9. The background of the nested RT-PCR must be reduced. Excessive cycling often results 

in the generation of multimeric PCR product that usually appears as a smear in the lane 

from the slot to the expected size of the amplified product in the agarose gel. Background 

also appears if the annealing temperature is not sufficient and/or the primer concentration 

is too high. 


The authors wish to thank Dr. Mats Ohlin, University of Lund, Lund, Sweden, and 

Dr. Nuria Duran-Vila from IVIA, Valencia, Spain, for critical reading of the manuscript. 

The development of nested RT-PCR in a single closed tube has been funded by IVIA, 

INIA (SC98-060), CICYT (OLI96-2179), and EU-BIO96-0773 grants. O. Esteban 

and E. Bertolini were the recipients of PhD fellowships from Instituto Valenciano 

de Investigaciones Agarias and Agencia Española de Cooperación Internacional, 

respectively. 

References 

1. Hadidi, A., Levy, L., and Podleckis, E. V. (1995) Polymerase chain reaction technology in 

plant pathology, in Molecular Methods in Plant Pathology (Singh, R. P. and Singh, U. S., 

eds.), CRC/Lewis Press, Boca Raton, FL, pp. 167–187. 

2. Candresse, T., Hammond, R. W., and Hadidi, A. (1996) Detection and identification of 

plant viruses and viroids using polymerase chain reaction (PCR), in Control of Plant Virus 

Diseases, APS Press, St. Paul, MN, pp. 399– 416. 

3. Singh, R. P. (1998) Reverse-transcription polymerase chain reaction for the detection of 

viruses from plants and aphids. J. Virol. Methods 74, 125–138. 

4. Hamoui, S., Benedetto, J. P., Garret, M., and Bonnet, J. (1994) Quantitation of mRNA 

species by RT-PCR on total mRNA population. PCR Methods Appl. 4, 160–166. 

5. Wilson, I. G. (1997) Inhibition and facilitation of nucleic acid amplification. Appl. Environ. 

Microbiol. 63, 3741–3751. 

6. Wetzel, T., Candresse, T., Macquaire, G., Ravelonandro, M., and Dunez, J. (1992) A 

highly sensitive immunocapture polymerase chain reaction method for plum pox potyvirus 

detection. J. Virol. Methods 39, 27–37. 

7. López-Moya, J. J., Cubero, J., López-Abella, D., and Díaz-Ruíz, J. R. (1992) Detection of 

cauliflower mosaic virus (CaMV) in single aphids by de polymerase chain reaction (PCR). 

J. Virol. Methods 37, 129–138. 

8. Nolasco, G., de Blas, C., Torres, V., and Ponz, F. (1993) A method combining immunocapture 

and PCR amplification in a microtiter plate for the detection of plant viruses and 

subviral pathogens. J. Virol. Methods 45, 201–218. 

9. Rowhani, A., Maningas, M. A., Lile, L. S., Daubert, S. D., and Golino, D. A. (1995) 

Development of a detection system for viruses of woody plants based on PCR analysis of 

immobilized virions. Phytopathology 85, 347–352. 

10. Olmos, A., Dasi, M. A., Candresse, T., and Cambra, M. (1996) Print-capture PCR: A simple 

and highly sensitive method for the detection of plum pox virus (PPV) in plant tissues. 

Nucleic Acids Res. 24, 2192–2193. 

11. Olmos, A., Cambra, M., Dasi, M. A., Candresse, T., Esteban, O., Gorris, M. T., and Asensio, 

M. (1997) Simultaneous detection and typing of plum pox potyvirus (PPV) isolates by 

Heminested-PCR and PCR-ELISA. J. Virol. Methods 68, 127–137.


12. Olmos, A., Cambra, M., Esteban, O., Gorris, M. T., and Terrada, E. (1999) New device and 

method for capture, reverse transcription and nested-PCR in a single closed-tube. Nucleic 

Acids Res. 27, 1564–1565. 

13. Levy, L., Lee, I. M., and Hadidi, A. (1994) Simple and rapid preparation of infected plant 

tissue extracts for PCR amplification of virus, viroid and MLO nucleic acids. J. Virol. 

Methods 49, 295–304. 

14. Mackenzie, D. J., McLean, M. A., Mukerji, S., and Green, M. (1997) Improved RNA 

extraction from woody plants for the detection of viral pathogens by reverse transcriptionpolymerase 

chain reaction. Plant Dis. 81, 222–226. 

15. Simmonds, P., Balfe, P., Peutherer, J. F., Ludlam, C. A., Bishop, J. O., and Brown, A. 

J. (1990) Related articles human immunodeficiency virus-infected individuals contain 

provirus in small numbers of peripheral mononuclear cells and at low copy numbers. 

J. Virol. 64, 864–872. 

16. Porter-Jordan, K., Rosenberg, E. I., Keiser, J.F., Gross, J.D., Ross, A. M., Nasim, S., et al. 

(1990) Related articles nested polymerase chain reaction assay for the detection of 

cytomegalovirus overcomes false positives caused by contamination with fragmented 

DNA. J. Med. Virol. 30, 85–91. 

17. Arias, C. R., Garay, E., and Aznar, R. (1995) Nested PCR method for rapid and sensitive 

detection of Vibrio vulnificus in fish, sediments, and water. Appl. Environ. Microbiol. 

61, 3476–3478. 

18. Green, J., Henshilwood, K., Gallimore, C. I., Brown, D. W. G., and Lees, D. N. (1998) 

A nested reverse transcriptase PCR assay for detection of small round-structured viruses 

in environmentally contaminated molluscan shellfish. Appl. Environ. Microbiol. 64, 

858–863. 

19. Noyes, H., Reyburn, A. H., Bailey, J. W., and Smith, D. (1998) A nested-PCR-based 

schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from 

clinical samples and its application to the study of the epidemiology of Leishmania tropica 

in Pakistan. J. Clin. Microbiol. 36, 2877–2881. 

20. Yourno, J. (1992) A method for nested PCR with single closed reaction tubes. PCR Methods 

Appl. 2, 60–65. 

21. Wolff, C., Hornschemeyer, D., Wolf, D., and Kleesiek, K. (1995) Single-tube nested PCR 

with room-temperature-stable reagents. PCR Methods Appl. 4, 376–379. 

22. Mutasa, E. S., Chwarszczynska, D. M., and Asher, M. J. C. (1996) Single-tube, nested PCR 

for the diagnosis of Polymyxa betae infection in sugar beet roots and colorimetric analysis 

of amplified products. Phytopathology 86, 493– 497. 

23. Bertolini, E., Olmos, A., López, M. M., and Cambra, M. (2003) Multiplex nested RT-PCR in 

a single tube for sensitive and simultaneous detection of four RNA viruses and Pseudomonas 

savastonoi pv savastanoi in olive trees. Phytopathology (in press). 

24. Olmos, A., Bertolini, E., and Cambra, M. (2002) Simultaneous and co-operational 

amplification (Co-PCR): a new concept for detection of plant viruses. J. Virol. Methods 

106, 51–59. 

25. Altschul, S. F., Madden, T. L., Schäfer, A. A., Zhang, J., Zhang, Z., Miller, W., et al. (1997) 

Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. 


26. Rosner, A., Maslenin, L., and Spiegel, S. (1997) The use of short and long PCR products 

for improved detection of prunus necrotic ringspot virus in woody plants. J. Virol. Methods 

67, 135–141. 

27. Singh, M. and Singh, R. P. (1997) Potato virus Y detection: sensitivity of RT-PCR depends 

on the size of fragment amplified. Can. J. Plant Pathol. 19, 149–155.

160 Olmos et al.

Direct PCR from Serum 161 

27 

Direct PCR from Serum 

Application to Viral Genome Detection 

Kenji Abe 


Nucleic acids used for polymerase chain reaction (PCR) assays usually are extracted 

by the phenol-chloroform method or an alternative rapid purification. The acidguanidinium 

thiocyanate-phenol-chloroform method for RNA extraction and proteinase 

K digestion-phenol-chloroform method for DNA extraction from serum samples are 

used widely for PCR assays (1,2), but usually at least 3 h are needed for this step. 

Detection of RNA is more difficult and complex than that of DNA, mainly because of 

the contaminating RNase and the need to conduct an additional reverse transcription 

(RT) step. Additionally, another problem is the high cost of the reagents for RNA 

extraction. Recently, we reported that viral RNA and DNA are readily amplified 

directly from serum without purification of nucleic acids by direct (RT) PCR (3). The 

method is sensitive because as little as 1 µL of the initial serum produces a clearly 

visible amplified fragment, and there is no difference in the sensitivity and stability 

between the direct PCR and conventional PCR assay. Interestingly, the results of the 

direct PCR are much better when 1 to 2 µL is used rather than 3 to 5 µL of serum. 

This inability to amplify RNA/DNA from serum may be to the result of the masking 

of the target RNA/DNA by coagulated proteins during the initial heat denaturation or 

the presence in the serum of inhibitors (probably such as lipoprotein) of the enzyme 

reaction. The sensitivity of the direct PCR assay allows detection of as few as one copy 

of viral genome. This technique not only eliminates the risk of cross contamination 

during nucleic acid extraction but also is cost and time saving. In this chapter, we 

describe the method of the direct (RT) PCR assay and apply it for detection of hepatitis 

B virus (HBV) DNA and hepatitis C virus (HCV) RNA in serum specimens. 

2. Materials 


2. AmpliTaq Gold DNA polymerase 5 U/µL (Perkin–Elmer). 

3. 10× reaction buffer containing 15 mM MgCl 2 (supplied with AmpliTaq Gold DNA 

polymerase kit). 

4. RNase inhibitor 40 U/µL (Promega). 



161

162 Abe 

5. Moloney murine leukemia virus: 200 U(µL (M-MLV) reverse transcriptase (Gibco BRL). 

6. Primer sequences used for detection of HBV DNA and HCV RNA by direct (RT) PCR 

are listed in Table 1 (100 ng/µL). 

7. Deoxy nucleotide triphosphate (dNTP) mixture: 10 mM (Pharmacia Biotech). 

8. Phosphate-buffered saline (PBS): Dissolve 8 g of NaCl, 0.2 g of KCl, 1.44 g of Na 2 HPO 4 , 

and 0.24 g of KH 2 PO 4 in 800 mL of distilled H 2 O. Adjust the pH to 7.4 with HCl. Add 

H 2 O to 1 L. Dispense the solution into aliquots and sterilize them by autoclaving for 

20 min at 15 psi in. on liquid cycle. Store at room temperature. 

9. RNase-free H 2 O. 

10. 50-bp DNA ladder (Pharmacia Biotech). 

3. Methods 

3.1 Pretreatment of Serum Samples (see Note 1) 

1. Serum samples (4 µL) are diluted with PBS to the final volume of 20 µL (15 dilution, 

see Note 1). 

2. The diluted serum samples are heated for 3 min at 95°C then cooled rapidly on ice for 

3 to 5 min. 

3. Five microliters of the heat-denatured diluted serum samples (= 1 µL of serum) are used 

as templates for the nested (RT) PCR. 

3.2. PCR Reaction 

1. Set up PCR mastermixes as follows. 

a. Reverse transcription and first PCR buffer (when performing DNA PCR omit RNase 

Inhibitor and M-MLV Reverse Transcriptase, see step 4). 

for RNA for DNA 

Ingredients µL µL Final concentration 

10× AmpliTaq Gold buffer 5 5 1× (1.5 mM MgCl 2 ) 

(containing 15 mM MgCl 2 ) 

10 mM dNTP mix 1 1 200 µM 

Sense primer (100 ng/µL) 1 1 100 ng 

Antisense primer (100 ng/µL) 1 1 100 ng 

AmpliTaq Gold DNA polymerase (5 U/µL) 0.4 0.4 2 U 

RNase inhibitor (40 U/µL) 0.25 None 10 U 

M-MLV reverse transcriptase (200 U/µL) 0.5 None 100 U 

RNase-free H 2 O 35.85 36.6 

Total 45 µL 45 µL 

b. Second PCR buffer 

Ingredients µL Final concentration 

10× AmpliTaq Gold buffer 5 1× (1.5 mM MgCl 2 ) 

(containing 15 mM MgCl 2 ) 

10 mM dNTP mix 1 200 µM 

Sense primer (100 ng/µL) 1 100 ng 

Antisense primer (100 ng/µL) 1 100 ng 

AmpliTaq Gold DNA polymerase (5 U/µL) 0.4 2 U 

RNase-free H 2 O 39.1 

Total 47.5 µL

163 

Table 1 

Primer Sequences Used for Nested PCR 

Primer Sequence Primer pair Product size 

For HBV DNA (X region) 

MD24 5′-TGCCAACTGGATCCTTCGCGGGACGTCCTT-3′ (nt 1392-1421) MD24/MD26 (1st) 233bp 

MD26 5′-GTTCACGGTGGTATAAATG-3′ (nt 1625-1607) 

HBx1 5′-GTCCCCTTCTTCATCTGCCGT-3′ (nt 1487-1507) HBx1/HBx2 (2nd) 117 bp 

HBx2 5′-ACGTGCAGAGGTGAAGCGAAG-3′ (nt 1604-1584) 

For HCV RNA (5′-untranslated region) 

19 5′-GCGACACTCCACCATAGAT-3′ (nt 2-20) 19/20 (1st) 329 bp 

20 5′-GCTCATGGTGCACGGTCTA-3′ (nt 330-312) 

21 5′-CTGTGAGGAACTACTGTCT-3′ (nt 28-46) 21/22 (2nd) 268 bp 

22 5′-ACTCGCAAGCACCCTATCA-3′ (nt 295-277) 

Nucleotide positions deduced from HBVadr4 (see ref. 4) for HBV and HC-J1 for HCV (see ref. 5) 

Direct PCR from Serum 163

164 Abe 

Table 2 

Detection Rate of Hepatitis Virus Nucleic Acids in Serum. 

Comparison of Conventional PCR and Direct PCR 

HBV DNA HCV RNA HGV RNA 

Conventional PCR Positive 121 56 32 

Direct PCR-Positive 121 51 30 

Agreement Rate 100% 91% 94% 

Fig. 1. Efficiency of serum volume and diluent as a factor in HCV-PCR reaction. A different 

amount of serum sample ranging in volume from 1 to 5 µL of serum was used. Each aliquot 

of serum, except for the 5 µL of volume, was diluted with PBS or H 2 O to the final volume of 

5 µL, respectively. M = 50-bp DNA ladder. 

2. Perform the first PCR reaction by adding 45 µL of mastermix 1 to each 5-µL sample of 

heat-inactivated serum from Subheading 3.1. Then, program the thermocycler to incubate 

the samples for 50 min at 37°C for the initial RT step and then preheat at 95°C for 10 min 

to activate AmpliTaq Gold followed by 50 cycles consisting of 94°C for 20 s, 55°C for 20 s, 

and 72°C for 30 s using a Thermal Cycler. RT-PCR is performed with a one-step method 

combined with cDNA synthesis reaction, followed by the PCR reaction in a single tube 

(see Note 2). That is, for RNA of HCV, the first PCR is combined with the RT step 

in the same tube containing 50 µL of a reaction buffer as shown above. To obtain an 

automatic hot-start reaction, we use the AmpliTaq Gold DNA polymerase instead of 

regular thermostable DNA polymerase. 

3. For the second reaction, 2.5 µL (1/20 volume) of the first PCR product is added to a tube 

containing second PCR buffer. The thermocycling for 50 cycles is performed as above, but 

omitting the initial 50 minute incubation at 37°C and the annealing temperature is raised 

to 60°C instead of 55°C for the second round of PCR. 

4. The PCR products are electrophoresed on a 2% agarose gels staining with ethidium 

bromide and evaluated under ultraviolet light. The sizes of PCR products are estimated 

according to the migration pattern of 50-bp DNA ladder. 

4. Notes 

1. Examination of the optimal serum quantity reveals that 1 to 2 µL of serum give a readily 

amplifiable band of HCV RNA but 3 µL of serum give a faint band and 4 to 5 µL of serum 

do not yield any band (Fig. 1). This result is much better when PBS is used to dilute serum 

than that obtained using H 2 O. It is similar even if this result is in the case of HBV. 

2. The whole process of the direct RT-PCR can be completed within 6 h by combination with 

the one-step amplification method and the second round PCR. 

3. Detection rate of HCV RNA and HBV DNA by direct PCR are consistent with the results 

obtained by conventional PCR (Fig. 2 and Table 2).

Direct PCR from Serum 165 

Fig. 2. Result of HCV-RNA detection in clinical serum samples. Comparison of conventional 

RT-PCR and direct RT-PCR. 

Fig. 3. An outline of direct (RT)-PCR.

166 Abe 

4. For HBV, nested PCR using the same PCR buffer for RT-PCR, but without reverse 

transcriptase and omitting cDNA synthesis step is performed. 

5. An outline of direct (RT)-PCR is shown in Fig. 3. 

References 


guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 

2. Kunkel, L. M., Smith, K. D., Boyer, S. H., Borgaonkar, D. S., Wachtel, S. S., Miller, O. J., 

et al. (1977) Analysis of human Y-chromosome-specific reiterated DNA in chromosome 

variants. Proc. Natl. Acad. Sci. USA 74, 1245–1249. 

3. Abe, K., Konomi, N., and Abdel-Hamid, M. (1998) Direct polymerase chain reaction 

for detection of hepatitis B, C and G virus genomes from serum without nucleic acid 

extraction—simple, rapid and highly sensitive method. Hepatol. Res. 13, 62–70. 

4. Fujiyama, A., Miyanchara, A., Nozaki, C., Yoneyama, T., Ohtoma, N., and Matsubara, K. 

(1983) Cloning and structural analyses of hepatitis B virus DNAs, subtype adr. Nucleic 

Acids Res. 11, 4601–4610. 

5. Okamoto, H., Okada, S., Sugiyama, Y., Yotsumoto, S., Tanaka, T., Yoshizawa, H., et al. 

(1990) the 5′-terminal sequence of the hepatitis C virus genome. Jpn J. Exp. Med. 60, 

167–177.

Long PCR 167 

28 

Long PCR Amplification of Large Fragments 

of Viral Genomes 

A Technical Overview 



1.1. Long PCR 

The polymerase chain reaction (PCR) has become an essential and ubiquitous 

tool for biological research and laboratory diagnostic applications. Until recently, 

reliable and sensitive amplification of large templates (several kb) was difficult to 

achieve. However, in 1994, an important breakthrough was reported by Barnes (1). 

He hypothesized that a major obstacle to long PCR was the Taq DNA polymerase 

error rate, which causes mismatches that make elongation very inefficient. Many other 

thermostable DNA polymerases have a 3′ to 5′ exonuclease “proofreading” activity and 

a higher fidelity. However, the use of these polymerases alone does not reliably achieve 

long PCR, presumably because of excessive degradation of primers by the exonuclease 

activity (1). The processivity of the enzyme may also be a factor. Of note, the 3′ to 5′ 

exonuclease activity alone is not a guarantee of high fidelity: Fidelity also depends 

on the degree of discrimination against misinsertion, the mismatch extension rate, 

and the rate of shuttling between polymerizing and proofreading modes (2). The 

breakthrough reported by Barnes consisted in performing PCR with a mixture of 

two DNA polymerases: a major component consisting of a highly processive DNA 

polymerase and a minor component consisting of a DNA polymerase with a 3′ to 5′ 

exonuclease “proofreading” activity. With such enzyme mixes, reliable amplification 

of templates up to 35 kb in length was achieved (1). The greater fidelity of long PCR 

enzyme mixes, relative to Taq, has been demonstrated (1,2). Other modifications 

contribute to making long PCR possible, including optimization of the buffer and the 

thermal cycling conditions. It is especially important to address the drop in pH at high 

temperature observed with Tris-based buffers (1,3). This is significant because DNA 

depurination is enhanced both by high temperature and by low pH. Because a larger 

DNA template is more likely than a small template to sustain depurination at sites 

within its boundaries, long PCR is inherently more vulnerable to depurination (1,3). 

Interestingly, in contrast to 3′ to 5′ exonuclease-deficient DNA polymerases, the fidelity 



167

168 Tellier et al. 

of Pfu (and therefore possibly of other proofreading DNA polymerases) actually 

increases with the pH (2). In general, long PCR works better with rapid temperature 

transition, which is addressed by using smaller reaction and mineral oil volumes, 

thin-wall PCR tubes, and rapid thermocyclers (1,3). Synthesis of amplicons of up to 

42 kb has now been reported (3). 

There are currently several commercially available long PCR kits, made from 

different enzymes and requiring somewhat different protocols. It is expected that new 

thermostable enzymes will be introduced. More research will be needed to determine 

which enzyme mix is superior for which application. 

1.2. Long RT-PCR 

Long PCR from mRNAs or from the genomes of RNA viruses obviously necessitates 

the synthesis of a sufficient amount of long cDNA. In some systems, such as plant 

viruses, it is possible to start with a large amount of RNA (4). For the more common 

scenario where the amount of RNA is limited, many have reported good results with the 

use of reverse-transcriptase enzymes that have been engineered to destroy the RNase H 

activity of the enzyme (5–15). In principle, this would prevent the premature destruction 

of the RNA template before the synthesis of a large cDNA copy. A potential problem 

with the synthesis of long cDNA is the presence of strong secondary structures in some 

template RNAs. To some extent, this problem can be addressed by raising the temperature 

as high as enzyme stability permits during reverse transcription. For example, 

the RNase H-deficient reverse transcriptase Superscript II is active at temperatures up 

to 50°C (although its optimal temperature is between 42 and 45°C; ref. 16). Another 

approach is to use the thermostable DNA polymerase rTth which in the presence of 

Mn 2+ has a reverse transcriptase activity at temperatures up to 70°C (17,18). A 

fundamental limitation with this approach is that the RNA hydrolysis catalyzed by 

divalent cations is accelerated by high temperature (17,19). Recent reports on the use of 

nucleic acid isostabilizers, such as betaine (20), and the thermal stabilization of enzymes 

by trehalose (18) may lead to further refinements in this area. 

2. Applications of Long PCR 

2.1. General Applications 

The availability of long PCR obviates some shortcomings of standard PCR: Not only 

does it speed up cloning or sequencing of genetic sequences of interest, but it extends 

the power of the PCR by enabling it to bridge large gaps of unknown or variable 

sequences between primers. As examples of the latter, there have been many reports of 

the use of long PCR to amplify introns of unknown sequence using primers targeting 

the adjacent exons (e.g., refs. 21–24), or to characterize transposons in Drosophila (25). 

Long PCR has also been used to amplify the complete mitochondrial genome (26) and 

large genomic fragments for the determination of deletions in genetic diseases (27,28) 

or gene fusions in cancer (29). Other applications in microbiology include bacterial 

typing (30,31) and amplification of Plasmodium falciparum DNA (32). 

2.2. Long PCR and Viruses 

Long PCR has been applied with great success to viral genomes. For example, 

amplification of full-length, near full-length, or large fragments of the genome of many 

DNA viruses has been achieved, such as for the hepatitis B virus (HBV) (8,33), the

Long PCR 169 

human papilloma virus (34), SV-40 (35), varicella-zoster virus (36), the proviruses 

of the simian foamy virus of chimpanzees (SFVcpz) (37), human T-cell leukemia 

virus 1 (HTLV-1) (38), and human immunodeficiency virus type 1 (HIV-1) (39–41) 

and type 2 (HIV-2) (42). 

Long RT-PCR for RNA viruses has also been successful. Large fragments of the viral 

genome have been amplified for the tick-borne encephalitis virus (6), the Norwalk-like 

viruses (12), the hepatitis C virus (HCV) (13), and the bovine torovirus (43). The near 

full-length genome was amplified for HCV (8,14) and the full-length genome for the 

potato virus Y (4), hepatitis A virus (HAV) (7,9), hepatitis E virus (44), poliovirus (11), 

and coxsackie B2 virus (10,15). 

For HAV, we have shown that RNA transcribed directly from the full-length amplicon 

is infectious (7,9). Furthermore, long PCR has greatly facilitated the construction 

of infectious clones or infectious cDNAs for HBV (33), SV-40 (35), SFVcpz (37), 

HIV-1 (41), tick borne encephalitis virus (6), HAV (9), coxsackie B2 (15), coxsackie 

B6 (45), HCV (46,47), and potato virus Y (4). These results confirm the high fidelity 

of long PCR. 

In addition to streamlining the cloning and sequencing of viral genomes, long PCR 

presents other advantages for virology. For example, many viral sequences are toxic to 

Escherichia coli, leading to selection bias in cloning procedures (48). This problem 

can be circumvented to a great extent by long PCR because large amplicons can be 

directly sequenced (or transcribed). Furthermore, direct sequencing of amplicons 

provides a certain protection against DNA polymerase mistakes during PCR: Unless 

these mistakes occur in the early cycles, at each position the majority of amplicons will 

have the correct nucleotide and the sequencing will provide the correct result, whereas 

cloning might select an amplicon with mistakes. However, one must remember 

that there are circumstances, such as when encountering homopolymeric stretches, 

tandem repeats, extreme AT or GC content, or strong secondary structures, in which 

polymerases can produce systematic mistakes (49–52). 

Long PCR is also of great interest for RNA viruses, which typically exist as 

“quasispecies,” a mixed population containing several variants. Not only does direct 

sequencing of the amplicon yield immediately the consensus sequence, but it has been 

proposed that long PCR can be used to preserve and propagate a representative DNA 

version of such a “quasispecies” (9,11). In fact, it has been shown that long PCR 

preserves the distribution of variants of poliovirus (11) and HIV-1 (53). In the latter 

study, however, a relatively high rate of recombination between templates was observed 

after performing PCR (53). Recombination was measured by cloning and sequencing, 

and thus this measurement is possibly affected by a selection bias from the cloning 

process. Nonetheless, because of this observation, and pending further research on 

this topic, the possibility of artifactual recombination should be kept in mind. Because 

the recombination is thought to occur as the result of incomplete transcripts acting 

as “mega primers” in subsequent PCR cycles (53,54), careful optimization of the 

elongation time during PCR may minimize this problem. The use of polymerases with 

high processivity may also diminish the occurrence of recombination (54). 

References 

1. Barnes, W. M. (1994) PCR amplification of up to 35-kb DNA with high fidelity and high 

yield from λ bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220.


2. Cline, J., Braman, J. C., and Hogrefe, H. H. (1996) PCR fidelity of Pfu DNA polymerase 

and other thermostable DNA polymerases. Nucleic Acids Res. 24, 3546–3551. 

3. Cheng, S., Fockle, C., Barnes, W. M., and Higuchi, R. (1994) Effective amplification of 

long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad Sci. USA 

91, 5695–5699. 

4. Fakhfakh, H., Vilaine, F., Makni, M., and Robaglia, C. (1996) Cell-free cloning and biolistic 

inoculation of an infectious cDNA of potato virus Y. J. Gen. Virol. 77, 519–523. 

5. Nathan, M., Mertz, L. M., and Fox, D. K. (1995) Optimizing long RT-PCR. Focus 17, 

78–80 

6. Gritsun, T. S. and Gould, E. A. (1995) Infectious transcripts of tick-borne encephalitis 

virus, generated in days by RT-PCR. Virology 214, 611–618. 

7. Tellier, R., Bukh, J., Emerson, S. U., and Purcell, R. H. (1996) Amplification of the fulllength 

hepatitis A virus genome by long reverse transcription-PCR and transcription of 

infectious RNA directly from the amplicon. Proc. Natl. Acad. Sci. USA 93, 4370– 4373. 

(Erratum published in Proc. Natl. Acad. Sci. USA 1997;94:10,485) 

8. Tellier, R., Bukh, J., Emerson, S. U., Miller, R. H., and Purcell, R. H. (1996) Long PCR and 

its application to hepatitis viruses: amplification of hepatitis A, hepatitis B and hepatitis C 

virus genomes. J. Clin. Microbiol. 34, 3085–3091. (Erratum published in J. Clin. Microbiol. 

1997;35:2713). 

9. Tellier, R., Bukh, J., Emerson, S. U., and Purcell, R. H. (1997) Amplification of the 

full length hepatitis A virus by long RT-PCR and generation of infectious RNA directly 

from the amplicon, in Viral Hepatitis and Liver Disease Proceedings of the IX Triennial 

International Symposium on Viral Hepatitis and Liver Disease (Rizzetto, M., Purcell, R. H., 

Gerin, J. L., and Verme G., eds.), Minerva Medica, Turin, pp. 48–50. 

10. Gow, J. W., McGill, M. M., Behan, W. M. H., and Behan, P. O. (1996) Long RT-PCR 

amplification of full-length enterovirus genome. BioTechniques 20, 582–584. 

11. Chumakov, K. M. (1996) PCR engineering of viral quasispecies: A new method to preserve 

and manipulate genetic diversity of RNA virus populations J. Virol. 70, 7331–7334. 

12. Ando, T., Monroe, S. S., Noel, J. S., and Glass, R. I. (1997) A one tube method of reverse 

transcription-PCR to efficiently amplify a 3-kilobase region from the RNA polymerase 

gene to the poly(A) tail of small round-structured viruses (Norwalk-like viruses). J. Clin. 

Microbiol. 35, 570–577. 

13. Rispeter, K., Lu, M., Lechner, S., Zibert, A., and Roggendorf, M. (1997) Cloning and 

characterization of a complete open reading frame of the hepatitis C virus genome in only 

two cDNA fragments. J. Gen. Virol. 78, 2751–2759. 

14. Wang, L-F., Radkowski, M., Vargas, H., Rakela, J., and Laskus, T. (1997) Amplification and 

fusion of long fragments of hepatitis C virus genome. J. Virol. Methods 68, 217–223. 

15. Lindberg, A. M., Polacek, C., and Johansson, S. (1997) Amplification and cloning of 

complete enterovirus genomes by long distance PCR. J. Virol. Methods 65, 191–199. 

16. Gibco BRL (1994) Technical bulletin 18064-2. Gibco BRL, Gaithersburg, Md. 

17. Myers, T. W. and Gelfand, D. H. (1991) Reverse transcription and DNA amplification by a 

Thermus thermophilus DNA polymerase. Biochemistry 30, 7661–7666. 

18. Carninci, P., Nishiyama, Y., Westover, A., Itoh, M., Nagaoka, S., Sasaki, N., et al. (1998) 

Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its 

application for the synthesis of full length cDNA. Proc. Natl. Acad. Sci. USA 95, 520–524. 

19. Lindahl, T. (1967) Irreversible heat inactivation of transfer ribonucleic acids. J. Biol. 

Chem. 242, 1970–1973. 

20. Henke, W., Herdel, K., Jung, K., Schnorr, D., and Loening, S. A. (1997) Betaine improves 

the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957–3958.

Long PCR 171 

21. Gaedigk, R., Karges, W., Hui, M. F., Scherer, S. W., and Dosch, H.-M. (1996) Genomic 

organization and transcript analysis of ICAp69, a target antigen in diabetic autoimmunity. 

Genomics 38, 382–391. 

22. Purroy, J., Bisceglia, L., Calonge, M. J., Zelante, L., Testar, X., Zorzano, A., et al. (1996) 

Genomic structure and organization of the human rBAT gene (SLC3A1). Genomics 37, 

249–252. 

23. Nobile, C., Marchi, J., Nigro, V., Roberts, R. G., and Danieli, G. A. (1997) Exon-intron 

organization of the human dystrophin gene. Genomics 45, 421– 424. 

24. Kelley, P. M., Weston, M. D., Chen, Z.-Y, Orten, D. J., Hasson, T., Overbeck, L. D., et al. 

(1997) The genomic structure of the gene defective in Usher syndrome type 1b (MYO7A). 

Genomics 40, 73–79. 

25. Gordadze, A. V. and Beněs, H. (1996) Long PCR-based technique for detection of transposon 

insertions in and around cloned genes of Drosophila melanogaster. BioTechniques 

21, 1062–1066. 

26. Li, Y.-Y., Hengstenberg, C., and Maisch, B.(1995) Whole mitochondrial genome amplification 

reveals basal level multiple deletions in mtDNA of patients with dilated cardiomyopathy. 

Biochem. Biophys. Res. Commun. 10, 211–218. 

27. Bochmann, H., Gehrisch, S., and Jaross, W. (1996) Fast amplification of the low density 

lipoprotein receptor gene and detection of a large deletion by means of long polymerase 

chain reaction. Eur. J. Clin. Chem. Clin. Biochem. 34, 955–959. 

28. Hećimović, S., Barišić, I., Müller, A., Pertković, I., Barić, I., Ligutić, et al. (1997) Expand 

long PCR for fragile X mutation detection. Clin. Genet. 52, 147–154. 

29. Waggott, W., Lo, Y.-M. D., Bastard, C., Gatter, K. C., Leroux, D., Mason, D. Y., et al. 

(1995) Detection of NPM-ALK DNA rearrangement in CD30 positive anaplastic large-cell 

lymphoma. Br. J. Haematol. 89, 905–907. 

30. Smith-Vaughan, H. C., Sriprakash, K. S., Mathews, J. D., and Kemp, D. J. (1995) 

Long PCR-ribotyping of nontypeable Haemophilus influenzae. J. Clin. Microbiol. 33, 

1192–1195. 

31. Hookey, J. V., Saunders, N. A., Clewley, J. P., Efstratiou, A., and George, R. C. (1996) 

Virulence regulon polymorphism in group A streptococci revealed by long PCR and implications 

for epidemiological and evolutionary studies. J. Med. Microbiol. 45, 285–293. 

32. Su, X.-Z., Wu, Y., Sifri, C. D., and Wellems, T. E. (1996) Reduced extension temperatures 

required for PCR amplification of extremely A+T– rich DNA. Nucleic Acids Res. 24, 

1574–1575. 

33. Günther, S., Li, B.-C., Miska S., Krüger, D. H. Meisel, H., and Will, H. (1995) A novel 

method for efficient amplification of whole hepatitis B virus genomes permits rapid 

functional analysis and reveals deletion mutants in immunosuppressed patients. J. Virol. 

69, 5437–5444. 

34. Stewart, A.-C. M., Gravitt, P. E., Cheng, S., and Wheeler, C. M. (1995) Generation of 

entire human papillomavirus genomes by long PCR: frequency of errors produced during 

amplification. Genome Res. 5, 79–88. 

35. Lednicky, J. A., Jafar, S., Wong, C., and Butel, J. S. (1997) High-fidelity PCR amplification 

of infectious copies of the complete simian virus 40 genome from plasmids and virusinfected 

cell lysates. Gene 184, 189–195. 

36. Takayama, M., Takayama, N., Inoue, N., and Kameoka, Y. (1996) Application of long PCR 

method to identification of variations in nucleotide sequences among Varicella-Zoster virus 

isolates. J. Clin. Microbiol. 34, 2869–2874. 

37. Herchenröder, O., Turek, R., Neumann-Haefelin, D., Rethwilm, A., and Schneider, J. (1995) 

Infectious proviral clones of chimpanzee foamy virus(SFVcpz) generated by long PCR 

reveal close functional relatedness to human foamy virus. Virology 214, 685–689.


38. Tamiya, S., Matsuoka, M., Etoh, K.-I., Watanabe, T., Kamihira, S., Yamaguchi K., et al. 

(1996) Two types of defective human T-lymphotropic virus type 1 provirus in adult T-cell 

leukemia. Blood 88, 3065–3073. 

39. Salminen, M. O., Koch, C., Sanders-Buell, E., Ehrenberg, P. K., Michael, N. L., Carr, J. K., 

et al. (1995) Recovery of virtually full-length HIV-1 provirus of diverse subtypes from 

primary virus cultures using the polymerase chain reaction. Virology 213, 80–86. 

40. Salminen, M. O., Johansson, B., Sönnerborg, A., Ayehunie, S., Gotte, D., Leinikki, P., et al. 

(1996) Full-length sequence of an Ethiopian human immunodeficiency virus type 1 (HIV-1) 

isolate of genetic subtype C. Aids Res. Hum. Retroviruses 12, 1329–1339. 

41. Gao, F., Robertson, D. L., Carruthers, C. D., Morrison, S. G., Jian, B., Chen, Y., et al. (1998) 

A comprehensive panel of near-full-length clones and reference sequences for non-subtype 

B isolates of human immunodeficiency virus type 1. J. Virol. 72, 5680–5698. 

42. Damond, F., Loussert-Ajaka, I., Apetrei, C., Descamps, D., Souquière, S., Leprêtre, A., 

et al. (1998) Highly sensitive method for amplification of human immunodeficiency virus 

type 2 DNA. J. Clin. Microbiol. 36, 809–811. 

43. Duckmanton, L. M., Tellier, R., Liu, P., and Petric, M. (1998) Bovine torovirus: sequencing 

of the structural genes and expression of the nucleocapsid protein of Breda virus. Virus 

Res. 58, 83–96. 

44. Donati, M. C., Fagan, E. A., and Harrison, T. J. (1996) Sequence analysis of full length 

HEV clone derived directly from human liver in fulminant hepatitis E, in Viral Hepatitis 

and Liver Disease, Proceedings of the IX Triennial International Symposium on Viral 

Hepatitis and Liver Disease (Rizzetto, M., Purcell, R. H., Gerin, J., and Verme, G., eds.), 

Minerva Medica, Turin, pp. 313–316. 

45. Martino, T. A., Tellier, R., Petric, M., Irwin, D. M., Afshar A., and Liu P. (1999) The 

complete consensus sequence of coxsackievirus B6 and generation of infectious clones by 

long RT-PCR. Virus Res. 64, 77–86. 

46. Yanagi, M., Purcell, R. H., Emerson S. U., and Bukh, J. (1997) Transcripts from a single 

full-length cDNA clone of hepatitis C virus are infectious when directly transfected into the 

liver of a chimpanzee. Proc. Natl. Acad. Sci. USA 94, 8738–8743. 

47. Yanagi, M., St. Claire, M., Shapiro, M., Emerson, S. U., Purcell., R. H., and Bukh, J. (1998) 

Transcripts of a chimeric cDNA clone of hepatitis C virus genotype 1b are infectious in 

vivo. Virology 244, 161–172. 

48. Forns, X., Bukh, J., Purcell, R. H., and Emerson, S. U. (1997) How Escherichia coli can bias 

the results of molecular cloning: preferential selection of defective genomes of hepatitis C 

virus during the cloning procedure. Proc. Natl. Acad. Sci. USA 94, 13,909–13,914. 

49. Loewen, P. C. and Switala, J. (1995) Template secondary structure can increase the error 

frequency of the DNA polymerase from Thermus aquaticus. Gene 164, 59–63. 

50. Wu, M. J., Chow, L. W., and Hsieh, M. (1998) Amplification of GAA/TTC triplet repeat in 

vitro: Preferential expansion of (TTC)n strand. Biochem. Biophys. Acta 1407, 155–162. 

51. Ji, J., Clegg, N. J., Peterson, K. R., Jackson, A. L., Laird, C. D., and Loeb, L. A. (1996) In 

vitro expansion of GGC:GCC repeats: identification of the preferred strand of expansion. 


52. Kroutil, L. C., Register, K., Bebenek, K., and Kunkel, T. A. (1996) Exonucleolytic 

proofreading during replication of repetitive DNA. Biochemistry 35, 1046–1053. 

53. Yang, Y. L., Wang, G., Dorman, K., and Kaplan, A.H. (1996) Long polymerase chain 

reaction amplification of heterogeneous HIV type 1 templates produces recombination at a 

relatively high frequency. Aids Res. and Hum. Retroviruses 12, 303–306. 

54. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., et al. (1988) 

Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. 

Science 239, 487– 491.

Long PCR Methodology 173 

29 

Long PCR Methodology 



In this chapter, we detail protocols of long polymerase chain reaction (PCR) and 

long RT-PCR, which we have found to be versatile, sensitive, and straightforward to 

optimize. We have used these protocols with success on several different templates, 

including lambda phage DNA, HAV, HBV, HCV (1), torovirus (2), coxsackie B6 

virus (3), and human beta galactosidase mRNA (R. Tellier, unpublished data). The 

guanine–cytosine (GC) content of these templates varied from 37.8 to 58.8%. These 

protocols have also been used on genomic human DNA with success (4). 

The long PCR protocol we use is derived from the method described by Barnes 

(5) for KLA-16, a mixture of KlenTaq 1 and Pfu. We have replaced this mix by a 

commercially available mix, Advantage KlenTaq Polymerase mix (Clontech), a mix 

of KlenTaq 1, and Deep Vent. In our hands, this mix was found to produce more 

consistent results. KlenTaq 1 is an N-terminal deletion mutant of Taq, analogous to 

the Klenow fragment enzyme, and devoid of the 5′- 3′ exonuclease activity of Taq (5). 

Unexpectedly, KlenTaq 1 was also found to be more thermostable and slightly more 

accurate than Taq (5,6), as well as less sensitive to variation in Mg 2+ concentration 

and more processive than Taq (7). 

2. Materials 

1. Water free of RNase, DNAse, and proteinase (ddH 2 O). Aliquot and store at –20°C. 

2. DTT (100 mM, Promega or Gibco BRL). Store at –20°C. 

3. RNasin (20–40 U/µL; Promega). Store at –20°C. 

4. Superscript II reverse transcriptase (Gibco BRL/Life Technologies). Store at –20°C. 

5. 5× RT buffer (Gibco BRL). Store at –20°C. 

6. RNase H (1–4 U/µL; Gibco BRL). Store at –20°C. 

7. RNase T1 (900–3000 U/µL; Gibco BRL). Store at –20°C. 

8. 50× Advantage KlenTaq Polymerase Mix (Clontech). Store at –20°C(see Note 1). 

9. 10× KlenTaq PCR buffer (Clontech). Store at –20°C (see Note 2). 

10. dNTP mix (10 mM each). Prepared in ddH 2 O from 100 mM dNTP set (Pharmacia). Aliquot 

and store at –80°C. 

11. Mineral oil (molecular biology grade, Sigma). 

12. Primers. Aliquot at a concentration of 10 µM in ddH 2 O, store at –20°C (see Note 3). 



173


13. Thin-wall PCR tubes (Stratagene; see Note 4). 

14. Robocycler 40 (Stratagene; see Note 5). 

3. Methods: Long PCR 

3.1. Long PCR of DNA 

1. Components of the PCR are prepared in a master mix. For each reaction use the following: 

10× KlenTaq PCR buffer (5 µL); 1.25 µL of dNTP mix (10 mM each) L; 1 µL of 

sense primer (10-µM stock); 1 µL of antisense primer (10-µM stock); 1 µL of KlenTaq 

Advantage; and 30.75 µL of ddH 2 O. 

2. Aliquot 40 µL in thin-wall 0.5-mL PCR tubes and keep at room temperature. Add 10 µL 

of the DNA template to the mix. Overlay with 40 µL of mineral oil. 

3. Cycling parameters. We use a Robocycler 40; during each cycle of PCR we use the 

following parameters (see Note 6): denaturation: 99°C × 35 s; annealing: 67°C × 30 s; and 

elongation: 68°C × (optimal time for the targeted amplicon; see Note 7). 

3.2. Nested Long PCR 

1. We have shown that the strategy of nested PCR can be applied with success to long PCR. 

It requires a slightly modified master mix, including per reaction (see Note 8): 4.5 µL 

of 10× KlenTaq PCR buffer; 1.25 µL of dNTP mix (10 mM each); 1 µL of sense primer 

(10 µM); 1 µL of antisense primer (10 µM); 1 µL of KlenTaq Advantage; and 36.25 µL 

of ddH 2 O. 

2. Aliquot 45 µL of master mix in 0.5-mL thin-wall PCR tubes and overlay with 40 µL of 

mineral oil. Add 5 µL of the first-round PCR (see Notes 9 and 10). 

3. Cycling parameters as in Subheading 3.1. 

3.3. Long RT-PCR 

3.3.1. Reverse Transcription 

1. Components of the reverse transcription are prepared in a master mix. For each reaction 

use (see Note 11) the following: 4 µL of 5× RT buffer; 0.5 µL of RNasin; 1 µL of DTT 

(100 mM); 1 µL of dNTP mix (10 mM each); 2.5 µL of primer (10 µM; see Note 12); 

and 1 µL of Superscript II. 

2. Heat the 10 µL of RNA aliquot at 65°C for 2 min, and then put on ice. 

3. Add 10 µL of master mix and incubate 1 h at 42°C (see Note 13). 

4. Put on ice, add 1 µL of RNase H and 1 µL of RNase T1, and incubate 20 min at 37°C 


5. Keep on ice until used in long PCR or keep frozen for later use. 

3.3.2. Long RT-PCR 

Because of buffer incompatibility (the buffer for Superscript II contains KCl), not 

all of the RT reaction can be used in the PCR. We obtain good results by transferring 

a small amount of the RT reaction into a long PCR mix. The remainder of the RT 

reaction can then be frozen and used at a later time. 

1. To amplify by long PCR the cDNA produced in the RT, we prepare a master mix as in 

Subheading 3.1. but corrected for adding the template in a volume of 2 µL. For each 

reaction, use the following: 5 µL of 10 × KlenTaq PCR buffer; 1.25 µL of dNTP mix 

(10 mM each); 1 µL of sense primer (10-µm stock); 1 µL of antisense primer (10-µm 

stock); 1 µL of KlenTaq Advantage; 38.75 µL of ddH 2 O.


2. Aliquots (48 µL) of the master mix are placed in thin-wall 0.5-mL PCR tubes and overlaid 

with 40 µL of mineral oil. 

3. Finally, 2 µL of the RT reaction is added. We neglect the contribution of the 2 µL of RT 

reaction to primer and dNTP concentrations, etc. 

4. Notes 

1. The KlenTaq Advantage polymerase mix also contains anti-Taq antibody, which ensures 

a “hot start” to the PCR. We have not found it necessary to include an initial prolonged 

denaturation step, so the way we are using the polymerase mix is in fact “time-release 

PCR.” 

2. The Clontech buffer is Tricine-based, and therefore is not subject to the same drop in pH 

at high temperatures that is seen with Tris-based buffers (8). The buffer already contains 

Mg 2+ ; we have not found it necessary to modify the concentration of Mg 2+ for any of the 

templates we have amplified. The buffer does contain KOAc instead of KCl, the latter 

having been shown to decrease the processivity of DNA polymerases (8). 

3. Primers: 10 pmol of each primer are used in the PCR. Because long PCR in general uses 

a higher annealing temperature than does standard PCR, a requirement of primer design is 

that the Tm must be high enough to hybridize at that temperature. Whereas 20 to 25 mers 

with a sufficiently high GC content will work, we have also often used primers of 30 to 40 

bp without problems, and when incorporating promoters and cloning sites, primers of up 

to ~60 bp. Barnes (5) has also reported the use of amplicons of a few hundred bp as “mega 

primers.” Primer design should include consideration of secondary structures, dimers, etc., 

but because of the high temperatures throughout the PCR cycle and the “hot start,” there 

is in fact greater tolerance for weak secondary structures than with many “standard” PCR 

protocols. Because of the high annealing temperature, however, there is a low tolerance 

for mismatches between the primers and the template. 

4. Long PCRs usually require rapid temperature transition (however, some templates are more 

tolerant than others), and several parameters are optimized toward this goal, including the 

small reaction volume (50 µL) and the small volume of oil. Because different volumes lead 

to different thermal capacity, great consistency is required for optimization. We use the 

Stratagene thin-wall tubes; we have found that some other brands may require, for some 

templates, different parameters: again, consistency is the essential element. 

5. Long PCR requires a thermal cycler with fast temperature transitions; depending on the 

template and the size of the target for amplification, not all thermal cyclers will allow 

successful amplification (5). In any case, cycling parameters must be determined for each 

different model of thermal cycler. 

6. We usually use 35 cycles of PCR amplification. If greater yield or sensitivity is required, 

consider using nested PCR. 

7. The elongation time is usually the only parameter to adjust in the protocol and depends on the 

template and the size of the targeted amplicon. Elongation times shorter or longer than the 

optimal time can result in sensitivity loss (or even negative results). Extension times that 

are too long are often associated with a “smearing” of the reaction product when it is 

electrophoresed on agarose gels. Optimal elongation time is best determined by using a 

serial dilution of the template (since suboptimal times may give positive reactions but with 

a loss of a few logs in sensitivity). The initial time should be chosen between 1 and 2 min 

per kb. Like other authors (8), we have found that step-wise increase of the elongation 

time can be beneficial. Examples of elongation times for various templates can be found 

in Barnes (5) and Tellier et al. (1). For example, to obtain amplicons from the tobacco 

mosaic virus (6.2 kb), HAV (7.5 kb), and HCV (9.25 kb), we found we could use the same 

elongation times: 9 min 45 s for the first 15 cycles, 11 min for the next 10 cycles, and


13 min for the last 10 cycles (1). To minimize recombination events during PCR, one 

should probably err on the side of longer elongation times. 

8. The master mix is merely corrected for a 5 µL volume of template, taking into account the 

amount of buffer carried from the first reaction. 

9. For nested PCR, the primers of the second round must be internal to those of the first round 

(although they can overlap). If the same primers were to be used, artifactual bands produced 

by long PCR because of false priming would also get re-amplified. A second round of long 

PCR with the same primers can be performed, but this necessitates purification of the first 

round amplicon by agarose gel electrophoresis (9). 

10. The overall sensitivity that can be achieved can be close to standard PCR: for the lambda 

phage DNA, we have obtained an 11-kb amplicon from as few as 200 copies. When we 

used a nested long PCR protocol we could obtain, at the end of the whole process, a 5-kb 

amplicon starting from as few as 20 copies (1). 

11. This protocol assumes that the RNA is diluted in 10 mM DTT and 5% (vol/vol) RNasin 

(20–40 U/µL, Promega). If one uses RNA dissolved in RNase free water, increase the DTT 

in the RT master mix to 2 µL, and decrease the amount of primer to 1.5 µL. 

12. The primer for the reverse transcription must be a template-specific primer and can be one 

of the primers used in the long PCR. Do not use random hexamers. 

13. The optimal temperature for Superscript II is between 42 and 45°C (10), but it is active 

up to 50°C. Although incubation at 50°C was less sensitive in our hands (1), for some 

templates with strong secondary structures, it may be advantageous. 

14. The treatment with RNase H and RNase T1 is not absolutely necessary, but we have found 

that it increases the sensitivity of the long RT-PCR (1). Other authors have also reported 

benefits from the use of RNase H (11–13). We have not tested separately the contributions 

of RNase H and RNase T1, but the benefits of RNase T1 are expected to vary depending 

on the amount of extraneous RNA present in the template. 

References 

1. Tellier, R., Bukh, J., Emerson, S. U., Miller, R. H., and Purcell, R. H. (1996) Long PCR and 

its application to hepatitis viruses: Amplification of hepatitis A, hepatitis B and hepatitis C 

virus genomes. J. Clin. Microbiol. 34, 3085–3091. (Erratum published in J. Clin. Microbiol. 

1997;35:2713). 

2. Duckmanton, L. M., Tellier, R., Liu, P., and Petric, M. (1998) Bovine torovirus: Sequencing 

of the structural genes and expression of the nucleocapsid protein of Breda virus. Virus 

Res. 58, 83–96. 

3. Martino, T. A., Tellier, R., Petric, M., Irwin, D. M., Afshar, A., and Liu P. (1999) The 

complete consensus sequence of coxsackievirus B6 and generation of infectious clones by 

long RT-PCR. Virus Res. 64, 77–86. 

4. Chen, B., Rigat, B., Curry, C., and Mahuran, D. J. (1999) Structure of the GM2A gene: 

identification of an exon 2 nonsense mutation and a naturally occurring transcript with an 

in-frame deletion of exon 2. Am. J. Hum. Genet. 65, 77–87. 


yield from λ bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220. 

6. Lawyer, F. C., Stoffel, S., Saiki, R. K., Chang, S. Y., Landre, P. A., Abramson, R. D., et al. 

(1993) High-level expression, purification, and enzymatic characterization of full-length 

Thermus aquaticus DNA polymerase and a truncated form deficient in 5′ to 3′ exonuclease 

activity. Genome Res. 2, 275–287. 

7. Clontech (1998) User Manual for Advantage cDNA PCR kit and Advantage cDNA 

Polymerase Mix.


8. Cheng, S., Fockle, C., Barnes, W. M., and Higuchi, R. (1994) Effective amplification of 

long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad Sci. USA 

91, 5695–5699. 

9. Tellier, R., Bukh, J., Emerson, S. U., and Purcell, R. H. (1997) Amplification of the 

full length hepatitis A virus by long RT-PCR and generation of infectious RNA directly 

from the amplicon in Viral Hepatitis and Liver Disease, Proceedings of the IX Triennial 

International Symposium on Viral Hepatitis and Liver Disease (Rizzetto M., Purcell R. H., 

Gerin J. L., and Verme, G., eds.), Minerva Medica, Turin, pp. 48–50. 

10. Gibco BRL (1994) Technical Bulletin 18064-2. Gibco BRL, Gaithersburg, MD. 

11. Nathan, M., Mertz, L. M., and Fox, D. K. (1995) Optimizing long RT-PCR. Focus 17, 

78–80. 

12. Wang, L.-F., Radkowski, M., Vargas, H., Rakela, J., and Laskus, T. (1997) Amplification and 

fusion of long fragments of hepatitis C virus genome. J. Virol. Methods 68, 217–223. 

13. Lindberg, A. M., Polacek, C., and Johansson, S. (1997) Amplification and cloning of 

complete enterovirus genomes by long distance PCR. J. Virol. Methods 65, 191–199.

178 Tellier et al.

Qualitative and Quantitative PCR 181 

30 

Qualitative and Quantitative PCR 




The nature of the polymerase chain reaction (PCR) process lends itself well to 

qualitative determinations. It transforms very small quantities of analyte into the realms 

of bucket chemistry, allowing specific gene portions to be directly visualized with 

ethidium bromide and ultraviolet light. It was these approaches that were first to be 

exploited in DNA analysis. The early PCR tests were for the presence or absence of a 

gene, transcript, or by inference whole organism (e.g., pathogen identification). These 

qualitative tests rapidly evolved to distinguish between related genes or organisms and 

accelerated the whole process of molecular taxonomy. 

In contrast to this global utility and acceptance, the use of quantitative PCR has 

grown more slowly, for similar reasons. A chain reaction by definition is intuitively out 

of control. Surely the vagaries of chaos theory will obliterate any hope of quantitation; 

it matters not if the butterfly flaps once or one thousand times. Despite these early 

misgivings, a great many successful quantitative PCR protocols have been developed 

and gained general acceptance. 

2. Qualitative PCR 

There a number of considerations that should be taken into account when performing 

qualitative PCR. Careful thought at the outset of the design process can avoid a great 

deal of subsequent frustration. When the PCR product contains the expected amplicon 

(assuming all negative controls have been included and are negative), it is safe to 

assume the template was present in the starting sample. However, the converse is not 

true. There are a number of common causes for the failure of qualitative PCR other 

than the absence of template. 

2.1. Template Concentration 

Even the most basic qualitative PCR is dependent on quantitative changes in template 

concentration. The whole process is based on an ideally exponential amplification 

of starting material to a point where it can be readily seen and manipulated. Clearly, 

this ability will be influenced by both the starting concentration of template and the 



181

182 Stirling 

efficiency of the reaction. Although it is theoretically possible to amplify from a single 

copy of a sequence, if the reaction conditions are not optimized, such amplification 

may not reach a threshold for detection within the average 30-cycle PCR. If the object 

of the exercise is to determine the presence or absence of a specific sequence, elements 

of quantitation must be built into the reaction design to determine the required level of 

sensitivity. Where PCR is to be used to test for the presence of a pathogen for instance, 

consideration has to be given to the clinically significant levels. If a single organism 

is clinically significant, then clearly the test has to be capable of detecting a single 

copy. If, however, 1000 organisms are required for clinically significant event, the 

assay need not be as sensitive (1). 

2.2. Mixed Template Competition 

If the template contains more than one species of DNA capable of being amplified by 

the primers, those templates that exist in greater initial concentrations or that amplify 

more efficiently may outcompete the remaining templates. For instance, PCR is used to 

amplify papilloma virus sequences in cervical cytology specimens. Consensus primers 

are used to amplify a broad spectrum of viral strains, which can then be characterized 

by restriction digest or probe hybridization. If the patient has a mixed infection, it 

is likely that the more abundant strain will be amplified preferentially, resulting in 

only one strain being represented in the PCR product (2). This is perfectly adequate to 

determine which are the predominant strain(s) within a sample. However, if a complete 

description of the strains present is required, PCR should be performed to specifically 

amplify individual strains 

3. Quantitative PCR: General Considerations 

3.1. End-Point Analysis 

Unfortunately, the cause of quantitative PCR has not promoted by the use of end-point 

analysis. This approach simply amplifies multiple templates under the same set of conditions 

and examines the amount of product at the end of the run. Because PCR exhibits a 

typical exponential amplification of product, complete with lag phase and plateau, it is 

easily possible for widely differing starting template concentrations to yield remarkably 

similar final product concentrations. This can be a useful technique but only if great 

care is taken to establish an appropriate end point. Reactions should be sampled after 

a wide range of cycle numbers, to delineate the exponential phase, and the subsequent 

plateau. Tests should then be designed to sample during the exponential phase of 

amplification, before primers, dNTPs, and or enzyme become limiting. As with all 

quantifications, it is greatly enhanced by the inclusion of a suitable internal control. 

3.2. Limiting Dilution 

PCR quantitation can be achieved using qualitative end points. For the PCR to 

proceed, there must me a theoretical minimum of one template per reaction. Thus, 

if a dilution series is performed on the template, a dilution can be reached where an 

aliquot of sample taken for PCR has a statistical probability of containing no template 

molecules. The higher the initial template concentration, the greater the dilution 

required needed to reach that point. This approach has been used with great success 

to quantify viral titers (3).

Qualitative and Quantitative PCR 183 

3.3. Competitive Template PCR 

If two different templates capable of being amplified by the same primers are 

present at the start of a PCR, one will tend to predominate by the end. This will be 

determined by a number of factors, such as relative starting concentrations, size, and 

internal sequence. If a competitive template is designed to be almost identical to the 

test sequence, the final dominance of test or competitor will entirely be the result of the 

initial concentration. Many groups, including myself, have used competitors identical 

to the test DNA apart from one base change (used to introduce a restriction site to 

distinguish the templates) in this way (4). A dilution series of competitor is set up with 

a constant concentration of test sample and subjected to PCR. A plot of the relative 

product concentrations at the end of the amplification reveals a point where there is 

equivalent production from both template and competitor. This then yields the concentration 

of the test sample template. This is a very robust approach to quantitation, 

but is time consuming both to establish and to run, requiring many PCRs for each 

sample, and being difficult to automate. 

3.4. Real-Time PCR 

The development of fluorescent detection systems, capable of monitoring PCR 

product accumulation while it occurs has greatly improved the reliability of quantitative 

PCR. There is a well-established inverse correlation between the template concentration 

and the duration of the lag phase of the PCR. An entire generation of automated systems 

has been developed to exploit this. Using any of several different chemistries, the 

accumulation of PCR product is monitored until a predetermined threshold is reached. 

This lag time is then compared with a standard curve and a concentration calculated. 

Lending itself very readily to automation, real-time PCR is becoming the method 

of choice for most quantitative PCR systems. Although the equipment for performing 

such analysis has been fairly expensive, second-generation systems are already on the 

market at much more reasonable costs. 

One final note of caution: It is not uncommon for these systems to be based upon the 

detection of accumulated PCR product by the use of a fluorescent dye, such as SYBR 

green. Such systems can work very well when the PCRs are optimized to yield only 

the product to be quantified. If, however, a great many heterogeneous samples are to be 

analyzed, it is entirely possible that some will yield additional bands, confounding the 

results. The use of hybridization probe strategies will greatly reduce this possibility. 

References 

1. Tonjum, T., Klintz, L., Bergan, T., Baann, J., Furuberg, G., Cristea, M., et al. (1996) 

Direct detection of Mycobacterium tuberculosis in respiratory samples from patients in 

Scandinavia by polymerase chain reaction. Clin. Microbiol. Infect. 2, 127–131. 

2. O’Leary, J. J., Landers, R. J., Crowley. M., Healy, I., O’Donovan, M., Healy, V., et al. 

(1998) Human papillomavirus and mixed epithelial tumors of the endometrium. Hum. 

Pathol. 29, 383–389. 

3. Lee, T. H., Sunzeri, F. J., Tobler, L. H., Williams, B. G., Busch, M. P. Lee, T. H., et al. 

(1991) Quantitative assessment of HIV-1 DNA load by coamplification of HIV-1 gag and 

HLA-DQ-alpha genes. AIDS 5, 683–691. 

4. Stirling, D., Hannant, W. A., and Ludlam, C. A. (1998)Transcriptional activation of the 

factor VIII gene in liver cell lines by interleukin-6. Thromb. Haemost. 79, 74–78.

184 Stirling

PCR Detection of Tumor Cells 185 

31 

Ultrasensitive PCR Detection of Tumor Cells in Myeloma 

Friedrich W. Cremer and Marion Moos 


Chromosomal aberrations, such as translocations or inversions, described for a 

growing number of malignancies, are now widely used to detect tumor cells by 

polymerase chain reaction (PCR). However, in multiple myeloma (MM), no such 

ubiquitous PCR marker exists. Therefore, other means have been established to 

distinguish myeloma cells from normal cells. Because the plasma cells of a myeloma 

clone share an identical rearranged immunoglobulin gene sequence, it is possible to 

detect malignant cells with PCR primers specific for the VDJ rearrangement of the 

heavy chain of each myeloma clone. The sensitivity and specificity of this method, 

named allele-specific oligonucleotide (ASO) PCR, even with low proportions of 

malignant cells, has been proven (1). 

The heavy chains of the immunoglobulins have three highly variable regions near 

their amino-terminal end that mediate specific binding of the antigen. These regions 

are called complementarity determining regions (CDR1 to –3). The sequences of the 

heavy chain of the immunoglobulin genes are encoded on chromosome 14. In germline 

configuration, several hundred base pairs divide the approx 200 variable regions 

(V) from the 30 diversity regions (D). Several kilobase pairs downstream, 6 joining 

regions (J) are located. About 7000 base pairs to the 3′-end the constant regions of the 

heavy chain are encoded. During B-cell maturation, a random rearrangement of 

these regions occurs, in which one of the V-, one of the D-, and one of the J-regions are 

joined together, thus generating the VDJ-segment. Together with the sequence of the 

rearranged light chain, it determines the antigenic specificity of the immunoglobulin. 

The rearrangement of V-, D-, and J-regions can generate over 35,000 different VDJsequences. 

The diversity of these sequences is further increased by three different 

mechanisms: (1) the recombination process is imprecise, thus nucleotides can be lost 

or stretches of bases that divide the different regions are not deleted; (2) nucleotides 

can be inserted without matrix at the junctions of V-, D-, and J-regions; and (3) somatic 

hypermutations, especially of the V-regions, further enhance the antigenic specificity of 

the immunoglobulin. Although CDR1- and CDR2-regions are entirely encoded by the 

V-region, the CDR3-region stretches over the 3′-end of the V-region, the D-region 

and the 5′-end of the J-region (see Fig. 1). Thus, the CDR3-region has the highest 



185

186 Cremer and Moos 

Fig. 1. Rearranged VDJ segment of a mature B-cell and strategies for consensus PCR to 

amplify the VDJ segment. The CDR regions of the heavy chain of the immunoglobulin gene 

are flanked by highly conserved segments, the framework (FR) regions 1 through 4. Consensus 

primers complementary to these FR-regions have been developed that can be used to amplify 

the enclosed highly variable CDR regions regardless of their sequence. In this chapter, two 

strategies are described using either FR1C or FR3A plus LJH. 

diversity of all CDR-regions, and its sequence is a specific marker for each clone 

of B-cells (2,3). 

In MM, the CDR regions of the malignant cells are somatically hypermutated, and 

no further mutations occur, which would lead to an oligoclonal diversification (4). This 

is a prerequisite for designing ASO primers complementary to the CDR regions of the 

malignant clone that allow the detection of myeloma cells by PCR. 

For designing ASO primers, the sequence of the CDR regions of the malignant 

clone has to be determined. In a first step, the CDR regions of virtually all B-cells are 

amplified with consensus primers flanking the CDRs (see Fig. 1). Besides the strategies 

using FR1C (5) or FR3A (6) as sense primers and LJH as antisense primer, consensus 

PCR with family-specific primers complementary to the leader segment 5′-end to 

the V-region (7), with a mixture of six FR1 family-specific primers (8), with an FR2 

consensus primer alone (9) or as a mixture with the FR1 family-specific primers 

VH5 and VH6 (5) and a mixture of JH1245, JH3, and JH6 antisense primers (5) 

has been described. After consensus PCR, the product of the malignant clone can 

be distinguished from normal ones clones by its predominant occurrence among 

the polyclonal CDR-regions. After sequencing (directly or after cloning), primers 

complementary to the CDR regions can be designed. These ASO primers have to be 

tested for specificity and sensitivity before they can be used for the PCR detection of 

cells of the malignant clone. PCR is quantified using the method of limiting dilutions. 

2. Materials 

2.1. Isolation of Nucleic Acids 

1. Bone marrow (BM) sample with a high proportion of myeloma cells. 

2. Ficoll separating solution (Biochrom, Berlin, Germany). 

3. Phosphate-buffered saline (pH 7.4; Gibco BRL, Eggenstein, Germany). 

4. TE buffer (10 mM Tris-HCl, pH 7.5, and 1 mM EDTA). 

5. Reagents for RNA extraction, for example, Trizol Reagent (Gibco BRL). 

6. Reagents for DNA extraction, for example, DNAzol (Gibco BRL). 

7. Ethidium bromide-stained agarose gels (0.8 and 2%).


8. Denaturating agarose gels (1.2%) containing 2.2 mM formaldehyde for RNA. 

9. PCR reagents and primers for amplifying reference genes like β-actin or GAPDH. 

2.2. Consensus RT-PCR 

1. GeneAmp RNA PCR Core Kit (Perkin–Elmer, Weiterstadt, Germany). 

2. Amplitaq Gold DNA polymerase with GeneAmp 10× PCR buffer II (Perkin–Elmer) and 

MgCl 2 solution. 

3. Mixture of dATP, dCTP, dGTP, and dTTP, concentration 2.5 mM each (stock solution 

100 mM, Promega, Madison WI). 

4. Consensus primers FR1C (5′-GGTGCAGCTGS(A/T)GSAGTC(A/G/T)GG-3′) (5), FR3A 

(5′-ACACGGCYSTGTATTACTGT-3′) (6), and LJH (5′-TGAGGAGACGGTGACC-3′) (6). 

5. Ethidium bromide-stained agarose gels (2 and 5%, NuSieve 3:1 Agarose, FMC/Biozym, 

Oldendorf, Germany). 

2.3. Identification of the Myeloma CDR Regions 

1. Scalpel. 

2. DNA purification kit (EasyPure DNA Purification kit, Biozym, Göttingen, Germany). 

3. Cloning kit for PCR products (TOPO TA Cloning Kit, Invitrogen, De Schelp, The 

Netherlands). 

4. LB medium, LB plates, with 50 µg/mL kanamycin (Boehringer Mannheim, Mannheim, 

Germany). 

5. Lysis buffer (100 µg/mL of Proteinase K (Boehringer Mannheim) in 10 mM Tris-Cl, 

pH 7.5, and 1 mM EDTA). 

6. PCR reagents (see Subheading 2.2.) and M13 universal (forward) and M13 reverse 

primers. 

7. Sequitherm Cycle Sequencing kit (Biozym, Göttingen, Germany). 

2.4. Quantitative PCR (qPCR) Using ASO Primers 

1. DNA processing software, for example Gene Jockey II (Biosoft, Cambridge, United 

Kingdom). 

2. PCR reagents, ASO primers as designed, LJH primer, ethidium bromide stained agarose 

gels (2% or 5%). 

3. Buffy coat DNA from healthy donors. 

4. Computer program for likelihood maximization and χ 2 minimization, for example, 

MAXLIKE. This program written in C (Watcom C/C++ version 10.6, Powersoft, Waterloo, 

Canada) running under DOS on an IBM compatible PC or the source code can be 

obtained for free according to the terms and conditions for copying, distribution, and 

modification of programs under the GNU general public license agreement from the 

authors (see contact address). 

5. Myeloma or B-cell lines, for example U266 (10) or Daudi (11). 

3. Methods 

3.1. Isolation of Nucleic Acids 

1. Collect bone marrow aspirate in two 10-mL syringes with heparin added for anticoagulation. 

This will be the starting material for both the identification of the VDJ sequence of 

the malignant clone and the testing of ASO primers. 

2. Isolate mononucleated cells by centrifugation over Ficoll separating solution. 

3. Wash cells twice in phosphate-buffered saline, pelleting between washes by centrifugation 

at 800g for 10 min.


4. Count cells and divide them into at least 1 × 10 7 cells for RNA extraction and the remaining 

cells for DNA extraction. If the cell pellet appears red, resuspend in TE buffer and vortex 

for 5 to 10 s to lyse remaining red blood cells, then pellet again quickly and remove 

TE buffer. 

5. Add 250 µL of Trizol reagent per 1 × 10 7 cells then freeze cells at –20°C for later RNA 

extraction. Freeze the remaining cells immediately for later DNA extraction. 

6. Thaw pelleted cells in Trizol reagent and extract RNA according to the manufacturers’ 

instructions. 

7. Thaw pelleted cells and isolate DNA, for example using the DNAzol reagent according to 

the manufacturers instructions or see Chapter 6 for DNA extraction protocol. 

8. Determine concentration of RNA and DNA by optical density (OD) measurement at 260 

and 280 nm. Adjust concentration of RNA to 500 ng/µL and of DNA to 100 ng/µL. 

9. Confirm integrity of RNA by electrophoresis of 500 ng on a denaturing 1.2% agarose gel 

containing 2.2 mM formaldehyde. 

10. Confirm integrity of DNA by electrophoresis of 100 ng on a 0.8% agarose gel. 

11. Check quality of DNA or RNA by PCR amplifying a gene like β-actin in the case of DNA 

or a housekeeping gene like GAPDH in the case of RNA. 

3.2. Consensus RT-PCR 

1. Perform reverse transcription reaction in a total volume of 20 µL containing 2 µg of RNA 

using commercially available kits. 

2. Prepare a PCR mixture containing 8 µL of 10× PCR buffer, 1 µL of 20 mM primer 

solutions FR1C or FR3A plus LJH-CL, and 2.5 U Amplitaq Gold DNA polymerase. 

3. Add the total volume of the RT reaction mixture to the PCR mixture. The final volume 

should be 100 µL. 

4. Amplify with a program consisting of 7 min of denaturation and enzyme activation at 

94°C, followed by 40 cycles of denaturation for 1 min at 94°C and combined annealing 

and extension at 63°C (for primer FR3A) or 65°C (for primer FR1C) for 1 min, followed 

by a final extension step at 65°C for 5 min. 

5. Resolve PCR products either on a 2% (PCR products are approx 350 bp in size if FR1C 

was used) or 5% (PCR products are approx 110 bp in size if FR3A was used) ethidium 

bromide stained agarose gels. The monoclonal CDR regions lead to a distinct band if the 

proportion of myeloma cells is high enough. This band can be distinguished from the 

surrounding smear of polyclonal CDR-regions. Figure 2 shows an example of a consensus 

PCR (see Note 1). 

3.3. Identification of the Myeloma CDR Regions 

3.3.1. Cloning of Consensus PCR Products and Direct Lysis 

of Transformed Bacteria 

1. Excise appropriately sized consensus PCR products from the agarose gel with a scalpel (4). 

2. Purify DNA from the agarose block using commercially available kits. 

3. Clone-purify PCR products into plasmids and transform competent cells using kits 

featuring TA-cloning. If possible, use kanamycin rather than ampicillin for selection, as 

satellite colonies occur less frequently. Grow bacteria for 12 to 16 h at 37°C. 

4. Pick single colonies and transfer to a replica plate. Spread on an area of approx 1 cm 2 . 

Incubate for 12 to 16 h at 37°C. If a distinct band without surrounding smear was visible 

after consensus PCR, 10 to 20 colonies should be sufficient. If a band surrounded by a 

polyclonal smear was visible, 20 to 40 colonies should be picked.


Fig. 2. Consensus PCR using primers FR3A and LJH. In 5 of 16 cases, the consensus PCR 

product of the malignant clone can be distinguished from the surrounding polyclonal smear. 

In all other cases, only a smear, like the one seen in buffy coat DNA, is visible. This figure 

also illustrates the low rate of distinct consensus PCR products obtained if using DNA instead 

of RNA. Detection rates can further be increased by using two different consensus strategies 

in parallel. 

5. Scrape layer of bacteria from the plate and suspend in 100 µL of lysis buffer. Vortex 

vigorously. 

6. Incubate the suspension at 65°C for 15 min. 

7. Inactivate proteinase K at 95°C for 15 min. 

8. Pellet debris by centrifugation at maximum speed and 4°C. Transfer the supernatant 

containing the plasmids to a fresh tube. Store at 4°C. 

9. Analyze plasmids for inserts by PCR using primers complementary to the M13 sites 

of the vector. Set up a PCR containing 5 µL of 10× PCR buffer, 2 mM MgCl 2 , each 

deoxynucleotide at 0.1 mM, primers M13 forward plus M13 reverse at 0.4 µM each, 2.5 U 

Taq-DNA-polymerase, and 1 µL of plasmid solution. Amplify for 40 cycles of 1-min 

denaturation at 94°C, 1 minute annealing at 65°C, and extension at 72°C, followed by a 

final extension of 5 min at 72°C. Analyze on a 2% agarose gel. 

3.3.2. Sequencing and Identification of the CDR Regions of the Myeloma Clone 

1. Prepare sequencing reactions using commercially available kits according to the manufacturer’s 

instructions with 4 to 8 µL of plasmid solution, and perform cycle sequencing. 

2. Analyze on a sequencer, for example Alf-express (Pharmacia, Freiburg, Germany). 

3. Analyze obtained sequences by aligning them to known CDR regions (examples for CDR3 

regions are given in Fig. 3; see Note 2). 

4. Identify the consensus PCR product of the malignant clone by its predominant occurrence 

among the polyclonal CDR-regions. B-cells of normal clones are not encountered more 

frequently than once in 20000 B-cells (12). At least five identical clones should be typed 

to identify the myeloma clone.


Fig. 3. Alignment of sequences of CDR3 consensus PCR products of the malignant clones 

from 10 patients with MM and an example of four ASO primers designed for the last of the 

given sequences (testing of the primers is shown in Fig. 4). Aligning allows to distinguish 

variable and rather conserved segments. Primers are designed to be complementary to the 

highly variable region. 

3.4. Quantitative PCR (qPCR) Using ASO Primers 

To quantitate PCR results, essentially four different methods have been described. 

Although the measurement of the amount of PCR product, the coamplification of a 

control gene, and the competitive PCR rely on the quantitation of the generated product, 

the limiting dilution assay analyzes only positive and negative PCRs at different 

dilution levels (13). Amplification efficiencies and hence the amounts of PCR product 

can vary substantially from tube to tube despite identical and simultaneous processing 

of reaction mixtures (14), even if quantitation is performed in the exponential phase of 

amplification. Limiting dilutions are less prone to errors caused by these deviations. 

Standards can be used to control for these differences; however, in MM a system of 

standard and template would have to be established for each new patient. Therefore, 

we prefer the limiting dilutions assay, which analyzes only PCR positivity versus 

PCR negativity. A prerequisite of this method is that a single copy of target DNA 

can be detected. 

3.4.1. Designing Primers (see Note 3) 

1. ASO primers should be 18 to 23 bases long. 

2. The initiation of the Taq-DNA-polymerase can be enhanced by 3′-ends with NS or SS as 

bases, but more than 2 G at the 3′-end should be avoided. 

3. The 5′-end and 3′-end of primers should not be complementary to each other to avoid 

primer homodimerization. 

4. The A/T to G/C ratio should be approx 50%, if possible. 

5. There are several computer programs that can be used to check primers for hairpin 

formation and primer pairs for dimerization. 

6. FR3-strategy: Identify hypervariable parts of the CDR3-region of the malignant clone 

by aligning the sequence to known CDR3-sequences. Avoid segments that are relatively 

conserved. Design ASO primer as forward primer according to above considerations. Use 

ASO primer together with LJH as antisense primer.


7. FR1-strategy: Distinguish FR regions and CDR regions by aligning sequence to known 

CDR sequences. Design the first ASO primer as the forward primer complementary to the 

CDR1 or CDR2 region (CDR1 regions are often rather conserved, thus CDR2-specific 

primers might be preferred). Design the second ASO primer as the antisense primer 

complementary to the CDR3 region. Use these primers as a pair for PCR. 

3.4.2. Testing of ASO Primers 

Because even carefully designed primers may not work as well as expected, only 

testing can distinguish between oligonucleotides that fulfill all requirements and 

those that are not specific or sensitive enough. CDR1/2- plus CDR3-specific ASO 

primer pairs do not necessarily give better results than CDR3-specific plus J-consensus 

primers. An example of a primer test is given in Fig. 4. Design several CDR3-specific 

or CDR1/CDR2-specific plus CDR3-specific (antisense) primers. An example for 4 

ASO primers is given in Fig. 3. 

1. Prepare PCRs containing 5 µL of 10× PCR buffer, 2 mM MgCl 2 , each deoxynucleotide at 

0.1 mM, the ASO primer pair or the CDR3-specific primer plus LJH-CL at 0.8 µM each, 

and 2.5 U Taq-DNA-polymerase. 

2. Add 500 ng of DNA from the initial BM sample to generate a positive control. Add 1000 ng 

of buffy coat DNA from healthy donors to generate a negative control that tests for 

specificity of the primers. Adjust with distilled water to a final volume of 50 µL. Repeat 

this for every primer combination to be tested. 

3. Amplify with a program consisting of 7 min of preheating at 94°C, 60 cycles of 1 min 

of denaturation at 94°C, and 1 minute of annealing and extension at 63°C, ending with 

a final extension at 63°C for 5 min. 

4. Analyze PCR products on a 2 (for FR1/2-strategy) or 5% (for FR3-strategy) ethidium 

bromide-stained agarose gel. Reactions containing DNA from the positive control should 

display a prominent band of the expected size (see Note 4). No such product should be 

visible in those with buffy coat DNA only. Avoid primers that generate a multitude of 

nonspecific products. 

3.5. Quantitation by Limiting Dilutions 

1. Isolate DNA from the sample to be assessed (see Note 3). 

2. Determine the DNA concentration of the sample by OD measurement. Add distilled water 

to achieve a DNA concentration of 100 ng/µL. 

3. Prepare a dilution series in 0.5 log steps (resulting in dilution levels of 13, 110, 

133, etc.). 

4. For each dilution level, set up a PCR containing 10 µL of the DNA solution. Use conditions 

as determined to be optimal for the ASO primers used (see Subheading 3.7.) and 

amplify. 

5. Analyze PCR products on agarose gels. Determine the highest dilution that still generates 

a specific PCR product. 

6. Set up five replicates of PCRs containing 10 µL of DNA solution from the highest dilution 

level that was PCR positive, five replicates with DNA from the lowest dilution level that 

was PCR negative, and five replicates with DNA from the next lowest dilution level that 

was PCR negative and amplify. 

7. Analyze on an agarose gel. 

8. Decrease or increase the dilution level analyzed in five replicates until the pattern of 

PCR results finally obtained shows a change from PCR positivity in all replicates (or the


Fig. 4. Testing of primers (see Fig. 3) as described in Subheading 3.4.2. For each ASO 

primer, a negative control without added DNA, a positive control with DNA from the initial BM 

sample, and a specificity test with buffy coat DNA were amplified by PCR. Using primer 1, only 

the positive control leads to the PCR product of the expected size. Primers 2, 3, and 4 produce 

several nonspecific bands, even in the negative control. Primer 3 generates a false-positive PCR 

product of the same size with buffy coat DNA. Primer 1 was selected, and PCR conditions were 

further optimized for this oligonucleotide as described in Subheading 3.7. 

undiluted level has been reached) to partial PCR positivity in the next higher dilution levels 

to PCR negativity in all replicates in the highest dilution levels (see Fig. 5). 

9. To deduce the proportion of malignant cells in the undiluted sample from the pattern 

of PCR results, analyze by likelihood maximization and by χ 2 -minimization (15), for 

example, by using the MAXLIKE computer program. Ten microliters of the undiluted 

DNA solution (100 ng/µL) are equivalent to 165,000 cells, which is used as a starting 

point for the calculations. The program will return the most probable value for the initial 

proportion of malignant cells in the analyzed sample. 

10. Compare the values obtained by likelihood maximization and by χ 2 -minimization. If PCR 

results are plausible, both methods will yield consistent values (see Note 5). 

3.6. Testing the Sensitivity of ASO Primers 

A prerequisite for the analysis of the pattern of PCR results by χ 2 -minimization 

or likelihood maximization is that a single copy of target DNA per PCR tube can be 

detected. It is advisable that at least the overall sensitivity of the assay should be tested, 

as described in Subheading 3.6.1.


Fig. 5. Example for a qPCR of a PB sample from a patient with MM. The specific PCR 

product is 85 bp. The highest dilution level at which all five replicates are PCR positive is 

11000, the lowest dilution level at which all five replicates are PCR negative is 110,000. 

Analysis of this pattern of PCR results by likelihood maximization and χ 2 -minimization yielded 

a result of 1.2% of malignant cells. 

3.6.1. Testing the Sensitivity of the Assay Using a Cell Line 

1. Design primers for a B-cell or myeloma cell line and test for specificity. 

2. Isolate DNA from cells of the cell line and from buffy coat of healthy donors and quantitate 

by OD measurement. 

3. Mix DNA from the cell line with buffy coat DNA to simulate samples with different 

proportions of malignant cells (100%, 10%, 1%, 0.1%, 0.01%, and 0.001%). 

4. Analyze all samples by qPCR (see Chapter 6.3.) using the appropriate ASO primers. 

5. Compare the results of the qPCR with the simulated tumor loads. 

3.6.2. Testing Primer Sensitivity by Comparison to Results of Flow Cytometry 

1. Collect a BM sample with a proportion of malignant cells of greater than 2% from a patient 

in whom ASO primers have been devised. 

2. Assess sample for CD38++, κ/γ-restricted cells by flow cytometry. This gives an approximate 

value for the proportion of malignant cells. 

3. Isolate DNA from this sample (see Subheading 3.1.). 

4. Quantitate the tumor load by qPCR as described in Subheading 3.1.


5. Compare the value determined by qPCR with the result of the analysis by flow cytometry. 

If the result obtained by qPCR is definitely lower than the one obtained by flow cytometry, 

then the ASO primer is most probably not able to detect a single copy of the template 

of the malignant clone. 

3.7. Optimization of PCR Conditions for ASO Primers 

1. As a starting point, use PCRs of 50 µL containing 5 µL of 10× PCR buffer, 2 mM MgCl 2 , 

each deoxynucleotide at 0.1 mM, the ASO primer pair or the CDR3-specific primer 

plus LJH at 0.8 µM each, 2.5 U Taq-DNA-polymerase, and a maximum of 1000 ng 

of DNA. Amplify with a program consisting of 7 min preheating at 94°C, 60 cycles of 

1 min of denaturation at 94°C and 1 min of annealing and extension at 63°C, ending with 

a final extension at 63°C for 5 min. 

2. If these amplification conditions lead to unsatisfactory results, for example, too many 

nonspecific products or low intensity of the specific product, optimize the reaction 

conditions. Always amplify a negative control without added DNA, a negative control 

with buffy coat DNA from healthy donors, and a positive control with DNA from a BM 

sample of the patient. 

3. Vary the annealing temperature in steps of 1°C. Vary the MgCl 2 concentration in steps of 

0.25 mM. These parameters work synergistically. 

4. Vary the concentration of primers in 0.2-µM steps in a range of 0.4 to 1.2 µM. Higher 

concentrations of primers can lead to a higher sensitivity; however, this is hampered by 

the occurrence of more nonspecific products. 

5. Increase the number of amplification cycles to improve sensitivity. Decrease the number 

of cycles to reduce nonspecific products. At least 50 cycles should be performed to allow 

detection of single copies of template, which is a prerequisite for the statistical analysis of 

limiting dilution series by likelihood maximization. 

4. Notes 

1. No distinct band or multiple bands are visible after consensus PCR: Some BM samples will 

not lead to a single distinct band of the expected size after consensus PCR. Either only a 

polyclonal smear is visible or, in rare cases, more than one band of the expected size. (1) 

Change the strategy used for consensus PCR (FR3 or FR1). Try DNA instead of RNA. 

Prepare a PCR mixture containing 10 µL of 10× PCR buffer, 2 mM MgCl 2 , each deoxynucleotide 

at 0.05 mM, primers FR1C or FR3A plus LJH at 0.4 µM each, and 2.5 U Taq- 

DNA-polymerase. Add 500 to 1000 ng of DNA and distilled water to a final volume of 100 µL. 

Amplify with a program consisting of 7 min denaturation and enzyme activation at 94°C, 

followed by 50 cycles of denaturation for 1 min at 94°C and combined annealing and 

extension at 63°C (for primer FR3A) or 65°C (for primer FR1C), followed by a final 

extension step at 65°C for 5 min. If possible, collect another BM aspirate and start again. 

2. Sequence has no resemblance to known CDR regions: This is most probably caused by a 

nonspecific product of the consensus PCR. Perform consensus RT-PCR again. 

3. Sequence of a CDR-region is unsuitable for primer design: Sometimes the sequence of 

a CDR region is too short, has too many base repeats, or has too many long stretches 

rich in G and C, which makes designing primers difficult. Because CDR1 and CDR2 

region are shorter and less variable than the CDR3-region, one should never do without a 

CDR3-specific primer. If segments suitable for primer design are not long enough, identify 

at least a short segment that is apt. Devise primers complementary to this stretch, and 

elongate in 5′-end direction (never in 3′-direction, because this end is more important for 

specific annealing of the primer to the template). Use the CDR1/2- plus CDR3-specific 

primer strategy, if the CDR3 region is the one that is difficult for primer design.


4. The ASO primer does not generate specific PCR product or is not specific or sensitive 

enough: Optimize PCR conditions and test primer for specificity or sensitivity. Devise 

new primers. Change primer strategy (CDR3 or CDR1/ plus CDR3). If no specific product 

can be generated at all, it is most probable that the sequence of the CDR-regions is not 

that of the malignant clone. 

5. qPCR results are implausible: This is most probably caused by a faulty dilution series. 

Prepare dilution series anew and reanalyze the sample by qPCR. 

5. Discussion 

The described qPCR assay with ASO primers complementary to CDR regions of 

the malignant clone can be used to quantitate the proportion of malignant cells in 

peripheral blood (PB) and BM, aliquots of leukapheresis products, sorted cell fractions, 

or in cultured cells. It is possible to use this method for quantitative follow up in the 

course of therapy (16), to determine the tumor load of different stem cell sources (17), 

to determine the effect of different mobilization regimens and the duration of collection 

on the number of malignant cells in leukapheresis products (18,19) or to assess the 

extent of involvement in the malignant process of different cell fractions, for example, 

in the CD19+ or CD20+ cells of PB (20,21). The qPCR assay has evolved into an 

accurate and very sensitive tool for the detection of malignant cells in MM. 

References 

1. Cremer, F. W., Kiel, K., Wallmeier, M., Goldschmidt, H., and Moos, M. (1997) A quantitative 

PCR assay for the detection of low amounts of malignant cells in multiple myeloma. 

Ann. Oncol. 8, 633–636. 

2. Tonegawa, S. (1983) Somatic generation of antibody diversity. Nature 302, 575–581. 

3. Walter, M. A., Surti, U., Hofker, M. H., and Cox, D. W. (1990) The physical organisation 

of the human immunoglobulin heavy chain gene complex. Eur. Mol. Biol. Org. J. 9, 

3303–3313. 

4. Bakkus, M. H., Heirman, C., Van Riet, I., Van Camp, B., and Thielemans, K. (1992) 

Evidence that multiple myeloma Ig heavy chain VDJ genes contain somatic mutations but 

show no intraclonal variation. Blood 80, 2326–2335. 

5. Aubin, J., Davi, F., Nguyen-Salomon, F., Leboeuf, D., Debert, C., Taher, M., et al. (1995) 

Description of a novel FR1 IgH PCR strategy and its comparison with three other strategies 

for the detection of clonality in B cell malignancies. Leukemia 9, 471– 479. 

6. Brisco, M. J., Tan, L. W., Orsborn, A. M., and Morley, A. A. (1990) Development of a 

highly sensitive assay, based on the polymerase chain reaction, for rare B-lymphocyte 

clones in a polyclonal population. Br. J. Haematol. 75, 163–167. 

7. Campbell, M. J., Zelenetz, A. D., Levy, S., Levy, R. (1992) Use of family specific leader 

region primers for PCR amplification of the human heavy chain variable region gene 

repertoire. Mol. Immunol. 29, 193–203. 

8. Deane, M., McCarthy, K. P., Wiedemann, I. M., and Norton, J. D. (1991) An improved 

method for detection of B-lymphoid clonality by polymerase chain reaction. Br. J. 

Haematol. 5, 726–730. 

9. Diss, T. C., Peng, H., Wotherspoon, A. C., Isaacson, P. G., and Pan, L. (1993) Detection 

of monoclonality in low-grade β-cell lymphoma using the polymerase chain reaction is 

dependent on primer selection and lymphoma type. J. Pathol. 169, 291–295. 

10. Moore, G. E. and Kitamura, H. (1968) Cell line derived from patient with myeloma. N. Y. 

State J. Med. 68, 2054–2060.


11. Klein, E., Klein, G., Nadkarmi, J. F., Nadkarmi, J. J., Vigzell, H., and Clifford, P. (1968) 

Surface IgM-k specificity on a Burkitt lymphoma cell in vivo and in derived culture lines. 

Cancer Res. 28, 1300–1310. 

12. Yamada, M., Wasserman, R., Reichard, B. A., Shane, S., Caton, A. J., and Rovera, G. 

(1991) Preferential utilization of specific immunoglobulin heavy chain diversity and joining 

segments in adult human peripheral blood B lymphocytes. J. Exp. Med. 173, 395– 407. 

13. Brisco, M. J., Condon, J., Sykes, P. J., Neoh, S. H., and Morley, A. A. (1991) Detection and 

quantitation of neoplastic cells in acute lymphoblastic leukaemia, by use of the polymerase 

chain reaction. Br. J. Haematol. 79, 211–217. 

14. Wiesner, R. J. (1992) Direct quantitation of picomolar concentrations of mRNAs by 

mathematical analysis of a reverse transcription/exponential polymerase chain reaction 

assay. Nucleic Acids Res. 51, 5863–5864. 

15. Taswell, C. (1981) Limiting dilution assays for the determination of immunocompetent 

cell frequencies. J. Immunol. 126, 1614–1619. 

16. Cremer, F. W., Dada, R., Kiel, K., Ehrbrecht, E., Goldschmidt, H., and Moos, M. (1998) 

Quantitative PCR monitoring of the effect of double high-dose therapy on the tumor load of 

patients with multiple myeloma. Ann. Hematol. 77 (Suppl. II), 182 (abstract 722). 

17. Vescio. R. A., Han, E. J., Schiller, G. J., Lee, J. C., Wu, C. H., Cao, J., et al. (1996) 

Quantitative comparison of multiple myeloma tumor contamination in bone marrow harvest 

and leukapheresis autografts. Bone Marrow Transplant. 18, 103–110. 

18. Cremer, F. W., Kiel, K., Wallmeier, M., Haas, R., Goldschmidt, H., and Moos, M. (1998) 

Leukapheresis products in multiple myeloma: lower tumor load after mobilization with 

cyclophosphamide plus granulocyte colony-stimulating factor (G-CSF) compared with 

G-CSF alone. Exp. Hematol. 26, 969–975. 

19. Kiel, K., Cremer, F. W., Ehrbrecht, E., Wallmeier, M., Hegenbart, U., Goldschmidt, H., aet 

al. (1998) First and second apheresis in patients with multiple myeloma: no differences in 

tumor load and hematopoietic stem cell yield. Bone Marrow Transplant. 21, 1109–1115. 

20. Kiel, K., Cremer, F. W., Rottenburger, C., Kallmeyer, C., Ehrbrecht, E., Atzberger, A., et al. 

(1998) Circulating tumor cells in patients with multiple myeloma in the course of high-dose 

therapy. Ann. Hematol. 77 (Suppl. II), 182 (abstract 724). 

21. Rottenburger, C., Kiel, K., Cremer, F. W., B′′sing, T., Atzberger, A., Moldenhauer, G., 

et al. (1998) No differences in the tumor load in the CD19+ and CD20+ cell fractions of 

peripheral blood from patients with multiple myeloma post high-dose therapy and with 

peripheral blood stem cell support. Ann. Hematol. 77 (Suppl. II), 184 (abstract 731).

qPCR to Detect RNA Viruses 197 

32 

Ultrasensitive Quantitative PCR to Detect RNA Viruses 



The use of quantitative polymerase chain reaction (qPCR) to detect RNA viruses 

has become increasingly important as a prognostic marker and in patient management, 

for example, in human immunodeficiency virus (HIV) and hepatitis C virus (HCV) 

infection. Drug therapies can be monitored by regularly checking viral load, indicating 

whether the regime is sufficient, or whether alternatives should be sought. It is therefore 

crucial that the systems used are ultrasensitive and give accurate and reproducible 

results. 

There are several elements to consider in developing a reliable and accurate 

quantitative assay. First, rapid transport and storage of samples is important because 

of the unstable nature of RNA, as is the method of preparation. Samples should be 

received and processed within 6 h and the relevant fractions stored at –70°C until 

testing. Second, it is difficult to ascertain the efficiency of sample preparation methods; 

therefore, values obtained using qPCR may be several times lower than the actual copy 

number. Known standards should therefore be processed alongside samples to assess 

the loss within the system (1). Third, the efficiency of the reverse transcriptase step has 

been assessed to be from 5 (2) to 10% (3,4), and this must be taken into account when 

calculating viral load. Finally, there is a need to amplify all viral types equally, which 

can be a problem with the high mutation rate observed in RNA viruses. As a result, 

primers should be chosen from highly conserved noncoding regions. such as the 5′ noncoding 

region of HCV (5) and of enteroviruses (6). 

Several quantitative systems that use a variety of approaches have been developed 

and published. These include limiting dilution; the use of external standard curves; 

co-amplification of an internal reference template; and competitive PCR using an 

internal control. There are advantages and disadvantages with each of these systems, 

and the system of choice will depend on several factors. These methods have been used 

to detect as few as 40 copies of HCV (7), 64 and 4 copies of HIV per ml of plasma or 

serum, respectively (8,9), and less than 10 copies of enterovirus (10). 

1.1. Limiting Dilution 

The linear relationship between the amount of template and product is the basis of 

the limiting dilution method. However, this only occurs over a limited range; therefore, 



197

198 McDonagh 

the dilution method is a semiquantitative system. Another consideration is that several 

reactions have to be run if Poisson distribution analysis is to be conducted using the 

limiting dilution method. Perhaps the most important consideration is that tube-to-tube 

variation is not controlled using this method (1). 

1.2. External Standard Curves 

This is based on the generation of an external standard curve where a dilution series 

of known amounts of template are carried out alongside each run. 

1.3. Coamplification of an Internal Reference Template 

The problem of tube-to-tube variation can be overcome by the coamplification of 

a single-copy cellular gene and the target sequence. This means that both templates 

should be affected by any variations of amplification efficiency. However, because 

different templates and reactions have different efficiencies, the relative amounts of 

product could vary. An added problem is that this system cannot be used to quantitate 

extracellular organisms and therefore is of no value in measuring viruses, including 

HIV and HCV, in plasma samples (1). As a result, this method will not be considered 

further. 

1.4. Competitive PCR Using an Internal Control 

The use of a competitive internal control that is similar to the target apart from 

length or the existence of a restriction site may alleviate the problems encountered with 

other methods of qPCR, such as co-amplification of an internal reference template (9). 

It will also act as a control for inhibition (10). Both the target and control DNA should 

amplify with the same efficiency because they compete equally under given conditions 

and the ratio of products will therefore remain constant throughout amplification (11). 

The point at which target and control DNA are equal can then be found by direct 

comparison using gel electrophoresis and densitometry or by enzyme immunoassay 

(EIA). This method has become the method of choice for quantitative assays, but it is 

expensive and time consuming because it requires several reactions per sample. 

To conduct a competitive PCR, it is necessary to create a template that is virtually 

the same as the product to be amplified but which can be identified during the detection 

stage. Primer-directed mutagenesis can be used to create a deletion, insert, or substitution 

at any point in the fragment (12,13). An outline of this procedure can be seen 

in Fig. 1. Two separate reactions are conducted, each using an external primer plus 

an internal primer containing the appropriate changes, for example, to create a novel 

restriction enzyme (RE) site. This can then be used as a competitive template, which 

can be differentiated from amplified wild-type product. The products of these reactions 

are purified, denatured, and renatured together then added to a PCR containing the 

outer primers. The resulting amplicon contains the mutated site and can be used directly 

or cloned to create as much template as required. 

The analysis of products is also important. Agarose gel electrophoresis, sometimes 

with densitometry, is easy to perform and is suitable for differentiating wild type from 

mutated products after digestion with the appropriate enzyme.


Fig. 1. Construction of a competitive PCR template. Figure modified from ref. 12. 

2. Materials 

Unless stated, all chemicals are supplied by Sigma (Poole, UK), or Merck. All stock 

solutions up to and including the PCR step should be made using RNA free water. 

2.1. Reverse Transcription (see Note 1) 

1. dNTPs (1 mM; Pharmacia). 

2. Anti-Sense primer (100 ng/µL). 

3. RNasin (20–40 units/µL; Promega, Southampton, UK). 

4. Reverse transcriptase (RT) and 10× buffer, for example, AMV (Promega). 

5. Dimethyl sulphoxide (DMSO). 

6. Thermocycler (Hybaid, Teddington, UK).

200 McDonagh 

2.2. Basic PCR 

1. dNTPs (2 mM, 10× stock; Pharmacia; see Note 2). 

2. Taq or Pfu DNA polymerase and 10× buffer (Sigma, Promega; see Note 3). 

3. Forward and reverse primers (2 µM; 10× stock). 

4. Mineral oil (Sigma) or wax beads (Perkin–Elmer, Warrington, UK). 

5. Thermocycler (Hybaid, Teddington, UK). 

2.3. PCR to Create Mutated Competitor Fragments 

(e.g., Containing a Novel RE Site) 

1. Forward and reverse primers used in conventional PCR (2 µM). 

2. Internal forward and reverse primers containing bases to create novel RE site (2 µM). 

3. DNA purification system (Geneclean, Bio 101, US). 

4. PCR cloning system (TA cloning kit; Promega or Invitrogen; Leek, The Netherlands). 

5. RE enzyme (to digest mutated product) or method of differentiating between wild-type 

and mutated product, such as a probe. 

3. Methods 

3.1. Reverse Transcription 

1. Mix together the following reagents in an ice bath: 

7.5 µL of RNAse free water 

3 µL of DMSO 

100 ng of antisense virus-specific primer (in 1 µL) 

2 µL × 10 RT buffer 

3 µL of 1 mM dNTPs 

0.5 µL of RNAsin (20–40 units/µL) 

5 µL of RNA, prepared by extraction method 

1 µL of RT 

2. Incubate for 30–60 min at 42°C followed by 5 min at 95°C and 5 min at 4°C. 

3. Pulse spin tubes and add 5 µL to PCR reaction or store at –20°C until required (see 

Note 4). 

3.2. PCR 

3.2.1. Basic Reaction 

1. Make up a master mix containing 5 µL of buffer (×10); 5 µL of dNTP (2 mM, final 

concentration 0.2 mM); 5 µL of each primer (2 µM, final concentration 0.2 µM); and 1 U 

DNA polymerase (see Notes 2 and 3). 

2. Overlay with oil if not using a thermocycler with a heated lid, then add 5 µL of prepared 

cDNA through the oil. 

3. A typical cycling protocol consists of denaturation at 95°C for 30 s, annealing at 5°C below 

the primer melting point for 30 s, and extension at 68 to 74°C for 45 s (see Note 5). 

4. Carry out as few cycles as necessary because the reaction is only linear over a short range 

and this may distort the results. 

5. To further increase sensitivity, it is beneficial to use nested PCR. As a general rule, the 

primary round should consist of 20 to 25 cycles and the secondary round up to 20 cycles. It 

may also be necessary to add diluted primary product (1/10) to the secondary round. 

3.2.2. Limiting Dilution Method 

A limiting dilution of cDNA is performed in 10-fold steps, and this is then added 

to the PCR. The sensitivity of the assay must be known, and the amount of cDNA in


the samples can then be extrapolated by finding the detection end point. A specific 

volume of cDNA may also be added to a number of replicate reactions to give a Poisson 

distribution (5,14,15). 

3.2.3. The Use of External Standard Curves 

A 10-fold dilution series covering from 1 to 10 5 molecules is used to produce a 

standard calibration curve. Amplified products can then be analyzed using the desired 

detection system, for example, by microwell capture so that optical density values can 

be compared with those of the standard curve (4). 

3.3. Competitive PCR Using an Internal Control 

3.3.1. Creation of a Mutated Template Containing a Novel RE Site 

1. Perform two PCR reactions, each containing an external primer plus the appropriate 

internal primer with mismatches to create the RE site. Approximately 20 to 30 cycles using 

a low annealing temperature will allow for mismatches (Fig. 1). 

2. Analyze the products by agarose gel electrophoresis, excise the bands, and recover the 

DNA using Geneclean following manufacturer’s protocols. 

3. Heat the combined products to 94°C for 1 min, then cool and allow to renature. 

4. Amplify the renatured products using the external primers and normal cycling conditions. 

5. Check for the mutated site by RE digest (3 µL of product, 1 µL of 10× buffer, 5 µL of 

dH2 2 O, 10 U/µL enzyme) at the appropriate temperature for 1 h. Analyze products by 

agarose gel electrophoresis. Alternatively, sequence the amplicon. 

6. If required, the products may be cloned into a PCR cloning vector for further manipulation 

or simply used as PCR template to create as much competitor as necessary. 

3.3.2. Quantitative PCR Using the Mutated Competitor 

1. Perform a series of 10-fold titrations of mutated fragment with known copy number 

(1–10,000 copies; see Note 6). 

2. Add each to a separate basic PCR along with the unknown quantity of DNA to be amplified 

and perform as few rounds as necessary (20–30 rounds). 

3. Run products on 1 to 2% agarose and analyze by densitometry (gel or photograph; see 

Fig. 2). 

4. The point at which wild-type and mutant intensity is equal identifies the amount of wild 

type DNA to within 1 log. 

4. Notes 

1. The RT and PCR stages may be performed in a single-tube format and also combined with 

hot start when wax beads are used to separate the stages (7). 

2. PCR DIG labeling mix must also be included if using EIA detection methods. Instead 

of adding combined dNTPs, add 200 µM of dATP, dCTP, dGTP, 190 µM of dTTP, and 

10 µM of Dig dUTP. 

3. Pfu has been found to generate higher product yields (4). 

4. cDNA produced in this reaction appears to be slightly unstable. Long-term storage leads 

to significant reductions in the amount of target DNA. 

5. Hot start PCR where a heating step at 95°C is required to activate the polymerase may 

increase amplification efficiency. 

6. Further titrations can be performed, although this is expensive and time consuming. 

7. The 118-bp fragment must also be taken into account when finding the point of equilibrium. 

Although it is possible to detect the end point of this reaction by eye (between lanes 6 and 7), 

it is more accurate to use densitometry.

202 McDonagh 

Fig. 2. Quantitative PCR products after RE digestion to reveal true products (522 bp) and 

mutated competitor products (404 and 118 bp). Lanes 1 through 8 contain 15 copies of template 

and decreasing amounts of mutated competitor (10,000, 2000, 1000, 200, 100, 20, 10, and 

1 copy, respectively). The reaction was based on the amplification of a 522-bp product and a 

mutated competitor that was identical except for the creation of a SmaI site 118 bp into the 

fragment (see Note 7). 

References 

1. Clementi, M., Menzo, S., Bagnarelli, P., Manzin, A., Valenza, A., and Varaldo, P. E. (1993) 

Quantitative PCR and RT-PCR in virology. PCR Methods Appl. 2, 191–196. 

2. Zhang, L. Q., Simmonds, P., Ludlam, C. A., and Leigh Brown, A. J. (1991) Detection, 

quantification and sequencing of HIV-1 from plasma of seropositive individuals and from 

factor VIII concentrates. AIDS 5, 675–681. 

3. Kaneko, S., Murakami, S., Unoura, M., and Kobayashi, K. (1992) Quantitation of hepatitis 

C virus by competitive polymerase chain reaction. J. Med. Virol. 37, 278–282. 

4. Whitby, K. and Garson, J. A. (1995) Optomisation and evaluation of a quantitative 

chemiluminescent polymerase chain reaction assay for hepatitis C virus RNA. J. Virol. 

Methods. 51, 75–88. 

5. Hawkins, A., Davidson, F., and Simmonds, P. (1997) Comparison of plasma virus loads 

among individuals infected with hepatitis C virus (HCV) genotypes 1, 2, and 3 by 

Quantiplex HCV RNA Assay versions 1 and 2, Roche Monitor Assay and an in-house 

limiting dilution method. J. Clin. Microbiol. 35, 187–192. 

6. Lauwers, S., Bissay, V., and Rombaut, B. (1997) Development of an enterovirus specific 

PCR method for the quantification of enterovirus genomes in blood of diabetes patients. 

Clin. Diagn. Virol. 9, 135–139. 

7. Whitby, K. and Garson, J. A. (1997) A single tube two compartment reverse transcription 

polymerase chain reaction system for ultrasensitive quantitative detection of hepatitis C 

virus RNA. J. Virol. Methods 66, 15–18.


8. Kashanchi, F., Melpolder, J. C., Epstein, J. S., and Sadaie, M. R. (1997) Rapid and sensitive 

detection of cell-associated HIV-1 in latently infected cell lines and in patient cells using 

sodium-n-butyrate induction and RT-PCR. J. Med. Virol. 52, 179–189. 

9. Liuzzi, G., Chirianni, A., Clementi, M., Bagnarelli, P., Valenza, A., Cataldo, P. T., et al. 

(1996) Analysis of HIV-1 load in blood, semen and saliva: Evidence for different viral 

compartments in a cross-sectional and longitudinal study. AIDS 10, F51–F56. 

10. Mayerat, C., Burgisser, P., Lavanchy, D., Mantegani, A., and Frei, P. C. (1996) Comparison 

of a competitive combined reverse transcription PCR assay with a branched-DNA assay 

for hepatitis C virus. J. Clin. Microbiol. 34, 2702–2706. 

11. Gilliland, G., Perrin, S., Blanchard, K., and Bunn, H. K. (1990) Analysis of cytokine 

mRNA and DNA: Detection and quantitation by competitive polymerase chain reaction. 


12. Higuchi, R., Krummel, B., and Saiki, R. K. (1988) A general method of in-vitro preparation 

and specific mutagenesis of DNA fragments: study of protein and DNA interactions. 


13. Vallette, F., Mege, E., Reiss, A., and Adesnik, M. (1989) Construction of mutant and 

chimeric genes using the polymerase chain reaction. Nucleic Acids Res. 17, 723–733. 

14. Simmonds, P., Zhang, L. Q., Watson, H. G., Rebus, S., Ferguson, E. D., Balfe, P., et al. 

(1990) Hepatitis C quantification and sequencing in blood products, haemophiliacs, and 

drug users. Lancet 336, 1469–1472. 

15. van Kerckhoven, I., Fransen, K., Peeters, M., de Beenhouwer, H., Piot, P., and van der 

Groen, G. (1994) Quantification of human immunodeficiency virus in plasma by RNA 

PCR, viral culture, and p24 antigen. J. Clin. Microbiol. 32, 1669–1673.

204 McDonagh

Site-Directed Mutation and PCR Mimics 205 

33 

Quantitative PCR for cAMP RI Alpha mRNA 

Use of Site-Directed Mutation and PCR Mimics 



Precise and accurate determination of mRNA expression levels in tissues and model 

systems is a central methodology in a wide range of research applications. Expression 

of many genes is currently assessed by northern blotting, RNAse protection assays, 

Serial Analysis of Gene Expression (SAGE), and many other techniques; however, for 

single transcripts, especially where tissue is limited or abundance is low, quantitative 

polymerase chain reaction (PCR) is the method of choice. However, where quantitative 

PCR is to be used, the reproducibility, accuracy, and detection limits of the technique 

must be clearly defined. 

We address this issue in the context of breast cancer by establishing a quantitative 

PCR technique for the measurement of cAMP RI alpha-binding proteins, the regulatory 

subunitis of cAMP-dependent protein kinase, using PCR mimics. The technique was 

evaluated for interassay and intraassay variation and precision. This approach is 

applicable to any marker of interest where quantitation of RNA or DNA levels by 

PCR is attempted. For details of the construction of the mimics. see Bartlett et al. (1); 

however, a more robust and reproducible method of mimic construction is described 

within this volume (see Chapter 7). 

2. Materials 

1. RI alpha PCR primers (100 µM, see Note 1). 

RI alpha 430 sense: 5′-GCATAACATTCAAAGCACTGC-3′ 

RI alpha antisense: 5′-CTTGCTGAATCACAGTCTCTCC-3′ 

2. RI alpha control (430 base pairs) in pCRII vector: Dilute the control plasmid to 100, 10, 

1, and 0.1 pg of insert per µL (see Note 2). 

3. RI alpha MIMIC (430 base pairs) in pCRII vector (see Note 3): Dilute the mimic plasmid 

to 100, 10, 1, and 0.1 pg of insert per µL. 

4. Extracted RNA (1 µg in 5 µL per sample; see Subheadings 2.1.3.–2.1.5., ibid). 

5. Random hexamer N6 (100 µM, Life Technologies, Paisley, UK, see Note 4). 

6. dNTP mix: 2 mM each of dATP, dTTP, dCTP and dGTP in distilled water, aliquoted, and 

stored at –20°C (Life Technologies, Paisley, UK). 

7. MMLV Reverse transcriptase and buffer (200 units/µL; Life Technologies, Paisley, UK). 



205


Table 1 

Example Assay Layout 

Sample 

Control 10 pg of RIα 100 pg of RIα Sample 1 Sample 2 Sample 3 Etc. 

0.1 pg of RIα 

mutant 

1.0 pg of RIα 

mutant 

10 pg of RIα 

mutant 

100 pg of RIα 

mutant 

8. Human placental ribonuclease inhibitor (40 U/µL, Pharmacia, UK). 

9. Radioactive dNTP mix: 1.25 mM each of dATP, dTTP, dGTP, and 0.5 mM dCTP in distilled 

water, aliquoted, and stored at –20°C (Life Technologies, Paisley, UK). Before use, add 

0.1 µCi 32 P dCTP (Amersham, UK)/5 µL dNTP mix to be used in PCR (see Note 5). 

10. Taq polymerase (5 units/µL) and buffer (Applied Biosystems, UK) 10× buffer: 500 mM 

potassium chloride, 100 mM Tris-HCl, 1% Triton-X and 25 mM magnesium chloride 

(see Note 6). 

11. Paraffin oil (see Note 7). 

12. Sodium chloride (100 mM) in sterile distilled water. 

13. EcoRV restriction enzyme 10 units/µL (Pharmacia UK). 

14. PAGE electrophoresis system (e.g., Protean II, Bio-Rad UK). 

15. Gel fixative: 5% glacial acetic acid, 40% methanol, 10% glycerol in water. 

16. Gel dryer. 

3. Methods 


1. Add 1 µL of random hexamer (100 ng) to 1 µg of RNA and make up to a total volume of 

9.5 µL with distilled water in a 0.2-mL thin-walled PCR tube. 

2. Heat to 65°C for 10 min and cool on ice. 

3. Prepare reverse transcription mix as follows: 4 µL of 5× reverse transcriptase buffer, 5 µL 

of 2 mM dNTP mix, 1 µL of reverse transcriptase (200 units), 0.5 µL of human placental 

ribonuclease inhibitor per reverse transcription reaction. 

4. Incubate at 42°C for 1 h, inactivate reverse transcriptase at 80°C for 5 min, and store 

cDNA at –20°C until required for quantitative PCR (see Note 8). 

3.2. Quantitative PCR 

1. Construction of standard reactions: Duplicate reactions were set up as follows: to separate 

aliquots of 10 pg of control RI alpha (in 10 µL), add 0.1, 1, 10, and 100 pg of mutant RI 

alpha (in 10 µL). Also, to separate aliquots of 100 pg of control RI alpha (in 10 µL), add 

0.1, 1, 10, and 100 pg of mutant RI alpha (in 10 µL). Prepare separate tubes only containing 

10 pg of mutant plasmid or 10 pg of control plasmid (restriction digest controls). 

2. For each sample (unknown concentration), take 1 µL of cDNA from the reverse transcription 

reaction plus 9 µL distilled water and to separate aliquots add 0.1, 1, 10, and 100 pg of 

mutant RI alpha (in 10 µL; see Table 1 for assay layout; also, see Note 9).


Fig. 1. Example of a crossover plot for a sample containing 10 pg of RI alpha cDNA. Vertical 

axis, counts per minute. Horizontal axis concentration of RI alpha mutant cDNA added. Solid 

curve = mutant RI alpha plasmid, dashed curve = sample. Reproduced with permission from 

Bartlett et al. (1). 

3. Prepare PCR master mix as follows: per tube, add To each tube 5 µL of 10× reaction 

buffer, 5 µL of 25 mM MgCl 2 , 0.1 µL of Taq polymerase, 5 µL of radioactive dNTP mix, 

and 14.9 µL of distilled water. 

4. Add 30 µL of PCR master mix to each tube set up in steps 1 and 2. If not using a heated 

lid PCR block, overlay with 100 µL of paraffin oil. 

5. Perform PCR amplification for 26 cycles (94°C for 40 s, 55°C for 60 s, 72°C for 70 s) 

followed by extension at 72°C for 5 min. 

3.3. Restriction Digestion 

1. Add 5.0 µL of 100 mM sodium chloride to each reaction followed by 1.0 µL of EcoRV 

restriction enzyme (10 units; see Note 10). 

2. Incubate at 37°C for 2 h to ensure complete digestion of mutant RIα product. 

3. Labeled PCR products were separated on a 6% polyacrylamide gel at 30 mA for 2 to 3 h 

using a Protean II vertical electrophoresis system (Bio-Rad UK). 

4. Gels were fixed for 30 to 60 min in fixative and dried using a flat bed gel dryer and heating 

to 80°C for 1 to 2 h. 

5. Gels were exposed to preflashed X-OMAT (Kodak UK) film for 1 to 8 h using radioactive 

ink to orient the gels. 

6. Bands corresponding to normal (430 base pair) and mutant component (215 base pair) 

component of each reaction were excised and 32 P incorporation determined by Cerenkov 

counting (see Note 11).


3.4. Calculation of Results 

1. The results of a typical assay are illustrated in Fig. 1. After restriction digestion of the 

co-amplified mutant and normal RI alpha, two bands are clearly visible, representing 

products of 430 and 215 base pairs. If no normal cDNA is added, all the product is digested 

to give only a 215-bp band. In the illustrated assay, mutant RI alpha cDNA is co-amplified 

in a range of concentrations with known (100 or 10 pg) or unknown (patient sample) 

concentrations of unmutated RI alpha cDNA. At high concentrations of mutant plasmid, 

the lower band is the most intense. As the concentration of mutant cDNA is decreased, 

the relative intensity of the lower 215 bp band decreases and that of the larger 430 bp 

band increases. Where concentrations are equivalent, each product is produced at the 

same intensity. Thereafter, the upper 430-bp band becomes more intense. The point of 

equivalence of concentration is therefore represented by a crossover between the lower 

and upper band intensities. 

2. For each sample, the counts per minute determined by Cerenkov (1) counting for the 

mutant and normal bands are plotted against the concentration of mutant plasmid added. 

The point at which the two curves cross represents the point at which the concentration of 

mutant and normal RI alpha are equivalent, thus allowing the concentration in unknown samples 

to be determined from this crossover point (see Fig. 2). In this example, the counts for 

the mutant and normal RI alpha bands from the PCR assay are plotted against the concentration 

of mutant RI alpha added. The curves cross over at 10 pg, indicating a concentration 

in the test sample of 10 pg RI alpha cDNA equivalent to 3.4 fmol RI alpha mRNA in 

the sample. 

3. The sensitivity of the assay was assessed using a range of cDNA concentrations from 

34 fmol to 0.0034 attomol (10 –14 to 10 –21 mol, 30 cycles of PCR were used for this lower 

limit). The sensitivity under these conditions was 0.002 attomol (2 × 10 –21 mol or approx 

1000 copies of mRNA; see Note 12). 

4. Intra and interassay variation for the quantitative PCR assay were determined as 8.0 and 

14.3%, respectively (see Note 13). 

5. Calculation of confidence intervals for results: As the co-efficients of variation are known 

for each stage of the reverse transcription (RT)-PCR assay, we were able to calculate 

the confidence intervals for sample concentrations determined by this assay technique. 

Where samples are measured within the same assay this is calculated as follows (see 

Note 13): 

C imax = C o (1 + E i )(1 + V i ) and C imin = C o (1 – E i )(1 – V i ) 

Where C imax is the maximum estimated concentration and C imin is the minimum. C o is the 

observed concentration, E i is the intra-assay variation for reverse transcriptase, and V i is 

the intra-assay variation for PCR. 

If necessary interassay confidence limits can be defined from the above values using 

the following formula: 

C bmax = C imax (1 + E b )(1 + V b ) and C bmin = C imin (1 – E b )(1 – V b ) 

Where C bmax is the maximum estimated concentration and C bmin is the minimum and E b 

is the inter-assay variation for reverse transcriptase and V b is the intra-assay variation 

for PCR. 

3.5. Discussion 

By assessing the variation at each step during the RT-PCR procedure, this method 

defines the variation as a result of the reverse transcription and PCR steps and show that


for samples assayed within a single assay the variation can be kept within acceptable 

limits. Furthermore, although it is possible, using the pCRII vector, to generate mRNA 

as an additional control, the low intra assay variation defined in this system allows this 

simpler procedure to be followed. 

Interassay and intra-assay variations were similar to those obtained by conventional 

radioimmunoassays (2,3), suggesting this technique could be robustly applied to 

clinical diagnostic problems, such as the determination of viral load for either RNA or 

DNA viruses (omitting the RT step for the latter). 

The sensitivity of this technique is such that low copy number genes could be 

assayed in 100 s or at most a few thousand cells and can be applied to patient tissue 

samples and small cell cultures. In addition, by allowing absolute concentrations to 

be determined, this assay will facilitate comparisons between laboratories previously 

hampered by semiquantitative approaches to PCR (4,5), and this precision is maintained 

even over most applications of fluorescence real-time PCR (6). 

4. Notes 

1. The cDNA sequence for human cAMP-dependent protein kinase subunit was retrieved 

from the Gembl database (accession no. M33336; 7). Using this sequence, primers were 

designed that amplified bases 159 to 589. This 430-bp fragment codes entirely for mRNA, 

which is subsequently translated into protein. 

2. The mimic is inserted in the 3900-bp pCRII vector by calculating the length of the vector 

containing the insert and dividing this by the length of the insert the molecular weight fraction 

made up by the insert is calculated and the Mwt corrected to reflect that of the PCR insert 

only. The molar equivalent for RI alpha mRNA added to the assay system was calculated 

as follows: 1 pg RI alpha plasmid is equivalent to 0.34 fmols RI alpha mRNA. 

3. The PCR mimic was constructed as described elsewhere. Using site-directed mutagenesis, 

a single bp change was introduced within the RI alpha PCR product to introduce a EcoRV 

restriction site. For researchers wishing to evaluate this quantitative PCR approach, this 

mimic is available on request from the author. 

4. Reverse transcription with a random hexamer will target all RNA species. Specific primers 

for the product of interest, out with the PCR product sequence, or polyA primers to target 

mRNA may be substituted as required. 

5. Because of the high activity of 32 P, alternatives such as 33 P or biotin-dCTP may be 

considered. 

6. Magnesium chloride concentrations may need to be altered for different PCR products. We 

therefore recommend using buffer with separate magnesium chloride. 

7. Using heated lids avoids the need for paraffin oil overlay, which reduces evaporation. 

8. To evaluate the reproducibility of the reverse transcription reaction we recommend 

including 0.5 µCi [ 35 S]dATP. This small amount of [ 35 S]dATP does not affect subsequent 

quantitation of the PCR. In our previous experiments, we demonstrated an intra-assay 

variation of 17% between samples in RT reactions and a 9% mean inter assay variation. 

9. The sensitivity of the assay can be varied by varying the standard range; decreasing the 

range of mutant and control plasmid from 0.1 to 100 pg to 0.01 pg to 1.0 pg increased the 

sensitivity of detection. For these experiments, PCR was performed over 30 cycles. 

10. The restriction enzyme EcoRV has an optimal digestion in buffered 50 mM KCl, 10 mM 

NaCl, and addition of 10% 100 mM NaCl to the PCR mix best approximates these 

conditions and avoids the need for purification of the PCR product at this step. The use of 

amplified control and mutant plasmids provides a high degree of control over the efficiency 

of the restriction digestion reaction.


11. Cerenkov counting is a simple principle where excised gel fragments are counted in the 

absence of scintillation fluid. Image analysis of the exposed autoradiograph can also be 

used at this stage. 

12. The assay has not been evaluated below this limit and theoretically could function at 

sensitivities of tens or hundreds of mRNA copies; at these low concentrations, stochastic 

errors may be introduced. 

13. Where all samples from a given individual or experiment are included in the same assay, 

interassay variation can be ignored. 

References 

1. Bartlett, J. M. S., Hulme, M. J., and Miller, W. R. (1996) Analysis of cAMP RI-alpha 

messenger-RNA expression in breast cancer—Evaluation of quantitative polymerase 

chain-reaction for routine use. Br. J. Cancer 73, 1538–1544. 

2. Bartlett, J. M., Wu, F. C. W., and Sharpe, R. M. (1987) Enhancement of Leydig cell 

testosterone secretion by isolated seminiferous tubules during co-perifusion in vitro: 

comparison with static co-culture systems. Intl. J. Androl. 10, 603–617. 

3. Bartlett, J. M. S., Weinbauer, G. F., and Nieschlag, E. (1989) Quantitative analysis of 

germ cell numbers and relation to intratesticular testosterone following vitamin a-induced 

synchronization of spermatogenesis in the rat. J. Endocrinol. 123, 403– 412. 

4. Touraine, P., Martini, J. F., Zafrani, B., Durand, J. C., Labaille, F., Malet, C., et al. (1998) 

Increased expression of prolactin receptor gene assessed by quantitative polymerase chain 

reaction in human breast tumors versus normal breast tissues. J. Clin. Endocrinol. Metab. 

83, 667–674. 

5. Sugimoto, T., Tsukamato, F., Fujita, M., and Takai, S. (1994) Ki-ras and c-myc oncogene 

expression measured by coamplification polymerase chain reaction. Biochem. Biophys. 

Res. Commun. 201, 574–580. 

6. Bieche, I., Olivi, M., Champeme, M. H., Vidaud, D., Lidereau, R., and Vidaud, M. (1998) 

Novel approach to quantitative polymerase chain reaction using real-time detection: 

application to the detection of gene amplification in breast cancer. Intl. J. Cancer 78, 

661–666. 

7. Sandberg, M., Skalhegg, B., and Jahnsen, T. (1990) The two mRNA forms for the type 

I alpha regulatory subunit of cAMP-dependent protein kinase from human testis are due 

to the use of different polyadenylation site signals. Biochem. Biophys. Res. Commun. 

167, 323–330.

Quantitation of Multiple RNA Species 211 

34 

Quantitation of Multiple RNA Species 

Ron Kerr 


Real-time quantitative polymerase chain reaction (PCR) methods (1) can be further 

optimized for various purposes by performing quantitative PCR for multiple RNA 

species in one sample (2). Advantages of this method not only include the elimination 

of differences in reaction mix volumes and conditions that may occur in separate 

samples, but importantly it also allows reference of RNA quantitation to an internal 

control (also see Notes 1 and 2). Internal controls are RNA species for which the 

quantity of RNA does not change across different cell types or conditions. They allow 

correction of RNA quantitation for different starting quantities of total RNA. Widely 

used examples of internal controls are 18S ribosomal RNA and glyceraldehyde-3- 

phosphate dehydrogenase (GAPDH) (3), and commercial standard kits for these are 

available. Different internal controls may be appropriate depending on the cell types 

or conditions being studied, and it is advisable to try several different controls when 

setting up a new assay. Quantitation of multiple RNA species is possible through the 

use of fluorescent probes, such as Taqman probes, as previously described. 

When multiple RNA species are to be quantified in a single sample, probes with 

fluorophores of different wavelengths are used. As with any assay that relies on 

the measurement of multiple fluorescent signals, it is important to ensure that the 

wavelengths of the emitted signals are as distant as possible to reduce overlap in 

signal detection (Fig. 1). The materials and methods for quantitation of mRNA for the 

fibrinolytic protein tissue plasminogen activator (t-PA) using 18S ribosomal RNA as 

an internal control are shown below as a worked example of the quantitation of two 

RNA species in a single sample. 

2. Materials 

All reagents may be obtained from Applied Biosystems, Warrington, Cheshire, UK, 

unless otherwise stated. 

1. 100 ng/µL RNA sample (see Chapters 9–11 for RNA isolation method). 

2. Reverse Transcriptase mastermix (9 µL per reaction): 2.85 µL of DEPC distilled H 2 O, 

1 µL of 10× Taqman buffer, 2.2 µL of 25 mM MgCl 2 , 2 µL of dNTPs, 0.2 µL of RNase 

Inhibitor, 0.25 µL of multiscribe RT, and 0.5 µL of random hexamers. 



211

212 Kerr 

Fig. 1. Fluorescent probes 1 to 4 have different wavelengths as shown. For quantitation of 

multiple RNA species in a single sample, probes with the greatest difference in wavelengths 

should be selected to minimize overlap in signal detection. In this example probes 1 and 4 

would be selected. 

3. Primers/probes: Strict conditions must be adhered to for primer/probe design when using 

the ABI 7700 quantitative PCR system. These are shown in Table 1 and may be designed 

using Primer Express software. Primer and probe concentrations used are 10 pmol/µL 

and 5 pmol/µL, respectively. 

t-PA forward primer: GCAGGCTGACGTGGGAGTAC 

t-PA reverse primer: CCTCCTTTGATGCGAAACTGA 

t-PA probe: TGATGTGCCCTCCTGCTCCACCT 

These primers generate an amplicon of 91 base pairs, which spans intron 9 (1249 bp) 

of the t-PA gene. Because of the large intron size, only t-PA mRNA and not genomic 

DNA is amplified, removing the need for a DNase step. The t-PA Taqman probe has a 

FAM fluorescent label. 

4. 18S rRNA primer-probe mix (supplied premixed). The 18S rRNA probe has a VIC 

fluorescent label. 

5. PCR mastermix (Stratagene, La Jolla, California): 100 µL (500U) hot start Taq polymerase, 

1.7 mL of 10× PCR buffer, 1.44 mL of 50 mM MgCl 2 , 400 µL of 5 mM dNTPs, 6 µL 

of reference dye, and 6.354 mL of DEPC distilled H 2 O. This can be stored at –20°C 

until needed. 

6. Standard wall 0.6-mL capped conical tubes. 

7. 96-well reaction plate. 

8. ABI Prism 7700 Sequence detection system. 

3. Methods 

1. Reverse Transcriptase mastermix (9 µL) is added to 0.6-mL conical tubes. 

2. To this, 1 µL (approx 100 ng/µL) of total RNA is added.

Quantitation of Multiple RNA Species 213 

Table 1 

Conditions for Primer/Probe Design for Quantitative PCR 

Using the ABI 7700 Quantitative PCR System 

Primer 

T m (melting temperature) 58–60°C 

20–80% of nucleotides GC 

Length 9–40 bases 

214 Kerr 

after the PCR. This reduces the occurrence of contamination of subsequent assays 

by previous PCR products, which is an important consideration for any PCR system. 

A disadvantage of this system is that it may not be suitable for all target proteins. 

We have found that for some target RNAs trial of a large number of primer sets may be 

necessary before suitable primers are found. Also, the short amplicon length leads to an 

increased chance of homologous products amplified compared with PCR using primers 

for longer amplicons. We have found that the strict conditions may result in it not being 

possible to find suitable primers/probe for some RNA species. In our experience, these 

have been coagulation proteins, which are known to have a high degree of homology 

with other proteins. 

3. The above protocol will generate results as the cycle at which a set fluorescence threshold 

(Ct) is reached for each standard/unknown for both t-PA mRNA (FAM) and 18S rRNA 

(VIC). The standards are used to ensure that the difference between the Ct of the test RNA 

species and the Ct of the 18S rRNA internal control (∆Ct) remains constant across all 

mRNA dilutions in the range chosen for the standards (10 to 0.156× above). We can ensure 

that this is the case by plotting the ∆Ct for each of the standards against the log total RNA 

for each of the standards. If the gradient of the slope of this line is less than ± 0.1, this 

indicates that the ∆Ct is remaining constant and that the “∆∆Ct∀ method can be used 

to quantitate the mRNA for the unknowns as follows. The relative mRNA quantity of 

various unknowns compared with a nominal baseline unknown are calculated by using 

the formula 2 –∆∆ct , where ∆∆Ct is the difference in the ∆Ct of the test sample and the ∆Ct 

of the nominal baseline sample. 

The use of the ∆∆Ct method is advantageous when a large number of repeated samples 

have to be analyzed because it removes the need for running a set of standards each time, 

which is both time-consuming and increases costs. However, for many purposes, it seems 

sensible to generate a standard curve each time to ensure the validity of the results. 

References 

1. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996) Real time quantitative 

PCR. Genome Res. 6, 986–994. 

2. Desjardin, L. E., Chen, Y., Perkins, M. D., Teixeira, L., Cave, M. D., and Eisenach, K. D. 

(1998) Comparison of the ABI 7700 system (TaqMan) and competitive PCR for quantification 

of IS6110 DNA in sputum during treatment of tuberculosis. J. Clin. Microbiol. 36, 

1964–1968. 

3. Goidin, D., Mamessier, A., Staquet, M. J., Schmitt, D., and Berthier-Vergnes, O. (2001) 

Ribosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and betaactin 

genes as internal standard for quantitative comparison of mRNA levels in invasive and 

noninvasive human melanoma cell subpopulations. Anal. Biochem. 295, 17–21.

Differential Display Techniques 217 

35 

Differential Display 




Since the completion of the human genome-sequencing project, scientists are now 

able to read the code of all human genes stored on the 46 chromosomes of the human 

genetic library. However, we are far from reaching an understanding of the functional 

relationships existing between more than a tiny fraction of these genes. The value of 

the human genome-sequencing project, beyond the simple collation of data, has been 

to teach us that it is possible to take a highly intensive analytical approach to the study 

of human systems in health and disease (1–4). 

The aim of our research has now shifted from the study of individual genes, isolated 

from the cellular environment in which they play their roles, to the investigation of the 

hugely complex interactions between gene and gene families. We are shifting from 

the observation of individual trees to an evaluation of the wood itself. To accomplish this, 

novel techniques have emerged that simultaneously allow the analysis of entire 

pathways or indeed entire cellular transcription patterns. The challenge this provides is 

both a molecular and mathematical one. Experiments now yield vast amounts of data 

that must be sifted through to formulate novel hypotheses. Conversely, we are now 

able to see how whole families of genes are regulated and interact rather than having to 

slowly piece together information often from quite different experimental approaches. 

The continuing development of biomathematical modeling systems (5–9) is essential 

to this approach. 

Over the next decade, scientists face the challenge of transforming the knowledge 

gained of the human genome sequence into a practical and functional understanding 

of complex biological systems in health and disease. It is clear that analysis of gene 

expression represents a highly significant pointer to the altered function of transcripts 

identified by the human genome project whose function is largely unknown. The ability 

to select candidate genes from expression libraries from different tissues and disease 

states (and stages) for rapid investigation represents the single most important driver 

behind the current explosion in expression library analysis. It is therefore critical 

that we understand both the potentials and limitations of technologies available for 

expression analysis of entire transcriptomes. 



217


As with any experimental approach, the researcher must have a clear goal and 

hypothesis in mind at the outset of the experimental procedure such that the techniques 

selected to achieve that goal are appropriate. The attraction, and pitfall, of transcriptome 

analysis is that these are extremely powerful tools for the identification of transcripts 

implicated in altered tissue functions. There are therefore a few basic principles that bear 

stating at this stage before the examination of the techniques available in this area. 

First and most importantly, a point commonly overlooked by those researching RNA 

expression is that proteins are effectors, and RNA is a blueprint. When examining RNA 

expression profiles, insight is gained into the regulation of expression and stability of 

the RNA species under examination, and these data must be extrapolated, usually by the 

assumption that expression of RNA relates to expression of protein. This extrapolation 

must be made with caution. However, the existence of the blueprint does not prove 

the material for which it codes has been produced and, conversely, failure to detect 

the template does not mean the protein is not present. It is therefore essential to link 

RNA analyses with analyses of protein expression and function; this requirement is 

frequently overlooked in transcriptome analyses. 

Second, in common with all analytical techniques, it is imperative that the composition 

of the tissue under examination be understood before correct interpretation of 

results can be performed. Although many transcriptome analyses are performed in 

monoclonal cell systems, frequently the analysis uses tissue, malignant or otherwise, 

as a starting point. Where mRNA is extracted from entire tissues, there exists a strong 

possibility of incorrectly assigning expression to the wrong cellular component. The 

presence of blood vessels, inflammatory cells, stromal components, and a mixture of 

diseased and normal tissue cells can complicate analyses. It is imperative, at some 

stage of the investigation, to determine the tissue source of the mRNA detected to avoid 

ascribing an incorrect origin to a protein or mRNA species. 

Each approach described within this section presents specific problems that must be 

sufficiently addressed to allow accurate and reliable data to be gathered if the effort 

expended is to be worthwhile. However, almost all techniques aimed at global analysis 

of RNA transcripts rely upon reverse transcription of mRNA, and most incorporate 

polymerase chain reaction (PCR). Reverse transcription (RT) comprises the transcription 

of the mRNA of choice into DNA (more accurately termed copy DNA or cDNA). 

This stage of the reaction is performed using RNA virus enzymes whose role in vivo 

is to transcribe viral RNA genome into a template for host transcription systems. 

The earliest RT enzymes used were derived from the Molony murine leukemia virus 

(Mo-MLV reverse transcriptase) and the avian myeloblastosis virus (AMV reverse 

transcriptase). More recently, genetically modified forms of these enzymes with 

enhanced activity have become the agents of choice. The enzymes are relatively heat 

labile (particularly in comparison with Taq polymerase) and reactions are performed at 

42°C with mRNA and nucleotides. The reaction must be primed because the enzymes 

are dependent on double-stranded nucleic acid template. The primer is usually allowed 

to anneal to the RNA after a short incubation (in the absence of enzyme) at 85°C to 

denature RNA tertiary structure. Primer selection is very important. Either a primer 

specific for the target sequence may be used or, more commonly, primers targeted at 

copying the entire mRNA population can be used. The use of poly (dT) primers will 

target mRNA poly A tails and transcribe from this point. In this case between 2 to 4 kb


of cDNA can be routinely copied, which may place a constraint on PCR primer design. 

RNA can be transcribed with random hexanucleotide primers (more efficient than poly 

dT and produce cDNAs from the entire RNA pool); however, in this case, separation of 

mRNA from ribosomal and transfer RNAs is recommended as these will also be copied 

diluting the target sequences (10,11). The cDNA produced is then used for multiple 

PCRs using specific sequence primers. A further novel development has been the use 

of rTth DNA polymerase (from the bacterium Thermus thermophilus) allowing reverse 

transcription and PCR to be performed in a single reaction tube using this thermostable 

DNA polymerase with RT activity. Use of higher temperatures for the RT step with 

this system allows more efficient transcription, particularly from mRNAs with high 

guanine-cytosine content (12,13). The quality of mRNA extracted is an important 

confounder of many experimental approaches; even with conventional and proprietary 

mRNA extraction techniques, some carryover of polymerase or transcriptase inhibitors 

can be observed. In extreme cases, this may reduce the efficiency of the RT to an extent 

that causes errors in quantification, which may bias comparisons between experimental 

samples. Therefore, every effort should be made to ensure that mRNA preparations for 

quantification are as pure as possible. 

2. Systems for Transcriptome Analysis 

2.1. Differential Display 

The use of differential display technologies has rapidly expanded over the last 

decade as this technique has become established as a potent tool for the simultaneous 

analysis of multiple mRNA species (14). Differential display techniques have become 

as varied as the questions they are used to answer; however. in general they combine 

the following three separate techniques to address this single question. 

1. Production of cDNA from mRNA by RT. 

2. Design of arbitrary primers to allow parts of the cDNA (tags) to be amplified by PCR. 

3. Use of sequencing quality resolution by acrylamide electrophoresis. 

This approach builds up a fingerprint of the RNA species expressed in different 

tissue or cell samples. Comparison of these fingerprints identifies those genes that are 

upregulated or downregulated in different tissues. The technique is quite elegant in 

both its simplicity and power. However, as with many such techniques, the secret lies 

in the careful design and interpretation of the results. 

The model is best suited to the study of gene regulation in tissue culture where conditions 

can be varied under careful control to avoid artifacts. Even then extreme care 

must be taken to ensure that results are reproducible between experiments, the control 

of tissue culture conditions is in fact the most critical phase of the experiment in 

the production of accurate differential display results. Use of tissue samples makes the 

approach all the more complex. Although there is obvious value in investigations 

seeking to identify metastasis related gene expression, care must be taken to ensure 

that, for example, differences between premetastatic and postmetastatic tissues are 

related to metastasis and not a consequence of altered tumor–stroma interactions, or 

differences between primary tumors. In addition, extreme care must be taken to ensure 

samples to be compared are treated exactly the same to avoid artifacts being introduced 

during tissue storage, mRNA extraction, or subsequent amplification.


Even once novel regulatory changes are identified using differential display techniques, 

it remains common to double-check these changes using a second system, such 

as representational differential analyses (RDA), PCR. or Northerns, to confirm the 

result. This is an important confirmatory step before investing significant effort into the 

study of novel genes or gene transcripts identified by differential display (14). Even 

with these caveats, differential display has already proven itself as a highly valuable 

system for the study of gene expression changes during neoplastic progression. 

There are many similarities between differential display technologies and serial 

analysis of gene expression (SAGE). Indeed, SAGE might be seen as a logical progression 

from differential display. Both use degenerate primer sequences to produce a 

fingerprint of mRNA species for analysis. In differential display. these sequences may 

range from the highly selective (members of a particular gene family) to the more 

inclusive (polyT based) (14–21). Both methods use tagged primers, differential display 

for the purpose of detection, and SAGE for the purpose of capture and ligation. The 

fundamental difference between these approaches is that differential display continues 

to use a semiquantitative measure of expression and although more sensitive than 

microarrays in the detection of low copy number changes in expression, signal strength 

remains a determining factor of sensitivity. Again, identification of transcripts with 

altered expression relies on further analysis, either by sequencing of a representative 

clone or by blotting with a selective probe. A strength of this approach is illustrated 

by its ability to be targeted at specific genes or gene families. However, the number 

of transcripts able to be analyzed is limited by the electrophoretic separation required 

for the analysis of the results. Although this still has the capacity to recognize many 

hundreds of distinct transcripts, it is unlikely that the capacity of differential display 

can match that of either gene microarrays or SAGE. This section includes two different 

differential display protocols, one using targeted primers (AU Motifs) and the other 

being a more global protocol. Further techniques are available in an associated volume 

in this series (13). 

2.2. Microarrays 

DNA Chips or microarrays are becoming much more widely applied to the investigation 

of both model systems and whole tissues (14,22–25). However, these approaches 

are not, strictly speaking PCR related and therefore we have included an overview of 

arrays purely for completeness. DNA microarrays have the advantage of being data 

rich, that is to say it is possible to analyze many thousands of genes simultaneously. 

Using this approach it is possible to identify transcripts that are markedly upregulated 

or downregulated after experimentation or, indeed, as recently reported in the simple 

classification of cancers. This approach, in common with many conventional methods 

of gene expression analysis (northerns, RDA, etc.) relies on the measurement of 

signal intensity resulting from nucleic acid hybridization. Therefore, the efficiency 

of detection is a compound of the efficiency of labeling and hybridization of the 

individual clone. The resulting data give a semiquantitative estimate of changes in 

expression either up or down. 

The major weakness of the microarray approach is that it is firstly a semiquantitative 

approach and that it is therefore not optimal for the detection of low copy number 

gene transcripts. The major strength is the large number of genes (10 3 –10 4 ) that


can be examined simultaneously in a single experiment and the rapidity with which 

information can be gathered from multiple samples. 

2.3. SAGE 

In SAGE, short expressed sequence tags are produced from each mRNA expressed. 

Thus far, the technique is very similar to that of expressed sequence tag (EST) library 

screening. The advantage of SAGE is that the tags used are 9- to 10-bp long, and 

through a number of steps (see chapter 40 by Oien, these tags are concatenated into 

clones containing multiple (up to 40+) sequence tags before sequencing. Therefore, the 

expression profile is generated by sequencing many such clones and simple counting 

of the number of times each tag is represented (26). 

Therefore, the chief difference between DNA microarrays, differential display, and 

SAGE is that SAGE produces a digital count of the number of clones representing 

each sequence expressed. This is, however, only one of the differences between these 

approaches. Microarrays can identify large numbers (10,000 or more) of expressed 

genes, and determine, semiquantitatively, alterations in their expression. However, 

genes whose expression is modulated only marginally are unlikely to be identified by 

this approach. In SAGE, each expressed gene may be sequenced and thus single copy 

changes in expression may be detected if sufficient clones are sequenced. In SAGE, 

the sensitivity is determined not by the detection system but by the amount of effort 

given to identification of sequence tags. A further advantage of SAGE analysis over 

microarrays is that it is not necessary to have to hand a clone representing the gene(s) of 

interest; because the detection of genes is performed by sequencing, no hybridization 

matrix is required. SAGE analysis is therefore limited only by the amount of sequencing 

that can be performed in a cost-effective manner. Conventional sequencing of ESTs 

relies on the analysis of several hundred bps to identify each gene. In SAGE the 

sequence tag used to identify the expressed sequence is 10 bp. Theoretically, the 

discriminatory power of a 10-bp region of cDNA is 1 in 1,048,576 (4 10 ). By linking 

together the sequence tags from many different genes into a concatemeric clone, a 

single sequencing run of 800 bp can be used to identify 50 or more different sequences. 

Given the high throughput available in today’s 96-lane sequencing platforms, approx 

5000 gene transcripts may be analyzed from a SAGE library in a single sequencing 

run. In addition, SAGE has the advantage that digital data is more suited to statistical 

analysis. Finally, and perhaps of greatest significance as increasingly experiments 

become more time consuming and costly to perform the quantitative nature of SAGE 

library analysis potentially allows direct comparisons between laboratories and between 

libraries, subject only to the constraints of the initial experimental variables. Initial data 

comparisons support the premise that comparisons between laboratories performing 

SAGE can provide valuable and valid information. The caveat that must be applied 

is that although such comparisons are at present validated by internal controls and 

performed in expert laboratories with rigorous controls, there are also specific pitfalls in 

SAGE analysis relating to identification of clones and PCR biases in construction of tags 

(26). Although some groups are already extrapolating from this data to compare data 

from different experimental approaches (27), in the light of some concerns raised and 

the possible impact on gene expression of even small changes in pH, nutrient, etc., this 

approach is at present premature, not just for SAGE but for all expression analyses.


Notwithstanding these caveats, SAGE analysis is a highly powerful experimental 

tool on which is increasingly applied to transcriptome analysis. The power of SAGE 

analysis is the product of an extremely complex experimental protocol, one that relies 

on the construction of a representative cDNA library for each RNA sample to be 

analyzed. In addition, the number of clones that must be sequenced for even a simple 

comparison between two libraries, despite the use of short sequence tags, is high 

(between 800–4000 has been suggested). Furthermore, although there is a high 

probability that a short sequence tag of 10 bp will identify a unique sequence, it is 

undeniably more complex to identify gene transcripts from such tags. Proponents 

of SAGE point out, with some justification, that the effort may well repay the cost. 

Nonetheless, the prospect of performing even a limited analysis of clinical material 

(50–100 tumors) using this method is a daunting one and many will be tempted to take 

a simpler, albeit less quantitative approach, such as microarray or differential display 

analysis, for their first steps in transcriptome analysis. More importantly, SAGE is 

an undirected technique that produces a global transcriptome map. Both microarrays 

and differential display techniques can, however, be readily tailored to the particular 

experimental question and hypothesis under investigation. As discussed at the outset of 

this chapter, careful consideration will be required to select the method most appropriate 

to the research question, expertise, and resources available to the investigator. 

References 

1. Zhang, L., Zhou, W., Velculescu, V. E., Kern, S. E., Hruban, R. H., Hamilton, S. R., et al. 

(1997) Gene expression profiles in normal and cancer cells. Science 276, 1268–1272. 

2. Lennon, G. G. (2000) High-throughput gene expression analysis for drug discovery. Drug 

Discovery Today 5, 59–66. 

3. Loging, W., Lal, A., Siu, I.-M., Loney, T., Wikstrand, C., Marra, M., et al. (2000) Identifying 

potential tumour markers and antigens by database mining and rapid expression screening. 

Genome Res. 10, 1393–1402. 

4. Szallasi, Z. (1998) Gene expression patterns and cancer. Nat. Biotechnol. 16, 1292–1293. 

5. Larsson, M., Stahl, S., Uhlen, M., and Wennborg, A. (2000) Expression profile viewer 

(ExProView): A software tool for transcriptome analysis. Genomics 63, 341–353. 

6. Lash, A. E., Tolstoshev, C. M., Wagner, L., Schuler, G. D., Strausberg, R. L., Riggins, 

G. J., et al. (2000) SAGEmap: A public gene expression resource. Genome Res. 10, 

1051–1060. 

7. http://www.ncbi.nlm.nih.gov/geo/. 

8. www.ncbi.nlm.nih.gov/sage. 

9. http://www.ebi.ac.uk/arrayexpress/. 

10. Ji, H. J., Zhang, Q. Q., and Leung, B. S. (1990) Survey of oncogene and growth factor/ 

receptor gene expression in cancer cells by intron-differential RNA/PCR. Biochem. Biophys. 

Res. Commun. 170, 569–575 

11. Jindal, S. K., Ishii, E., Letarte, M., Vera, S., Teerds, K. J., and Dorrington, J. H. (1995) 

Regulation of transforming growth factor alpha gene expression in an ovarian surface 

epithelial cell line derived from a human carcinoma. Biol. Reprod. 52, 1027–1037. 

12. White, B. A., ed. (1984) PCR Protocols: Current Methods & Applications.Volume 15, 

Methods in Molecular Biology. Humana Press, Totowa, NJ. 

13. Liang, P. and Pardee, A. B., eds. (1998) Differential Display Methods & Protocols.Volume 

85, Methods in Molecular Biology. Humana Press, Totowa, NJ. 

14. Jurecic, R. and Belmont, J. W. (2000) Long-distance DD-PCR and cDNA microarrays. 

Curr. Opin. Microbiol. 3, 316–321.


15. Marguiles, E. and Innis, J. (2000)eSAGE: Managing and analysing data generated with 

serial analysis of gene expression (SAGE). Bioinformatics 16, 650–651. 

16. Liang, P. and Pardee, A. B. (1998) Differential display: A general protocol. Mol. Biotechnol. 

10, 261–267. 

17. Jorgensen, M., Bevort, M., Kledal, T. S., Hansen, B. V., Dalgaard, M., and Leffers, H. 

(1999) Differential display competitive polymerase chain reaction: An optimal tool for 

assaying gene expression. Electrophoresis 20, 230–240. 

18. Matz, M. V. and Lukyanov, S. A. (1998) Different strategies of differential display: Areas 

of application. Nucleic Acids Res. 26, 5537–5543. 

19. Lapointe, J. and Labrie, C. (1999) Identification and cloning of a novel androgen-responsive 

gene, uridine diphosphoglucose dehydrogenase, in human breast cancer cells. Endocrinology 

140, 4486–4493. 

20. Cirelli, C. and Tononi, G. (1999) Differences in brain gene expression between sleep 

and waking as revealed by mRNA differential display and cDNA microarray technology. 

J. Sleep Res. 8, 44–52. Supplement. 

21. Aittokallio, T., Ojala, P., Nevalainen, T. J., and Nevalainen, O (2000) Analysis of similarity 

of electrophoretic patterns in mRNA differential display. Electrophoresis 21, 2947–2956. 

22. Lockhart, D., Dong, H., Byrne, M., Follettie, M., Gallo, M., Chee, M., et al. (1996) 

Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat. 

Biotechnol. 14, 1675–1680. 

23. Schena, M., Shalon, D., Davis, R., and Brown, P. (1995) Quantitative monitoring of gene 

expression patterns with a complementary cDNA microarray. Science 270, 467– 470. 

24. Lomax, M. I., Huang, L., Cho, Y., Gong, T.-W., and Altschuler, R. A. (2000) Differential 

display and gene arrays to examine auditory plasticity. Hearing Res. 147, 293–302. 

25. Sun, Y. (2000) Identification and characterization of genes responsive to apoptosis: 

Application of DNA chip technology and mRNA differential display. Histol. Histopathol. 

15, 1271–1284. 

26. Bartlett, J. M. S. (2001) Technology evaluation: SAGE, Genzyme molecular oncology. 

Curr. Opin. Mol. Ther. 3, 85–96. 

27. Kal, A. J., Van Zonneveld, A. J., Benes, V., Van den Berg, M., Koerkamp, M. G., Albermann, 

K., et al. (1999) Dynamics of gene expression revealed by comparison of serial analysis 

of gene expression transcript profiles from yeast grown on two different carbon sources. 

Mol. Biol. Cell 10, 1859–1872.

224 Bartlett

AU-Differential Display 225 

36 

AU-Differential Display, Reproducibility 

of a Differential mRNA Display Targeted to AU Motifs 

Orlando Dominguez, Lidia Sabater, Yaqoub Ashhab, 

Eva Belloso, and Ricardo Pujol-Borrell 


AU-rich elements (AREs) are found in 3′ untranslated regions (3′ UTR) of many 

highly unstable mRNAs for mammalian early-response genes. The minimal AU 

sequence core within the ARE is the heptamer WAUUUAW, although from a functional 

point of view, several pentanucleotides clustered in close proximity are the key 

sequence motif that mediates mRNA degradation (1). 

Genes containing AREs are of potential biological and pharmacological interest 

because they often code for inflammatory mediators, cytokines, proto-oncoproteins, 

and transcription factors (2–5). 

A targeted differential display named AU-motif directed display (AU-DD) is 

described here. It allows the isolation of cDNA fragments from ARE-containing 

mRNAs with minimal sequence information. AU-DD combines a high specificity 

gained at the polymerase chain reaction (PCR) level with the advantages of direct 

comparison between samples at different stages of activation to detect differentially 

expressed genes (6,7). 

Previous examples of targeted differential display have used longer and wellconserved 

motifs from multigene families. These include zinc finger motifs (8,9), 

plant MADS boxes (10), and motifs specific for heat shock proteins (11). They employ 

longer conserved sequences (from 6 to 8 codons) to design primers that can predictably 

work well on PCR. 

The PCR step of AU-DD uses primers which contain two distinctive domains, a 

double AU motif at the 3′ end (AU2 in short) and a guanosine rich 5′ (Table 1). This 

primer core sequence is previously incorporated as a 5′ tag in the retrotranscription 

primer (see below). The 5′ domain configures a sticky anchor that increases Tm and 

stabilizes primer annealing whereas the 3′ confers motif specificity. Both 5′ and 3′ 

domains contribute in a cooperative way to primer annealing. When the natural primerbinding 

site was identified on cloned products, it was always found to be a true AU-rich 

site. The use of the AU2 domain-based primers does not restrict; however, the spectrum 

of amplified mRNAs to clustered AU-pentamer containing genes. In fact, cDNAs 



225

226 Dominguez et al. 

Table 1 

Primer Sequences for Both AU-DD and Control Genes 

Protocol Primer Designation Sequence 

(A) Retrotranscription (RT) and PCR Primers Used in AU-DD 

1 G7AU2dT (RT) GGGGGGGTATTTATTTA(ACGT)TTTTTTTTT 

TTTTTT(ACG) 

2 G7AU2 GGGGGGGTATTTATTTA 

G7AU2A 

GGGGGGGTATTTATTTAA 

G7AU2C 

GGGGGGGTATTTATTTAC 

G7AU2G 

GGGGGGGTATTTATTTAG 

G7AU2T 

GGGGGGGTATTTATTTAT 

3 GTGAU2dT (RT) GGTGGGTGGTATTTATTTA(ACGT)TTTTTTT 

TTTTTTTT(ACG) 

4 GTGAU2 GGTGGGTGGTATTTATTTA 

GTGAU2A 

GGTGGGTGGTATTTATTTAA 

GTGAU2C 

GGTGGGTGGTATTTATTTAC 

GTGAU2G 

GGTGGGTGGTATTTATTTAG 

GTGAU2T 

GGTGGGTGGTATTTATTTAT 

(B) Primers Used in Control PCR Experiments 

IFNα (J00207) IFNα513s GGCCTTGACCTTTGCTTTA 

IFNα915as 

CTTCATCAGGGGAGTCTCTGT 

GAPDH (M33197) GAPDH19s TCTTCTTTTGCGTCGCCAG 

GAPDH390as 

AGCCCCAGCCTTCTCCA 

(A) 1 and 3 are alternative retrotranscription (RT) primers; 2 and 4 list two series of PCR primers compatible 

with RT primers 1 and 3, respectively. (B) Specific primers for IFNA and GAPD, respectively. 

carrying single AU motifs were often amplified, and only 15% of cloned cDNAs 

contained a complete double AU element (12). 

On its part, the reverse transcriptase primer incorporates a significant feature by 

including the PCR primer as a 5′ tag. This allows the use of a single primer in the 

PCR, providing the possibility of a fine titration of the annealing temperature to 

avoid primer artifacts generated when two oligonucleotides are used in low stringency 

conditions. 

The cDNA is synthesized from total RNA trying to ensure initiation from true 

poly-A tails of mRNA, which is not always easy. With our protocol, only 8% of cloned 

products lacked the poly-A tail (12). 

For two mRNA species to be effectively sampled by DD, the following two conditions 

are critical: (1) comparable amounts of template must be used and (2) cDNA 

concentration must be above a threshold to obtain reproducible results. During all 

the initial processes, RNA concentration and integrity and the absence of contaminating 

DNA has to be monitored carefully. Even trace amounts of genomic DNA can 

significantly alter the final profile, yielding fake products and turning the technique 

unreliable. RNA should be checked for quantity and integrity both after purification 

and after DNase treatment. The use of good-quality DNase does not guarantee the 

removal of all DNA, and this process requires also monitoring. The assessment of


DNase treatment efficiency and titration and normalization of cDNA samples were 

performed by PCR as described (12). 

In general, it is always easy to get amplification products. However, this does 

not guarantee that those products are specific and reproducible. When the cDNA 

concentration is below a minimal threshold, the final products belong to nonspecific 

templates that were selected and amplified. This is why both minimal amounts of RNA 

to be retrotranscribed and cDNA normalization are fundamental. The minimal amount 

ensures that specific targets can be easily found and selected during the first cycles 

of PCR, and the normalization ensures that DD profiles between samples activated 

and resting can be compared. 

The major procedures described in the protocol refer to RNA preparation and DNase 

treatment, cDNA synthesis, AU-DD, and confirmation of differential expression. 

2. Materials 

In general, any reagent of analytical grade was considered of sufficient purity for 

general procedures, such as electrophoresis or initial stages of RNA purification. 

Otherwise, reagents added to enzymatic reactions or intended to dissolve RNA were of 

molecular biology or ultrapure grades. 

2.1. RNA Preparation 

1. Lysis solution: GCS (Guanidinium thiocyanate (GuTh), Citric acid, Sarkosyl) is a 

modification of Sacchi and Chomczynski solution D (14), that is, 4 M GuTh, 50 mM 

sodium citrate (citric acid adjusted to pH 3.8 with NaOH), and 0.5% Sarkosyl. The solution 

can be stored for up to no more than 1 mo at 4°C. 

2. Double-distilled phenol (Sigma). Phenol was saturated and equilibrated in ultrapure water 

and treated with 8-hydroxyquinoline (Sigma) (13) yielding unbuffered acidic phenol 

(pH 4 to 5). Aliquots containing a water overlay were dispensed in sterile polypropylene 

tubes and stored frozen at –20°C. After thawing, they were kept at 4°C and discarded 

after 2 wk. 

3. Complete Lysis solution (GCSMP): Mix GCS containing beta-2 mercaptoethanol up to 2% 

with 1 volume of acidic phenol to give GCSMP immediately before use. 

4. Phase lock heavy gel (PLG, Eppendorf) stored at room temperature. 

5. Glycogen as coprecipitant (Roche Molecular Biochemicals) stored at –20°C. 

6. Chloroformisoamyl alcohol: Chloroform should be mixed with isoamyl alcohol in a 

proportion of 982 v/v (CI), respectively, in a Pyrex bottle with minimal air volume 

and kept at 4°C. 

7. DNAse I RQ1 from Promega at 0.2 U/µL in a solution containing 10 mM Bis-Tris-HCl, 

pH 6.5, 1 mM EDTA, 5 mM MgCl 2 , 5 mM DTT, and 1 U/µL RNAsin. 

8. RNasin Ribonuclease Inhibitor (40 U/µL) from Promega stored at –20°C. 

9. Ethanol 96% and 75%. 

10. 3 M Potassium Acetate pH 5.0 (KAc). 

11. Isopropanol. 

12. Guanidinium thiocyanate (4 M) in water. 

2.2. cDNA Synthesis and Further Treatment 

1. Reverse transcriptase: SuperScript II RNase H- (Gibco-BRL). Store at –20°C. 

2. dNTPs (Amersham Biosciences) at 10 mM each. 

3. RNasin Ribonuclease Inhibitor 40 U/µL from Promega (Madison, WI) stored at –20°C.


4. Oligonucleotides used as reverse transcription primers (HPLC purified; Genset, Paris, 

France) are listed in Table 1. There are two variants used in independent but complementary 

experiments, G7AU2dT and GTGAU2dT. 

5. RNase H (Gibco BRL) stored at –20°C. 

6. Qiaquick PCR purification kit columns (Qiagen). 

7. EE (10 mM EPPS), 0.1 mM EDTA, pH 8.2 adjusted with 0.1 N NaOH was used throughout 

as a general elution/dilution solution. 

8. Reagents for agarose gel electrophoresis. 

9. GAPDH primers (see Table 1). 

2.3. AU-DD 

1. α- 32 P-dATP at 3000 Ci/mmol/DuPont NEN. 

2. Platinum Taq DNA polymerase (Gibco-BRL). 

3. PCR buffer 1×: 10 mM Tris-HCl, pH 8.8, 1.5 mM MgCl 2 , 50 mM KCl, 0.1% Triton 

X-100. 

4. dNTPs at 2 mM. 

5. AU-DD primers are listed in Table 1. 

6. For confirmation of differential expression by standard PCR, specific primers were 

derived from sequences of cloned AU-DD products with the program Oligo v5.0 (National 

Biosciences Inc.) to have a Tm of 63 to 65°. 

2.4. Gel Electrophoresis 

1. S2 GibcoBRL electrophoresis apparatus for 0.8-mm thick gels. 

2. 40% (382) Polyacrylamide-bispolyacrylamide (Serva, Germany). 

3. TEMED (N,N,N′,N′-tetramethylethylethlenediamine). 

4. 10% Ammonium persulfate. 

5. Whatman 3 MM paper (gel blotting paper). 

6. TBE buffer (89 mM Tris Base, 89 mM boric acid, 1 mM EDTA). 

7. 20% methanol-10% acetic acid. 

3. Method 

A schematic representation of AU-DD method is shown in Fig. 1. 

3.1. RNA preparation (see Note 1) 

1a. Solid tissue is pulverized in liquid nitrogen with mortar and pestle (see Note 2). 

1b. Cultured cells are pelleted at 800g for 5 min at 4°C, and put on ice as dry pellets. 

1c. For culture flasks with adherent cells, decant, rinse with ice-cold phosphate-buffered saline 

and decant by aspiration. 

2. Add GCSMP in a proportion of 2 mL per 50 mg of tissue or 10 7 cells. 

3. Homogenize lysates at 25,000 rpm for 30 s with a mechanical homogenizer (Ultraturrax 

T25, Ika) to ensure both lysis and a complete DNA shearing. Stand for 2 min at room 

temperature (see Note 3). 

4. Add 0.4 volumes of CI (chloroformisoamyl alcohol) with respect to the complete lysis 

solution—including phenol volume—and shake energetically for 10 s. 

5. Pour on a prepacked PLG tube. Empty prepacked PLG tubes are 14-mL PPN round-bottom 

centrifuge tubes containing 1.5 mL of PLG-heavy and centrifuged 2 min at 1500g; it 

should then be left for 10 min on ice. 

6. Spin 10 min at 2000g on bench-top centrifuge with swinging bucket rotor. Save upper 

aqueous phase to high speed tubes and discard PLG interphase and bottom phase.


Fig. 1. Schematic representation of AU-DD. (1) Retrotranscription. Dotted line represents 

mRNA template. The RNA molecule at the top contains an AU-rich sequence (AU) and a poly-A 

tail. G-AU2TTTTTV represents a generic RT primer, with a 5′ anchor of rich on Guanosines, 

an AU2 sequence and an oligo(dT). (2) First round of PCR with a single primer GNAU2. (3) 

Final products of AU-DD amplification. 

7. Precipitate by mixing with 1 volume of isopropanol. Incubate 1 h at –20°C and centrifuge 

30 min at 10,000g. Wash with 75% ethanol. 

8. Dissolve pellets in 4 M guanidinium thiocyanate. Use at least 0.2 volumes of the lysis 

solution used initially. Heat if necessary (pulses of 5 min at 60°C) until there are 

not pellet particles left in solution. Be careful because the pellet particles become 

transparent and it is difficult to see them. Coprecipitant may be incorporated here adding 

1 µL of glycogen (20 mg/mL) and mix. 

9. Repeat the precipitation step with isopropanol (9). 

10. Wash with 75% ethanol. Dissolve in ultrapure water. The volume of water depends on the 

RNA concentration desired. Typically, 50 µL is appropriate to run out all the following 

experiments. 

11. Total RNA concentration is measured by spectrophotometry and gel electrophoresis. Not 

less than 3 µg (see Note 4) or up to 50% of RNA prep is DNase I treated (next step) in a 

separate tube, storing the other half as backup or for other purposes at –80°C after mixing 

with 3 volumes of 95% ethanol (see Note 5). 

12. RNA integrity and concentration is assessed by titration using Escherichia coli rRNAs 

(Sigma) as standard in 1% TBE agarose gel electrophoresis and ethidium bromide staining 

(13). Different concentrations of commercial E. coli rRNAs (800, 400, 200 ng) are 

compared in intensity with different dilutions of the RNA sample. 

13. Typically, 5 to 10 µg of total RNA (see Note 6) is incubated at 0.25 µg/µL with DNAse I 

for 30 min at 37°C. One microliter is then taken to check the absence of DNA (see 

Note 7). 

14. RNA is precipitated by adding 0.1 volumes of 3 M KAc, pH 5.0; 1 µL of glycogen; and 

3 volumes of 95% ethanol (see Note 8). After standing for 5 min at room temperature, 

the pellet is recovered by 10 min of centrifugation in a microcentrifuge at 10,000g and 

washed in 75% ethanol (see Note 9).


Fig. 2. cDNA normalization for their concentration in GAPDH gene. Lanes 1, 3, 5, and 

7 cDNA diluted 15 are different samples and. Lanes 2, 4, 6, and 8 are the respective cDNA 

diluted 150. Lane 9 is a PCR-negative control. 

3.2. cDNA Synthesis and Further Treatment 

1. A single reverse transcription with any of the two RT primers shown in Table 1 (G7AU2dT 

and GTGAU2dT) produced cDNA for a complete set of AU-DD reactions with matching 

PCR primers. These two different RT primers are anchored oligo(dT) 15 primers with a 5′ tag 

that accommodates the sequence of any of the AU-DD primers that will be used at the PCR 

step. The tag defines the particular RT primer and the set of AU-DD primers to be used. The 

15 T stretch was found to anneal more specifically on poly-A tails at the conditions used 

than others of 25 or longer. The tag was designed with the intention of generating the 

weaker secondary structure as possible. Standard oligo(dT) 15 was used to retrotranscribe 

control RNA samples (Jurkat and U937). First-stranded cDNA was prepared with 

Superscript II (Gibco-BRL) following manufacturer instructions with minor modifications 

indicated below. 

2. DNase treated total RNA (2–3 µg) in water and 10 pmoles of the chosen RT primer (Table 1) 

for a reaction volume of 20 µL were denatured at 72°C for 3 min on a PCR machine and 

chilled on ice for 1 min (see Note 10). 

3. The other reagents for a reaction volume of 20 µL except the enzyme are supplemented 

at room temperature (see Note 11). Annealing was allowed to proceed for 10 min at 


4. 200 U SuperScript II (Gibco-BRL) were then added and the mixture was incubated for 

1 h at 42°C. 

5. Reverse transcription was stopped by heating at 90°C for 2 min and RNAse H was used as 

recommended by its supplier (Gibco-BRL). 1.8 U RNase H, 20 min at 37°C. 

6. To validate cDNA synthesis, normalization was performed by amplifying 110 and 

1500 cDNA dilutions for GAPDH in a 25-cycle PCR adjusted to an annealing temperature 

of 60°C (primers in Table 1B). Product concentration was estimated by visual inspection 

of ethidium bromide stained gels, and cDNAs were normalized by dilution according 

to their GAPDH equivalents if required. Typically no adjustment was needed (Fig. 2, 

see Note 12). 

7. Free nucleotides and primer were washed out in Qiaquick columns (Qiagen). cDNA was 

eluted in 50 µL of EE. The eluates were used directly in AU-DD.


Fig. 3. Typical AU-DD gel. Results from adherent monocytes by using a single PCR (not 

nested) are shown. Lanes 1 and 2 show fingerprints from activated cells. Lanes 3 and 4 show 

resting cells. Net cDNA was used for lanes 1 and 3 and diluted (15) for 2 and 4. Arrows signal 

fragments from differentially expressed genes. 

3.3. AU-DD 

At this stage, there are two desalted cDNA samples ready to be compared, the 

experimental and the control. Every reaction on a template is made in duplicate to 

detect variability caused by the sample concentration only. In this way, two cDNA 

concentrations, net and 15, are used in independent PCR tubes with otherwise identical 

primer and conditions (see Note 13). Reactions are prepared for 10-µL volumes and 

contain 2 µL of cDNA, primer at 3 µM (1.5 µM in nested reactions as proposed in 

Note 13), 10 mM Tris-HCl, pH 8.8; 1.5 mM MgCl 2 , 50 mM KCl, 0.1% Triton X-100, 

dNTPs each at 0.2 mM (see Note 14), 0.25 µL of α- 32 P-dATP and 50 mU/µL Platinum 

DNA polymerase (see Note 15). Reactions are run in a PTC-100 thermocycler (MJ 

Research) for 40 cycles with the following profile: 94°C for 40 s; 42°C for 1 min, 

20 s; and 70°C for 40 s.


3.4. Gel Electrophoresis 

1. AU-DD products (2 µL) are mixed with nondenaturing DNA loading buffer and separated 

in native 0.8-mm thick, 6% TBE polyacrylamide gels at 12 V/cm. Voltage was chosen 

such that it did not generate higher temperature than 45°C during the run to avoid heat 

denaturation. Every set of four reactions coming from the same cell line, both resting and 

activated, and at each of the two cDNA concentrations are run in adjacent lanes. 

2. Gels are fixed in 20% methanol10% acetic acid for 30 min before drying under vacuum 

at 80°C about 1 h with a Whatman 3 MM as support and autoradiographed as for standard 

sequencing gels (13, see Note 16). 

3. Individual bands (Fig. 3) are selected when unique or more intense in activated cells 


4. The autorad is clamped against the dried gel by superimposing background signals with 

corresponding well line and gel edges. Edges of selected bands are punctured through the 

autorad with a hypodermic needle, leaving a mark in the dried gel. Gel slices containing 

those bands are cut out of the dried gel with a sterile scalpel knife. 

5. Dried gel pieces are rehydrated in 0.2 mL of EE for 3 h at 50°C. A further 1:20 dilution in 

EE was used as template for reamplification by 40 cycles of PCR and subsequent cloning. 

3.5. Confirmation of Differential Expression 

To confirm the differential expression, a semiquantitative RT-PCR was performed 

(Fig. 4, see Subheading 2.3., step 6). Specific PCR primers to the selected fragments 

were derived from the fragment sequences and were used in 40 cycles of PCR with 

paired resting and stimulated cDNAs. These cDNAs are normalized as described above, 

under Subheading 2.2., step 5. 

4. Designing a Primer Directed to AU Motifs 

A variety of AU-DD primers directed to single AU motifs were tested in preliminary 

experiments (not reported here). Their poor specificity and performance led us to design 

oligos with double AU pentamer motifs, which are often found in rich AU containing 

3′UTR of tightly controlled genes. 

AU-DD features reside in those specially designed primers that were used from 

reverse transcription to PCR. Results from experiments using two primers which differ 

in their 5′ anchors are presented: GTGAU2 and G7AU2 (Table 1). The 5′ anchors 

influence the annealing to natural AU containing sites and, therefore, the array of 

cDNAs that are selected and amplified during the PCR. In this way AU2 primers with 

different 5′ anchors sample distinct subsets of genes. 

The correctness of the rationale on the primer design was demonstrated in experiments 

which used an interleukin (IL)-2 gene fragment containing the AU2 sequence as 

template. In otherwise similar conditions the GTGAU2 primer allowed the detection of 

10 3 times less molecules of IL-2 cDNA than G7AU2 (not shown). A better anchoring 

of GTGAU2 on IL-2 does not necessarily imply that it also anneals better on other 

cDNAs. Therefore, both primers were used in parallel experiments, as other anchors 

can be tested, to increase the number of genes sampled. 

To keep structural simplicity, anchor domains containing only G or G and T were used, 

but variations can be expected to work as well as long as primer Tm is maintained. 

In an attempt to increase the affinity of the anchor, we tested inosine containing 

primers in different sequence configurations. When used alone, these primers reduced


Fig. 4. Confirmation of the differential expression by specific RT-PCR (primers derived from 

sequences of cloned AU-DD products) in agarose gels of a few AU-DD fragments taken as 

examples. Odd lanes are from activated cells and even lanes are the counterpart resting cells. 

the system sensitivity and reproducibility on the IL-2 cDNA. However, when used to 

supplement standard primers, a small but consistent gain in the number of products 

obtained from total cDNA was noticed, even when sensitivity to the IL-2 standard was 

not improved (not shown). Profile reproducibility among replicas was excellent for the 

primers and conditions described. 

5. Notes 

1. Different RNA preparation methods were examined in function of copurifying RNase 

activities, contaminating DNA, and yield. Ultracentrifugation in Cs salts (CsCl, CsTFA) 

gave an acceptable low level of DNA, but it was discarded because of its relatively 

poor yield. Phase lock heavy gel was found to improve both the yield in RNA and the 

partitioning of the genomic DNA to the lower phenolic phase. The single step acid-phenol 

method (14) was used with minor modifications intended to ensure RNA integrity and 

an efficient removal of both RNase activities and of contaminating genomic DNA. The 

procedure is described since this latter factor is considered relevant to the main method. 

2. Fresh tissue is snap frozen in liquid nitrogen and then stored at –80°C or lower until 

needed. Ceramic mortar is precooled by pouring on it liquid nitrogen where pestle is 

submerged; it is advised to wear gloves during this procedure. Initial bubbling will cease 

when the tool is cool enough. Then, the tissue is submerged and ground till reduced to 

a powdered state. The remaining liquid nitrogen is left to evaporate until the tissue is 

just wet, like a paste. Then, it is poured to a polypropylene 50-mL conical centrifuge 

tube. As soon as the tissue starts looking dry, add the lysis solution, mix by vortexing 

and homogenize.


3. If the container is not a polypropylene (PPN) tube, transfer lysates to a PPN centrifuge tube. 

Choose the tube so that the lysate volume is not larger than one third of its capacity. 

4. Because lower RNA amounts negatively affect the reliability of DD techniques, not less 

than 3 µg are processed. 

5. The RNA concentration in the storage ethanol solution is one fourth of the original 

concentration before adding the alcohol. In absence of salts, this solution forms a relatively 

uniform suspension of RNA, which is easy to pipet. To recover an aliquot, transfer the 

volume that contains the desired amount to a fresh tube. Supplement and mix with both 

coprecipitant (glycogen) and 0.1 vol of KAc, pH 5.0. Store an additional hour at –80°C 

and gather the sediment by centrifugation at 12,000g. After a single wash in 75% ethanol, 

the pellet is ready for any downstream application. 

6. To assure a complete removal of contaminating DNA, trial tests were performed. RNA 

from human thymus, which copurifies with relatively high content of DNA, was used for 

these assays. The best conditions were found when RNA (substrate) and DNase (enzyme) 

were kept as described. 

7. The absence of residual contaminating DNA was demonstrated by the failure to amplify 

the genomic locus of interferon-α, a multicopy gene, by PCR. A program of 40 cycles with 

an annealing temperature of 60°C was performed, with primers at 1 µM and reaction in 

10 µL (primers in Table 1). The inclusion of negative controls to test for PCR contamination 

is advisable. If DNA is detected, the DNAse-treated RNA sample is discarded. 

8. After DNase treatment, ethanol precipitation is apparently enough to inactivate any 

significant DNase activity without the need of any further treatment such as phenol. 

9. The RNA pellet can be stored indefinitely in this wash solution of 75% ethanol. It is 

left there before reverse transcription until it is confirmed by PCR that no residual DNA 

contamination has survived (see Note 7). 

10. Total RNA was always used because poly A selection from low amounts (tens of micrograms) 

of RNA was found inappropriate. The overall losses were significant, and an 

unquantifiable amount made the DD unreproducible and difficult to normalize. 

11. Given the 3′ location of the AU motifs there was a special interest in retrotranscribing true 

3′ ends. The separate step of annealing at room temperature was found to reduce primer 

extensions from false poly A tails. 

12. In this setting, the 1500 dilution always gives comparable results among samples; 4 µL 

checked by electrophoresis usually contains 5 to 10 ng of GAPDH amplimer. 

13. Because it is of interest to sample as many genes as possible different conditions are used 

side by side to increase throughput. Limited sample availability can also benefit from 

these variations. Primers of the series G7AU2 (Table 1) are used on cDNAs initiated 

from G7AU2dT. Similarly, GTGAU2 primers are more efficient on cDNA primed from 

GTGAU2dT. Both types of primers give different profiles, and different designs of the 

nonspecific 5′ domain also give different patterns. Proposed variations of conditions for a 

given cDNA to yield different profiles are as follows: (1) use the five primers of any series 

in 40 cycles of a single round of PCR; (2) run first a nonradioactive PCR of 30 cycles with 

either G7AU2 or GTGAU2, then dilute products 150 and run a series of nested PCR of 

30 cycles with the remaining four inner primers (G7AU2N or GTGAU2N) in four separate 

radioactive reactions; (3) reduce the concentration of cold dNTPs; (4) change the reaction 

buffer (different profiles can be achieved just by changing the Mg concentration in 1 mM 

differences); (5) combine any of these conditions. 

14. A cold dNTP concentration of 0.2 mM on radioactive reactions gives stronger signals and 

lower background than lower concentrations.


15. To reduce artifacts, it is important to use some hot start techniques or a preblocked 

polymerase. Some brands offer this kind of product. Those products that require extra 

PCR cycles for activation have been avoided. Note that different polymerases can also 

give different band patterns and sensitivity. 

16. Although even when fixed and washed radioactive gels still tend to give background 

signals on the autorad that assists the orientation, it may be preferred to use luminescent 

labels (such as the Glogos labels from Stratagene) for this purpose. 

17. According to the scientist’s interests, genes that are downregulated in experimental samples 

might also be of major interest. They would be isolated from the control sample since its 

concentration there would be higher. 


Pepi Caro is warmly thanked for her expert technical support and patience during 

the development of this work. 

This work has been supported in part by the CDTI as Concerted Projects 95/0184 

and 97/0313. 

References 

1. Xu, N., Chen, C. Y., and Shyu, A. B. (1997) Modulation of the fate of cytoplasmic mRNA 

by AU-rich elements: key sequence features controlling mRNA deadenylation and decay. 

Mol. Cell Biol. 17, 4611– 4621. 

2. Shaw, G. and Kamen, R. (1986) A conserved AU sequence from the 3′ untranslated region 

of GM-CSF mRNA mediates selective mRNA degradation. Cell 46, 659–667. 

3. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., and Cerami, A. 

(1986) Identification of a common nucleotide sequence in the 3’-untranslated region of 

mRNA molecules specifying inflammatory mediators. Proc. Natl. Acad. Sci. USA 83, 

1670–1674. 

4. Balmer, L. A., Beveridge, D. J., Jazayeri, J. A., Thomson, A. M., Walker, C. E., and 

Leedman, P. J. (2001) Identification of a novel AU-Rich element in the 3′ untranslated 

region of epidermal growth factor receptor mRNA that is the target for regulated RNAbinding 

proteins. Mol. Cell Biol. 21, 2070–2084. 

5. King, L. M. and Francomano, C. A. (2001) Characterization of a human gene encoding 

nucleosomal binding protein nsbp1. Genomics 71, 163–173. 


means of the polymerase chain reaction. Science 257, 967–971. 

7. Welsh, J., Chada, K., Dalal, S. S., Cheng, R., Ralph, D., and McClelland, M. (1992) 

Arbitrarily primed PCR fingerprinting of RNA. Nucleic Acids Res. 20, 4965– 4970. 

8. Stone, B. and Wharton, W. (1994) Targeted RNA fingerprinting: the cloning of differentiallyexpressed 

cDNA fragments enriched for members of the zinc finger gene family. Nucleic 

Acids Res. 22, 2612–2618. 

9. Donohue, P. J., Alberts, G. F., Guo, Y., and Winkles, J. A. (1995) Identification by targeted 

differential display of an immediate early gene encoding a putative Serine/Threonine 

kinase. J. Biol. Chem. 270, 10,351–10,357. 

10. Fischer, A., Saedler, H., and Theissen, G. (1995) Restriction fragment length polymorphismcoupled 

domain directed differential display: a highly efficient technique for expression 

analysis of multigene families. Proc. Natl. Acad. Sci. USA 92, 5331–5335.


11. Joshi, C. P., Kumar, S., and Nguyen, H. T. (1996) Application of modified differential 

display technique for cloning and sequencing of the 3′ region from three putative members 

of wheat HSP70 gene family. Plant Mol. Biol. 30, 641–646. 

12. Dominguez, O., Ashhab, Y., Sabater, L., Belloso, E., Caro, P., and Pujol-Borrell, R. (1998) 

Cloning of ARE-containing genes by AU-motif-directed display. Genomics 54, 278–286. 


Manual. Cold Spring Harbor Laboratory Press, Plainview, NY. 


guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159.

PCR Fluorescence Differential Display 237 

37 

PCR Fluorescence Differential Display 

Kostya Khalturin, Sergej Kuznetsov, and Thomas C. G. Bosch 


Differential display of mRNA via polymerase chain reaction (DD-PCR) has become 

a powerful procedure for the quantitative detection of differentially expressed genes 

in distinct cell populations (1–4). 

The standard procedure includes selective reverse transcription of polyadenylated 

RNA using specific anchored oligo(dT) primers, PCR amplification of cDNA using 

the oligo(dT) primer and an arbitrary upstream primer, resolution of PCR products on 

denaturing sequencing gels, and radioactive detection methods. To avoid hazardous 

radioisotopes, several nonradioactive methods for identification of differential display 

cDNAs have been reported, including ethidium bromide visualization in agarose gels 

(5), silver staining (6,7) and chemiluminescent detection (8,9) of cDNA bands. 

Several protocols have been published reporting the use of automated DNA sequencers 

for differential display of cDNAs labeled with infrared dyes (10) or fluorescent 

tags (11–13). A major drawback for using automated sequencers for this purpose 

is the inability to recover the amplified cDNAs from the gel. As an alternative, the 

programmable GenomyxLR DNA sequencer (Genomyx, Foster City, CA), which 

allows high resolution of cDNAs and easy localization and excision of radiolabeled 

bands from the gel, is becoming widely used in differential display studies (3). 

For nonradioactive detection of differential cDNA bands on the GenomyxLR DNA 

sequencer, cDNAs can be fluorescently labeled by using tetramethylrhodamine 

(TAMRA)-anchored primers. Alternatively, cDNAs can be fluorescently labeled 

by using TAMRA-dUTP (Perkin–Elmer), which is incorporated into extending 

cDNA during the PCR (14). Fluorescently labeled PCR products are separated on a 

GenomyxLR DNA sequencer (Genomyx), detected by the GenomyxSC Fluorescent 

Imaging Scanner, and directly excised from the gel for further characterization using an 

actual and virtual grid system. The flowchart shown in Fig. 1 outlines the experimental 

procedure. 

2. Materials 

1. peqGold RNAPure kit (PEQLAB Biotechnologie GmbH, Germany) or other reagents 

for total RNA/mRNA extraction. 

2. DEPC water. 



237

238 Khalturin, Kuznetsov, and Bosch 

Fig. 1. Flowchart of the fluorescent differential display procedure. 

3. First-Strand cDNA synthesis Kit (Amersham Pharmacia Biotech Inc.). 

4. Tailing primers T 12 2NN (e.g., T 12 CA) at concentration 25 µM (see Note 2). 

5. Arbitrary 10-mer primers (e.g., OPA Kit by Operon Technologies Ltd., Amelada, CA) 

at concentrations of 5 µM. 

6. dNTPs stock solution (1 mM of each). 

7. Taq DNA Polymerase and 10, PCR buffer (Amersham Pharmacia Biotech Inc.). 

8. TAMRA-dUTP (400 µM stock solution, Perkin–Elmer). 

9. MgCl 2 (25 mM stock solution). 

10. GeneQuantII photometer (Pharmacia) or equivalent device for measuring RNA 

concentration.


11. Thermal cycler with a ramping speed not more then 2.5°C/s. (or with programmable 

ramping speed). 

12. GenomyxLR DNA sequencer and GenomyxSC Fluorescent Imaging Scanner (Genomyx, 

Foster City, CA). 

3. Methods 

3.1. RNA Isolation (see Note 1) 

1. Isolate total RNA using peqGold RNAPureKit from approx 1 × 10 6 cells according to the 

manufacturer’s protocol. The final volume of total RNA suspension should be 20 µL. 

2. Measure OD 260 of 2 µL of RNA suspension in 80 µL of DEPC water (140 dilution). The 

total yield should be approx 300 µg of total RNA. 

3.2. Reverse Transcription (see Note 2) 

1. Reverse transcribe 3 µg of total RNA using First-Strand cDNA synthesis Kit. 

2. Place 3 µg of total RNA in a microcentrifuge tube and add RNAse-free (DEPC) water, if 

necessary, to bring the suspension volume to 7.75 µL. 

3. Heat the mixture for 10 min at 70°C and then place on ice immediately. 

Components (concentration of stock solution) Amount Final concentration 

Bulk First-Strand cDNA Reaction Mix (3×) 15 µL 1× 

DTT solution (200 mM ) 11 µL 13.3 mM 

Tailing primer, e.g. 5′-T 12 CA-3′ (25 µM ) 11.25 µL 2 µM 

RNA suspension (3 µg) 17.75 µL 0.2 µg/µL 

Final volume 15 µL 

4. Mix the following components on ice according to Table 1 for one reaction. 

5. Incubate for 1 h at 37°C. 

6. Incubate the tube at 95°C for 2 min to inactivate reverse transcriptase. 

7. Dilute the reaction mix 125. This quantity of template is sufficient for approx 180 

DD-PCRs in the volume of 10 µL. 

3.3. PCR (see Note 3) 

1. Set up the PCR mix according to Table 2. 

Components of stock solution) Amount Final concentration 

cDNA (125 dilution of RT-reaction mix) 12 µL – 

10× buffer 11 µL 111× 

MgCl 2 (25 mM ) 10.625 µL 113 mM 

random 10-mer primer (5 µM ) 10.5 µL 110.5 µM 

tailing primer (25 µM ) 11 µL 112.5 µM 

dNTP (1 mM of each) 12 µL 200 µM 

TAMRA-dUTP (400 µM ) 10.1 µL 114 µM 

Taq DNA Polymerase (5 U/µL) 10.1 µL 110.5 U 

H 2 O 12.675 µL – 

Final volume 10 µL 

2. Prepare all the samples in duplicates to check the reproducibility of the DD-PCR banding 

pattern. 

3. Perform the PCR with the following settings: initial denaturing 2 min at 95°C; 40 cycles 

30 s at 94°C (denaturation), 30 s at 40°C (annealing), and 30 s at 72°C (extension). 

4. Use the thermal cycler with a ramping speed not more then 2.5°C/s (see Note 4).


3.4. Electrophoresis 

1. Before electrophoresis, add 7 µL of sample buffer (95% formamide, 0.25% dextran blue, 

10 mM EDTA) to each 10-µL sample. 

2. Denature amplified labeled fragments at 95°C for 3 min and load onto a high-resolution 

denaturing polyacrylamide gel (HR-1000 4.5% matrix, Genomyx, Foster City, CA). 

3. Perform the electrophoresis for 2.5 h in parallel using the GenomyxLR DNA sequencer 

(according to the manufacturer’s instructions). 

3.5. Detection of PCR Products, Elution, and Cloning 

1. cDNA bands are detected using the GenomyxSC Fluorescent Imaging Scanner (Genomyx). 

A typical gel with several differentially expressed transcripts of the freshwater polyp 

Hydra vulgaris is shown in Fig. 2 (filled and open arrows). Fluorescently labeled cDNA 

fragments usually range from about 100 to 2000 bp. 

2. For further characterization, DNA from differentially expressed bands is localized using 

the grid coordinate system provided with the GenomyxSC Fluorescent Imaging Scanner. 

After excision from the gel, cDNA in gel slices can easily be recovered and reamplified 

using described procedures (7,14). 

4. Notes 

In our minds, the most crucial steps for performing a successful differential display 

screening are as follows: (1) quality of the initial RNA taken for the cDNA preparation; 

(2) the quantity of cDNA used for the DD-PCR; and (3) the PCR cycling profile, which 

depends greatly on the type of thermal cycler used. 

1. In our experience DD-PCR works equally well in using either total RNA or mRNA. Kits 

for the isolation of poly(A) + mRNA, however, seem to be more reliable. The reason is that 

when total RNA is extracted, DNAse I treatment is usually needed to eliminate the DNA. 

However, this procedure sometimes can lead to considerable loss of mRNA. 

If extraction of total RNA is the method of choice, it is crucial to check the quality of the 

RNA obtained not only by the OD 260 and OD 280 measurement but also by electrophoresis 

of the RNA in an agarose gel. In the ethidium bromide-stained gel, the total RNA should 

appear as a smear of approx 500 to 2000 bp with two prominent bands of 28S rRNA and 

18S rRNA. If any RNA degradation or traces of high molecular weight DNA are observed, 

the RNA samples should not be used in DD-PCR. 

2. We prefer to synthesize cDNA using T (12) NN tailing primers (where NN stands for one of 

the 12 possible combinations of 4 nucleotides) instead of standard NotI primer. Using the 

same tailing primer both in reverse transcription and DD-PCR gives more distinct bands in 

comparison with the case when cDNA is made with NotI primer and then one of T (12) NN 

primers is used in a DD-PCR. A slight increase in the reaction temperature (40°C instead 

of the usual 37°C) during reverse transcription improves the specificity of cDNA synthesis. 

DD-PCR banding patterns obtained with the same random primer, but two different tailing 

primers (e.g., –5′-T 12 CA-3′ and 5′-T 12 AC-3′) should be considerably different. 

3. High final concentrations of dNTP (from 25 to 250 µM of each) and Mg 2+ (from 1.5 to 

4 mM) may help increasing the quantity and quality of bands. For optimal results, it is 

always necessary to try different dilutions of the cDNA sample (e.g., 125 → 150). A 

low final concentration of cDNA in DD-PCR can lead to nonreproducible banding patterns 

and even to differences within pares of tubes containing identical cDNA templates. One 

typical problem encountered when doing DD-PCR is that the tailing primer does not 

anneal during PCR, resulting in fragments flanked by random primer only. In that case,


Fig. 2. Typical picture of DD-PCR of H. vulgaris cDNA using two different random primers 

(OPA-9 and OPA-3) and 5′-T (12) CA-3′ tailing primer. Fluorescently labeled PCR products were 

visualized by GenomyxSC Fluorescent Imaging Scanner. Filled arrows, induced transcripts; 

open arrows, repressed transcripts; C, control animals; I, immuno challenged animals; *, 

unincorporated TAMRA-dUTP.


the annealing temperature should be decreased from 40°C down to the 35°C. Besides that, 

the ratio between random 10-mer primer and tailing primer should be adjusted. Using 

fluorescent TAMRA-dUTP in the reaction mix adds additional complexity to the DD-PCR 

approach because it can be destroyed by frequent freeze-thaw cycles. PCR products 

labeled with new TAMRA-dUTP are nearly 10 times brighter than those labeled using 

TAMRA-dUTP that had undergone 3 to 4 freeze-thaw cycles. Because of that, TAMRAdUTP 

should be always kept in 2- to 3-µL aliquots. Usually, it is difficult to estimate 

the optimal concentration of TAMRA-dUTP for effective labeling. Therefore, a different 

dTTP:TAMRA-dUTP ratio should be tried (for example 301, 1001, 2001). Unincorporated 

TAMRA-dUTP results in the fluorescent cloud in the gel indicated by the asterisk 

in Fig. 2. 

4. One of the major variables during the DD-PCR experiment appears to be the fact that 

thermal cyclers vary greatly in their ramping time and other technical details. In our 

laboratory, we use two types of PCR machines: Omn-E (Hybaid) and RoboCycler 

(Stratagene). The former has a Peltier-element with the ramping time of approx 2.5°C/s 

(while cooling from 94° to 70°C), the latter nearly no ramping since a robotic arm transfers 

the samples from one thermoblock to another. When examining the influence of the 

ramping time on the DD-PCR and using the same temperature and time profiles in both 

machines (as well as identical components of the PCR mix) we observed considerably more 

fragments produced using the Omn-E thermal cycler in comparison with the Robocycler. 

The difference is not caused by the destruction of TAMRA-dye because the same result is 

observed in silver stained gels (7) as well as on those viewed by the fluorescent scanner. 

It seems the rapid change of the temperature provided by the RoboCycler prevents the 

efficient synthesis of PCR products when using standard PCR protocol. An increase of the 

annealing time from 30 to 90 s may overcome that drawback. 


The work in the laboratory is supported by grants from the DFG (to T.C.G.B.) and 

by the Daimler-Benz Foundation (S.K.) 

References 

1. Liang, P., Averboukh, L., Keyomarsi, K., Sager, R., and Pardee, A. B. (1992) Differential 

display and cloning of messenger RNAs from human breast cancer versus mammary 

epithelial cells. Cancer Res. 52, 6966–6968. 



3. Martin, K. J., Kwan, C. P., O’Hare, M. J., Pardee, A. B., and Sager, R. (1998) Identification 

and verification of differential display cDNAs using gene-specific primers and hybridization 

arrays. BioTechniques 24, 1018–1026. 

4. McClelland, M., Mathieu-Daude, F., and Welsh, J. (1995) RNA fingerprinting and differential 

display using arbitrarily primed PCR (review). Trends Genet. 11, 242–246. 

5. Rompf, R. and Kahl, G. (1997) mRNA differential display in agarose gels. BioTechniques 

23, 28–32. 

6. Bosch, T. C. G. and Lohmann, J. (1996) Non-radioactive differential display of messenger 

RNA, in Fingerprinting Methods Based on Arbitrarily Primed PCR, Springer Lab Manual 

(Micheli, M.R. and Bova, R., eds.), Springer Verlag, Heidelberg. 

7. Lohmann, J., Schickle, H. P., and Bosch, T. C. G. (1995) REN, a rapid and efficient 

method for non-radioactive differential display and isolation of mRNA. BioTechniques 

18, 200–202.


8. An, G., Luo, G., Veltri, R. W., and O’Hara, S. M. (1996) Sensitive, nonradioactive differential 

display method using chemiluminescent detection. BioTechniques 20, 342–346. 

9. Ross, R., Ross, X.-I., Rueger, B., Laengin, T., and Reske-Kunz, A. B. (1999) Nonradioactive 

detection of differentially expressed genes using complex RNA or DNA hybridization 

probes. BioTechniques 26, 150–155. 

10. Motlik, J., Carnwath, J. W., Hermann, D., Terletski, V., Anger, M., and Niemann, H. 

(1998) Automated recording of RNA differential display patterns from pig granulosa cells. 


11. Bauer, D., Müller, H., Reich, J., Riedel, H., Ahrenkiel, V., Warthoe, P., et al. (1993) 

Identification of differentially expressed mRNA species by an improved display technique 

(DDRT-PCR). Nucleic Acid Res. 21, 4272–4280. 

12. Jones, S. W. (1997) Generation of multiple mRNA fingerprints using fluorescence-based 

differential display and an automated DNA sequencer. BioTechniques 22, 536–543. 

13. Luehrsen, K. R. (1997) Analysis of differential display RT-PCR products using fluorescent 

primers and Genescan software. BioTechniques 22, 168–175. 

14. Reinhardt, B., Frank, U., Gellner, K., Lohmann, J., and Bosch, T. C. G. (1999) Highresolution, 

fluorescence-based differential display on a DNA sequencer followed by band 

excision. BioTechniques 27, 268–271.

244 Khalturin, Kuznetsov, and Bosch

RNA Arbitrarily Primed PCR 245 

38 

Microarray Analysis Using RNA 

Arbitrarily Primed PCR 

Steven Ringquist, Gaelle Rondeau, Rosa-Ana Risques, 

Takuya Higashiyama, Yi-Peng Wang, Steffen Porwollik, 

David Boyle, Michael McClelland, and John Welsh 


RNA arbitrarily primed polymerase chain reaction (RAP-PCR) has been used 

extensively to identify differentially regulated genes (1–6). The RAP-PCR method 

begins with conversion of RNA into cDNA, followed by arbitrarily primed PCR. 

The technique uses arbitrarily primed PCR (7–11) to amplify cDNA stretches lying 

between sequences that, by chance, match arbitrarily chosen oligonucleotide primers 

well enough to initiate primer extension. In earlier applications of the method, the 

complex mixture of products was resolved by polyacrylamide gel electrophoresis 

(PAGE), yielding highly reproducible fingerprints characteristic of the RNA source. 

Differences between fingerprints resulting from differentially expressed genes were 

verified by Northern blot analysis or reverse transcription (RT)-PCR. 

Here, a combination of RAP-PCR and cDNA array technology is described (see 

Note 1, refs. 12–14), which provide dramatic improvement in detection sensitivity and 

ease of analysis when compared with PAGE. Typically, PAGE analysis of a RAP-PCR 

examines ~50 to 100 genes, whereas microarray analysis of RAP-PCRs examines 

~10 to 20% of the genes represented on the microarray, simultaneously. With PAGE, 

characterization of differentially regulated genes requires laborious purification of the 

band, cloning, and sequencing (15). With microarrays, the identity of the gene is known 

immediately because the arrayed sequences are known. As is generally understood with 

microarrays, the microarray-based RAP-PCR approach can quickly narrow all mRNAs 

down to a subset that exhibits regulation under the conditions examined. However, the 

RAP-PCR method selectively examines a different population of mRNAs than does 

probe from mRNA or total RNA: RAP-PCR selectively samples the complex, rare 

class of mRNA, presumably as the result of the greater likelihood of the arbitrary 

primers encountering a sufficiently good match in the complex class to enable primer 

extension. This enables the method to measure changes in RNA abundances for rare 

transcripts with greater ease than with simple oligo (dT) n priming of mRNA for probe 

synthesis. Iteration of the method using different arbitrary primers allows greater 

coverage of the mRNA population to be achieved. 



245

246 Ringquist et al. 

In this chapter, protocols are presented for the synthesis of RAP-PCR probes for 

application to microarrays. Arrays spotted on nylon membranes can also be used. 

The manufacture of microarrays, themselves, is discussed only briefly, and the 

reader is reminded that there are a number of different approaches. For example, 

diverse chemistries for adhering cDNA sequences to glass slides, PCR-amplified vs. 

synthesized spotted sequences, different fluorescent dye-labeled nucleotides, different 

robotic spotting strategies, and other variables have been explored. The reader is 

encouraged to seek current technical information in this rapidly moving field. 

2. Materials 

2.1. Special Reagents and Supplies 

1. RNeasy Mini Kit (Qiagen #74106, Valencia, CA). 

2. QIAshredder columns (Qiagen #79656, Valencia, CA). 

3. QIAquick PCR Purification Kit (Qiagen, #74106, Valencia, CA). 

4. Microcon YM-30 (Millipore #42410, Bedford MA). 

5. Human cDNA clones (I.M.A.G.E; Research Genetics, Huntsville, AL). 

6. Vector-specific primers (Genosys Biotechnologies, The Woodlands, TX): Forward: 

5′-ctgcaaggcgattaagttgggtaac-3′, Reverse:5′-gtgagcggataacaatttcacacaggaaacagc-3′ 

7. First strand cDNA primer: oligo(dT) 20 . 

8. Arbitrary primers: primer A: (5′-ACGAAGAAGAAGAG), primer B (5′-GTGACAGACA; 

Genosys Biotechnologies, The Woodlands, TX). 

9. [α- 32 P] dCTP 10 Ci/mL (ICN, Irvine, CA). 

10. Random hexamers (NNNNNN; Genosys Biotechnologies, The Woodlands, TX). 

11. Cy3-dCTP and Cy5-dCTP (Amersham, Piscataway, NJ). 

2.2. Cell Culture 

1. Fibroblast (ATCC #CRL 2091, Manassas, VA). 

2. Cell-culture dishes (150 cm; Nunc, Rochester, NY). 

3. Cell culture media (DMEM, Irvine Scientific #9031 Irvine, CA), plus 10% fetal bovine 

serum (Omega scientific #FB-01, Tarzana, CA). 

4. Penicillin (1000 U/mL). 

5. Streptomycin (1 mg/mL). 

2.3. Enzymes 

1. M-MLV reverse transcriptase (200 U/µL; Promega, Madison, WI). 

2. AmpliTaq DNA polymerase Stoffel fragment (10 U/µL; Perkin–Elmer Cetus, Norwalk, 

CT). 

3. RNase-free DNase (10 U/µL) (Roche Molecular Biochemicals, Indianapolis, IN). 

4. RNase inhibitor (40 U/µL) (Roche Molecular Biochemicals, Indianapolis, IN). 

2.4. Common Reagents, Supplies, Buffers, and Equipment 

1. DMSO. 

2. Distilled, deionized H 2 O. 

3. 1× TE (pH 8.0). 

4. Formamide dye solution. 

5. 4% polyacrylamide, 8 M urea sequencing-style gels, prepared with 1× TBE buffer. 

6. 1% agarose minigels (1× TBE). 

7. 5× DNase I digestion buffer: 100 mM Tris-HCl, 50 mM MgCl 2 , pH 8.0.


8. 5× reverse transcription mixture: 250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl 2 , 

100 mM DTT, 1.0 mM each dNTP, 2.5 µM oligo(dT) 20 , and 100 U M-MLV reverse 

transcriptase. 

9. 2× RAP-PCR mixture: 20 mM Tris-HCl, pH 8.3, 20 mM KCl, 6 mM MgCl 2 , 0.35 mM each 

dNTP, 2 µM each arbitrary primer (see text); 2 µCi [α- 32 P] dCTP, and 0.5 U/µL AmpliTaq 

DNA polymerase Stoffel fragment. 

10. 2× Klenow reaction mixture: 20 mM Tris-HCl, pH 7.5, 10 mM MgCl 2 , 15 mM DTT, 

0.050 mM dATP, 0.050 mM TTP, 0.050 mM dGTP, 0.018 mM dCTP, 40 U Klenow. 

11. 2× terminal transferase buffer: 400 mM potassium cacodylate; 50 mM Tris-HCl, pH 7.2; 

500 mg/mL bovine serum albumin, and 3 mM CoCl 2 . 

12. Blocking solution: 10 µg/µL oligo (dA) 20 , 10 µg/µL yeast tRNA, 10 µg/µL human Cot-1 

DNA. 

13. 20× SSC. 

14. Human Cot-1 DNA (Invitrogen #15279, Carlsbad, CA). 

15. Klenow (New England BioLabs #MO210S, Beverly, MA). 

16. 96-well microtiter plates. 

17. 96-well PCR amplification plates. 

18. Ultraviolet spectrophotometer. 

19. Oven for baking slides. 

20. Vacuum desiccator for slide storage. 

21. Kodak BioMax X-Ray (Kodak #8715187, Rochester, NY). 

22. Succinic anhydride (Sigma #S-7626, St. Louis, MO). 

23. 1-methyl-2-pyrrolidinone (Sigma #6762, St. Louis, MO). 

24. poly-L-lysine (Sigma #P8920, St. Louis, MO). 

2.5. Special Equipment 

1. PCR amplification machine (GeneAmp ® PCR System 9700, Perkin-Elmer Cetus, Norwalk, 

CT). 

2. High-speed robotic arrayer (OmniGrid, GeneMachine, San Carlos, CA). 

3. Ultraviolet irradiation device (Stratagene, La Jolla, CA). 

4. ScanArray 5000 (GSI Lumonics, Billerica, MA). 

5. QuantArray analysis software (GSI Lumonics, Billerica, MA). 

6. GoldSeal glass slides (Fisher Scientific, Pittsburgh, PA). 

Molecular biology grade, RNase free reagents are used. Sterile disposable polypropylene 

was used rather than glassware. 

3. Methods 

3.1. Preparation of RNA 

1. Fibroblasts were grown in culture to about 7 × 10 6 cells per plate and harvested by scraping in 

the presence of RTL buffer lysis buffer (RNeasy kit) and homogenized through Qiashredder 

columns, both according to the manufacturer’s instructions. Total RNA was isolated using 

the RNeasy total RNA purification kit and eluted into 50 µL of distilled water. 

2. To 49 µL total RNA was added 6 µL of DNase I digestion buffer, 5 µL of DNase I, and 

0.5 µL of RNase inhibitor for 30 min at 37°C. 

3. DNase-treated total RNA was purified again using the RNeasy total RNA kit according to 

manufacturer’s instructions and eluted into 50 µL of distilled water. 

4. RNA concentration was determined by spectrophotometry in TE buffer (10 mM Tris-HCl, 

pH 8.4; 0.1 mM EDTA) assuming that one OD unit was equivalent to 40 µg/mL of RNA.


5. Total RNA samples were adjusted to 400 ng/µL with distilled water, checked for the 

integrity of the rRNAs by 1% agarose gel electrophoresis, and stored at –20°C. 

3.2. cDNA Synthesis 

1. Reverse transcription was performed on total RNA using at least three twofold dilutions of 

total RNA per sample between 1000 and 125 ng per 10 µL of reaction (see Note 1). cDNA 

synthesis uses oligo(dT) 20 for first strand priming, or alternatively, an arbitrary sequence 

primer can be used under exactly the same conditions. The reaction mixture contained 

20 µL of purified, DNase I-treated RNA plus 5 µL of 5× reverse transcription mixture. 

cDNA reactions were performed at room temperature (usually 23°C) for 15 min followed 

by incubation at 37°C for 1 h. 

2. The reactions were stopped by heating for 5 min in a boiling water bath followed by 

cooling on ice. Reactions should be diluted fourfold with 75 µL of distilled water and 

stored at –20°C, or one can proceed to the next step. (see Note 2). 

3.3. RAP-PCR 

1. 2× RAP-PCR mixture was prepared using different pairs of arbitrary primers (see Note 3). 

In Fig. 1, primers A and B were used. 

2. Diluted cDNAs (10 µL) were mixed with the same volume of 2X RAP-PCR mixture. 

Thermocycling was performed using an initial 3-min incubation at 94°C followed by 35 

cycles of 94°C for 1 min, 35°C for 1 min, and 72°C for 2 min. 

3.4. Polyacrylamide Gel Electrophoresis 

1. An aliquot of the amplification products (2 µL) was mixed with 9 µL of formamide dye 

solution, denatured at 85°C for 4 min, and chilled on ice. A sample of 2 µL was loaded 

onto a 4% polyacrylamide, 8 M urea gel, prepared with 1× TBE buffer. The PCR products 

resulting from different concentrations of the same RNA template were loaded side by 

side on the gel. 

2. Electrophoresis was performed at 1700 V or at a constant power of 50 to 70 W until the 

xylene cyanol tracking dye reached the bottom of the gel (about 4 h). The gel was dried 

under vacuum and either placed on Kodak BioMax X-Ray film for 16 to 48 h or used to 

expose a phosphor screen (Molecular Dynamics, Sunnyvale, CA) and analyzed on a Storm 

820 (Molecular Dynamics, Sunnyvale, CA). The results are shown in Fig. 1. 

3.5. Fluorescent Labeling 

1. Up to 10 µg of PCR product from the RAP-PCR can be purified using a QIAquick PCR 

Purification Kit (Qiagen, Valencia, CA), which removes unincorporated bases, primers, 

and primer dimer less than 40 bp. DNA was recovered in 50 µL of 10 mM Tris-HCl 

(pH 8.3), usually yielding 2 to 3 µg of DNA per RAP-PCR amplification. Recovered PCR 

products were quantified by spectroscopy assuming 33 µg/mL/OD unit. 

2. Klenow labeling of RAP-PCR DNA was performed by random primed synthesis using up 

to 1 µg of PCR product per reaction. PCR product was mixed with 12 µg total of 6-mer or 

9-mer random sequence primer and boiled for 4 min, cooled to room temperature, and spun 

briefly in a microfuge. The volume was adjusted to 20 µL, 25 µL of 2× Klenow reaction 

mixture, and 5 µL of either 1 mM Cy3-dCTP or 1 mM Cy5-dCTP (Amersham, Piscataway, 

NJ) was added and the mixture was incubated at 37°C for 4 h. The reaction was stopped by 

incubation at 70°C for 10 min to inactivate the Klenow fragment. Alternatively, addition of 

EDTA pH 8 to a final concentration of 10 mM can also be used. Probes from oligo (dT) n can 

be prepared by standard means to examine more abundant transcripts (see Note 4).


Fig. 1. RAP-PCR fingerprints. Products from RAP-PCR were resolved by electrophoresis 

as described. DNA molecular weights were determined using 32 P-labeled DNA fragments 

from MspI-digested pBR322 plasmid DNA, lane 1. Lanes 2 through 25 contain RAP-PCR 

products prepared from human fibroblast total RNA. Fingerprints were prepared from fibroblasts 

synchronized by serum starvation for 48 h and then treated by addition of serum containing 

media for the indicated times prior to isolation of total RNA, including isolation of total RNA 

from nonserum-starved cells. Fingerprinting of each sample was performed using three different 

concentrations of total RNA in the cDNA reaction, that is, 500, 250, and 125 ng per 10 µL of 

reaction. The fourth (empty) lane in each sample is the reverse transcriptase minus control.


3. Purification of fluorescently labeled material from unincorporated dye was performed by 

centrifuging the sample in a microfuge using Microcon columns twice, using 500 µL TE 

(pH 8.0) washes each time, according to the manufacturer’s instructions. 

4. Labeling of PCR products can also be performed by Terminal Transferase-catalyzed 

addition of Cy3-dCTP or Cy5-dCTP, as well as other fluorescent-labeled or modified 

deoxynucleotide triphosphates. 1 µg of PCR product in 20 µL was combined with 

25 µL 2× terminal transferase buffer and 5 µL of 1 mM Cy5-dCTP or 1 mM Cy3-dCTP. 

The reaction was performed at 37°C for 1 h and purified using the Microcon columns 

as described previously. 

5. After purification over microcon columns, fluorescent probe was dried under vacuum and 

dissolved in 8 µL of 1× TE buffer. Preparation of probe in hybridization solution was 

performed by addition of 8 µL of probe solution to 2 µL of blocking solution, 2.1 µL of 

20× SSC, and 0.4 µL of 10% SDS. The solution was then incubated 1 min in a boiling 

water bath, and allowed to cool on the bench top for 30 min. 

3.6. Microarray Hybridization 

1. Preparation of microarrays followed the protocol of Eisen and Brown (16) and used 

polylysine-treated slides and PCR products generated from sequenced human cDNA 

libraries; please see Eisen and Brown (16) for details on preparing polylysine-coated slides. 

Inserts from the IMAGE library, supplied by Research Genetics, were PCR amplified by 

standard means using the vector-specific primers. Printing of PCR products was done 

using an Omnigrid robot to spot PCR products onto GoldSeal glass slides using a 16 pin 

print head. After printing, slides were rehydrated briefly over an 80°C waterbath and snap 

heated for about 6 s by placing the slides on an 80°C heat block. Ultraviolet treatment was 

performed using a Stratalinker 2400 (Stratagene, La Jolla, CA) at 60 mJ for 1 min. The 

slides were then baked at 80°C for 2 h and stored. 

2. Immediately before hybridization, slides were treated with succinic anhydride as described 

by Eisen and Brown (16). The succinic anhydride blocking solution must be prepared 

fresh by placing 6 g of succinic anhydride into a dry beaker followed by addition of 

335 mL of 1-methyl-2-pyrrolidinone. After the succinic anhydride was dissolved 15 mL 

of 1 M sodium borate, pH 8.0 was added. The solution was stirred for 5 s to mix the 

solutions. The mixture was then poured into a clean glass chamber and the slides placed 

quickly inside and incubated for 15 min. 

3. Immediately after succinic anhydride blocking, slides were placed in a chamber with 

boiling water (the volume should be at least twice that of the blocking solution). The slides 

were plunged up and down and shaken for 2 min, and then the slides were immediately 

transferred to a chamber containing 95% ethanol, agitated and then dried for 37°C for 

15 min. 

4. Hybridization was performed by placing one glass chamber with distilled water in a 65°C 

oven for at least 30 min before doing the hybridization. One hybridization chamber was 

cleaned with pressurized air, and 2 drops (10 µL) of 3XSSC (450 mM sodium chloride, 

45 mM sodium citrate, pH 7.0) were placed in the wells. The slides were then cleaned with 

pressurized air and placed in the hybridization chamber. The probe was then pipetted onto 

the slide, usually in 40 µL, taking care to avoid bubbles. The coverslip was then cleaned 

with pressurized air and placed over the probe. This volume of probe usually spreads easily 

along the surface; if not, the overslip can be pressed to help the spreading. The chamber 

was then sealed and submerged in a 65°C water bath for 4 to 16 h. 

5. The hybridization was stopped by washing in 2× SSC, 0.1% SDS, followed by washing 

in 1× SSC. Samples were incubated for 2 min with 0.2× SSC. The washing steps were 

performed at room temperature. Drying should be avoided in all the washing steps. Prepare


Fig. 2. Scatter plot of fluorescent intensity of RAP-PCR products analyzed by microarray 

hybridization. Samples were RAP-PCR products (1 µg) from duplicate fingerprint reactions labeled 

using Cy3-dCTP (green fluorescence) or Cy5-dCTP (red fluorescence), random primer and 

Klenow as described. The microarray contained 6400 double spotted cDNAs of known identity. 

400 mL of each solution and place them in three different glass chambers. To minimize 

the transfer of solutions, a different container should be used each time and only the slides 

should be transferred. The solution should then be spun down 5 min to dry the slides. 

3.7. Analysis of Microarray Data 

Analysis of the microarray hybridization was performed using a ScanArray 5000 

or equivalent instrument to monitor fluorescent signal. Data was gathered first from 

the Cy5 dye followed by scanning of the Cy3 fluorescent signal. Typical instrument 

settings were laser power at 50 and photomultiplier tube at 100. Microarrays were 

scanned using 10-µm resolution. Quantification of microarray data was performed 

using QuantArray software or an equivalent software package. The results are shown 

in a scatter plot in Fig. 2. More than 95% of the signals that are significant relative to 

negative controls from salmonella are within twofold. 

4. Notes 

1. Knowing the total RNA concentration is critical for RAP-PCR. cDNA is synthesized 

at several concentrations ranging between 1000 ng and 125 ng of total RNA per 10-µL 

reaction. At lower concentrations of input total RNA there sometimes arise spurious PCR 

products, which overwhelm the amplification step. Also, DNA contaminants are monitored 

by the inclusion of a reverse transcriptase-free control in initial RAP-PCR experiments. 

This reaction is set up exactly as a RAP-PCR, but reverse transcriptase is omitted and 

replaced with water. The result should be a gel lane with no bands.


2. The present method is based closely on the protocol described by Trenkle et al. (12,14), 

in which RAP-PCR was used to generate probes for differential screening of cDNA 

arrays on nylon membranes. Each array contained 18,432 cDNA clones from the IMAGE 

consortium and hybridization detected approx 1000 cDNA clones using each RAP-PCR 

probe. Different RAP-PCR fingerprints gave hybridization patterns having very little 

overlap (less than 3%) with each other or with hybridization patterns from total cDNA 

probes. Thus, repeated application of RAP-PCR probes allows a greater fraction of the 

message population to be screened on this type of array than can be achieved with a 

radiolabeled total cDNA probe. 

3. In general, there are no constraints on the primers except that they contain at least a few 

C or G residues, that the 3′-ends are not complementary with themselves or the other 

primer in the reaction, to avoid primer dimer, and that primer sets are chosen that are 

different in sequence so that the same parts of mRNA are not amplified in different 

fingerprints. PCR with a combination of arbitrary and oligo(dT) primers, as has been used 

in differential display (17–20), can also be used to generate an effective probe for cDNA 

arrays. The use of different oligo(dT) anchor primers with the same arbitrary primer results 

in considerable overlap among the genes sampled by each probe. This can be avoided by 

using different arbitrary primers with each oligo(dT) anchor primer (13). 

4. Total RNA as well as poly(A) purified mRNA can also be labeled during reverse transcription 

for microrray analysis. Methods for preparing fluorescent cDNA from RNA have been 

presented by Eisen and Brown (16). 

References 

1. Welsh, J., Chada, K., Dalal, S. S., Cheng, R., Ralph, D., and McClelland, M. (1992) 

Arbitrarily primed PCR fingerprinting of RNA. Nucleic Acids Res. 20, 4965– 4970. 

2. Vogt, T. M., Welsh, J., Stolz, W., Kullmann, F., Jung, B., Landthaler, M., et al. (1997) 

RNA fingerprinting displays UVB-specific disruption of transcriptional control in human 

melanocytes. Cancer Res. 57, 3554–3561. 

3. Vogt, T., Stolz, W., Welsh, J., Jung, B., Kerbel, R. S., Kobayashi, H., et al. Overexpression of 

Lerk-5/Eplg5 messenger RNA: A novel marker for increased tumorigenicity and metastatic 

potential in human malignant melanomas. Clin. Cancer Res. 4, 791–797. 

4. Ralph, D., McClelland, M., and Welsh, J. (1993) RNA fingerprinting using arbitrarily primed 

PCR identifies differentially regulated RNAs in mink lung (Mv1Lu) cells growth arrested 

by transforming growth factor beta 1. Proc. Natl. Acad. Sci. USA 90, 10,710–10,714. 

5. McClelland, M. and Welsh, J. (1994) RNA fingerprinting by arbitrarily primed PCR. PCR 

Methods Appl. 4, S66–S81. 

6. McClelland, M., Mathieu-Daude, F., and Welsh, J. (1995) RNA fingerprinting and differential 

display using arbitrarily primed PCR. Trends Genet. 11, 242–246. 

7. Welsh, J. and McClelland, M. (1991) Genomic fingerprinting using arbitrarily primed PCR 

and a matrix of pairwise combinations of primers. Nucleic Acids Res. 19, 5275–5279. 

8. Welsh, J., Petersen, C., and McClelland, M. (1991) Polymorphisms generated by arbitrarily 

primed PCR in the mouse: application to strain identification and genetic mapping. Nucleic 

Acids Res. 19, 303–306. 

9. Welsh, J. and McClelland, M. (1990) Fingerprinting genomes using PCR with arbitrary 

primers. Nucleic Acids Res. 18, 7213–7218. 

10. McClelland, M. and Welsh, J. (1994) DNA fingerprinting by arbitrarily primed PCR. PCR 

Methods Appl. 4, S59–S65. 

11. Williams, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and Tingey, S. V. (1990) 

DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic 

Acids Res. 18, 6531–6535.


12. Trenkle, T., Welsh, J., Jung, B., Mathieu-Daude, F., and McClelland, M. (1998) Nonstoichiometric 

reduced complexity probes for cDNA arrays. Nucleic Acids Res. 26, 

3883–3891. 

13. Trenkle, T., Welsh, J., and McClelland, M. (1999) Differential display probes for cDNA 

arrays. BioTechniques. 27, 554–560,562,564. 

14. Trenkle, T., Mathieu-Daude, F., Welsh, J., and McClelland, M. (1999) Reduced complexity 

probes for DNA arrays. Methods Enzymol. 303, 380–392. 

15. Mathieu-Daude, F., Cheng, R., Welsh, J., and McClelland, M. (1996) Screening of 

differentially amplified cDNA products from RNA arbitrarily primed PCR fingerprints 

using single strand conformation polymorphism (SSCP) gels. Nucleic Acids Res. 24, 

1504–1507. 

16. Eisen, M. B. and Brown, P. O. (1999) DNA arrays for analysis of gene expression. Methods 

Enzymol. 303, 179–205. 



18. Liang, P., Zhu, W., Zhang, X., Guo, Z., O’Connell, R. P., Averboukh, L., et al. (1994) 

Differential display using one-base anchored oligo-dT primers. Nucleic Acids Res. 22, 

5763–5764. 

19. Liang, P. and Pardee, A. B. (1998) Differential display. A general protocol. Mol. Biotechnol. 

10, 261–267. 

20. Martin, K. J. and Pardee, A. B. (1999) Principles of differential display. Methods Enzymol. 

303, 234–258.

254 Ringquist et al.

Arrays for Genotyping 255 

39 

Oligonucleotide Arrays for Genotyping 

Enzymatic Methods for Typing Single Nucleotide Polymorphisms 

and Short Tandem Repeats 

Stephen Case-Green, Clare Pritchard, and Edwin Southern 


Much of modern genetics is based on analysis of DNA sequence. Therefore, there 

is great pressure to scale up sequence analysis while decreasing its cost. The most 

promising platforms are based on the use of oligonucleotide arrays (DNA chips), which 

perform many analyses in parallel (1). Arrays comprise libraries of oligonucleotides 

or polynucleotides attached to solid supports at defined locations. Assays can be 

performed on the whole library simultaneously, increasing both the speed and accuracy 

of analysis of the target nucleic acid. 

In this chapter, we describe the fabrication and some uses of oligonucleotide arrays 

that are under development in our laboratory and give an idea of the flexibility of the 

array platform. Practical array-based assays will need to be individually optimized to 

the desired target nucleic acid. Although arrays can be made from large fragments of 

DNA (2), this chapter concentrates on arrays of synthetic oligonucleotides. Analytic 

methods for single nucleotide polymorphisms (SNPs) and short tandem repeat (STR) 

measurement are described. Other uses have been made of DNA arrays, such as 

expression monitoring (3) and antisense oligonucleotide optimization (4). 

Most methods for DNA sequence analysis are based on gel electrophoretic separation 

of DNA fragments. Automation and miniaturization of these techniques has been 

difficult to achieve. A major advantage of arrays is the potential for automation at all 

stages of manufacture and application. Figure 1 shows a scheme for an assay using 

an oligonucleotide array. 

1.1. Fabrication of Arrays 

Two methods of array fabrication are in general use, listed as follows: 

1. Presynthesized oligonucleotides can be applied to a support. 

2. Oligonucleotide synthesis can be performed in situ at specific sites on the support. 



255

256 Case-Green, Pritchard, and Southern 

Fig. 1. General scheme for assays using oligonucleotide arrays. 

Both methods have advantages and disadvantages, as summarized here. 

• In situ fabrication allows a truly combinatorial synthesis of oligonucleotide probes to 

be performed, whereas presynthesis involves synthesis of every probe and its individual 

application to the array. 

• The combinatorial fabrication route may be best suited to producing low numbers or single 

copies of many different arrays, whereas presynthesis allows enough pure oligonucleotide 

to be produced to make many copies of the same array with speed and reliability. 

• Presynthesized oligonucleotides can be purified before addition to the array, whereas 

in situ fabrication depends on the reliability and high yields of conventional solid phase 

synthesis to ensure that most of the array probe products are correct. 

In our laboratory, we have developed barrier-based methods for combinatorial in 

situ array synthesis using standard oligonucleotide synthesis reagents (5) confined 

within reaction cells (Fig. 2). 

These techniques allow combinatorial synthesis of multiple oligonucleotides using 

four basic steps (6). Different shapes of cells are used to create arrays with different 

organizations and uses. For example, a square-shaped cell can be used for the synthesis 

of an array containing overlapping oligonucleotide sequences that have all the possible 

complements of a target sequence up to a chosen length of oligonucleotide. 

Alternatively, using a block with channels cut into it allows serial synthesis of 

oligonucleotides of any sequence in a series of stripes (7,8). If the oligonucleotides 

on an array are arranged in parallel lines, it may be used in more than one reaction 

if the target samples are hybridized in lines perpendicular to the oligonucleotides (8) 

or the array cut into strips. 

Assays described in this chapter are performed on amino functionalized polypropylene 

support (Beckman) (7,9). This surface is suitable as a support for solid-phase 

oligonucleotide synthesis. All syntheses in this chapter use 3′-dimethoxytrityl-5′-N,N′- 

diisopropylcyanoethylphosphoramidites (reverse phosphoramidites). Deprotection


Fig. 2. The layout of reaction cells used for the synthesis of arrays. The synthesis support 

is pressed to the reaction cell by a clamp. The inlet and outlet ports are attached to a DNA 

synthesizer. DNA synthesis on the support is achieved using the synthesizer to add and remove 

reagents from the reaction cell; the reagents flood the surface of the support. After the required 

sequence has been added the clamp is released and the cell moved and reclamped to allow 

further synthesis. Apparatus described in ref. 6 can be used to aid this process. 

leaves the oligonucleotides attached to the polypropylene via the initial, ammonia 

stable, phosphoramidite linkage to the 5′ end of the oligonucleotide and the amine 

of the polypropylene support. 

1.1.1. Arrays for Biallelic (SNP) Typing 

The simplest fabrication method involves the synthesis of each allele specific 

oligonucleotide (ASO) one at a time at a separate site on the surface. A patch of the 

first oligonucleotide is synthesized on the support using a cell to direct the synthesis 

reagents. The cell is then moved to a position adjacent to the first oligonucleotide and 

the second oligonucleotide synthesized. A long narrow cell (Fig. 2, left) minimizes


reagent use and allows the array to be cut into strips in a direction perpendicular to 

the array synthesis. 

Alternatively, a sequence that flanks the variable base is synthesized; the cell is 

displaced by half a cell’s width and a base corresponding to one of the alleles is added, 

the cell is then moved to cover the other half and the other varying base added. The 

cell can then be returned to its original position and any further bases common to both 

allele specific probe oligonucleotides added. 

1.1.2. STR Array Fabrication 

The basic requirements for an array suitable for use in STR typing are shown in 

Fig. 3. All the oligonucleotides of the array include a sequence complementary to the 

region immediately adjacent to the repeats. This registration sequence forms duplex 

between the target and the array oligonucleotides and aligns the start of the repeat 

of the oligonucleotides with that in the target. The array oligonucleotides vary in the 

number of repeat units that they contain on top of the flanking registration sequence. 

Synthesis of these arrays can be carried out in a combinatorial manner. Figure 4 shows 

a scheme for the synthesis of an array for typing the FES locus (10). 

1.2. Preparation of Target DNA 

To achieve good hybridization yields and allow efficient extension of the array 

oligonucleotides, a single-stranded target is required. Depending on the type of assay 

the target may be either labeled or unlabeled. Because the DNA for analysis is usually 

genomically derived material, an amplification step is normally performed. 

For hybridization assays, the most common target species is body labeled RNA, 

prepared by carrying out a polymerase chain reaction (PCR) of the required region 

using a primer that includes an RNA polymerase promoter sequence and transcribing 

the product with the appropriate enzyme. The reaction mixture also contains labeled 

nucleotide triphosphate. 

For assays involving enzymes, a single-stranded unlabeled DNA target is required. 

A two-step procedure can be used where the sample is first amplified using the PCR 

and the unwanted strand digested away using an exonuclease (11). The primer for the 

strand to be retained is synthesized with approximately the last five internucleotide 

linkages at the 5′ end as phosphorothioate (12), which protect the strand against 

nuclease degradation. After PCR, T7 gene 6 exonuclease is added to the product to 

digest away the unwanted, (unphosphorothioated) strand. The resulting single-stranded 

DNA can often be used without further purification but, if required, standard purification 

techniques could be used, for example, Sephadex or Qiaquick columns. 

1.3. Hybridization Assays 

Target alleles are distinguished by their ability to hybridize to complementary allele 

specific oligonucleotides (ASOs) on the array (Fig. 5A) (8). Hybridization yield and 

discrimination depend on temperature, salt concentration, time, and target concentration. 

The sequence of the oligonucleotide also affects both yield and discrimination. 

Many alleles can be simultaneously examined on the same array, but this requires careful 

choice of both oligonucleotide sequence and hybridization and washing conditions 

to achieve the maximum discrimination under one set of conditions. Computer-based


Fig. 3. General scheme for the typing of STRs using oligonucleotide reporter ligation to immobilized oligonucleotides. The addition of 

nucleotide triphosphates catalyzed by polymerase can be used in a similar manner. 

259


Fig. 4. Synthesis of an array for typing F13 locus. 

methods have proved inadequate for choosing the oligonucleotide sequences because 

many factors, such as the position of mismatches and secondary structure in both 

the oligonucleotides and target, affect the duplex yield. An empirical solution to 

this problem is to test various conditions using combinatorially synthesized arrays 

containing many of the possible oligonucleotides complementary to the allele being 

investigated (13,14). 

1.4. Enzyme-Aided Assays 

1.4.1. SNPs 

Several variants of the hybridization/extension method are suitable for the analysis 

of (biallelic) SNPs (Fig. 5B,C) (15,16). In the simplest form, two oligonucleotides are 

synthesized that differ in their terminal base; the two bases complementary to the 

bases to be analyzed. Hybridization of the target sequence will occur in similar yields 

to both oligonucleotides because of the poor discrimination at terminal bases (17). 

Ligases and polymerases can distinguish the two duplexes and are able to extend 

only oligonucleotides with the matching base. Labeled nucleotide triphosphate, 

complementary to the first base after the allelic position in the target, is incorporated 

only on oligonucleotides, which form perfect duplex. The position of the label 

on the support indicates the sequence that is complementary to the target (Fig. 

5C). Alternatively, a common primer can be used and labeled nucleotide added 

complementary to either of the alleles of interest in the target. Only when the nucleotide 

added is complementary to the biallelic position will the primer be extended. (Fig. 

5B) Ligation can also be used in these assays, replacing the nucleotide triphosphates 

with labeled reporter oligonucleotides having terminal bases complementary to the 

alleles to be analyzed. 

1.4.2. STR Typing 

A method for measurement of STR length is shown in Fig. 3. As with SNP typing, 

assays using both DNA ligases and DNA polymerases are possible. In the basic ligation 

assay, the target sequence plus a reporter oligonucleotide complementary to the distal


Fig. 5. Three schemes for typing of single nucleotide polymorphisms. The target varies at 

the middle of the three bases and can be a G or A. (A) Hybridization to ASOs. (B) Polymerasecatalyzed 

extension to a common, locus-specific oligonucleotide primer using nucleotide 

triphosphates complementary to one or other of the alleles. In this case, the bases may be 

labeled with different fluorophores. (C) Polymerase catalyzed extension to ASO primers using 

a common nucleotide triphosphate. The ligation of labeled oligonucleotides catalyzed by ligase 

can also be used in a similar manner.


flanking region to the repeat is hybridized to an array of oligonucleotides that contain a 

guide registration sequence plus a varying number of repeats. The ligase can only 

join the labeled oligonucleotide to the oligonucleotides of the array where a perfect 

duplex junction is formed. This only occurs for oligonucleotides with repeat length 

equal to those of the target (18). 

The polymerase method is similar. The STRs must have a base of the repeat unit 

that differs from the first base in the flanking sequence following the repeats. Labeled 

nucleotide triphosphate complementary to the first base after the repeat and DNA 

polymerase is added. The labeled nucleotide is incorporated only where the repeat 

number on the array matches that of the target. As confirmation, the reaction can be 

performed using a labeled nucleotide triphosphate complementary to the first base of 

the repeat. Only array oligonucleotides shorter than the target repeat size are extended 

in this case. 


Three broad classes of assays useful with oligonucleotide arrays are described 

above: allele-specific hybridization; primer extension by polymerase (minisequencing); 

and ligase assay. All have been used in solution and adapted to arrays. Each assay 

incorporates an initial hybridization of target nucleic acid (usually PCR product) to 

the oligonucleotide array. 

Allele-specific hybridization and the related technique of sequencing by hybridization 

for sequencing and resequencing nucleic acids has been under development and in 

use for some time (8,14). Hybridization has several well-documented complications, the 

major one being the variability of hybridization yield between different oligonucleotide 

probes against the nucleic acid target. This variability has two causes, detailed as 

follows: 

• Sequence-dependent hybridization efficiency. Where oligonucleotides of the array are 

of the same length, then the stability of the duplex formed with the nucleic acid target 

will depend on the sequence of the oligonucleotides and the type of target (19). This 

effect of base composition in DNA/DNA duplexes is lessened by the use of salts, such as 

tetramethylammonium chloride as hybridization buffer (20). The stabilities of each set of 

duplexes could be measured by thermal denaturation in solution but this is extremely time 

consuming and therefore impractical. 

• Differences in accessibility of the target to oligonucleotide probes. Secondary and tertiary 

structure in both the target and oligonucleotides can prevent hybridization. The problem 

can be alleviated by degrading the target to short fragments. 

Selecting a set of oligonucleotide probes that give similar hybridization yields 

between loci and similar differences in hybridization yield between the allele specific 

oligonucleotides at each locus, under the same set of hybridization conditions, is 

difficult. In practice, the problem can be minimized by building redundancy into oligonucleotide 

arrays (14). Each locus and each allele is represented by oligonucleotides 

with different lengths so that at least one pair of allele-specific oligonucleotides will 

exhibit the correct hybridization characteristics. 

In enzymatic assays, the hybridization step is used to capture the target. This step 

can be done at low stringency, allowing efficient hybridization at all ASOs. Alleles are 

then discriminated by either polymerase or ligase, which add a labeled reporter group


to the array at any position where probe/target duplex contains no mismatches. The use 

of enzymes that produce a covalently bonded modification to the array also allows the 

assays to be thermally cycled. This increases the signal to noise ratio. 

Primer extension/minisequencing/genetic bit analysis has the great advantage that the 

reporter (labeled dideoxynucleotide triphosphates) is simple and readily commercially 

available. At most four different reporters are needed for each assay. This contrasts 

with ligase assays where a unique oligonucleotide reporter is required for each locus 

studied. Primer extension can also be adapted for resequencing, using a tiling path of 

complementary oligonucleotides. 

2. Materials 

2.1. Array Fabrication 

2.1.1. SNP Array Synthesis 

1. DNA synthesizer (Perkin–Elmer/ABI). 

2. Synthesis cell (Fig. 2, left). 

3. Glass or perspex sheet. 

4. Deoxynucleotide 3′-DMT, 5′-phosphoramidites (Glen Research). 

5. Reagents for oligonucleotide synthesis (Perkin–Elmer/ABI, Pharmacia, Cruachem). 

6. Ammonium hydroxide solution (30%) (BDH). 

7. Duran bottle. 

8. Aminated polypropylene support (Beckman). 

9. Scalpel. 

2.1.2. STR Array Synthesis 

1. See Subheading 2.1.1. 

2. Synthesis cell (Fig. 2, right). 

2.2. Target Preparation 

2.2.1. In Vitro Transcription of RNA 

1. PCR reagents. 

2. PCR primer for the target containing a T7 or SP6 promoter sequence. 

3. T7 or SP6 RNA polymerase (Promega). 

4. Transcription buffer 5µ: 200 mM Tris-HCl, pH 7.9, 30 mM MgCl 2 , 10 mM spermidine, 

50 mM NaCl; Promega. 

5. DTT (100 mM; Promega). 

6. RNase Inhibitor (Recombinant RNasin; Promega). 

7. [α- 32 P]UTP (3000 Ci/mmol; Amersham). 

8. NTPs: ATP, CTP, and GTP as 10 mM stock solutions, and UTP at 250 µmol (all in nuclease 

free distilled water; Pharmacia). 

2.2.2. Single-Stranded DNA Preparation 

1. PCR reagents. 

2. PCR primer for the target strand containing 6 phosphorothioate linkages at the 5′-most 

6 phosphate linkages. 

3. Thermal cycler (MJ Research). 

4. T7 gene 6 exonuclease (Amersham). 

5. PCR purification kit (optional, Qiagen).


2.3. Hybridization 

2.3.1. Hybridization Assay 

1. Buffer: 1 M NaCl, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 0.01% SDS. 

2. Petri dish. 

3. Tissues. 

4. Forceps. 

5. Strip cut from oligonucleotide array (30 × 2 mm). 

6. Target single-stranded RNA (see Subheading 3.2.1.). 

2.3.2. Hybridization of Target for Polymerase Assay 

1. Buffer: 1 M NaCl. 


3. Tissues. 

4. Forceps. 

5. Strip cut from oligonucleotide array (30 × 2 mm). 

6. Target single-stranded DNA (see Subheading 3.2.2.). 

2.3.3. Hybridization of Target and Reporter for Ligation Assays 

1. Buffer: 1 M NaCl. 


3. Tissues. 

4. Forceps. 

5. Labeled reporter oligonucleotide containing 5′ phosphate group. 

6. Target single-stranded DNA (see Subheading 3.2.2.). 

7. Strip of oligonucleotide array (30 × 2 mm). 

2.4. Enzyme-Aided Assays 

2.4.1. Ligation 

1. 5µ ligation buffer: 100 mM Tris-HCl, pH 8.3, 0.5% Triton X-100, 50 mM MgCl 2 , 250 mM 

KCl, 5 mM NAD + , 50 mM DTT, 5 mM EDTA (Advanced Biotechnologies Ltd.). 

2. Thermus thermophilus DNA ligase (Tth DNA ligase; Advanced Biotechnologies Ltd). 

3. Petri dish set up as humid chamber. 

4. Forceps. 

2.4.2. Primer Extension with Polymerase 

1. 5µ Polymerase buffer: 200 mM Tris-HCl, pH 7.5, 100 mM MgCl 2 , 250 mM NaCl 

(Amersham). 

2. Polymerase dilution buffer: 50 mM Tris-HCl, pH 7.5; 10 mM DTT (Amersham). 

3. DTT (100 mM, Promega). 

4. T7 Sequenase V2. 13 U/µL (Amersham). 

5. Dideoxynucleotidetriphosphate [α- 33 P]ddNTP (450 µCi/mL; Amersham). 

6. Humid chamber. 

7. Forceps. 

8. Buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.


3. Methods 

3.1. Array Synthesis (Notes 1–3) 

3.1.1. SNP Array Synthesis 

1. Clamp a reaction cell (Fig. 2, left, 4 × 40 mm) to a piece of aminated polypropylene using 

a G-clamp and a glass or perspex backing plate. 

2. Attach ports to the synthesizer and synthesize a patch of oligonucleotide corresponding 

to the first allele. 

3. Displace the cell by 4 mm so that the cell is alongside the previously synthesized patch. 

4. Synthesize the oligonucleotide corresponding to the other allele. 

5. Repeat as necessary for other alleles. 

6. Place the array in a Duran bottle, add 30% ammonia solution, seal the bottle securely, 

and heat at 55°C for 6 h. 

7. After allowing the bottle and contents to cool, remove the array, wash with ethanol and 

dry. Store at –20°C. 

8. The array is cut into strips (1- to 2-mm wide) in a direction perpendicular to the stripes of 

oligonucleotides using a scalpel and straight edge. 

3.1.2. STR Array Synthesis 

1. Clamp a cell (Fig. 2, right, 30 × 40 mm) to a piece of aminated polypropylene using a 

G-clamp and a glass backing-plate. 

2. Attach ports to the synthesizer and synthesize a patch of oligonucleotide corresponding to the 

complement of the flanking sequence before the repeats of the target single stranded DNA. 

3. On top of this add a sequence complementary to the smallest number of repeats that may 

be present in the target DNA. 

4. Displace the cell by 2 mm and synthesize a patch corresponding to one repeat. 

5. Repeat step 4 until the maximum required number of repeats has been reached. 

6. Place the array in a Duran bottle, add 30% ammonia solution, and heat at 55°C for 6 h. 

7. After allowing the bottle and contents to cool, remove the array from bottle, wash with 

ethanol, and dry. Store at –20°C. 

8. The array is cut into strips (1- to 2-mm wide) in a direction perpendicular to the stripes 

of oligonucleotides. 

3.2. Single-Stranded Target Production 

3.2.1. In Vitro Transcription of RNA 

1. Perform PCR under conditions that give the required product. 

2. Dilute this product to give a concentration of 0.5 to 1.0 µg/µL. 

3. In a mircofuge tube at room temperature add the following reagents in order: 5µ transcription 

buffer (4 µL); 100 mM DTT (2 µL); RNasin (20 units); 10 mM ATP, CTP, and GTP 

(1 µL each); 250 mM UTP (1 µL); Template DNA (2 µL); [α- 32 P] UTP (2 µL) T7 or SP6 

RNA polymerase (20 units); and water to give final volume of 20 µL. 

4. Mix and Incubate at 37°C for 1 h. 

5. Remove unincorporated label by Sephadex G-25 or G-50 chromatography. 

3.2.2. Single-Stranded DNA Preparation 

1. Perform PCR under conditions that give the required product. 

2. Add T7 Gene 6 exonuclease to give a concentration of 2 U per µL.


3. Incubate at 25°C for 1 h. 

4. Incubate at 80°C for 5 min. 

5. If desired, purification can be performed using a commercially available purification kit. 

3.3. Hybridization (see Note 4) 

3.3.1. Hybridization Assay (see Notes 5 and 6) 

1. Make up a solution of the target (50–100 fmol, see Subheading 3.2.1.) in 100 µL of 

buffer. 

2. Soak a tissue in 1X buffer and place around the inner perimeter of a Petri dish to create 

a 100% humidity chamber. 

3. Place the solution as a puddle in the middle of the Petri dish and place a strip of array 

(30 × 2 mm) on top. 

4. Incubate for 1hr at the required temperature. 

5. Wash the array in fresh buffer solution and blot dry. 

3.3.2. Hybridization Reaction for Polymerase Assay (see Note 7) 

This method is the same as used in Subheading 3.3.1. except that a solution of 

1 to 5 pmol of single-stranded DNA target (see Subheading 3.3.2.) in a 1 M NaCl 

solution is made in step 1. 

3.3.3. Hybridization for Ligation Assay (see Note 8) 

This method is the same as used in Subheading 3.3.1. except that a solution of 

1 to 5 pmol of single-stranded DNA target (see Subheading 3.3.2.) and 5 to 10 pmol of 

reporter oligonucleotide in a 1 M NaCl solution is made in step 1. 

3.4. Enzyme-Catalyzed Assays (see Notes 9–11) 

3.4.1. Ligase Assay 

1. Make up a solution of DNA ligase (1 U/µL) in 1µ ligase buffer (100 µL) and place as a 

puddle in a converted Petri dish. 

2. Place a strip of array (30 × 2 mm) that has undergone hybridization according to Subheading 

3.3.3. face down in the puddle, ensuring that the surface is completely covered by 

the solution. 

3. Incubate at 37°C (or 65°C for STR arrays) for 1 to 8 h. 

4. Heat in 50/50 water/formamide v/v solution at 100°C for 5 min. 

5. Blot dry and image. 

3.4.2. Polymerase Assay (see Note 12) 

1. Make up 40 µL of a solution containing sequenase (0.5 U/µL), DTT (2.5 mM), polymerase 

buffer (1µ), and the appropriate ddNTP (25 nCi/µL). 

2. Soak a tissue in water and place round the inside of a Petri dish. 

3. Add the solution as a puddle to the middle of the Petri dish. 

4. Float a strip of prehybridized array (see Subheading 3.3.2., 1 × 30m) face down on 

the solution. 

5. Incubate at 37°C for 1 h. 

6. Wash away unbound material with Tris-EDTA (TE) buffer at 65°C for 5 min. 

7. Blot dry and image.


4. Notes 

1. The synthesis cells are produced by milling or moulding blocks of PTFE. The cavity is 

generally 0.5- to 0.75-mm deep and the wall thickness 0.3 to 0.5 mm. 

2. Polymerase-catalyzed extension requires the oligonucleotides to be attached through their 

5′ ends. For ligation, the oligonucleotides on the array can be attached in either orientation, 

using either the method described in Subheadings 2.1. or 2.2. Thus, deoxynucleotide 

5′-dimethoxytrityl-3′- phosphoramidites replace the deoxynucleotide 3′-dimethoxytrityl-5′- 

phosphoramidites. A requirement for ligation with oligonucleotides is that the 5′ end must be 

phosphorylated. This can be achieved by the reaction of a chemical phosphorylating reagent 

(Phosphate-On phosphoramidite available from most DNA synthesis reagent suppliers). 

This is added as the last step in the chemical synthesis of the oligonucleotides. Phosphate 

can also be added post synthetically using polynucleotide kinase and ATP (this reaction 

works on both oligonucleotides in solution and array supported oligonucleotides). 

3. The use of a linker between the surface and the oligonucleotides improves both hybridization 

yield and access to the oligonucleotides by enzymes. Addition of phosphoramidites 

based on polyethylene glycol (21) or addition of deoxythymidine phosphoramidites (22) 

have both been used to add linkers before oligonucleotide synthesis. 

4. Performing hybridizations and reactions of the array strips in puddles allows the volume 

of liquid to be minimized. However, the chamber has to be made as humid as possible to 

prevent evaporation, especially at elevated temperatures. The methods described use Petri 

dishes with wet tissues inside, but the tissues can also be draped over the top of the dish. 

The Petri dishes can be placed in sealed plastic containers. Sealed tubes may also be used 

and although the volumes are often greater than in puddles of solution, they can be more 

easily incubated in hot blocks or in water baths. 

Both the hybridization and washing buffer and temperature can be varied. Conditions 

should be found that give high yields of duplex and good discrimination between matched 

and mismatched duplexes. 

5. For hybridizations below 37°C, care must be taken not to warm the plates by touching 

with fingers because this can cause the melting of short duplexes. For hybridizations below 

room temperature, all the apparatus that comes in contact with the array must be cooled to 

the hybridization temperature or below. 

6. When using large RNA targets, secondary and tertiary structures can become a problem 

preventing hybridization. One method to alleviate this is to randomly cleave the RNA 

in base. 

7. For assays, including reactions with enzymes, both the buffer and temperature of the 

hybridization reaction can be varied. Using a two-step hybridization followed by reaction 

procedure the hybridization buffer need not be the buffer required for the enzymatic 

reaction. Also, because many of the enzymes used do require specific temperatures, using a 

two-step hybridization/reaction the hybridization temperature can be completely different 

from the enzyme-catalyzed reaction. 

8. The reporter oligonucleotide is typically 5′ end labeled with a radio label using standard 

methods. If fluorescence labeling is used, the label is incorporated during oligonucleotide 

synthesis. 

9. In our methods, radiolabels were used. These are convenient for many applications because 

they are readily commercially available and are easily detected using a phosphorimager. 

Other label types can be used and in most cases there are similar ready-labeled reagents 

available. We have used Cy5 labels on oligonucleotides in ligation assays and nucleotide 

triphosphates in polymerase extension assays. This label can be detected using a STORM 

phosphorimager. Because of the large fluorescent background of the polypropylene support 

at short wavelengths, we have found that fluorescein is not useful with polypropylene.


10. Instead of performing the assays in two steps, a hybridization followed by a ligation 

or polymerization, an all-in-one reaction can be used. There are several advantages to 

conducting all-in-one reactions, such as the saving time and effort and the potential to 

cycle the temperature allowing the target DNA to be used as a template for more than one 

ligation or polymerization. Conducting all-in-one reactions puts additional constraints on 

the conditions because the majority of enzymes work in only a small range of temperatures 

and salt concentrations. The target single-stranded DNA generally needs to be purified. 

11. The methods described use Thermus Thermophilus DNA ligase for ligation reactions 

and Sequenase in extension reactions. Other enzyme types can also be used and have 

advantages if particular temperatures are required, particularly in all in one reactions. 

Therefore, for example, Taq and Thermosequenase have all been used successfully. 

12. The extension method described adds a dideoxynucleotidetriphosphate (ddNTP). For most 

applications, appropriate deoxynucleotidetriphosphate (dNTP) can be used. 

References 

1. Case-Green, S. C., Mir, K. U., Pritchard, C. E., and Southern, E. M. (1998) Analysing 

genetic information with DNA arrays. Curr. Opin. Chem. Biol. 2, 404– 410. 

2. Schena, M., Shalon, D., Davis, R. W., and Brown, P. O. (1995) Quantitative monitoring of 

gene expression patterns with a complementary DNA microarray. Science 270, 467– 470. 

3. Wodicka, L., Dong, H., Mittmann, M., Ho, M. H., and Lockhart, D. J. (1997) Genome-wide 

expression monitoring in Saccharomyces cerevisiae. Nat. Biotechnol. 15, 1359–1367. 

4. Milner, N. M., Mir, K. U., and Southern, E. M. (1997) Selecting effective antisense reagents 

on combinatorial oligonucleotide arrays. Nat. Biotechnol. 15, 537–541. 

5. Brown, T. and Brown, D. J. S. (1991) Modern machine-aided methods of oligodeoxyribonucleotide 

synthesis. In Oligonucleotides and Analogues: A Practical Approach (Eckstein, 

R., ed.), IRL Press, Oxford, UK, pp. 1. 

6. Southern, E. M., Case-Green, S. C., Elder, J. K., Johnson, M., Mir, K. U., Wang, L., et al. 

(1994) Arrays of complementary oligonucleotides for analysing the hybridisation behaviour 

of nucleic acids. Nucleic Acids Res. 22, 1368–1373. 

7. Matson, R. S., Rampal, J., Pentoney, S. L., Anderson, P. D., and Coassin, P. (1995) 

Biopolymer synthesis on polypropylene supports: Oligonucleotide arrays. Anal. Biochem. 

224, 110–116. 

8. Maskos, U. and Southern, E. M. (1993) A novel method for the parallel analysis of multiple 

mutations in multiple samples. Nucleic Acids Res. 21, 2269–2270. 

9. Matson, R. S., Rampal, B., and Coassin, P. J. (1994) Biopolymer synthesis on polypropylene 

supports. Anal. Biochem. 217, 306–310. 

10. Polymeropoulos, M. H., Rath, D. S., Xiao, H., and Merril, C. R. (1991) Tetranucleotide 

repeat polymorphism at the human c-fes/fps proto-oncogene (FES). Nucleic Acids Res. 

19, 4018. 

11. Nikiforov, T. T., Rendle, R. B., Goelet, P., Rogers, Y.-H., Kotewics, M. L., Anderson, 

S., et al. (1994) Genetic bit analysis: a solid phase method for typing single nucleotide 

polymorphisms. Nucleic Acids Res. 22, 4167–4175. 

12. Zon, G. and Stec, W. J. (1991) In Phosphorothioate oligonucleotides. In Oligonucleotides 

and Analogues: A Practical Approach (Eckstein, F., ed.), IRL Press, Oxford, UK, pp. 87. 

13. Maskos, U. and Southern, E. M. (1993) A novel method for the analysis of multiple 

sequence variants by hybridisation to oligonucleotides. Nucleic Acids Res. 21, 2267–2268. 

14. Kozal, M. J., Shah, N., Shen, N., Yang, R., Fucini, R., Merigan, T., et al. (1996) Extensive 

polymorphisms observed in HIV-1 clade B protease gene using high-density oligonucleotide 

arrays. Nat. Med. 2, 753–759.


15. Schumaker, J. M., Metspalu, A., and Caskey, C. T. (1996) Mutation detection by solid 

phase primer extension. Human Mutat. 7, 346–354. 

16. Pastigen, T., Kurg, A., Metspalu, A., Peltonen, L., and Syvanen, A. C. (1997) Minisequencing: 

A specific tool for DNA analysis and diagnostics on oligonucleotide arrays. Genome 

Res. 7, 606–614. 

17. Case-Green, S. C. and Southern, E. M. (1994) Studies on the base pairing properties of 

deoxyinosine by solid phase hybridisation to oligonucleotides. Nucleic Acids Res. 22, 

131–136. 

18. Pritchard, C. E. and Southern, E. M. (1996) Spatially addressable ligation assays: application 

of oligonucleotide arrays to DNA fingerprinting. In Innovation and Perspectives in 

Solid Phase Synthesis and Combinatorial Libraries (Epton, R., ed.), Mayflower Scientific, 

Birmingham, UK, pp. 499. 

19. Ratmeyer, L., Vinayak, R., Zhong, Y. Y., Zon, G., and Wilson, W. D. (1994) Sequence 

specific thermodynamic and structural properties for DNA-RNA duplexes. Biochemistry 

33, 5298–5304. 

20. Maskos, U. and Southern, E. M. (1993) A study of oligonucleotide reassociation using 

large arrays of oligonucleotides synthesised on a glass support. Nucleic Acids Res. 21, 

4663– 4669. 

21. Shchepinov, M. S., Case-Green, S. C., and Southern, E. M. (1997) Steric factors influencing 

hybridisation of nucleic acids to oligonucleotide arrays. Nucleic Acids Res. 25, 

1151–1161. 

22. Guo, Z., Guilfoyle, R. A., Thiel, A. J., Wang, R., and Smith, L. M. (1994) Direct fluorescence 

analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass 

supports. Nucleic Acids Res. 22, 5456–5465.

270 Case-Green, Pritchard, and Southern

Serial Analysis of Gene Expression 271 

40 

Serial Analysis of Gene Expression 

Karin A. Oien 


Serial analysis of gene expression (SAGE ) is a patented, large-scale mRNAprofiling 

technology that produces comprehensive, quantitative, and reproducible 

gene expression profiles (originally described in refs. 1 and 2). Unlike the alternative 

technologies of differential display and subtractive hybridization, SAGE produces a 

full catalog of all transcripts, not only differentially expressed genes, and unlike smaller 

arrays, SAGE needs no assumptions about the genes that are likely to be expressed, 

thus allowing the identification of novel genes (are among many excellent reviews, see 

refs. 3–5). SAGE is based on generating clones of concatenated (linked) short sequence 

tags derived from mRNA from the target cells or tissue (Fig. 1). 

Each tag is 9- or 10-bp long and represents one mRNA and each clone insert contains 

up to 40 tags joined serially. Therefore, sequencing of multiple concatenates describes 

the pattern and abundance of mRNA, with an improvement in efficiency of up to 

40-fold compared with conventional analysis of expressed sequence tags. The mRNA 

transcript corresponding to the short SAGE tag is identified from genetic databases 

using appropriate software. 

The SAGE method was developed in 1995 by Velculescu et al. (1) of the Kinzler and 

Vogelstein laboratory at Johns Hopkins University, from where the SAGE protocol, 

software, and updates are available to academic investigators for noncommercial use 

via http://www.sagenet.org/sage_protocol.htm. For commercial purposes, the user 

should contact Genzyme Corporation, who own and license the SAGE technology. 

This and other useful web sites are listed in Table 1. Since the first report of SAGE, 

many technical modifications have been described. Some enable the use of smaller 

amounts of starting material (3,6–10), whereas others have improved the efficiency 

of intermediary SAGE reactions (11–14). Invitrogen has also released a kit called 

I-SAGE , which provides all of the numerous reagents required in a high-quality 

form. 

The Johns Hopkins protocol is 27 pages long, and Invitrogen’s online I-SAGE 

instructions contain 73 pages. This is because SAGE involves many stages, each using 

well-established and relatively straightforward molecular biological techniques, but any 

of which can go wrong! This article thus provides concise instructions with an emphasis 



271

272 Oien 

Fig. 1. A schematic diagram of the SAGE method: the numbers refer to the corresponding 

stages in Subheading 3. 

on common problems (well discussed in ref. 15), but it is strongly recommended 

that one also consult the full protocols and references supplied in this chapter. 

The software used to analyze the tags has been regularly updated, and alternative 

programs have been developed, including eSAGE (16), USAGE (17), and ExProView 

(18). The web-based bioinformatics facilities of the National Center for Biotechnology 

Information (NCBI) are extremely useful (19). There, through SAGEmap (20), 

numerous publicly available SAGE libraries can be accessed online both for global


Table 1 

Useful Web Sites for SAGE 

URL 

Contents 

http://www.sagenet.org/sage_protocol.htm Johns Hopkins SAGE protocol and software 

for non-commercial use, plus conferences, 

publications and other information (1,2) 

http://www.genzyme.com/sage/ 

Genzyme Molecular Oncology: information 

on SAGE and its commercial use 

http://www.invitrogen.com 

Invitrogen including I-SAGE protocol 

http://www.dsv.cea.fr/thema/get/ 

SADE: a SAGE Adaptation for Downsized 

sade.html Extracts (6) 

http://www.ambion.com 

Ambion website with advice on RNA work 

http://www.ncbi.nlm.nih.gov/SAGE/ NCBI’s SAGEmap (20) 

http://www.ncbi.nlm.nih.gov/UniGene/ 

NCBI’s UniGene (“unique gene”: clusters all 

index.html transcripts of one gene under one name) (19) 

http://www.geneontology.org 

Gene Ontology databases: information on 

gene function and cellular location (25) 

comparisons and for investigation of the expression of individual transcripts, which can 

be further studied via Unigene (see Table 1, ref. 19). The statistical basis for designing 

and analyzing SAGE experiments has also been discussed in detail (21–24). Here, 

however, the focus is on the wet laboratory work. 

2. Materials 

The reagents specified have been used successfully, but many equivalents are 

available and could be used if preferred (see Note 1). This description is based on 

the Johns Hopkins protocol (version 1.0d); the most helpful modifications are also 

described. 

2.1. RNA Work (see Note 2) 

1. Aerosol-resistant pipet tips (Greiner Labortechnik Ltd, Gloucestershire, UK). 

2. DEPC-treated water (Diethylpyrocarbonate: Sigma, Dorset, UK). 

3. (Optional) RnaseZap ® (Ambion (Europe) Ltd, Cambridgeshire, UK). 

2.2. Kits for Purification of RNA and cDNA Synthesis 

1. Preparation of total RNA: TRIZOL ® Reagent (Invitrogen Life Technologies, Paisley, UK). 

2. Purification of polyA+ mRNA: Poly(A)Purist Kit (Ambion). 

3. (Alternative protocols: streptavidin-coated tubes obtained with mRNA Capture Kit or 

separately (Roche Diagnostics Ltd, East Sussex, UK), instead of steps 1 and 2 (see Note 3 

and Subheadings 2.4. and 2.6.). 

4. cDNA synthesis: SUPERSCRIPT Choice System for cDNA Synthesis (Invitrogen). 

2.3. Purification of DNA 

1. Phenolchloroform (P/C): phenolchloroformisoamyl alcohol (25241; Ambion). 

2. Glycogen, molecular biology grade (20 mg/mL) (Roche Diagnostics Ltd). 

3. Ammonium acetate (10 M).

274 Oien 

4. 100% and 70% ethanol. 

5. LoTE: 3 mM Tris-HCl (pH 7.5), 0.2 mM EDTA (pH 7.5). 

6. TE: 10 mM Tris-HCl (pH 7.5), 1 mM EDTA (pH 7.5). 

7. (Optional) QIAquick ® DNA Cleanup System: QIAquick Nucleotide Removal and PCR 

Purification Kits; and, for higher through-put, QIAquick 8 PCR Purification Kit with 

QIAvac 6S (Qiagen Ltd, West Sussex, UK). 

2.4. Oligonucleotides 

1. Biotinylated oligo dT: 5′ [biotin] T 18 (Alternative protocols, see Note 3). 

2. SAGE Linker 1A: 5′ TTT GGA TTT GCT GGT GCA GTA CAA CTA GGC TTA ATA 

GGG ACA TG 3′ 

3. SAGE Linker 1B: 5′ TCC CTA TTA AGC CTA GTT GTA CTG CAC CAG CAA ATC C 

[amino mod. C7] 3′ 

4. SAGE Linker 2A: 5′ TTT CTG CTC GAA TTC AAG CTT CTA ACG ATG TAC GGG 

GAC ATG 3′ 

5. SAGE Linker 2B: 5′ TCC CCG TAC ATC GTT AGA AGC TTG AAT TCG AGC AG 

[amino mod. C7] 3′ 

6. SAGE Primer 1: 5′ [biotin] GGA TTT GCT GGT GCA GTA CA 3′ (11) 

7. SAGE Primer 2: 5′ [biotin] CTG CTC GAA TTC AAG CTT CT 3′ (11) 

8. M13 Forward: 5′ GTA AAA CGA CGG CCA GT 3′ 

9. M13 Reverse: 5′ GGA AAC AGC TAT GAC CAT G 3′ 

The working concentration of all primers, except biotinylated oligo dT, is 350 ng/µL. 

Obtain linkers and biotinylated oligos gel-purified: recommended suppliers include 

Integrated DNA Technologies, Inc. (IA, USA) and Oswel Research Products Ltd. 

(Southampton, UK). Before use, linkers must be kinased, either biochemically during 

synthesis or later enzymatically (see Note 4), and annealed to the complementary 

linker. 

2.5. Restriction and Modifying Enzymes 

1. NlaIII (10 U/µL), supplied with NEBuffer 4 and 100× bovine serum albumin (New 

England Biolabs [NEB] Inc, MA,) stored at –70°C). 

2. BsmFI (2 U/µL) (NEB). 

3. SphI (5 U/µL) (NEB). 

4. T4 Polynucleotide Kinase 10U/µL (NEB) (or obtain linker oligonucleotides already 

kinased, see Note 4). 

5. T4 DNA Ligase (5 U/µL, or 20 U/µL if preferred; NEB). Aliquot ligase enzyme and buffer 

to prevent cross-contamination from PCR products. 

6. DNA polymerase I large fragment (Klenow); 5 U/µL (NEB). 

2.6. Magnetic Beads and Related Materials 

1. Dynabeads ® M-280 Streptavidin (-coated) (Dynal AS, Oslo, Norway). 

2. Magnetic particle concentrator (magnetic stand to immobilize beads) and sample mixer 

(Dynal AS). 

3. 2× Binding and washing (B+W) buffer: 2 M NaCl, 10 mM Tris-HCl (pH 7.5), 1 mM 

EDTA. Also prepare 1× B+W buffer solution. 

4. (Optional) Nonstick RNase-free tubes (Ambion) have been recommended for use with 

magnetic beads to minimize adhesion of beads to the tube walls. 

5. (Alternative protocols: Dynabeads ® Oligo dT 25 (Dynal AS; see Note 3 and Subheadings 

2.2. and 2.4.).


2.7. Gel Materials 

1. 40% polyacrylamide (37.51 acrylamidebis) (Bio–Rad Ltd, Hertfordshire, UK). 

2. 40% polyacrylamide (191 acrylamidebis) (Bio–Rad). 

3. DNA molecular weight markers, for example, 10- and 100-bp DNA ladders (Invitrogen). 

4. SYBR ® Green I nucleic acid gel stain (Molecular Probes Inc., OR) or a 0.5 µg/mL solution 

of Ethidium Bromide (Sigma). 

5. Gel-loading buffer containing Bromophenol Blue and Xylene Cyanol (e.g., Ambion). 

6. Apparatus for vertical polyacrylamide gel electrophoresis, for example, Atto Maxi Slab 

with 16- × 16-cm glass gel plates, 1.5-mm spacers, and 12- and 20-well combs (Genetic 

Research Instrumentation, Essex, UK). 

7. 50× Tris-Acetate buffer: 242 g of Tris base, 57.1 mL of glacial acetic acid, and 100 mL of 

0.5 M EDTA (pH 8.0) made up to 1 L with dH 2 O. 

8. 10% Ammonium persulfate. 

9. TEMED (N,N,N′,N′-Tetramethylethylenediamine; Sigma). 

10. Sterile scalpel. 

11. 21-gauge needles. 

12. Spin-X filter microcentrifuge tubes (Corning Ltd, Buckinghamshire, UK). 

13. Materials, buffers, and apparatus for agarose gel electrophoresis 

2.8. Polymerase Chain Reaction (PCR) 

1. Option 1: Johns Hopkins protocol. PLATINUM Taq DNA Polymerase (5 U/µL; Invitrogen); 

10× PCR buffer: 166 mM (NH 4 ) 2 SO 4 , 670 mM Tris-HCl (pH 8.8), 67 mM MgCl 2 , 100 mM 

β-mercaptoethanol; Dimethyl sulphoxide (Sigma). Option 2: own modification. HotStarTaq 

DNA Polymerase Kit and Taq PCR core kit (Qiagen). 

2. dNTPs (10 mM; Invitrogen; included in some kits). 

3. Thermal cycler of choice (e.g., Thermo Hybaid, Middlesex, UK). 

4. Mineral oil (Sigma). Ensure that it is free from PCR contamination. 

2.9. Cloning 

1. For cloning of concatemers: Zero Background Cloning Kit (Invitrogen). 

2. ELECTROMAX DH10B Cells (Invitrogen). 

3. S.O.C. Medium (Invitrogen). 

4. Low-salt LB medium and agar plates with Zeocin , prepared according to instructions 

in Zero Background Cloning Kit. 

5. Electroporator and electroporation cuvettes (Thermo Hybaid). 

2.10. Sequencing 

1. Sequencing as performed locally, for example, use BigDye Primer Kit and ABI automated 

sequencer (both Perkin–Elmer from Applied Biosystems, Warrington, UK). 

2.11. SAGE Bioinformatics 

Johns Hopkins SAGE program (downloaded from web site after registration), in 

combination with NCBI’s GenBank ® databases and Microsoft ® Access and Excel 

programs, or other software (see Subheading 1., last paragraph, and Table 1). 

3. Methods (see Notes 1 and 2) 

3.1. mRNA Preparation 

1. Prepare total RNA from cells or tissue by standard methods, for example, TRIZOL 

Reagent.

276 Oien 

2. Purify polyA + mRNA from total RNA using, for example, Poly(A)Purist kit. This original 

protocol requires 2.5 to 5 µg of mRNA for the next step (but see Note 3). 

3.2. cDNA Synthesis 

1. Synthesize double-stranded cDNA using SUPERSCRIPT ® Choice System. For the first strand 

synthesis, use 2.5 µg of the biotinylated oligo dT purchased separately, instead of that 

supplied with the kit. Synthesize the second strand, proceed to the next step in this SAGE 

protocol. (Do not perform EcoRI adapter addition). 

2. Phenolchloroform (P/C) extract and ethanol precipitate (see Notes 5–7). Resuspend 

in 20 µL of LoTE. 

3.3. Cleavage of Biotinylated cDNA with Anchoring Enzyme NlaIII 

to Create CATG Sticky-End 

1. To 10 µL (half) of the biotinylated cDNA, add 74 µL of LoTE, 10 µL of 10× NEBuffer 4, 

1 µL of 100× BSA, and 5 µL of NlaIII. Incubate at 37°C for 1 h. 

2. P/C extract, ethanol precipitate, and resuspend in 20 µl LoTE. 

3.4. Binding of Biotinylated cDNA to Magnetic Beads 

1. Add 100 µL of streptavidin Dynabead slurry to each of two 1.5-mL microcentrifuge tubes. 

Immobilize beads with Dynal magnet and remove supernatant. 

2. Wash beads with 200 µL of 1× B+W buffer then remove supernatant. 

3. Add 100 µL of 2× B+W buffer, 90 µL of dH 2 O, and 10 µL of cleaved biotinylated cDNA to 

each of the two tubes. Incubate with gentle mixing for 15 min at room temp. 

4. Immobilize beads with magnet and remove supernatant. Wash three times with 200 µL of 

1× B+W buffer and once with 200 µL of LoTE. Proceed immediately to next step. 

3.5. Ligating CATG Sticky-Ended Linkers to Bound cDNA 

1. Linkers must be kinased and annealed in advance (see Note 4). 

2. Use one of the two tubes containing washed magnetic beads for linker 1 and the other for 

linker 2. Immobilize beads with magnet and remove supernatant. 

3. Add 29 µL of LoTE, 5 µL of annealed linker 1 or 2, and 4 µL of 10× ligase buffer. 

Resuspend the beads with gentle mixing (flick tube with finger). 

4. Heat at 50°C for 2 min then allow to cool to room temp over 15 min. 

5. Add 2 µL of T4 DNA Ligase. Incubate at 16°C for 2 h with intermittent gentle mixing. 

6. After ligation, wash beads three times with 200 µL of 1× B+W buffer. Transfer to new tubes. 

Wash once with 200 µL of 1× B+W buffer and twice with 200 µL of 1× NEBuffer 4. 

3.6. Creation of cDNA Tags and Their Release 

from Magnetic Beads Using Tagging Enzyme BsmFI 

1. Remove buffer then add 87 µL of LoTE, 10 µL of 10× NEBuffer 4, and 1 µL of 100× BSA 

to each tube. Pre-incubate at 65°C for 2 min. 

2. Add 2 µL of BsmFI. Incubate at 65°C for 1 h with intermittent gentle mixing. 

3. Immobilize beads with magnet. This time, collect supernatant and transfer to two new 

tubes. Wash beads with 100 µL of 1× NEBuffer 4. Collect buffer and add to previous 

supernatant, discarding beads. 

4. P/C extract, ethanol precipitate, and resuspend in 10 µL of LoTE.


3.7. Blunt-Ending-Released cDNA Tags 

1. To each of the two tubes (from linkers 1 and 2) containing released cDNA tags, add 31 µL 

dH 2 O, 5 µL of 10× EcoPol buffer, 0.5 µL of 100× BSA, 2.5 µL of 10 mM dNTPs, and 

1 µL of DNA polymerase I large fragment (Klenow). 

2. Incubate at 37°C for 30 min, and then pool both tubes of blunt-ended tags. 

3. P/C extract, ethanol precipitate, and resuspend in 12 µL of LoTE. 

3.8. Ligating Blunt-Ended Tags to Form 102-bp Ditags 

1. Set up two new tubes, ideally of small size (0.2 mL). One tube is for the ditag ligation 

reaction. The other is a negative ligation control, to exclude cross-contamination at the 

next, PCR, step: set this tube up first. To each of the two tubes, add 4 µL of blunt-ended 

tags, 0.8 µL dH 2 O and 0.6 µL of 10× ligase buffer. 

2. To the negative control tube, add 0.6 µL of dH 2 O. 

3. To the ditag reaction, add 0.6 µL of T4 DNA ligase. 

4. Cover with a drop of mineral oil to avoid evaporation and incubate at 16°C overnight. 

3.9. PCR Amplification of 102-bp Ditags 

The PCR aims to produce sufficient 102-bp ditag DNA for subsequent isolation and 

concatemerization of 26 bp ditags but may itself be problematic (see Note 8). 

1. After ligation, add 14 µL of LoTE to increase volume to 20 µL and mix. Take 1 µL 

and dilute 100-fold with LoTE. Use 1 µL of the dilution in a 50- or 100-µL PCR with 

biotinylated SAGE Primers 1 and 2 (11). To avoid cross-contamination, set up the two 

negative control reactions (no template and no ligase) first. 

2. Step 2, option 1: Johns Hopkins protocol. Per 50-µL reaction, use 30.5 µL dH 2 O, 5 µL 

of 10× SAGE PCR buffer, 3 µL of DMSO, 7.5 µL of 10mM dNTPs, 1 µL of each of 

SAGE Primers 1 and 2, and 1 µL PLATINUM Taq DNA Polymerase. The cycling parameters, 

optimized for a Hybaid thermal cycler, are as follows: 94°C for 1 min; 26 to 30 cycles of 

94°C for 30 s, 55°C for 1 min and 70°C for 1 min; then 70°C for 5 min. Optimize with 

different template dilutions (1/50, 1/100, or 1/200 per reaction). Step 2, option 2: own 

modification. The HotStarTaq DNA Polymerase Kit routinely works well with 1 µL, or 

often less, of the 1/100 dilution with no need for further adjustment of template dilution. 

Per 100-µL reaction, use: 60.5 µL of dH 2 O, 10 µL of 10× Qiagen PCR buffer, 5 µL of 

25 mM MgCl 2 , 20 µL of 5× Q-Solution, 2 µL of 10 mM dNTPs, 0.5 µL of each of SAGE 

Primers 1 and 2, and 0.5 µLHotStarTaq DNA Polymerase. The cycling parameters are: 

94.5°C for 15 min; 26 to 30 cycles of 94.5°C for 30 s; 56°C for 1 min and 72°C for 1 min; 

then 72°C for 5 min. 

3. Optimize the cycle numbers between 26 and 30. More than 30 cycles usually results in 

high molecular weight smearing with less of the desired product. 

4. After PCR, load 10 µL of each reaction on a 12% polyacrylamide gel with a 20-bp ladder. 

Run at 160 V for 2.5 h until the bromophenol blue dye front has run out of the gel and 

the xylene cyanol is 1 to 2 cm from the bottom, then stain (see Note 9). The amplified 

ditags should produce a 102-bp band. Background bands are common: the brightest runs 

at 80 bp and contains amplified ligated linkers without tags. The negative controls should 

contain no product. 

5. After optimization, perform large-scale PCR by preparing then distributing a master-mix 

into three 96-well PCR plates with 50 or 100 µL in each well. 

6. After PCR, pool the reactions. P/C extract and ethanol precipitate, scaling up as needed. 

The large volumes can be dealt with using either multiple 1.5-mL microcentrifuge tubes or

278 Oien 

50-mL conical tubes. Resuspend in a total of 250 µL of LoTE. (see Note 10 for optional 

DNA quantitation at this stage.) 

3.10. Isolation of 102-bp Ditags by Gel Purification 

1. Load pooled PCR products on three 12% polyacrylamide gels. Run and stain as before. 

2. Cut out the 102-bp band of amplified ditags. 

3. Fragment gel by placing cut-out bands in 0.5 mL of microcentrifuge tubes that have previously 

been pierced through the base with a needle, and insert into a 2-mL tube. (Depending 

on bandwidth, 3–4 tubes are used per gel.) Centrifuge at full speed for 2 min. 

4. Elute DNA from gel fragments by adding 250 µL of LoTE and 50 µL of 10 M ammonium 

acetate to each 2-ml tube. Ensure that gel fragments are covered by buffer (add more if 

necessary). Vortex tubes then incubate at 65°C for 2 h. 

5. For each 0.5-mL tube, prepare two Spin-X filter microcentrifuge tubes by placing 5 µL of 

LoTE on the filter. Transfer contents of each 0.5-mL tube to two Spin-X tubes. Centrifuge 

at full speed for 5 min. (see Note 7 and ref. 12). 

6. Pool samples and ethanol precipitate. Resuspend in a total of 100 µL of LoTE. 

3.11. Isolation of 26-bp Ditags by NlaIII Digestion and Removal 

of Linkers Using Magnetic Beads and Gel Purification 

1. To the pooled PCR products, add 58 µL of LoTE, 20 µL of 10× NEBuffer 4, 2 µL of 100× 

BSA and 20 µL of NlaIII. Incubate at 37°C for 1 h. 

2. During NlaIII digestion, add 100 µL of streptavidin Dynabeads to each of two 1.5-mL 

tubes. Immobilize beads with magnet and remove supernatant. Wash beads with 200 µL of 

1× B+W buffer. Remove buffer when NlaIII digestion is complete. 

3. To each of the two tubes containing streptavidin Dynabeads, add 100 µL of 2× B+W buffer 

and 100 µL (half) of the NlaIII digestion (11). 

4. Incubate with gentle mixing for 15 min at room temp. 

5. Immobilize beads with a magnet. Collect supernatant. 

6. Wash beads once with 200 µL of 1× B+W buffer and once with 200 µL of LoTE. Collect 

supernatant in each case. 

7. Pool supernatants and keep on ice to prevent ditag denaturation (13). Discard beads. 

8. P/C extract at 4°C. Ethanol precipitate with centrifugation at 4°C (13). Resuspend in 15 µL 

of TE (not LoTE). 

9. Load on two lanes of a 12% polyacrylamide gel with a 20-bp ladder. Run at 160 V for 2 h 

until the bromophenol blue dye front is 3 cm from the bottom. Stain. (Purified ditags 

run at 22–26 bp. Released linkers run at 40 bp. Bands between 60–100 bp result from 

incomplete NlaIII digestion.) 

10. Cut out ditag band running at 22–26 bp. 

11. Elute DNA from gel fragments as before, but incubate at 37°C, not 65°C. 

12. Ethanol precipitate with centrifugation at 4°C (13). Resuspend in 6.4 µL of LoTE. 

3.12. Ligation of Sticky-Ended 26-bp Ditags to Form Concatemers 

Then Gel Purification of Concatemers 

1. To the purified ditags, add 0.8 µL of 10× ligase buffer and 0.8 µL of T4 DNA Ligase. 

Incubate at 16°C for 2 h (or longer, e.g., overnight, if desired). 

2. Add loading buffer directly to concatemer ligation. Heat at 65°C for 15 min then chill on 

ice for 5 min (14). Load on 8% polyacrylamide gel in one lane with a 100-bp ladder. Run at 

130 V for 3 h, until the bromophenol blue is 3 cm from the bottom. Stain. 

3. Cut out DNA smear over 500 bp in size. 

4. Elute concatemer DNA from gel fragments as before but incubate at 65°C. 

5. Ethanol precipitate and resuspend in 6 µL of LoTE.


3.13. Cloning Concatemers 

Clone concatemers using the Zero Background Cloning Kit. The pZErO ® -1 vector 

contains a lethal gene which is disrupted by insertion of DNA, thus only positive 

recombinants should grow (this is the theory: in practice, some colonies do lack inserts). 

1. To linearize the vector, mix 1 µL of pZErO ® -1 (1 µg/µL), 7 µL of dH 2 O, 1 µL of NEBuffer 

2 and 1 µL of SphI. Incubate at 37°C for 15 to 30 min (not over 30 min). 

2. P/C extract and ethanol precipitate. Resuspend in 30 µL of LoTE. 

3. To 1 µL of SphI-linearized pZErO ® , add the 6 µL of purified concatemers, 1 µL of 

10× ligase buffer and 1 µL of T4 DNA Ligase. Include no insert (omit concatemers) and no 

ligase (omit concatemers and ligase) controls. Incubate at 16°C for 2 h. 

4. P/C extract and ethanol precipitate. Resuspend in 6 µL of LoTE. 

5. Transfect 2 µL of DNA into ELECTROMAX DH10B Escherichia coli cells by electroporation, 

according to manufacturer’s instructions. 

6. Plate one-tenth of transfected bacteria onto each 13-cm Zeocin -containing low-salt LB 

agar plate. Keep all plates at 4°C until inserts are checked. If inserts are of appropriate 

size, plates may be used for large-scale sequencing. 

3.14. Screening of Transformants by PCR 

to Identify Long Concatemer Inserts 

Perform PCR with vector-specific primers to determine insert size in each bacterial 

colony. Tubes (0.5 mL) may be used initially, but 96-well PCR plates are more efficient 

for large-scale screening. The 25-µL reaction volume can be reduced, for example, 

to 16 µL. 

1. Step 1, option 1: Johns Hopkins protocol. Per 25 µL of reaction, use: 2.5 µL of 10× SAGE 

PCR buffer; 1.25 µL of DMSO; 1.25 µL of 10 mM dNTPs; 0.5 µL of each of M13 forward 

and reverse Primers; 19 µL of dH 2 O; and 0.2 µL of PLATINUM Taq DNA Polymerase. The 

cycling parameters are 95°C for 2 min; 25 cycles of 95°C for 30 s, 56°C for 1 min and 

70°C for 30 s; then 70°C for 5 min. Step 1, option 2: own modification. The colony PCRs 

are robust and work well with the Taq PCR core kit. Per 100 µL of reaction volume, use: 

61.5 µL of dH 2 O, 10 µL of 10× Qiagen PCR buffer, 5 µL of 25 mM MgCl 2 , 20 µL of 

5× Q-Solution, 2 µL of 10 mM dNTPs, 0.5 µL of each of M13 forward and reverse Primers, 

and 0.5 µL of Taq DNA Polymerase. The cycling parameters are 94.5°C for 1.5 min; 

30 cycles of 94.5°C for 30 s, 52°C for 1 min and 72°C for 1 min; then 72°C for 5 min. 

2. Touch a single colony with a new pipet tip then dip into reaction mix and shake. Repeat 

as necessary. Perform PCR. 

3. Run 5 µL of each reaction on a 2% agarose gel with a 100-bp ladder. 

3.15. Sequencing of SAGE Concatemer Inserts 

Select and sequence the PCR products of 500 bp in size or over because these 

should contain at least 15 tags (226 bp of flanking pZErO ® -1 vector plus 12 to 13 bp 

per tag). 

1. Before sequencing, purify the PCR product (partly to remove primers because M13 

forward is used again). Individual phenol chloroform extraction and ethanol precipitation 

is one option. However, Qiagen’s QIAquick 8 PCR Purification Kit with the QIAvac 6S 

are more efficient for large-scale sequencing (see Note 7). 

2. Sequence according to local preference. For example, use the BigDye Primer Kit with 

one-half to one-tenth of the purified PCR product per sequencing reaction and the M13

280 Oien 

Forward Primer, and then run the reaction on an ABI automated sequencer. In some 

laboratories, DNA purification and sequencing can be fully automated. 

3.16. Analysis of SAGE Sequence Files 

Within the concatemer sequences, the linked ditags of approx 26 bp are separated 

by CATG, which is the recognition site of NlaIII. The SAGE software uses the CATG 

sequence to identify and extract the ditags, which are then halved into individual 

tags. The software then quantifies the number of times the tag occurs within a given 

population of clone inserts and creates a report of the abundance of each tag. The report 

can be linked to genetic databases for identification of the gene(s) corresponding to the 

tags and used to compare different SAGE libraries. 

Use the downloaded Johns Hopkins SAGE software according to the instructions 

provided, in combination with NCBI’s Genbank databases, and Microsoft Access and 

Excel. Other SAGE programs are also available (see Subheading 1 and Table 1). 


The I-SAGE instructions suggest that the whole procedure takes at least 9 d and 

longer to screen and sequence the selected clones. A few weeks, or more likely, months, 

is a more realistic estimate, especially if setting up SAGE on your own without a 

kit. Here I have emphasized commonly encountered problems, but the more detailed 

Johns Hopkins and I-SAGE protocols contain excellent trouble-shooting sections, and 

I-SAGE in particular describes verification steps to check the success of each stage. 

Once the SAGE libraries have been produced and analyzed, individual SAGE tags 

may be selected for further study, through NCBI’s SAGEmap (20) and Unigene (19), 

and the developing Gene Ontology databases (25), among other resources. This process 

is straightforward where the tag clearly corresponds to one gene but may be more 

difficult where either no matching gene or multiple matches exist. This problem can be 

addressed by reverse-transcription PCR with the short SAGE tag as a primer (26–28). 

This generates longer, more specific, 3′ cDNA fragments that facilitate investigation of 

the gene and can also be used to check whether the tag is truly differentially expressed 

between samples of interest (26). 

To conclude, SAGE is an excellent method of mRNA expression profiling. Although 

it is time-consuming and laborious, and requires expertise in molecular biology, the 

resulting libraries are extremely valuable, providing data that are truly comprehensive 

and quantitative and that enable the identification of novel genes. 

4. Notes 

1. General instructions. These concise instructions assume knowledge of and experience 

in standard molecular biological techniques: purification and manipulation of RNA and 

DNA, including phenol:chloroform extraction and ethanol precipitation; cDNA synthesis; 

restriction enzyme digestion; PCR; agarose and polyacrylamide gel electrophoresis; 

cloning; and sequencing. For further information, consult the references and web sites 

listed and, of course, Sambrook et al. (29). Where kits are used, follow the manufacturer’s 

protocol. Most other reagents, including enzymes and magnetic beads, are also supplied 

with detailed instructions. Alternatively, use Invitrogen’s I-SAGE kit and protocol 

throughout. The availability of standard laboratory equipment is also assumed: 0.2-, 0.5-, 

1.5-, and 2- mL microcentrifuge tubes; 96-well PCR plates; a microcentrifuge, preferably


refrigerated; a vortex mixer; 50-mL tubes and an appropriate centrifuge; wet and dry ice; 

water baths; and incubators, including one for bacterial culture. 

2. Working with RNA. The quality and quantity of input RNA is critical to the success or 

failure of SAGE. Working with RNA may be difficult, and advice is given in Maniatis 

and on Ambion’s web site. Materials should be RNase-free: solutions may be DEPC 

treated and RnaseZap ® or other RNase inhibitors may be used on equipment. Check RNA 

quality by agarose gel electrophoresis: 0.5 µg of total RNA should yield two clear bands 

of ribosomal RNA (4.5 kb and 1.9 kb). 

3. Protocols for smaller amounts of starting material (see Subheadings 2.2., 2.4., 2.6., 

and 3.2.). The Johns Hopkins protocol as described here (and used personally) requires 

a relatively large amount of input material: ideally, at least 2.5 µg of mRNA, broadly 

equivalent to 250 µg of total RNA, 250 mg tissue, or 2.5 × 10 7 cultured cells. This 

protocol therefore cannot be used to generate expression profiles where RNA is limited, 

for example, tissue biopsies. Various technical modifications now enable SAGE to be 

applied to smaller quantities of RNA (3): at least 100-fold (and up to 5000-fold) less may 

be needed. SADE (a SAGE Adaptation for Downsized Extracts) (6) uses Dynal’s oligo 

dT-coated magnetic beads to capture polyA+ mRNA directly from the total RNA or cell 

lysate. (This substitutes for mRNA purification then cDNA synthesis with biotinylated 

oligo dT followed by capture onto streptavidin-coated Dynabeads.) All steps from 

mRNA isolation to tag release are then performed directly on the beads. This procedure 

significantly reduces sample loss and has been adopted in Invitrogen’s I-SAGEkit. Oligo 

dT is used to similar effect in microSAGE (7) and miniSAGE (8), in the form of a coating 

inside microcentrifuge tubes (Roche’s Streptavidin-Coated Tubes). The references contain 

the experimental protocols. Further modifications include additional PCR steps. In SADE 

and microSAGE, the ditags generated by the first round of large-scale PCR amplification 

are then re-amplified using extra PCR cycles (6,7). In contrast, SAGE-Lite (9) and PCR- 

SAGE (10) have adapted Clontech’s SMART system to generate PCR-amplified cDNA, 

to increase the amount of input material before proceeding to SAGE proper. 

4. Enzymatic kinasing of linker oligonucleotides. Dilute linkers to 350 ng/µL. Set up two 

tubes, one for linker pair 1 and the other for pair 2. Mix 9 µL of Linker B (either 1B or 2B) 

with 8 µL of LoTE, 2 µL of 10× ligase buffer (works with kinase and contains ATP) and 

1 µL of T4 polynucleotide kinase. Incubate at 37°C for 30 min then heat inactivate at 65°C 

for 10 min. Add 9 µL of Linker 1A to the 20 µL of kinased Linker 1B, and do likewise for 

Linkers 2. To anneal linkers, heat to 95°C for 2 min, then place at 65°C for 10 min, 37°C 

for 10 min, and room temp for 20 min. Store at –20°C. The final linker concentration is 

200 ng/µL. Test the kinase reaction by self-ligating 200 ng of each linker pair. Run on a 12% 

polyacrylamide gel. Kinased linkers should result in linker-linker dimers of 80 to 100 bp, 

whereas unkinased linkers should not self-ligate. Only linker pairs resulting in over 70% 

self-ligation should be used in further steps. 

5. Phenolchloroform extraction. If the sample volume is below 200 µL, increase it to 200 µL 

with LoTE in a 1.5-mL microcentrifuge tube. Add an equal volume of P/C. Vortex and centrifuge 

at full speed for 5 min at room temp. Transfer the aqueous (top) phase to another tube. 

6. Ethanol precipitation. For a 200-µL sample volume in a 1.5-mL tube, add 3 µL glycogen 

(as a carrier), 100 µL 10 M ammonium acetate, and 700 µL 100% ethanol. (Scale volumes 

up or down as required.) Mix well. Precipitate on dry ice (or at –20°C) for at least 15 min. 

Centrifuge at full speed for 15 min, preferably at 4°C. Wash pellet with 70% ethanol and 

respin. Resuspend in LoTE. 

7. QIAquick columns (see Subheading 2.3.). In this protocol, DNA is prepared by P/C extraction 

and ethanol precipitation. At some stages, QIAquick ® columns can be substituted, 

saving time and possibly providing purer samples for SAGE (12).

282 Oien 

8. PCR. With SAGE, achieving the initial 102-bp ditag PCR product takes time. Thereafter, 

however, equally strenuous efforts are necessary to avoid PCR cross-contamination, hence 

the inclusion of negative controls. The Johns Hopkins protocol now recommends three 

separate PCR areas, for pre-PCR assembly of reagents and negative controls; the addition 

of ligated ditag template; and the manipulation of post-PCR products. Ultraviolet PCR 

preparation hoods may also be useful. 

9. Polyacrylamide gel electrophoresis (PAGE). The SAGE PCR products and ditags are isolated 

by 12% PAGE and the concatemers are separated by 8% PAGE. 12% PAGE uses 14 mL 

of 40% polyacrylamide (191 acrylamidebis) and 31.3 mL of dH 2 0. 8% PAGE requires 

9.3 mL of 40% Polyacrylamide (37.51 acrylamidebis) and 36 mL of dH 2 0. To either, 

add 930 µL of 50× Tris acetate buffer, 470 µL of 10% ammonium persulfate, and 30 µL of 

TEMED. Mix and pour in a vertical gel apparatus. Allow to polymerize for 30 min. Run 

gel as described in the text (the time is approximate). (Note that bromophenol blue is dark 

blue and runs ahead of xylene cyanol, which is turquoise.) After electrophoresis, stain gel 

with SYBR ® Green I, according to manufacturer’s instructions, or with ethidium bromide. 

Visualize bands under ultraviolet light. The Johns Hopkins and I-SAGE protocols and some 

of the methodological papers contain useful photographs of sample gels at each stage. 

10. DNA quantitation. The Johns Hopkins and I-SAGE protocols recommend assessment 

of DNA yield by dot quantitation at various stages during PCR purification and ditag 

isolation. In general, however, this is not routinely required. 


Thanks to the Cancer Research Campaign and the University of Glasgow for research 

funding and to Dr. Kenneth W. Kinzler for SAGE protocols, software and advice. 

References 

1. Velculescu, V. E., Zhang, L., Vogelstein, B., and Kinzler, K. W. (1995) Serial analysis of 

gene expression. Science 270, 484– 487. 

2. Zhang, L., Zhou, W., Velculescu, V., Kern, S., Hruban, R., Hamilton, S., et al. (1997) Gene 

expression profiles in normal and cancer cells. Science 276, 1268–1272. 

3. Velculescu, V. E., Vogelstein, B., and Kinzler, K. W. (2000) Analysing uncharted transcriptomes 

with SAGE. Trends Genet. 16, 423– 425. 

4. Madden, S. L., Wang, C. J., and Landes, G. (2000) Serial analysis of gene expression: from 

gene discovery to target identification. Drug Discov. Today 5, 415– 425. 

5. Polyak, K. and Riggins, G. J. (2001) Gene discovery using the serial analysis of gene 

expression technique: implications for cancer research. J. Clin. Oncol. 19, 2948–58. 

6. Virlon, B., Cheval, L., Buhler, J. M., Billon, E., Doucet, A., and Elalouf, J. M. (1999) Serial 

microanalysis of renal transcriptomes. Proc. Natl. Acad. Sci. USA 96, 15,286–15,291. 

7. Datson, N. A., van der Perk-de Jong, J., van den Berg, M. P., de Kloet, E. R., and 

Vreugdenhil, E. (1999) MicroSAGE: a modified procedure for serial analysis of gene 

expression in limited amounts of tissue. Nucleic Acids Res. 27, 1300–1307. 

8. Ye, S. Q., Zhang, L. Q., Zheng, F., Virgil, D., and Kwiterovich, P. O. (2000) MiniSAGE: 

Gene expression profiling using serial analysis of gene expression from 1 µg total RNA. 

Anal. Biochem. 287, 144–152. 

9. Peters, D. G., Kassam, A. B., Yonas, H., O’Hare, E. H., Ferrell, R. E., and Brufsky, A. M. 

(1999) Comprehensive transcript analysis in small quantities of mRNA by SAGE-lite. 

Nucleic Acids Res. 27, e39. 

10. Neilson, L., Andalibi, A., Kang, D., Coutifaris, C., Strauss, J. F., Stanton, J. A. L., 

et al. (2000) Molecular phenotype of the human oocyte by PCR-SAGE. Genomics 63, 

13–24.


11. Powell, J. (1998) Enhanced concatemer cloning—a modification to the SAGE (Serial 

Analysis of Gene Expression) technique. Nucleic Acids Res. 26, 3445–3446. 

12. Angelastro, J. M., Klimaschewski, L. P., and Vitolo, O. V. (2000) Improved NlaIII digestion 

of PAGE-purified 102 bp ditags by addition of a single purification step in both the SAGE 

and microSAGE protocols. Nucleic Acids Res. 28, E62. 

13. Margulies, E. H., Kardia, S. L., and Innis, J. W. (2001) Identification and prevention of a 

GC content bias in SAGE libraries. Nucleic Acids Res. 29, E60. 

14. Kenzelmann, M. and Muhlemann, K. (1999) Substantially enhanced cloning efficiency 

of SAGE (Serial Analysis of Gene Expression) by adding a heating step to the original 

protocol. Nucleic Acids Res. 27, 917–918. 

15. Yamamoto, M., Wakatsuki, T., Hada, A., and Ryo, A. (2001) Use of serial analysis of gene 

expression (SAGE) technology. J. Immunol. Methods 250, 45–66. 

16. Margulies, E. H. and Innis, J. W. (2000) eSAGE: managing and analysing data generated 

with Serial Analysis of Gene Expression (SAGE). Bioinformatics 16, 650–651. 

17. van Kampen, A. H. C., van Schaik, B. D. C., Pauws, E., Michiels, E. M. C., Ruijter, J. M., 

Caron, H. N., et al. (2000) USAGE: a web-based approach towards the analysis of SAGE 

data. Bioinformatics 16, 899–905. 

18. Larsson, M., Stahl, S., Uhlen, M., and Wennborg, A. (2000) Expression profile viewer 

(ExProView): A software tool for transcriptome analysis. Genomics 63, 341–353. 

19. Wheeler, D. L., Church, D. M., Lash, A. E., Leipe, D. D., Madden, T. L., Pontius, J. U., 

et al. (2001) Database resources of the National Center for Biotechnology Information. 


20. Lal, A., Lash, A. E., Altschul, S. F., Velculescu, V., Zhang, L., McLendon, R. E., et al. (1999) 

A public database for gene expression in human cancers. Cancer Res. 59, 5403–5407. 

21. Audic, S. and Claverie, J.-M. (1997) The significance of digital gene expression profiles. 

Genome Res. 7, 986–995. 

22. Stollberg, J., Urschitz, J., Urban, Z., and Boyd, C. D. (2000) A quantitative evaluation of 

SAGE. Genome Res. 10, 1241–1248. 

23. Man, M. Z., Wang, X. N., and Wang, Y. X. (2000) POWER_SAGE: Comparing statistical 

tests for SAGE experiments. Bioinformatics 16, 953–959. 

24. Kal, A. J., van Zonneveld, A. J., Benes, V., van den Berg, M., Koerkamp, M. G., Albermann, 

K., et al. (1999) Dynamics of gene expression revealed by comparison of serial analysis 

of gene expression transcript profiles from yeast grown on two different carbon sources. 

Mol. Biol. Cell. 10, 1859–1872. 

25. Ashburner, M., Ball, C. A., Blake, J. A., Botstein, D., Butler, H., Cherry, J. M., et al. 

(2000) Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. 

Nat. Genet. 25, 25–29. 

26. van den Berg, A., van der Leij, J., and Poppema, S. (1999) Serial analysis of gene expression: 

rapid RT-PCR analysis of unknown SAGE tags. Nucleic Acids Res. 27, e17. 

27. Chen, J. J., Rowley, J. D., and Wang, S. M. (2000) Generation of longer cDNA fragments 

from serial analysis of gene expression tags for gene identification. Proc. Natl. Acad. 

Sci. USA 97, 349–353. 

28. Matsumura, H., Nirasawa, S., and Terauchi, R. (1999) Transcript profiling in rice (Oryza 

sativa L.) seedlings using serial analysis of gene expression (SAGE). Plant J. 20, 719–726. 

29. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1987) Molecular Cloning. Cold Spring 

Harbor Laboratory Press, Cold Spring Harbor, NY.

284 Oien

Mutation and Polymorphism Detection 287 

41 

Mutation and Polymorphism Detection 




Analysis of DNA variation (polymorphism and mutations) is one of the most 

common challenges faced by molecular biologists. Studies of polymorphisms and 

mutations as molecular markers of or underlying causes of disease have confirmed 

the importance of mutation and polymorphism detection. With mutation detection 

currently being so important for the study of genetic diseases, gene discovery, and 

solving problems of basic biology, there is a large demand for quick and relatively 

cheap methods for mutation detection. Therefore, many different methods have been 

developed for detecting new mutations and screening populations for known mutations 

or polymorphisms. Traditional mutation detection systems, such as restriction fragment 

length polymorphism and denaturing gradient gel electrophoresis, have their limitations. 

With restriction fragment length polymorphism, the mutational event needs to either 

create or destroy a restriction site (1). With denaturing gradient gel electrophoresis, 

although a change at a restriction digest site is not required, this method may only 

detect about 50% of possible mutations and polymorphisms (1). The use of polymerase 

chain reaction (PCR)-based mutation and polymorphism detection systems 

increase the sensitivity and accuracy of the screening methods. This chapter will introduce 

some of the available detection methods and discuss the problems associated 

with these techniques. 

2. Detection Methods 

2.1. Detection of Single Nucleotide Polymorphisms (SNPs) 

2.1.1. Single-Strand Conformation Polymorphism (SSCP) 

SSCP can detect up to 90% of single base changes and relies on the different 

mobilities of DNA strands containing single bp differences when run on a denaturing 

polyacrylamide gel (2). SSCP analysis is widely used to screen large numbers of samples 

for mutations. If a mutation is detected, direct sequence analysis is often then used to 

determine the exact location and base change of the mutation. SSCP can be performed 

using either fluorescent or radioactive technology (2,3). The advantages of fluorescent 



287

288 Edwards and Bartlett 

technology over radioactive are (1) an internal molecular weight standard is used in each 

lane to align data, thereby eliminating lane-to-lane variability; (2) strands of DNA in the 

PCR amplicon can be labeled with different-colored labels; And (3) there is the ability 

to multiplex products from different PCRs in one lane to increase sample throughput. 

SSCP is further discussed in Chapter 48. However, although SSCP is a useful screening 

technique, it yields no information on the location of the mutation. A band shift will 

identify the presence of the mutation within the PCR product, but no sequence information 

on the exact base that has been mutated can be determined without sequencing. 

2.1.2. Mutational Detection Using Cleavage Systems 

2.1.2.1. GEL-BASED METHOD 

An alternative screening method for mutations or polymorphisms that does provide 

some information on the location of the mutation is enzymatic cleavage of DNA. 

Enzymatic cleavage systems rely on enzymes such as resolvases (e.g., the enzyme T4 

endonuclease VII; ref. 4). These enzymes cleave double-stranded DNA at sites where 

a “bubble” is formed because of miss-pairing of bases. Mutation analysis is performed 

by mixing PCR products from the test samples and samples with known sequences 

(either normal alleles or wild type DNA). The PCR products are melted and the DNA 

strands allowed to re-anneal. In the presence of either a mutation or a different allele 

from the wild type, a miss-match in sequence provides a target for the resolvase 

enzyme. The enzyme scans along the double-stranded DNA and binds to the singlestranded 

“bubble” at the site of the miss-match, and the DNA is then cleaved in 

this region. The resultant fragments are then separated by electrophoresis, and the 

presence of cleavage products indicates the presence of a mutation (4,5). The size of 

the cleaved fragments indicates the approximate location of the mutation, which is 

an advantage over SSCP. 

2.1.2.2. NONGEL-BASED METHOD 

The method just discussed uses a gel-based detection system. An example of a 

cleavage method that is not gel based is the use of a structure-specific 5′ nuclease to 

cleave sequence-specific structures in each of two cascading reactions (6). The cleavage 

structure forms when two synthetic oligonucleotides hybridize in tandem to a target. 

One of the oligonucleotides cycles on and off the target and is cut by the nuclease 

only when the appropriate structure forms. The cleaved probes then participate in a 

second reaction involving a dye-labeled fluorescence resonance energy-transfer probe. 

Cleavage of this probe generates a signal, which can be analyzed by fluorescence 

microtiter plate readers (6). 

2.1.3. Oligonucleotide Microarrays 

Current screening methods are rapid and when combined with gel-based fluorescent 

DNA sequencing technology can accurately locate and identify mutations and polymorphisms. 

However, SNPs are now being uncovered and assembled into large SNP 

databases. Although this will be invaluable for linking SNPs with disease, it will require 

analysis of thousands of polymorphisms (7). Currently, there is no technique available 

that is fast, specific, sensitive, reliable, and cost-effective enough for genome-wide 

polymorphism analysis. Oligonucleotide microarrays are currently under intensive


development and if this technique is successful should enable the investigation of 

thousands of SNPs in parallel (8). However, currently there are still limitations 

associated with it. A recent mapping study analyzed 500 SNPs using array technology 

and only 70% of sites analyzed were genotyped correctly (9). This limitation has been 

broached by using enzymatic reactions with the oligonucleotide arrays to enhance 

specificity of hybridization, for example, array primer extensions are being developed 

that use the principle of allele specific single-base primer extension. It has been 

demonstrated that this method is more specific at identifying unknown mutations 

in a known sequence (deletions, transversions, and up to two-base insertions) that 

can be readily found, using arrayed primer extension reactions (10). However, 

promising mutational analysis using oligonucleotide microarrays still remains in the 

developmental stage. 

2.2. Detection of Large Inserts or Deletions 

Large inserts or deletions may be detected by the methods discussed above, such as 

SSCP, enzyme cleavage systems, or amplification refractory mutation system discussed 

in detail in Chapter 47. However, currently the most commonly used detection system 

is either radioactive or fluorescent-based automated sequencing. Although many of 

the above mentioned available screening methods detect in the region of 90 to 98% 

of mutations (whether SNPs, deletions, or insertions) there are still mutations that are 

missed. Therefore, currently the only way to assure that every mutation is found is to 

sequence the region of interest, although this method is both costly and time consuming 

and requires high-quality pure DNA. 

2.3. Detection of Loss of Heterozygosity (LOH) 

and Replication Error Phenotype 

Microsatellite loci have a high degree of polymorphism that is caused by problems 

associated with copying repetitive sequences of DNA. Microsatellites are popular 

genetic markers because of their abundance and high level of allelic variation, and 

expansion of microsatellite trinucleotide repeats have been demonstrated to cause 

several human genetic disease (11). Microsatellite analysis is also useful for detection 

of LOH and replication errors in tumors (12,13). LOH is detected as a reduced intensity 

or total loss of one or more bands in the tumor DNA compared with normal DNA 

form the same individual (12). Replication errors are detected as changes in the length 

of the microsatellite sequences in the tumor DNA compared with normal DNA (13). 

Mutation polymorphism detection of microsatellites basically involves amplifying 

the microsatellite loci and estimating the size of the PCR product. The most common 

techniques used to estimate the size of the microsatellite product involves separation 

of products by gel electrophoresis. The most common method used to visualize PCR 

products on an agarose gel is ethidium bromide staining. Staining with ethidium 

bromide is not a routine method used for microsatellite analysis because it has low 

sensitivity and does not provide a permanent record. Microsatellite analysis is more 

commonly performed using polyacrylamide gels because they give better separation 

than agarose gels. Visualization of DNA on a polyacrylamide gel may be achieved 

by silver staining, radioactive-labeled DNA visualized by autoradiography, or laseractivated 

fluorescent-labeled DNA detected by an automated sequencer. Silver staining 

can be difficult to control, and use of radiation within the laboratory setting is becom-


ing less popular in current years because of the associated health risks. Therefore, 

fluorescent-based methods are currently the method of choice, that is, labeling of DNA 

using fluorescent-labeled primers or nucleotides. Fluorescent technology eliminates the 

handling of radioactivity, makes it easier to interpret stutter bands and laser-activated 

detection of fluorescent products during electrophoresis, allows immediate detection of 

signal, permits rapid data analysis, and provides permanent records of results. The use 

of fluorescent technology has allowed development of techniques that greatly increase 

the speed by which microsatellite analysis can be performed by increasing throughput. 

For example, a rapid way to screen for microsatellites is described in Chapter 42. This 

chapter discusses multiplex touchdown PCR, which allows amplification of multiple 

microsatellite loci simultaneously. Use of different fluorescent-labeled primers then 

allows identification of each loci. Similarly, Chapter 43 describes the use of fluorescent 

technology to increase throughput of LOH analysis by labeling PCR products with 

differently labeled fluorescent primers. 

3. Technical Constraints 

All of the above methods require good-quality DNA; therefore, in most cases before 

mutational analysis can begin RNA or DNA must be extracted from the sample and a PCR 

performed to provide DNA of sufficient purity and quantity for mutational analysis. 

3.1. Problems Associated with Quality and Quantity 

of Extracted DNA or RNA 

If the amount of available DNA or RNA is limited and therefore insufficient for 

use in mutational analysis, PCR or RT-PCR may be used to increase the quantity of 

DNA. If multiple regions of interest are to be investigated, then it may be necessary to 

globally amplify DNA by degenerate oligonucleotide-primed PCR (DOP-PCR) (14). 

The use of this technique in mutational analysis is described in Chapter 45. 

The purity of extracted DNA or RNA for subsequent mutational analysis is extremely 

important. Contamination with other cellular components, such as protein, or chemicals, 

such as ethanol, can easily be removed after the extraction process using various 

cleanup protocols. However, contamination with foreign DNA is not dealt with as 

easily. Contamination at this stage of the process with either foreign DNA from external 

sources or from within the sample will be amplified as the process proceeds and 

can result in mutational analysis being conducted on the wrong DNA. Precautions 

should be taken to limit cross-contamination and external contamination as with any 

PCR. Methods for increasing the purity of RNA and decreasing the introduction of 

contamination during RT-PCR are discussed in Chapter 46. Contamination may also be 

a problem from within the tissue, for example, if studying cancer genetics, normal cells 

may contaminate a tumor cell population. Microdissection is a technique that allows 

separation of normal and tumor cells, and Chapter 43 discusses use of this method 

in microsatellite analysis. 

For mutational analysis, DNA is required to be of high quality because poor-quality 

DNA, for example, degraded or nicked, could result in false results. If performing 

RT-PCR from RNA, RNA should be extracted from fresh tissue or from tissue snap 

frozen on removal to decrease RNA degradation. Although kits now are available for 

extraction of RNA from archival material, the quality of RNA retrieved is often poor.


DNA may be extracted from fresh, frozen, or archival material. High-quality DNA 

should be easily retrieved from fresh or frozen material, for example, tissue or blood. 

Extraction of good-quality DNA from archival material is more difficult; however, the 

most abundant source of clinically available tissue is archival formalin-fixed paraffinembedded 

tissue. This process not only drastically decreases the yield of DNA in 

comparison with fresh or frozen material but also damages the DNA, often making it 

unsuitable as a DNA template. Chapter 43 discusses how archival DNA can be used for 

microsatellite analysis by keeping the PCR product size small. 

In summary, for successful mutational analysis a significant quantity of high-quality, 

pure DNA is required. Low quantities of DNA make analysis difficult, and poor-quality 

or contaminated DNA may cause false results. 

3.2. PCR Artifacts 

Although PCR is the recognized method for increasing the quantity of DNA required 

for polymorphism or mutational analysis, PCR can in itself introduce problems. 

Contamination by foreign DNA and cross-contamination is often introduced at this 

stage of the process. With appropriate care, that is, gloves, aseptic technique, and 

clean pipette tips between every sample, this should be limited. However, this is 

a particular problem with DOP-PCR. DOP-PCR is very sensitive to contamination 

because degenerate primers in the reaction will amplify DNA from any source present 

in the tube. However, the presence of DNA in the blank control after DOP-PCR does 

not always indicate contamination, and the low temperature in the DOP-PCR can result 

in DOP primers attaching to each other and replicating (15). If this occurs, then a 

second PCR amplifying only the region of interest should not be possible. It is therefore 

recommended that blanks should be tested by sequential PCR after DOP-PCR before 

samples are discarded. 

Other problems created by PCR are the addition of an extra base (normally adenine) at 

the end of the DNA sequence and the creation of shadow bands (discussed in Chapter 44). 

In summary, although PCR solves the problem of insufficient DNA for analysis, with 

its use comes an assortment of additional problems. 

4.1. Applications 

Mutational analysis has many applications, for example, markers of disease, cancer 

research, and genotyping. Mutations are responsible for diseases, such as sickle cell 

anemia (1), cystic fibrosis (1), and adrenal leukodystrophy (1). An expansion of the 

CAG repeat in exon 1 of the androgen receptor alone can result in Kennedy’s disease, 

spinocerebellar ataxia, or fragile X syndrome (15). Therefore, polymorphism and 

mutational analysis are of use in diagnosing these diseases. 

Detection of polymorphism and mutational analysis is also widely used in the field 

of cancer research. Mutation detection has demonstrated that p53 function is lost in 

approximately 50% of all cancers and that the loss of function is caused by point 

mutations (16). It also demonstrates that a mutation in BRCA 1 or BRCA 2 increases 

susceptibility to breast and ovarian cancer (17). Microsatellite analysis is used in cancer 

research to study LOH and microsatellite instability. LOH studies have demonstrated 

most genetic alterations that occur in bladder cancer are on chromosome 9 (18) and that 

microsatellite instability is commonly found in colorectal cancer (13).


Stepwise mutation models and microsatellite polymorphisms have been used to 

determine relationships among primates (19). Such studies have investigated the 

relationship between humans, chimpanzees, and gorillas (19). There is also an ongoing 

debate about proper interpretation of DNA sequence polymorphisms and their ability 

to reconstruct human population history (20). 

Mutational analysis is also used in genotyping. It was use of mutational analysis 

that demonstrated that birds are not monogamous because genotyping performed on 

eggs in the same nest demonstrated different parentage (21). Genotyping is also used 

when breeding animals in captivity to determine their most appropriate mate (21). 

In summary, polymorphism and mutational analysis is a major tool in science today, 

without which much of our current understanding of genetics would not have been 

possible. 

References 

1. Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J. D. (1989) Recombinant 

DNA Technology, in Molecular Biology of The Cell, 2nd ed., chapter 4, (Robertson, M., ed.), 

Garland Publications, New York, pp. 180–196. 

2. Iwahana, H., Yoshimoto, K., and Itakura, J. (1994) Multiple fluorescence-based PCR-SSCP 

analysis. Biotechniques 16, 296–304. 

3. Nataraj, A. J., Olivos-Glander, I., Kusukawa, N., and Highsmith, W. E. (1999) Single-strand 

conformation polymorphism and heteroduplex analysis for gel-based mutation detection. 

Electrophoresis 20, 1177–1185. 

4. Youil, R., Kemper, B. W., and Cotton, R. G. (1995) Screening for mutations by enzyme 

mismatch cleavage with T4 endonuclease VII. Proc. Natl. Acad. Sci. USA 92, 87–92. 

5. Del Tito, B. J., Poff, H. E., Noviotny, M. A., Cartlidge, D. M., Walker, R. I., Earl, C. D., 

et al. (1998) Automated fluorescent analysis procedure for enzymatic mutation detection. 

Clin. Chem. 44, 731–739. 

6. Cotton, R. G. (1999) Mutation detection by chemical cleavage. Genet. Anal. 14, 165–168. 

7. Gray, I. C., Campbell, D. A., and Spurr, N. K. (2000) Single nucleotide polymorphisms as 

tools in human genetics. Hum. Mol. Genet. 9, 2403–2408. 

8. Kikoris, M., Dix, K., Moynihan, K., Mathis, J., Erwin, B., Grass, P., et al. (2000) High 

throughput SNP genotyping with the mass code system. Mol. Diagn. 5, 329–340. 

9. Faham, M., Baharloo, S., Tomitaka, S., DeYoung, J., and Freimer, N. B. (2001) Mismatch 

repair detection: high-throughput scanning for DNA variations. Hum. Mol. Genet. 10, 

1657–1664. 

10. Fan, J. B., Chen, X., Halushka, M. K. Berno, A., Huang, X., Ryder, T., et al. (2000) Parallel 

genotyping of human SNPs using generic high-density oligonucleotide tag arrays. Genome 

Res. 10, 853–860. 

11. Rohrbach, H., Hass, C .J., Baretton, G. B., Hirschmann, A., Diebold, J., Behrendt, 

R. P., et al. (1999) Microsatellite instability and loss of heterozygosity in prostatic 

carcinomas: comparison of primary tumours, and of corresponding recurrences after 

androgen-deprivation therapy and lymph node metastases. Prostate 40, 20–27. 

12. Niederacher, D., Picard, F., van Roeyen, C., An, A. X., Bender, H. G., and Beckmann, 

M. W. (1997) Patterns of Allelic loss on chromosome 17 in sporadic breast carcinomas 

detected by fluorescent labelled microsatellite analysis. Genes Chromosomes Cancer 18, 

181–192. 

13. Dietmaier, W., Riedlinger, W., Kohler, A., Wegele, P., Beyser K., Sagner, G., et al. (1999) 

Detection of microsatellite instability and loss of heterozygosity in colorectal tumours by 

fluorescence based multiplex microsatellite PCR. Biochemica 2, 43– 46.


14. Kuukasjarvi, T., Tanner, M., Pennanen, S., Karhu, R., Visakorpi, T., and Isola, J. (1997) 

Optimising DOP-PCR for universal amplification of small DNA samples in comparative 

genomic hybridisation. Genes, Chromosomes Cancer 18, 94–101. 

15. Chamberlain, N. L., Driver, E. D., and Mainsfeld, R. L. (1994) The length and location 

of CAG trinucleotide repeats in the androgen receptor N-terminal domain affect trans 

activation function. Nucleic Acids Res. 22, 3181–31886. 

16. Lane, D. P. (1992) TP53, the guardian of the genome. Nature 358, 15–16. 

17. Rohlfs, E. M., Learning, W. G. Friedman, K. J., Cough, F. J., Weber, B..L., and Silverman, 

L. M. (1997) Direct detection of mutations in the breast and ovarian cancer susceptibility 

gene BRCA1 by PCR mediated site directed mutagenesis. Clin. Chem. 43, 24–29. 

18. Knowles, M. A. (1998) Molecular genetics of bladder cancer: Pathways of development 

and progression. Cancer Surveys 31, 49–53. 

19. Goldstein, D. B., Ruis Linares, A., Cavalli-Sforsa, L. L., and Feldman, M. W. (1995) 

Genetic absolute dating based on microsatellite and the origin of modern humans. Proc. 

Natl. Acad. Sci. USA 92, 6723–6727. 

20. Cann, R. L. (2001) Genetic clues to dispersal in human populations: retracing the past from 

the present. Science, 291, 1742–1748. 

21. Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J. D. (1989) The 

organisation and evolution of the nuclear genome, in Molecular Biology of The Cell, 

2nd ed, chapter 10 (Robertson, M., ed.), Garland Publications, New York, pp. 599–609.

294 Edwards and Bartlett

MT-PCR for Microsatellite Analysis 295 

42 

Combining Multiplex and Touchdown PCR 

for Microsatellite Analysis 

Kanokporn Rithidech and John J. Dunn 


An improved nonradioactive polymerase chain reaction (PCR)-based method for 

simultaneous amplification of multiple loci of microsatellites has been developed as a 

rapid way to screen for microsatellites (1). The approach, termed multiplex-touchdown 

PCR (MT-PCR), is performed in a single PCR tube by combining touchdown (2–5) and 

multiplex (6) PCR protocols. The touchdown format is used to improve the specificity 

and the quality of amplification, that is, only DNA bands of an expected size are 

present as the major PCR bands observed on the nondenaturing polyacrylamide gels, 

thereby overcoming the presence of differently sized background bands (a ladder-like 

problem). The multiplex strategy is used so that simultaneous amplification of multiple 

microsatellite loci is achieved. In this chapter, we describe the MT-PCR strategy 

that has been successfully used for simultaneous amplification of up to three mouse 

microsatellites by choosing primer pairs with the corresponding touchdown-PCR 

parameters. The MT-PCR is very useful for genotyping hybrid mice, provided the 

allelic size difference between two parental genotypes is amenable to separation by 

gel electrophoresis. In principle, this MT-PCR should be applicable to similar studies 

in other species, including humans. 

2. Materials 

1. Sterile deionized water, for example, MilliQ water. 

2. 10× PCR buffer (10 mM Tris-HCL, pH 8.3, 50 mM KCL). 

3. 10 mM of each of dNTP (A,T,C, and G). 

4. Microsatellite primers. 

5. Taq polymerase. 

6. MgCl 2 . 

7. Template DNA (5 µg/mL, in sterile water). 

8. Polyacrylamide (premixed 300.8 acrylamide:bisacrylamide, Owl Separation System 

Portsmouth, NH). 

9. Slab gel, for example, Mini-protean cell from Bio-Rad, large format single sided vertical 

system (20 cm × 20 cm) from Owl separation System. 

10. 1× TBE (Tris borate EDTA) gel running buffer. 



295

296 Rithidech and Dunn 

11. Ethidium bromide (0.5 µg/mL). 

12. DNA size standards. 

3. Methods 

Basically, two basic principles are involved in this protocol, that is, 1) the repeat 

sequences are amplified by PCR by using primers specific for the flanking genes and 

2) the amplicons are then sized on nondenaturing polyacrylamide gels. The protocol 

outlined below has been used successfully for genotyping 50 mouse microsatellite 

markers, included in our study on leukemogenesis and hepatoma, of BALB/cJ X 

CBA/CaJ hybrid mice. The sizes of these markers are 84 to 270 bp with allelic size 

differences of 8 to 30 bp. The following steps are required. 

3.1. Step 1 

Set up PCR Master Mix. An example given in below is for a single PCR amplification 

of three microsatellite markers. To make a total volume of 15 µL Master Mix, combine 

the appropriate set of components in order listed in below in a 0.5-mL thin-walled 

PCR tube. 

Volume (µL) 

Final Concentration 

Sterile Milli Q Water 1.19 

10× PCR buffer 1.5 1X 

dATP at 10 mM 0.3 200 µM 

dCTP at 10 mM 0.3 200 µM 

dGTP at 10 mM 0.3 200 µM 

dTTP at 10 mM 0.3 200 µM 

Microsatellite marker 1: 

Forward Primer (6.6 µM) 1.14 0.5 µM 

Reverse Primer (6.6 µM) 1.14 0.5 UM 



Reverse Primer (6.6 µM) 1.14 0.5 µM 



Reverse Primer (6.6 µM) 1.14 0.5 µM 

MgCl 2 (25 mM) 1.2 2.0 mM 

template DNA (5 µg/mL) 3.0 1.0 µg/mL 

Taq polymerase (5Units/µL) 0.072 2.5 Units/100 µL 

NOTES: 

1. All chemicals, except primers, are purchased from Perkin-Elmer, Norwalk, CT. 

2. All primers are purchased from Research Genetics, Inc. Huntsville, AL. 

Add template DNA after a drop of mineral oil (Sigma, St. Louis, MO) has been placed 

into the tube. 

Add after “Hot Start” in Step 2. 

3.2. Step 2 

Hot-start at 96°C for 3 min. Then, add 0.072 µL of Taq polymerase (5 U/µL).


3.3. Step 3: Touchdown 

A typical PCR protocol for the initial Touchdown cycle is denaturation at 96°C for 

30 s, annealing at 65°C for 30 s, and extension at 72°C for 30 s. 

3.4. Step 4: Standard PCR Cycles 

After 5 to 10 touchdown cycles (depending on the targeted annealing temperature), 

20 standard PCR cycles are performed under the following conditions: denaturation at 

96°C for 30 s, annealing at 55°C (or 60°C) for 30 s, extension at 72°C for 30 s, and 

final extension at 72°C for an additional 5 min (see Note 3). 

3.5. Step 5: Gel Electrophoresis 

Typically, 6 and 10% nondenaturing polyacrylamide gels are used for separating 

microsatellites with allelic size differences of >12 bp and 20 cycles) results in deterioration of 

the PCR specificity leading to an increase in the background of spurious bands. Under 

the proper conditions, several amplicons from one round of MT-PCR can be analyzed 

simultaneously and each amplicon can be identified unambiguously on the same lane of 

nondenaturing PAGE. By choosing primer pairs with the corresponding T-PCR parameters, 

the MT-PCR is highly efficient for concurrent identification of three microsatellite loci 

(Fig. 1, lane 1). 

3. A soak file at 4°C can be set after the final extension step. 

4. A Mini-protean cell from Bio-Rad is used for the 6% nondenaturing polyacrylamide gel. 

A large format single sided vertical system (20 cm × 20 cm) from Owl separation System 

is used for the 10% nondenaturing polyacrylamide gel. 

5. Beside speed and ease, an additional advantage of MT-PCR is that it is notably useful 

when only small quantities of DNA template are available. Amounts of DNA template 

as low as 10 ng can be used in one simultaneous reaction with three different pairs of 

primers. DNA samples from different tissues of the mouse, that is, bone marrow cells, 

spleen, liver, and tail, have been used successfully as templates in MT-PCR. Normally, 

the simple salting out procedure for isolating genomic DNA described by Miller et al. (8) 

routinely gives, in our laboratory, high-quality DNA templates from these tissues. The 

only drawback to the use of MT-PCR for the genotyping of microsatellites is that each 

protocol depends largely on primer compatibility, that is, having similar reaction kinetics 

(amenable to the same T-PCR protocol).

298 Rithidech and Dunn 

Fig. 1. PCR amplification of the mouse microsatellites: D2Mit43 (242-210 bp), D2Mit107 

(134-112 bp, and D2Mit126 (160–190 bp) using genomic DNA isolated from the bone marrow 

cells of C3HeB/HeJ X C57BL/6J F1 Hybrid. Products were separated in a 6% nondenaturing 

PAGE (300.8 acrylamidebisacrylamide) run at 150 V (constant) for 3 h. The gel was stained 

with ethidium bromide (0.5 mg/mL) and photographed under ultraviolet light. The arrows 

indicate the position of the expected amplicons. The molecular markers (HaeIII digested 

pBR332 DNA) are shown in lanes M. The PCR products were obtained using five Touchdown 

cycles, and 20 cycles of constant annealing temperature (60°C). Lane 2 represents a control 

PCR without added mouse DNA. The sequences of primers are as follows: 


This work was support by the U.S.DOE Contract ER62487/0001684. 

References 

1. Rithidech, K., Dunn, J. D., and Gordon, C. R. (1997) Combining multiples and touchdown 

PCR to screen murine microsatellite polymorphisms. Biotechniques 23, 36– 44. 

2. Chou, Q., Russell, M., Birch, D. E., Raymond, J., and Bloch, W. (1992) Prevention of 

pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. 


3. Don, R. H., Cox, P. T., Wainright, B. J., Baker, K., and Mattick, J. S. (1991) Touchdown 

PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 

4008. 

4. Scrimshaw, B. J. (1992) A simple nonradioactive procedure for visualization of (dC-dA)n 

dinucleotide repeat length polymorphisms. BioTechniques 13, 189.


5. Mellersh, C. and Sampson, J. (1993) Simplifying detection of microsatellite length 

polymorphisms. BioTechniques 15(4), 582–583. 

6. Chamberlain, J. S., Gibbs, R. A., Ranier, J. E., Nguyen, P. N., and Caskey, C. T. (1988) 

Detection screening of the Duchenne muscular dystrophy via multiplex DNA amplification. 

Nucleic Acids Res. 16, 11,141–11,156. 

7. Thein, S. L. and Wallace, R. B. (1986) The use of synthetic oligonucleotides as specific 

hybridization probes in the diagnosis of genetic disorders, in Human genetic diseases: a 

practical approach (Davis, K. E., ed.), IRL Press, Herndon, Virginia, pp. 33–50. 

8. Miller, S. A., Dykes, D. D., and Polesky, H. F. (1989) A simple salting out procedure for 

extracting DNA from human nucleated cell. Nucleic Acids Res. 16, 1215.

300 Rithidech and Dunn

Detection of MIS 301 

43 

Detection of Microsatellite Instability and Loss 

of Heterozygosity Using DNA Extracted from 

Formalin-Fixed Paraffin-Embedded Tumor Material 

by Fluorescence-Based Multiplex Microsatellite PCR 



Microsatellites are widely distributed highly repetitive DNA sequences composed of 

di-, tri-, or tetranucleotide repeats (1). They are spread over the whole human genome 

and are located between and within genes. Physiologically, they exhibit high levels of 

polymorphism, relative to different chromosomal loci, and within different individuals, 

different microsatellite lengths can even be noted between two alleles of the same 

gene (1). Although the role of microsatellites in the genome and their evolutionary 

mechanisms are still incompletely understood, they are widely used tools in genetic 

mapping studies and as markers for prediction of disease (2,3). 

The length of microsatellite repeats may be used to predict the presence of disease, 

for example, the length of the CAG repeat in the AR receptor gene (40–65 repeats) 

is a marker of Kennedy’s disease (3). Microsatellites also exhibit a form of genetic 

instability characterized by the gain or loss of repeat units at multiple independent loci. 

Such alterations have been observed to accumulate in cells with defective DNA repair 

mechanisms and are commonly known as microsatellite instability (MIS) (1,2). The 

DNA mismatch repair system plays an important role in controlling the accumulation of 

somatic mutations and therefore there is an association between DNA repair defects and 

carcinogenesis, and the presence of MIS may be used as a marker of certain cancers (4). 

MIS has been associated with familial cancer syndrome hereditary nonpolyposis colorectal 

cancer, sporadic ovarian, prostate. and pancreatic cancer (1,4,5). Cancer research 

also uses microsatellites when investigating inactivation of tumor suppressor genes. 

Loss of heterozygosity (LOH) of microsatellites located in or close to a tumor suppressor 

gene is an indirect way of testing for inactivation of tumor suppressor genes in 

accordance to the classical two-hit model, that is, a recessive mutation is uncovered by 

loss of the second copy of the gene, resulting in inactivation of the tumor suppressor 

gene (6). 



301


Studies that involve microsatellites usually involve amplification of DNA using 

polymerase chain reaction (PCR). The three methods for detection of microsatellites 

currently in use are: radioactive PCR visualized by autoradiography; PCR visualized 

by silver-stained gels; and fluorescent PCR visualized on an automated DNA fragment 

analyzer (7). The current method of choice is fluorescent PCR coupled with analysis 

of fluorescent-labeled DNA fragments on polyacrylamide gel electrophoresis in an 

automated DNA fragment analyzer. This method considerably increases the throughput 

of samples because it uses detection of laser-activated fluorescent products during 

electrophoresis and data are then immediately available for analysis. A large number 

of microsatellites may be studied at once because as many as 20 PCR products may 

be run down one lane of the gel at any one time. This method is also of use if there is a 

limited amount of DNA template, for example, small biopsy samples, because it enables 

the detection of very low concentrations of PCR products. The fluorescence detection 

system has been proven to be at least 10 times more sensitive than autoradiography 

and silver staining because of the use of an internal standard the fluorescent system 

can more accurately size PCR products and it minimizes stutter bands. This method 

also enables detection of LOH even if complete allele loss is not apparent because of 

contamination from other cell types. There are also less associated hazards when using 

this technique because no handling of radioactivity is required. 

LOH and MIS studies commonly are used in cancer research; therefore, tumor and 

normal tissue must be separated before DNA can be extracted. Microdissection of 

histologically characterized cells from fresh-frozen or paraffin-embedded tissue sections 

has become an important technique for the analysis of genetic alterations occurring 

in tumors, allowing the separation of normal and tumor cells. Microdissection is a 

technique where by tissue sections approx 5-µm thick are stained in toluidine blue and 

viewed using a light microscope, and areas of normal/tumor cells are dissected using a 

micromanipulator. DNA from the different cells is extracted from the dissected tissue. 

The most abundant source of tumor tissue with clinical information is formalin-fixed 

paraffin-embedded tissue. Hospitals routinely archive tumors in this fashion, and 

although this is acceptable for most pathological processes, it does cause nicks to 

form in DNA, this damage to the DNA affects the ability to use it as a PCR template. 

The yield of DNA extracted from formalin fixed paraffin embedded tissue is also 

significantly diminished, (by about 70% compared to the yield from frozen tissue) (8). 

To overcome the problems associated with using archival DNA as a PCR template, the 

PCR product should be kept to a minimum size when designing primers, preferably 

under 300 bp. To overcome the concentration problem, fluorescent PCR with 40 or 

more amplification cycles should be used. Hot start Taq polymerase should also be used 

to decrease nonspecific binding of primers to the DNA template and the formation 

of primer dimers. With hot start Taq, the amplification reaction only starts after the 

initial denaturation step. Therefore, nonspecific PCR products, primer dimer formation, 

and background are minimized, maximizing the yield of specific PCR product from 

limited template. 

The following method is an example of how MIS and LOH can be determined for a 

panel of nine microsatellites spanning chromosome 9 using only 9 µL of DNA (approx 

15 µg/µL) microdissected from formalin-fixed paraffin-embedded archival transitional 

cell carcinomas of the urinary bladder tissue.


Table 1 

Sequence of the Forward and Reverse Primers for Each Microsatellite 

and the Annealing Temperature Used in the PCR 

Primer name Primer sequence Annealing temp 

D9S126 

Forward ATT GAA ACT CTG CTG AAT TTT CTG 50°C 

Reverse 

CAA CTC CTC TTG GGA ACT GC 

D9S259 

Forward GGC ATC ATT GCA CCA T 50°C 

Reverse 

GGA TGG ATC TTA TGG GTG GAA 

D9S275 

Forward CAG GAA CTT GTC CAT TCT C 47°C 

Reverse 

TCT ATT ATT GCC TTA CTC ACA G 

D9S195 

Forward AGC TCA GCA CGG AGG G 53°C 

Reverse 

AGG GCA GGT TCC TAC AAA 

D9S258 

Forward GCT AGA GAT GCC CTTCGAG TG 53°C 

Reverse 

AGG ATT TAT AGA AAG TCC AAA ACC C 

D9S102 

Forward ATA GAC TTC CAG ACA GAT AG 50°C 

Reverse 

CCT CTC TCA TTC CTG GTA CT 

GSN 

Forward CAG CCA GCT TTG GAG ACA AC 50°C 

Reverse 

TCG CAA GCA TAT GAC TGT AA 

D9S1199 

Forward AAA AAT CAT GTG CAT CAA TTC C 53°C 

Reverse 

CCA GAG AAG CAG AAC CAA CG 

D9S1198 

Forward TGG GAG AGG GAA AAT GCT ATC 47°C 

Reverse 

GTA CTC CAG CCT GGG TGG 

2. Materials 

1. Xylene (BDH, UK). 

2. 100%, 95% and 70% alcohol (BDH, UK). 

3. 0.05% Toluidine blue dissolved in distilled water (Sigma Aldrich, UK). 

4. Leitz microscope and Leica micromanipulator (Leica, UK). 

5. Microdissecting needle and needle holder (Leica, UK). 

6. Protein digestion buffer (0.5% Tween in 50 mM Tris-EDTA, pH 8.5). 

7. 0.5 mg/mL proteinase K, add 450 µL of protein digestion buffer to 50 µL of 10 mg/m 

proteinase K dissolved in water (Sigma Aldrich, UK). 

8. 37°C water bath. 

9. MJ Research PTC-225 Peltier Thermal Cycler (Genetic Research Instrumentation, UK). 

10. 2 µM forward and reverse fluorescent-labeled primers per reaction (MWG-Biotech, UK 

Ltd). Primers are present in the reaction at 0.2 µM. For individual primer sequences, 

refer to Table 1.


11. Hot start Taq polymerase, 5 units/µL, reaction concentration is 0.5 units/reaction (Qiagen 

Ltd, UK). 

12. 10× reaction buffer and 25 mM MgCl 2 (Qiagen Ltd, UK); reaction concentration is 

1× reaction buffer and 3 mM MgCl 2 . 

13. dNTPs (10 mM; Advanced Biotech); reaction concentration is 200 µm of each dNTP. 

14. PCR-grade water (Sigma Aldrich, UK). 

15. Formamide (BDH, UK). 

16. Loading buffer (50 mg/mL blue dextran, 25 mM EDTA). 

17. Genescan 400 HD size standard (rox), (ABI Perkin–Elmer, UK). 

18. Acrylamide (Sigma Aldrich, UK). 

19. Bisacrylamide (Sigma Aldrich, UK). 

20. Automated laser-activated fluorescent DNA sequencer, ABI 377 sequencer (Perkin 

Elmer, UK). 

21. Genescan and Genotyping software (Perkin Elmer, UK). 

3. Methods 

3.1. Microdissection of Archival DNA 

1. Archival formalin-fixed, paraffin-embedded TCCs are cut into 5-µm thick sections and 

put on to glass slides. 

2. Tissue sections are dewaxed by incubating in xylene (2 × 10 min). 

3. Tissue is rehydrated by incubating in a series of alcohol solutions, 100% alcohol 

(2 × 2 min), 95% alcohol (2 min), and 70% alcohol (2 min). 

4. Sections are stained in 0.05% Toluidine blue for 30 s. 

5. Areas of tumor cell are microdissected from 5-µm sections using a dissecting microscope 

and a micromanipulator. 

6. Dissected tissue is placed in an RNA/DNA free tube containing 12 µL of protein digestion 

buffer. 

7. DNA is extracted by addition of a 13 µL of protein digestion buffer containing proteinase 

K and incubating for 4 to 7 d at 37°C in a water (9). 

8. On removal from the water bath, proteinase K is inactivated by heating for 10 min at 95°C 

using a thermal cycler (see Note 1). 

9. Normal tissue is also dissected from the same section as the tumor, thus providing normal 

DNA to be used as a control in MIS and LOH analysis. 

10. LOH and MIS analysis is conducted using 1-µL aliquots of DNA without further 

purification. 

3.2. Primers and Loci Analyzed 

Primer sequences used for amplification of 9 microsatellites are found in Table 1. 

Two microsatellites (D9S126 and D9S259) are located on the short arm of chromosome 

9 spanning the 9p21 region, five microsatellites (D9S275, D9S195, D9S258, D9S103, 

and GSN) are located on the long arm of chromosome 9 spanning the 9q 32-33 region 

and two microsatellites (D9S1199 and D9S1198) are located on the long arm spanning 

the 9q 34 region. Primers were purchased from MWG-Biotech UK Ltd, one primer 

from each pair was fluorescently labeled at the 5′ end. 

3.3. PCR 

The target sequences were amplified by PCR in 10-µL reactions, with each reaction 

containing the following.


1. Archival DNA template (1 µL). 

2. 1× reaction buffer (1 µL of 10× reaction buffer); because the reaction buffer contained 

15 mM MgCl 2 , this gave a reaction concentration of 1.5 mM MgCl 2 . 

3. 2 µM reverse and forward primer (1 µL) to give a reaction concentration of 0.2 µM for 

each primer. 

4. 0.6 1 µL of 25 mM MgCl 2 to give a final reaction concentration of 3 mM MgCl 2 . 

5. 0.2 1 µL of 10 mM dNTP to give an reaction concentration of 200 µL each of dATP, 

dCTP, dGTP, and dTTP. 

6. 0.1 1 µL of 5 units/1 µL hot star Taq polymerase to give 0.5 units per reaction. 

7. Volume is made up to 10 1 µL using PCR-grade water. 

The reaction was started after a 15-min denaturation of DNA at 95°C. DNA 

amplification was performed in a thermal cycler as follows: 45 cycles of denaturation 

at 94°C for 30 s; annealing at 47, 50, or 53°C (Table 1) for 30 s and extension at 72°C 

for 1 min; followed by a final extension for 15 min at 72°C. 

The PCR is repeated using the same DNA template for each of the primer sets. On 

removal from the thermal cycler 2 µL of each of the 9 PCR products from each primer 

set are combined for each template and mixed thoroughly by vortexing. 

3.4. PCR Analysis 

1. PCR products are then prepared for gel electrophoresis. 

2. The following are combined in a 200-µL DNA/RNA free microfuge tube and vortexed: 

.5 µL of combined PCR products; 1 µL of formamide; 0.5 µL of loading buffer (50 mg/mL 

blue dextran, 25 mM EDTA); and 0.5 µL of commercial standard (Genescan 400 HD (rox), 

ABI Perkin–Elmer, Norwalk, CT). 

3. The mixture is then incubated at 96°C for 4 min and cooled on ice. 

4. The mixture (1.5 µL) is applied to a 4% arcrylamide/bisacrylamide gel and electrophoresed 

for 2 h on an automated laser-activated fluorescent DNA sequencer (Perkin–Elmer ABI 

377 sequencer). 

5. Fluorescent gel data were collected automatically during electrophoresis and analyzed 

using Genescan software. An example of the gel image is shown in Fig. 1. The data gained 

from Genescan is then exported into Genotyper and further analyzed. 

3.5. Assessment of Allele Loss and Microsatellite Instability 

Allele loss should be assessed as described by Dietmaier et al. (10). In heterozygous 

individuals, two alleles, that is, two PCR products of different size can be detected in 

normal DNA. Because PCR fragments of different sizes are amplified with different 

efficiencies, the ratio of allele peak heights is calculated in matched normal and tumor 

DNA. Peak heights of the longer length allele peaks are divided by the peak heights of 

the shorter length allele peaks (see Note 2). The ratio obtained in tumor DNA divided 

by the allele peak ratio of paired normal DNA gives a result range of 0.00 to 1.00 (see 

Note 3), that is, (tumor allele 1 peak height/tumor allele 2 peak height)/(normal allele 

1 peak height/normal allele 2 peak height). 

Theoretically a complete allele loss results is a value of 0 and both alleles retained 

results in a ratio of 1. In cases where the shorter length allele is lost the ratio obtained 

is greater than 1, this is therefore inverted (1/×) to obtain values within the 0.00 to 

1.00 range. A ratio below 0.65 represents an allele signal reduction of 35%, this is 

considered to be indicative of allele loss (see Note 4). This limit was chosen because


Fig. 1. Example of a gel image. 

the tumor cell content after microdissection is assessed to be greater than 70% and inter 

assay variations of the detection system is below 5%. An example of LOH detection 

using the Geneotype ® Software can be seen in Fig. 2. 

A locus is described as unstable if a novel peak is present or if a peak has undergone 

a size shift after PCR amplification of tumor DNA compared with PCR amplification 

of paired normal DNA. A tumor is described as exhibiting MIS if at least 40% of the 

loci investigated are found to be unstable. 

4. Notes 

1. Inactivation of proteinase K is a very important step because failure to inactivate proteinase 

K will cause PCR to fail, with the proteinase K destroying the Taq polymerase. 

2. When analyzing Genotyper data, more than one peak may be present for each allele 

because of polymerase artifact stutter bands. It is therefore difficult to decide the size 

and the height of the peak to include in the calculation. In general, however, the sizes


Fig. 2. The top graph shows LOH, as the peak at 104 base pairs is missing. However, the 

bottom graph demonstrates retention of both alleles. 

of the two alleles are assigned to the peaks of greatest height and the smaller peaks are 

interpreted as stutter bands. 

3. Tumor cells are not completely separated from adjacent normal cells by microdissection. 

Therefore, a major advantage of the fluorescence-based method is that the loss of alleles 

can be determined precisely by calculation of the ratio of the peak heights of normal 

and tumor alleles. 

4. Assays of samples with allele ratios in the border line range of 0.6 to 0.7 were repeated at 

least three times to ensure accuracy of results. Most repeated assays gave consistent results, 

and all informative markers gave similar allele ratios in the same sample. 

References 

1. King, B. L., Carcangiu, M.-L., Carter, D., Kiechle, M., Pfisterer, J., and Kaoinski, B. M. 

(1995) Microsatellite instability in ovarian neoplasms. Br. J. Cancer 72, 376–382. 

2. Sardi, I., Bartoletti, R., Occhini, I., Piazzini, M., Travaglini, F., Guazzelli, R., et al. (1999) 

Microsatellite alterations in superficial and locally advanced transitional cell carcinoma of 

the bladder. Oncol. Reports 6, 901–905.


3. Sartor, O. and Sheng, A. (1997) Determinatin of CAG repeat length in the androgen receptor 

gene using frozen serum. Urology 49, 301–304. 

4. Bronner, C. E., Baker, A. M., Morrison, P. T., Warren, G., Smith, L. G., Lesloe, M. K., et al. 

(1994) Mutation in the DNA mismatch repair gene homologue hMLH1 is associated with 

hereditary non-polyposis colon cancer. Nature 368, 258–261. 

5. Rohrbach, H., Haas, J. C., Baretton, G. B., Hirschmann, A., Diebold, J., Behrendt, R. P., 

et al. (1999) Microsatellite instability and loss of heterozygosity in prostatic carcinomas: 

Comparison of primary tumor and of corresponding recurrences after androgen deprivation 

therapy and lymph node metastases. Prostate 40, 20–27. 

6. Niederacher, D., Picard, F., van Roeyen, C. An, H. X., Bender, H. G., and Beckmann, W. 

(1997) Patterns of allelic loss on chromosome 17 in sporadic breast carcinomas dectected 

by fluorescent labelled microsatellite analysis. Genes Chromosomes Cancer 18, 181–192. 

7. Christensen, M., Sunde, L., Bolund, L., and Orntorft, T. F. (1999) Comparison of three 

methods of microsatellite detection. Scand. J. Clin. Lab. Invest. 59, 167–178. 

8. Serth, J., Kuczyk, M. A., Paeslack, U., Lichtinghagen, R., and Jonas, U. (2000) Quantitation 

of DNA extracted after microprepatation of cells from frozen and formalin-fixed tissue 

sections. Am. J. Pathol. 156, 1189–1196. 

9. Going, J. J. and Lamb, R. F. (1996) Practical histological microdissection for PCR analysis. 

J. Pathol. 79, 121–124. 

10. Dietmaier, W., Riedlinger, W., Kohler, A., Wegele, P., Beyser, K., Sagner, G., et al. (1999) 

Detection of microsatellite instability (MSI) and loss of heterozygosity (LOH) in colorectal 

tumours by fluorescence based multiplex microsatellite PCR. Biochemica 2, 43– 46.

Shadow Band Synthesis 309 

44 

Reduction of Shadow Band Synthesis During 

PCR Amplification of Repetitive Sequences 

from Modern and Ancient DNA 



Repetitive sequences like short tandem repeat (STR) loci are generally referred to 

as slippery DNA (1). They owe this nickname to a characteristic leading to slippage 

within the primer-template complex during PCR elongation of the new strand (2,3), 

resulting in the synthesis of byproducts shortened by one repeat unit compared with 

the original sequence. The generation of these so-called shadow bands (4) is a wellknown 

problem connected with the amplification of repetitive DNA, complicating the 

genotype analysis of modern (e.g., ref. 5), forensic (6), and ancient (7,8) specimens. 

In some applications, the occurrence of this artifact makes it necessary to develop 

guidelines for allele designation (6,9). 

The intensity of these byproducts increases with the degradation of the target DNA 

(8,10), and therefore represents a particular problem concerning the analysis of highly 

degraded DNA as in genotyping of forensic (e.g., refs. 11,12) and ancient DNA 

(7,13,14). In amplification products of highly degraded or ancient DNA, the intensity 

of a shadow band can exceed the peak height or band intensity of the original allele. 

As artifact alleles (7,15) they can lead to mistyping of amplification products (cf. also 

refs. 8,16). Because an amplification product is not necessarily affected in each case, 

this phenomenon can even result in seemingly different genotypes for independent 

amplification products of the same sample (7,15,16). 

To improve the reproducibility of amplification results and consequently decrease 

the probability of mistyping by reducing the generation of this artifact, the optimization 

of the PCR amplification process itself represents the most important strategy besides 

optimization of the extraction of the DNA used as template (17–19). 

The findings presented in the following resulted from a study within the scope 

of which different strategies to optimize PCR amplification of repetitive DNA were 

investigated with reference to their effect on the generation of shadow bands (cf. 

ref. 19 Schmerer, manuscript in preparation). The model locus investigated was 

HUMVWA31/A (20), the amplifications of which show a high tendency to accumulate 

shadow bands compared with other STR loci (11,12,21). Amplifications were performed 

on DNA Thermal Cycler (TC1, Perkin–Elmer Cetus). For a detailed presentation of 



309

310 Schmerer 

the investigation concerned, please refer to Schmerer (19) and Schmerer (manuscript 

in preparation). 

2. Materials 

1. InViTAQ ® DNA polymerase (Invitek). 

2. NH 4 reaction buffer (Invitek). 10× buffer: 160 mM (NH 4 ) 2 SO 4 , 500 mM Tris-HCl 

(pH 8.3 at 25°C), Tween ® 20. 

3. Betaine (3 M solution with sterile water also used for set up of the reaction mix). 

4. Betaine (2 M) + 10% dimethyl sulfoxide (DMSO; solution with sterile water). 

5. Bovine serum albumin (BSA; 125 µg/mL solution with sterile water). 

6. dNTP-mix composed according to the sequence amplified (e.g., for HUMVWA31/A with 

a A/TG/C ratio of 1.91, a stock of 121 µM each of dGTP, dCTP, and 220 µM each of 

dATP and dTTP were used). 

3. Methods 

Each of the following variations of a standard PCR amplification protocol resulted 

in reduced accumulation of shadow bands. They might be applied either soldiery or 

in any combination. 

3.1. Denaturation Time 

A reduction of denaturation time to 15 to 30 s results in a 28% decrease in shadow 

bands compared with the standard denaturation time of 1 min by decreasing the 

occurrence of additional degradation of the template DNA (cf. ref. 22) because of the 

shorter incubation period at the high temperature of 94°C. 

3.2. Elongation Step 

Applying an elongation time of 1 min, which is the standard used for synthesis 

of a PCR product up to 1 kb, the lowest intensity of shadow bands was found with 

an elongation temperature of 68°C, resulting in a 20.4% reduction compared with 

the generally applied temperature of 72°C. This reduction could be even increased to 

24.7% by doubling the time for synthesis. The highest reduction of the generation of 

this artefact (–30.9%) could be achieved with an elongation at 70°C for 2 min. 

3.3. Polymerase and Composition of Reaction Buffer 

Comparing different polymerases and polymerase mixes respective, the lowest 

intensity of shadow bands was observed with InViTAQ ® (Invitek) and the CombiPoil ® 

polymerase mix (Invitek) in combination with OptiPerform Buffer (Invitek) with 

a reduction of the artefact by up to 24 and 21.4% compared with AmpliTaq Gold 

(Perkin–Elmer) in combination with GeneAmp ® buffer (Perkin–Elmer). Applying 

InViTaq, a replacement of the generally used KCl-reaction buffer, by an optimized 

NH 4 buffer resulted in a 22% reduction in artefact accumulation applying the same 

polymerase. Further differences of the two buffer systems consist in a slightly elevated 

pH value of 8.8 (+0.5) and an addition of 0.01% Tween-20 in case of the NH 4 buffer. 

The use of a polymerase displaying a 3′→5′ exonuclease proof-reading ability 

showed no positive effects concerning the reduction of shadow band accumulation, 

neither applied alone, nor in combination with a Taq polymerase.


3.4. A/TG/C Ratio of the dNTP-Mix 

Changing the composition of the dNTP-mix from the usual equimolar concentration 

of nucleotides to a A/TG/C ratio of 1.91 corresponding to the composition of 

the general sequence of HUMVWA31/A, the locus amplified, resulted in a decrease 

in shadow band generation by 7.3%. Changes in amplification efficiency were not 

observed, neither in processing modern nor ancient DNA. Equability of the amplification 

of both alleles belonging to a heterozygous genotype was slightly improved. 

3.5. Betaine (N,N,N-trimethyl glycine) 

The presence of betaine in a concentration of 0.5 to 2 M reduced the accumulation 

of shadow bands, with a maximum reduction of 15.5% at 0.5 M. Concentrations lower 

than 0.5 showed an increase in artifact production. Concerning the amplification of 

ancient DNA, low concentrations of betaine (0.25–1 M) resulted in an increase in 

product yield because of the neutralizing effect of this reagent against inhibitory 

substances (cf. ref. 23) frequently present within ancient DNA extracts. Beyond 1.5 M, 

an addition of the inhibitory effect of betaine at elevated concentrations (24) and the 

inhibition caused by co-extracted impurities occurred, resulting in partial inhibition 

of amplification. 

3.6. Betaine Combined with DMSO 

Like betaine, low concentrations of both betaine and DMSO resulted in a slight 

increase in intensity of shadow bands. A reduction of the artifact was observed at 

concentrations of 0.4 to 1 M betaine combined with 2 to 5% DMSO, with a maximum 

decrease of shadow band intensity by 12.6% at 0.8 M betaine and 4% DMSO. In 

ancient DNA amplifications, the presence of these reagents increased product yield and 

reproducibility between multiple amplifications of the same sample (see Note 1). 

3.7. BSA 

The addition of BSA in a concentration of 10 to 25 µg/mL resulted in reduced 

intensity of artifact bands with a maximum at 25 µg/mL by 21.2% accompanied by an 

increased equability of amplification of a heterozygote genotype. In addition to this, 

the presence of BSA showed to increase the efficiency of ancient DNA amplifications 

by neutralizing inhibitory substances (25) that consequently resulted in higher yield 

of specific product. A concentration of 25 to 50µg/mL was determined as optimal for 

the amplification of ancient DNA. 

4. Notes 

1. Also investigated concerning their impact in the generation of shadow bands were further 

reagents commonly used as PCR-enhancing additives, such as DMSO, glycerol, and 

formamide. In amplifications of the locus concerned the addition of DMSO, as well as 

formamide in different concentrations resulted in an increase in shadow band accumulation. 

Glycerol, however, did not show any effect, neither on modern, nor ancient DNA 

amplification.

312 Schmerer 

References 

1. Kunkel, T. A. (1993) Nucleotide repeats. Slippery DNA and diseases. Nature 365, 

207–208. 

2. Levison, G. and Gutman, G. A. (1987) Slipped-strand mispairing: a mayor mechanism for 

DNA sequence evolution. Mol. Biol. Evol. 4, 203–221. 

3. Schlötterer, C. and Tautz, D. (1992) Slippage synthesis of simple sequence DNA. Nucleic 

Acids Res. 20, 211–215. 

4. Weber, J. L. and May, P. E. (1989) Abundant class of human polymorphisms which can be 

typed using the polymerase chain reaction. Am. J. Hum. Genet. 44, 388–396. 

5. Bluteau, O., Legoix, P., Laurent-Puig, P., and Zucman-Rossi, J. (1999) PCR-based genotyping 

can generate artifacts in LOH analyses. BioTechniques 27, 1100–1102. 

6. Gill, P., Sparkes, R., and Kimpton, C. (1997) Development of guidelines to designate alleles 

using a STR multiplex system. Forensic Sci. Int. 89, 185–197. 

7. Schmerer, W. M., Hummel, S., and Herrmann, B. (1997) Reproduzierbarkeit von aDNAtyping. 

Anthrop. Anz. 55, 199–206. 

8. Ivanov, P. L. and Isaenko, M. V. (1999) Identification of human decomposed remains 

using the STR systems: effect on typing results, in Proceedings of the second European 

symposium on human identification 1998. Promega Corporation, Innsbruck, Austria. 

9. Fourney, R. M., Fregau, C. J., Bowen, J. H., Bowen, K. L., Shutler, G. G., Elliot, J. C., et al. 

(1995) Interpretation guidelines for fluorescent automated detection of STRs: Defining the 

allele and the limits of detection, in Proceedings from the Sixth International Symposium on 

Human Identification 1995. Promega Corporation, Innsbruck, Austria. 

10. Murray, V., Monchawin, C., and England, P. R. (1993) The determination of the sequences 

present in the shadow bands of a dinucleotide repeat PCR. Nucleic Acids Res. 21, 

2395–2398. 

11. Kimpton, C., Fisher, D., Watson, S., Adams, M., Urquhard, A., Lygo, J., et al. (1994) 

Evaluation of an automated DNA profiling system employing multiplex amplification of 

four tetrameric STR loci. Int. J. Leg. Med. 106, 302–311. 

12. Lygo, J. E., Johnson, P. E., Holaway, D. J., Woodroffe, S., Whitaker, J. P., Clayton, T. M., 

et al. (1994) The validation of short tandem repeat (STR) loci for use in forensic casework. 

Int. J. Leg. Med. 107, 77–89. 

13. Ramos, M. D., Lalueza, C., Girbau, E., Perez-Perez, A., Quevedo, S., Turbon, D., et al. 

(1995) Amplifying dinucleotide microsatellite loci from bone and tooth samples of up to 

5000 years of age: More inconsistency than usefulness. Hum. Genet. 96, 205–212. 

14. Schultes, T., Hummel, S., and Herrmann, B. (1997) Recognizing and overcoming inconsistencies 

in microsatellite typing of ancient DNA samples. Ancient Biomol. 1, 227–233. 

15. Schmerer, W. M. (1996) Reproduzierbarkeit von Mikrosatelliten-DNA-Amplifikation und 

Alleldetermination aus bodengelagertem Skelettmaterial. Unpublished diploma-thesis, 

Göttingen. 

16. Taberlet, P., Griffin, S., Goossens, B., Questiau, S., Manceau, V., Escaravage, N., et al. 

(1996) Reliable genotyping of samples with very low DNA quantities using PCR. Nucleic 

Acids Res. 24, 3189–3194. 

17. Schmerer, W. M., Hummel, S., and Herrmann, B. (1999) Optimized DNA extraction to 

improve reproducibility of short tandem repeat genotyping with highly degraded DNA as 

target. Electrophoresis 20, 1712–1716. 

18. Schmerer, W. M., Hummel, S., and Herrmann, B. (2000) STR-genotyping of archaeological 

human bone: Experimental design to improve reproducibility by optimisation of DNA 

extraction. Anthrop. Anz. 58, 29–35. 

19. Schmerer, W. M. (2000) Optimierung der STR-Genotypenanalyse an Extrakten alter DNA 

aus bodengelagertem menschlichen Skelettmaterial. Cuvillier Verlag, Göttingen.


20. Kimpton, C. P., Walton, A., and Gill, P. (1992) A further tetranucleotide repeat polymorphism 

in the vWF gene. Hum. Mol. Genet. 1, 287. 

21. Bacher, J. and Schumm, J. W. (1998) Development of highly polymorphic pentanucleotide 

tandem repeat loci with low stutter. Profiles DNA 2, 3–6. 

22. Cheng, S., Fockler, C., Barnes, W. M., and Higuchi, R. (1994) Effective amplification of 

long targets from cloned inserts and human genomic DNA. Proc. Natl. Acad. Sci. USA 

91, 5695–5699. 

23. Baskaran, N., Kandpal, R. P., Bhargava, A. K., Glynn, M. W., Bale, A., and Weissman, S. M. 

(1996) Uniform amplification of a mixture of deoxyribonucleic acids with varying GC 

content. Genome Res. 6, 633–638. 

24. Weissensteiner, T. and Lanchbury, J. S. (1996) Strategy for controlling preferentiual 

amplification and avoiding false negatives in PCR Typing. Biotechniques 21, 1102–1108. 

25. Pääbo, S., Gifford, J. A., and Wilson, A. C. (1988) Mitochondrial DNA sequences from a 

7000-year old brain. Nucleic Acids Res. 20, 9775–9787.

314 Schmerer

DOP-PCR 315 

45 

Degenerate Oligonucleotide-Primed PCR 

Michaela Aubele and Jan Smida 


The amount of genomic DNA available for genetic studies can often be limiting. 

Degenerated oligonucleotide-primed polymerase chain reaction (DOP-PCR) is an 

appropriate method for overcoming these limitations by efficiently performing whole 

genome amplification. The DOP-PCR technique is increasingly being applied for 

simultaneous amplification of multiple loci in target DNA using oligonucleotide 

primers of partially degenerate sequences (1). Contrary to other PCR-based general 

amplification methods (Alu-PCR or IRS-PCR), DOP-PCR is a species-independent 

technique for the amplification of small amounts of DNA. 

Briefly, the use of one single degenerated primer allows random initial priming all 

over the target DNA during the first five cycles of PCR at low annealing temperatures. 

In subsequent cycles, more stringent conditions are then used to amplify the first PCR 

products. DOP-PCR technique is recently being applied to produce sufficient amounts 

of DNA from clinical tumor samples, in forensic analyses, prenatal diagnosis, and 

many other investigations. Slightly different protocols have been used and optimized 

worldwide. The protocol described here is adapted for use with microdissected, 

formalin-fixed, paraffin-embedded human tissue in comparative genomic hybridization 

analysis. A comparison of several DOP-PCR variations is also given by Larsen 

et al. (2). 

2. Materials 

2.1. Deparaffination and Sampling of Material 

1. Xylene (100%). 

2. Ethanol (100%, 70%, 50%). 

3. Distilled water. 

4. Mayer’s Hemalaun solution (Merck 109 249, Darmstadt, Germany). 

5. Laser buffer: 100 mM Tris-HCl, pH 7.5. 

6. Proteinase K: 10 mg/mL proteinase K, pH 7.5 (Merck, Darmstadt, Germany). 

7. Qiagen DNA Mini Kit (Qiagen, Hilden, Germany). 



315

316 Aubele and Smida 

2.2. Chemicals Required for DOP-PCR 

1. DOP-primer: 5′- CCG ACT CGA GNN NNN NAT GTG G - 3′, with N = A, C, G, or T in 

approx equal proportions, (Biometra, Göttingen, Germany). 

2. Topoisomerase I (Life Technologies, Eggenstein, Germany). 

3. Taq DNA Polymerase (Perkin–Elmer Life Sciences, Maryland). 

4. DNTPs (10 mM each of dATP, dCTP, dGTP, and TTP; Sigma-Aldrich, Steinheim, 

Germany). 

5. 10× amplification buffer: 500 mM KCl, 200 mM Tris-HCl, pH 8.4. 

6. 50 mM MgCl 2 . 

3. Method 

3.1. Preparation of Tumor Samples 

1. Dewax 5- to 10-µm thick paraffin sections for 30 min in a Coplin jar with Xylene. 

2. Transfer slides to a coplin jar with fresh xylene for 5 min. 

3. Transfer slides to a Coplin jar with 100% EtOH for 5 min. 

4. Transfer slides to a coplin jar with 70% EtOH for 5 min. 

5. Transfer slides to a coplin jar with 50% EtOH for 5 min. 

6. Transfer slides to a coplin jar with distilled water for 5 min. For sampling of small lesions 

or even single cells by microdissection, see chapter 2.1.3 

3.2. DOP-PCR Procedure (see Note 1) 

An optional Topoisomerase step may be performed (see Note 2). 

1. Prepare PCR mix (50-µL volume, see Note 3): 

Template 

Pretreated cell sample in 20 µL of laser 

buffer or up to 100 ng isolated DNA 

Primer 6-MW (0.1 nmol/µL, see Note 4) 1.0 µL 

10× amplification buffer 5.0 µL 

MgCl 2 3.4 µL 

dNTP (40 mM) 1.2 µL 

Taq Polymerase (5 U/µL) 0.8 µL 

H 2 O Fill up to final volume of 50 µL 

2. Set up cycler conditions: Start PCR in a thermal cycler in a 50-µL reaction volume using 

the following conditions (see Note 5). 

Denaturation 10 min at 94°C 

Followed by five cycles: 11 min at 94°C 

(Low stringency) 11.3 min at 30°C 

13 min transition 30–72°C 

13 min extension at 72°C 

Followed by 35 cycles: 11 min at 94°C 

(High stringency) 11 min at 62°C 

13 min at 72°C 

Final extension 10 min at 72°C 

3. Store PCR product at –20°C or continue to next step. 

4. Use a 5-µL aliquot of the PCR product to check the DNA fragment size on a 3% agarose 

ethidium bromide gel (see also Fig. 1), 

5. Determine DNA amounts by fluorometric or photometric measurements.

DOP-PCR 317 

Fig. 1. DOP-PCR products reveal a typical smear ranging from about 100 to 2500 bp. Lane 1: 

marker pBR 322, HaeIII; lane 2: positive control (PCR product with template DNA and a 

gene-specific primer (β-Actin); lane 3: negative control (PCR product without template and 

with degenerate primer); lane 4: empty; lanes 5 to 9: DNA samples from formalin-fixed, 

paraffin-embedded tissue that were amplified by DOP-PCR. 

4. Notes 

1. As in all preparations that require handling of small cell and/or small DNA amounts, the 

PCR mix should be set up in a laminar flow to avoid any contamination. Furthermore, 

because of the species-independent primer, a strict contamination-free working is 

prerequisite. 

2. Tumor samples may be pretreated for 30 min with 2 units Topoisomerase I at 37°C to relax 

the template DNAs. Stop activation of topoisomerase at 90°C for 10 min and chill on 

ice, then add Taq DNA Polymerase and start PCR. This additional step is recommended 

for isolated fresh material but is not necessary for degraded DNA, as is the case for 

formalin-fixed, paraffin-embedded tissue. 

3. All PCRs should be controlled for possible contamination by using at least one negative 

control (vial without template DNA), and one positive control (vial with template DNA 

and a gene specific primer, e.g., β-actin; Fig. 1). 

4. The most commonly used DOP-PCR primer is 6-MW, originally described by Telenius (1), 

a degenerate primer with 6 specific 3′ bases and a XhoI site at its 5′ end (the same primer 

has been described as UW4B, UN-1, or MTE1 by different authors). 

5. More than 40 cycles in DOP-PCR should be avoided. Based on the authors’ experiences, 

artificial results could arise. For this reason, labeling of DNA should be performed, for 

example, by Nick translation instead of a further DOP-PCR.

318 Aubele and Smida 

References 

1. Telenius, H., Carter, N. C., Bebb, C. E., Nordenskjöld, M., Ponder, B. A. J, and Tunnacliffe, 

A. (1992) Degenerate oligonucleotide-primed PCR: General amplification of target DNA 

by a single degenerate primer. Genomics 13, 718–725. 

2. Larsen, J., Ottesen, A. M., Lundsteen, C., Leffers, H., and Larsen, J. K. (2001) Optimization 

of DOP-PCR amplification of DNA for high resolution comparative genomic hybridization 

analysis. Cytometry 44, 317–325.

Mutation Detection Using RT-PCR-RFLP 319 

46 

Mutation Detection Using RT-PCR-RFLP 

Hitoshi Nakashima, Mitsuteru Akahoshi, and Yosuke Tanaka 


Genetic analysis by restriction fragment length polymorphism (RFLP) is one of 

the most common methods used to examine nucleic acids for the presence of known 

sequence variants. A segment that is to be searched for a mutation is amplified from 

genomic DNA or cDNA, digested by the appropriate restriction enzyme, and then 

separated by agarose gel electrophoresis. Although RFLP analysis is a highly sensitive 

method that is easy to apply for the screening of known sequence variants, many 

common polymorphisms are the result of single-base substitutions that fail to create 

or remove any restriction site and, therefore, these cannot be readily typed by simple 

polymerase chain reaction (PCR) and RFLP analysis. However, the use of a mismatch 

PCR primer to artificially create a restriction site in the amplified product make it 

possible to overcome this disadvantage (1,2). The mismatch primer contains a oneor 

two-base mismatch near its 3′ end such that the amplified product incorporates or 

removes a restriction site for the appropriate endonuclease in the presence of a base 

substitution (3–5). The protocol for this method is the same as standard PCR. 

2. Materials 

1. RNA extracted from cells or tissues of interest. 

2. Primers: stock solutions are at 100 µM in H 2 O; working solutions are at 10 µM in H 2 O. 

The following primer pairs yield a 164-bp amplicon. The sites of mismatch are in capital 

letters (3). Forward mismatch primer: 5′-ctc cta ccc ctt gtc atg cag gAt-3′; reverse primer: 

5′-gtt aaa aca ggg acc tgt ggc atg-3′. 

3. 10× PCR buffer: 500 mM KCl, 100 mM Tris-HCl, pH 8.3. 

4. MgCl 2 (25 mM) in distilled water. 

5. dNTPs (10 mM each of dATP, dGTP, dCTP, and TTP). 

6. RNase inhibitor (20 U/µL). 

7. Random hexamers (50 µM). 

8. MuLV reverse transcriptase (50 U/µL). 

9. AmpliTaq DNA polymerase (5 U/µL; Roche Molecular Systems, Inc. Branchburg, NJ). 

10. Restriction enzyme FokI (10 U/µL) and digestion buffer. 

11. DEPC-treated sterile H 2 O. 

12. Sterile mineral oil. 



319

320 Nakashima, Akahoshi, and Tanaka 


14. PEG-NaCl solution (20% PEG6000, 2.5 M NaCl). 

15. Microcentrifuge tube (0.5 mL). 

16. Microcentrifuge tube (1.5 mL). 

17. Equipment and reagents for 4% agarose gel electrophoresis. 

18. TBE: 89 mM Tris, 89 mM boric acid, and 2 mM EDTA (pH 8.3). 

19. Ethidium bromide (10 µg/mL). 

20. Loading buffer: 0.4% bromophenol blue, 0.4% xylene cyanol FF, 50% glycerol in H 2 O. 

3. Method 

To provide a DNA target for the PCR, cDNA is synthesized using reverse transcriptase. 

1. Place 1 µg of RNA in a 0.5-mL microcentrifuge tube, and add 4 µL of 25 mM MgCl 2 , 

2 µL of 10× PCR buffer, 8 µL of 10 mM dNTP, 1 µL of RNase inhibitor, 1 µL of random 

hexamers, 1 µL of MuLV reverse transcriptase, and DEPC-treated sterile H 2 O to form 

final total volume of 20 µL. 

2. Mix and stand for 10 min at room temperature. Add two drops of mineral oil. Briefly 

spin down the reaction mixture. 

3. Incubate the reaction mixture for 15 min at 42°C, then for 5 min at 99°C, and finally 

for 5 min at 4°C. 

4. Add 4 µL of 25 mM MgCl 2 , 8 µL of 10× PCR buffer, 65.5 µL of sterile H 2 O, 0.5 µL of 

AmpliTaq DNA polymerase, and 1 µL of forward primer (10 µM) and reverse primer 

(10 µM ) to the RT product and mix. Briefly spin down the reaction mix. 

5. Perform the PCR by subjecting the reaction mixture to an initial denaturation of 3 min 

at 94°C, 35 cycles of 1 min at 94°C and 1 min at 60°C, followed by a final extension 

of 7 min at 72°C. 

6. Discard the mineral oil and transfer the PCR product to a 1.5-mL microcentrifuge tube. 

7. Add 60 µL of PEG-NaCl solution to the PCR product. Mix and stand for 10 min at 37°C. 

8. Centrifuge at 12,000g for 10 min at 4°C. 

9. The DNA precipitate should be visible as a pellet at the bottom of the tube. Remove the 

supernatant and wash the pellet with 1 mL of 80% ethanol. 

10. Centrifuge at 7500g for 5 min at 4°C. 

11. Carefully remove all the supernatant and air dry the pellet. 

12. Dissolve the pellet in 100 µL of H 2 O. 

3.1. Restriction Enzyme Digestion 

1. Mix 5 µL of PCR product, 1 µL of 10× reaction buffer, 1 µL of the appropriate restriction 

enzyme (1–10 U), and 3 µL of H 2 O in a 1.5-mL microcentrifuge tube. 

2. Incubate the reaction mixture for more than 2 h at the optimum temperature for enzyme 

activity. 

3.2. Analysis of RFLP 

1. Prepare an appropriate concentration of agarose gel containing 0.2 µg/mL of ethidium 

bromide for electrophoresis with TBE buffer. 

2. Load the gel with 10 µL of digested PCR product mixed with 1 µL of 10× loading buffer, 

5 µL of undigested PCR product mixed with 4 µL of H 2 O, and 1 µL of 10× loading buffer 

and a DNA size standard. 

3. Perform electrophoresis and inspect the gel under an ultraviolet transilluminator (Fig. 1).

Mutation Detection Using RT-PCR-RFLP 321 

Fig. 1. G88A within IFNGR1 is detected by FokI digestion of the PCR product using a 1-bp 

mismatch primer. The upstream primer contains a 1-bp mismatch just proximal to its 3′ end 

such that the 164-bp amplified product incorporates a restriction site for FokI in the presence of 

guanine at nucleotide 88 (a allele) but not in the presence of adenine (b allele). A PCR product 

of genotype ab is cleaved by endonuclease FokI and shows three bands, 164, 130, and 34 bp, on 

the ethidium bromide-stained 4% agarose gel. 

Lowercase nucleotides represent the mismatch base. Underlined nucleotides represent the 

polymorphism site. Line 1: Part of the registered IFNGR1 cDNA sequence; line 2: the upstream 

primer for mismatch PCR; line 3: restriction enzyme Fok I recognition site. 

4. Notes 

We were searching for amino acid polymorphisms in cytokine receptors. At first 

we used the RT-PCR SSCP method for cDNA sequence. After confirmation of the 

base substitutions of SSCP-positive samples, we designed primers for population 

screening by RFLP analysis. Although RT-PCR RFLP is an easy and sensitive method 

for examining whether an already-known base substitution is present within the sample 

cDNA, there are some disadvantages involved. Concerning RT-PCR, the various kinds 

of amplicons resulting from alternative splicing could prove to be an obstacle for 

analysis. If the genomic DNA sequence is available, then analysis using PCR products 

templated with genomic DNA is recommended. Changing the primer setting position 

would be another solution. Concerning RFLP, this analysis is based on the fact that 

each restriction enzyme recognizes a specific DNA sequence, and incomplete digestion 

leads to a false-negative result. The causes of incomplete digestion are low enzyme 

activity (in cases with long-term usage of the restriction enzyme), an extremely 

small quantity of the enzyme compared with that of the DNA sample, reaction under 

the wrong conditions, and the use of the wrong reaction buffer. Performance of the

322 Nakashima, Akahoshi, and Tanaka 

same reactions using positive and negative control templates in parallel with sample 

examinations is recommended in order to check for incomplete digestion. 

References 

1. Russ, A. P., Maerz, W., Ruzicka, V., Stein, U., and Gross, W. (1993) Rapid detection of 

the hypertension-associated Met235-Thr allele of the human angiotensinogen gene. Hum. 

Mol. Genet. 2, 609–610. 

2. Hingorani, A. R. and Brown, J. M. (1995) A simple molecular assay for the C1166 variant of 

the angiotensin II type 1 receptor gene. Biochem. Biophys. Res. Commun. 213, 725–729. 

3. Tanaka, Y., Nakashima, H., Hisano, C., Kohsaka, T., Nemoto, Y., Niiro, H., et al. (1999) 

Association of the interferon-g receptor variant (Val14Met) with systemic lupus erythematosus. 

Immunogenetics 49, 266–271. 

4. Shibata, S., Asano, Y., Yokoyama, T., Shimoda, K., Nakashima, H., Okamura, S., et al. 

(1998) Analysis of the granulocyte colony-stimulating factor receptor gene structure using 

PCR-SSCP in myeloid leukemia and myelodysplastic syndrome. Eur. J. Haematol. 60, 

197–201. 

5. Iwata, I., Nagafuchi, S., Nakashima, H., Kondo, S., Koga, T., Yokogawa, Y., et al. (1999) 

Association of polymorphism in the NeuroD/Beta2 gene with type 1 diabetes in the 

Japanese. Diabetes 48, 416– 419.

ARMS PCR 323 

47 

Multiplex Amplification Refractory 

Mutation System for the Detection 

of Prothrombotic Polymorphisms 



First described by Newton and colleagues in 1989 (1), amplification refractory mutations 

system (ARMS) has become a standard technique that allows the discrimination 

of alleles that differ by as little as 1 bp. The system is simple, reliable, and nonisotopic. 

It clearly distinguishes heterozygotes at a locus from homozygotes for either allele. The 

system requires neither restriction enzyme digestion, nor allele-specific oligonucleotides 

as conventionally applied, nor the sequence analysis of polymerase chain reaction 

(PCR) products. The basis of the system is that oligonucleotides with a mismatched 

3′-residue will not function as primers in the PCR under appropriate conditions. 

A standard ARMS PCR consists of two complementary reactions (two tubes) and 

uses 3 primers. One primer is constant and complementary to the template in both reactions, 

and the other primers differ at their 3′ terminal residues and are specific to either 

the wild-type DNA sequence or the mutated sequence at a given base—only one of these 

primers is used per tube. If the sample is homozygous mutant or homozygous wildtype 

amplification will only occur in one of the tubes, if the sample is heterozygous 

amplification will be seen in both tubes. 

Here, we report our protocol for the multiplex ARMS detection of the polymorphisms 

in clotting factor V and II associated with increased risk of thrombosis (2,3). A portion 

of the factor IX gene is amplified as an internal positive control. 

2. Materials 


2. Plate mixer. 

3. Vertical PAGE system. 

4. Electrophoresis Power Pack. 

5. Thermowell 96-well plate and covers. 

6. Round tips (200 µL). 

7. Flat-cap PCR tubes (0.5 mL). 

8. Thermostable DNA Taq polymerase. 



323

324 Stirling 

9. TAE (20×): 484 g of Tris, 114 mL of glacial acetic acid, 20 mL of 0.5 M EDTA. Dissolve 

in 3 L of distilled water then make up to 5 L with distilled water. 

10. TAE (1×): 120 dilution of 20× TAE in distilled water. 

11. 8% polyacrylamide gel. 

12. dNTPs: supplied separately as four different types at concentrations of 100 mM. For use 

at 5 mM, take 100 µL of each stock dNTP and add to one tube 7600 µL of sterile distilled 

water. Aliquot and store at –20°C. 

Oligo F2 Wild 

5′-CAC TGG GAG CAT TGA GGA TC-3′ 

Oligo F2 Mutant 

5′-CAC TGG GAG CAT TGA GGA TT-3′ 

Oligo F2 Consensus 5′-TCT AGA AAC AGT TGC CTG GC-3′ 

Oligo F5 Wild 

5′-CAG ATC CCT GGA CAG ACG-3′ 

Oligo F5 Mutant 

5′-CAG ATC CCT GGA CAG ACA-3′ 

Oligo F5 Consensus 5′-TGT TAT CAC ACT GGT GCT TAA-3′ 

Oligo F9 Forward 

5′-CTC CTG CAG CAT TGA GGG AGA TGG ACA TT-3′ 

Oligo F9 Reverse 

5′-CTC GAA TTC GGC AAG CAT ACT CAA TGT AT-3′ 

13. Oligonucleotides. The oligonucleotides must be diluted to 100 pmol/µL on arrival. Aliquot 

in 20-µL volumes and store at –20°C. 

3. Methods 

1. Using sterile pipet tips, take 1.0 µL of each sample into identified wells in plate, one 

labeled ‘W’ (wild type), the other ‘M’ (mutant). Ensure that the DNA sample is pipetted 

directly into the bottom of the respective well. 

2. Prepare PCR mastermixes W and M with the following: DNTP (n × 1.5 µL); 10× polymerase 

reaction buffer (n × 2.5 µL); oligonucleotides (each (n × 0.5 µL); MgCl 2 (25 mM; 

(n × 2 µL); Taq polymerase (n × 0.2 µL); Sterile distilled water (n × 15.4 µL); where 

n = number of samples/controls + 2. 

3. Mix mastermixes W and M and add 24 µL to each corresponding well. Cover and seal 

tightly with adhesive film and mix well but carefully by agitation on a plate shaker. 

4. Place plate into thermal cycler and run the following program: 94°C for 5 min (94°C for 15 s, 

55°C for 15 s, 72°C for 30 s × 35 cycles), and 72°C for 10 min. 

5. When cycles are complete, add 4 µL of loading buffer to each sample well and agitate 

to mix. 

6. Load samples (approx 20 µL) into the wells of an 8% polyacrylamide gel in the vertical 

electrophoresis unit and electrophorese at 250 volts for approx 1.25 to 1.5 h along with a 

strategically placed molecular weight marker. 

7. Remove gel from tank and stain for 2 to 5 min in discarded buffer from upper tank 

containing 20 µL of ethidium bromide solution. 

8. Interpretation. 

The amplification generates three fragments: Prothrombin (F.II), 340 bp; Factor IX 

(control), 250 bp; and Factor V, 174 bp. Each set of two tubes, wild type and mutant, 

will show bands in the pattern below depending upon the allele detected. 

Wild type 

Mutant 

Homozygous negative – 

Heterozygous – – 

Homozygous positive – 

The Factor IX control fragments must be present in both the wild and mutant tubes 

to interpret the P20210A and V Leiden status. Specimens should be reanalyzed if be

ARMS PCR 325 

repeated if (1) the Factor IX control bands are not present; (2) other control specimens 

are not as expected; (3) the result is homozygous/heterozygous positive; (4) any dubiety 

exists with the overall interpretation. 

4. Notes 

1. Extreme care should be exercised to prevent the possibility of cross-contamination of 

samples with amplified DNA. 

2. PCR setup should be performed in a physically separated area from product analysis. 

3. Samples of known genotype (heterozygous and homozygous negative) should be analyzed 

along with unknowns. 

References 

1. Newton, C. R., Graham, A., Heptinstall, L. E., Powell, S. J., Summers, C., Kalsheker, N., 

et al. (1989) Analysis of any point mutation in DNA. The amplification refractory mutation 

system (ARMS). Nucleic Acids Res. 17, 2503–2516.

326 Stirling

PCR-SSCP Analysis of Polymorphism 327 

48 

PCR-SSCP Analysis of Polymorphism 

A Simple and Sensitive Method for Detecting Differences 

Between Short Segments of DNA 

Mei Han and Mary Ann Robinson 


Polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) 

(1) is a simple method that allows one to rapidly determine whether there are sequence 

differences between relatively short stretches of DNA. Coupled with sequence analysis, 

SSCP is an extremely useful method for both identifying and characterizing genetic 

polymorphisms and mutations. The theory of SSCP is that the primary sequence and 

the length of a single stranded DNA fragment determine its conformation when it is 

resolved in a nondenaturing polyacrylamide gel. Even single-base differences can cause 

different secondary conformations and thus result in different migration rates of the 

DNA strands. Radioactive nucleotides are incorporated into the DNA strands by PCR, 

making it possible to detect the DNA by autoradiography. SSCP has been widely used 

to identify mutations in host genes such as p53 (2–5) and in viruses, such as simian 

immuno-deficiency virus (SIV), during the course of infection (6). SSCP has been used 

to identify and characterize polymorphisms in a variety of genes (7–9) and was effective 

in characterizing alleles of linked genes present in individual sperm (10). 

Orita and colleagues (11) developed the SSCP method in 1989 and since then, it has 

been applied to screen for sequence differences in either genomic or complementary 

DNA (cDNA) samples. Figure 1 schematically shows the steps of the procedure. First, 

the region of interest (the gene or cDNA) can be PCR amplified by using primers 

corresponding to the desired sequence. Because migration differences are better 

resolved using shorter DNA fragments, success is more likely with primers selected 

to amplify fragments in 100- to 300-bp range. The PCR mixture contains 32 P-dCTP 

to radioactively label the amplification product, which is important for visualizing the 

migration differences in later steps of the procedure. The second step is to heat diluted 

amplified samples, which will denature the double-stranded DNA into single-stranded 

DNA. The samples are mixed with loading buffer containing formamide to hinder 

reannealing of the DNA and dye to visually follow the migration of samples through 

the gel. The third step is to resolve the single-stranded DNA samples by nondenaturing 

polyacrylamide gel electrophoresis. The length of time necessary for running the 



327

328 Han and Robinson 

Fig. 1. Basic steps in SSCP Procedure. 1. The DNA or cDNA fragment of interest is amplified 

by PCR incorporating 32 P-dCTP. 2. The PCR amplified-labeled DNA fragment is denatured 

by heating. 3. Fragments are separated on an acrylamide gel. 4. Patterns are revealed by 

autoradiography. 

gel is variable, dependent upon characteristics of the sequence amplified, and can be 

determined empirically. The final step is autoradiography to visualize the bands of 

radiolabeled DNA in the gel. 

Analysis of SSCP autoradiograms is performed visually. Each sequence amplified 

in step one will often result in two bands on a corresponding autoradiogram. One band


Fig. 2. Sample SSCP pattern. The human CD1a gene has two alleles. The DNA sample in 

band A derived from an individual homozygous for allele 1, in lane B from a heterozygous 

individual, and in lane C from an individual homozygous for allele 2. In this example, one of the 

DNA strands assumes two different conformations as it migrates through the gel and results in two 

bands. Notice the intensity of the top band compared with the lower bands showing that the top 

band corresponds to one strand in one conformation and the lower bands to two conformations 

for one strand. The pattern of the heterozygote is a composite of the homozygous patterns. The 

single-stranded DNA patterns are shown in this figure. Double-stranded DNA corresponding to 

nondenatured PCR product would be found migrating more rapidly on the gel. 

corresponds to the upper strand of DNA and the other the lower strand of the amplified 

fragment. It is also possible for a segment of single-stranded DNA to assume two 

different conformations as it migrates through the gel, and this will result in two bands 

for that strand of DNA on a SSCP autoradiogram. Examples of such SSCP patterns are 

shown in Fig. 2. There are two alleles of the human CD1a gene (9). DNA samples in 

lane A derives from an individual homozygous for allele 1, in lane C, the DNA is from 

an individual homozygous for allele 2, and in lane B the DNA is from an individual 

heterozygous for alleles 1 and 2. The bands corresponding to alleles 1 and 2 migrate 

at different rates, and each has one strand that assumes two different conformations. 

The pattern for a heterozygous individual is the composite of the two individual 

allele’s patterns. 

It was possible to make determinations about the assignment of CD1a alleles because 

the analysis was coupled with sequence analysis. To obtain material for sequencing, 

the same reaction mixture as used for the SSCP procedure is amplified using an 

amplification buffer that does not contain radioactivity for cloning. Many systems are 

commercially available for cloning and sequence analysis. In addition, SSCP bands 

can be excised from the gel and re-PCR amplified using the same set of primers, which 

provides a very convenient way to directly sequence the altered gene segment. 

A successful approach to screen for genetic polymorphisms has been to examine 

DNA samples from 10 unrelated individuals of diverse ethnic backgrounds. Genetic 

polymorphism is likely to be found in such a sampling; however, this does depend upon 

allele frequencies and distributions. Although SSCP is quite efficient in identifying


sequence differences between two segments of DNA, there are cases where differences 

are difficult to detect. Changing primers may make a difference. It is possible that the 

specific fragment will not show migration differences even if there are substitutions 

present. Analysis of overlapping fragments of the region of interest is one solution 

to circumvent this difficulty. 

The techniques required for the SSCP method are not complicated, and the whole 

procedure is time saving (only one-round PCR is needed) compared with other methods 

for detecting mutations and DNA polymorphisms. Because of its simplicity and 

reliability, PCR-SSCP has been used extensively for identifying alleles and genotypes 

in both basic and clinical investigations. 

2. Materials 

1. Thermal cycling (PCR) machine. 

2. AmpliTaq ® DNA polymerase, 5 U/µL (stored at –20°C). 

3. 10× PCR buffer stored at –20°C): 100 mM Tris-HCl, pH 8.3, 500 mM KCl, 15 mM 

MgCl 2 . 

4. dNTP (1.25 mM) stored at –20°C. 

5. Primers diluted to a concentration of 20 µM (see Note 1). 

6. [α 32 P]-dCTP (New England Nuclear, Boston, MA, BLU013H, 3000 Ci/mmol). 

7. DNA templates (100 ng/µL genomic or 110 diluted cDNA). 

8. 0.1% SDS and 10 mM EDTA, pH 8.0. 

9. Loading buffer: 10 mM NaOH, 95% formamide, 0.05% bromphenol blue, 0.05% xylene 

cyanol. 

10. Long Ranger 50% stock gel solution (FMC BioProducts, Rockland, ME; see Note 2). 

11. 10× TBE buffer: 0.89 M Tris-borate; 0.02 M EDTA, pH 8.0. 

12. TEMED. 

13. 10% Ammonium Persulphate (APS, after dissolving in water, store at –20°C). 

14. Glycerol (Ultra Pure, Life Technologies, Gaithersburg, MD). 

15. Sigmacote (Sigma Chemical Co., St. Louis, MO). 

16. Acrylamide gel electrophoresis supplies and equipment (see Note 3). 

17. Whatman 3MM chromatography paper. 

18. Plastic wrap (such as Saran Wrap). 

19. Vacuum gel dryer. 

20. Gel cassette with an enhancing screen. 

21. X-ray films. 

22. Lab safety area for working with radioactive materials (see Note 4). 

3. Methods 

3.1. PCR Amplification (see Note 5) 

The PCR should contain the following ingredients (in µL): 10× PCR Buffer (2.0); 

1.25 mM dNTP (3.2); 20 µM 5′ primer (1.0); 20 µM 3′ primer (1.0); 5 U/µL AmpliTaq ® 

(0.1); Experimental template (2.0); [ 32 P]-dCTP (0.1); and H 2 O (10.6) for a total 

of 20 µL. 

PCR amplification is performed for 30 cycles (denaturation at 95°C for 30 s, annealing 

at 55°C (see Note 6) for 30 s, extension at 72°C for 90 s) with a final extension at 

72°C for 7 min. PCR amplified DNA may be kept at 4°C or stored at –20°C.


3.2. SSCP Gel Preparation 

1. Prepare a 6% nondenaturing polyacrylamide gel with 10% glycerol as following: Long 

Ranger gel solution (7.5 mL), glycerol (7.5 mL), 10× TBE (4.5 mL), H 2 O (55.7 mL); 

10% APS (0.4 mL), and TEMED (0.04 mL) for a total of 73.64 mL. Add TEMED and 

APS right before pouring the gel. 

2. Place a few drops of Sigmacote on the inner side of the shorter plate (see Note 3) and 

spread evenly with a paper towel. Allow to air dry. Sigmocote forms a tight microscopically 

thin film of silicone on glass, which prevents the SSCP gel from sticking to this particular 

plate when you separate the two plates after the gel run is done, allowing the gel to remain 

smooth on the other plate. Set up the plates with 0.4-mm spacers on the sides and with 

a strip of Whatman chromatography paper at the bottom. Clamp three sides of the plates 

leaving the top open. 

3. Immediately before pouring the gel, add TEMED and APS to the mixture, collect it into a 

60-mL syringe, and push the solution into the plates slowly while holding the plates at an 

angle (see Note 7). Place either a 64-well or 36-well comb (see Note 8) into the top of the 

gel and clamp the top of the plates. The gel will be polymerized in 2 h. 

3.3. Dilution and Denaturation of PCR Products (see Note 9) 

1. Dilute 5 µL of amplified DNA in 45 µL of 0.1% SDS and 10 mM EDTA. 

2. Mix 5 µL of above diluted PCR products with 5 µL of loading buffer. The sample is ready 

to load and may be stored at –20°C for 2 wk. 

3.4. Loading Samples and Running Gels 

1. Before running the gel, denature the diluted PCR samples by heating at 95°C for 2 min 

and cool rapidly in an ice bath. 

2. Load 2 µL (for 64-well combs) or 5 µL (for 32-well combs) of the diluted PCR products 

onto gel. The leftover samples can be reused if they have been stored at –20°C for less 

than 2 wk. 

3. Electrophoresis is performed by using 0.6× TBE buffer at a constant 30 watts (W) for 

4 h at room temperature (see Note 10). 

3.5. Drying Gels and Developing Films 

1. After migration, the gel is transferred onto a double layer of Whatman Chromatography 

paper and covered with plastic wrap avoiding air bubbles. 

2. The gel is vacuum dried in a gel dryer at 80°C for 1 h, and then the gel is placed facing 

up in a film cassette. 

3. Expose gel to an X-ray film (the X-ray film should be put in between the enhancing screen 

and the gel) at –80°C for 16 to 20 h (see Note 11). 

4. Warm up film or air dry film before developing. Cut a corner of the film before developing, 

which will help to figure out the sample orders to load. Develop film using an automatic 

film developer or using the dip method. 

3.6. SSCP Gel Analysis 

SSCP patterns are analyzed upon visual examination. Analysis is facilitated with 

knowledge of the gene sequence, which is often available because sequence information 

was necessary to derive primers. Inclusion of control samples of known sequence allow 

allele typing (see Note 12 and Subheading 1.).


4. Notes 

1. PCR-SSCP is a very sensitive method for detecting point mutations in a DNA fragment 

shorter than 300 bp. A single base change may effect the overall conformation more easily 

on small fragments than large fragments. Therefore, primers used in your experiment are 

better designed for amplifying a 100- to 300-bp DNA fragment. If long genomic or cDNA 

segments are to be screened, it is important to find comparable electrophoresis conditions 

in which mutations in long DNA fragments are efficiently detected (see Note 10). If the 

primers used do not allow detection of known substitutions, moving the primer sequence 

further 5′ or 3′ may make it possible to distinguish the fragments. The sequences of the 

oligo primers used to amplify the human CD1a gene, as shown in Fig. 2, are as follows: 

CD1a.ex2F1 AGACGGGCTCAAGGAGCCTC and CD1a.ex2R1 TCCAGTTCCTTC 

CACTCCTC. 

2. Long Ranger stock gel solution contains acrylamide, a neurotoxin, which may cause cancer 

and /or heritable genetic damage. It is advisable to wear gloves while handling. 

3. Acrylamide gel electrophoresis supplies and equipment format used in PCR-SSCP method 

may vary between laboratories. In our laboratory, we use a set of glass plates (44.5 × 37.5 cm 

and 42 × 37.5 cm) and corresponding electrophoresis supplies. Mini-gel format is also 

frequently used by some other investigators and which is often followed by silver-staining 

DNA bands rather than labeling with 32 P. 

4. All procedures involved in dealing with [ 32 P]-dCTP should be performed in a lab safety 

area and handled by behind a protection screen. Radioactive waste should only be thrown 

into specialized trash cans. 

5. The final concentration of 1 µM primer in our PCR amplification provides clear migration 

bands, and we have never failed to detect known mutations using this primer concentration. 

However, it has been reported that lowering the upstream primer concentration improves 

DNA migration. Because the SSCP technique is not 100% effective in detecting any given 

substitution, it might be worthwhile to try lowering upstream primer concentrations if 

known base changes are not detected in your SSCP gel. The template can either be genomic 

or cDNA depending upon your interest. But do not forget to include DNA samples with 

known sequence in your PCR amplification, which will serve as a control SSCP pattern 

for reading allelic distributions of your test samples. 

6. Annealing temperature may vary depending upon the primers used. Usually the annealing 

temperature is determined empirically with estimates made by the following formula: 

[(G + C) × 4] °C + [(A + T) × 2] °C = annealing temperature °C. 

7. Some bubbles may appear between the plates if the plates are not very clean. You can get 

the bubbles out by further angling the plates with one hand and tapping on the plates with 

the other hand until the bubbles are out. 

8. It is important to ensure that the comb is very clean when casting the gel. Leftover 

acrylamide present between the teeth of the comb may cause shorter wells or a gel surface 

that will not hold your samples. 

9. Denaturation of amplified DNA samples can be performed by heating at 95°C or by both 

chemical agents (NaOH) and heating because the denaturation of the fragment to single 

strands is often incomplete. 

10. The optimum balance for band separation versus gel run time depends upon the size 

of amplified DNA fragment. For a DNA fragment around 150 to 300 bp, 4 h would be 

ideal. The migration pattern of a certain single-strand conformer may be improved by 

modification of a number of electrophoresis conditions, including lowering the buffer pH, 

changing the temperature of the gel, or increasing the acrylamide concentration (up to 

15%). Difficulties detecting certain mutations when using the routine protocol may be 

circumvented by adjusting one or more of these three gel conditions.


11. Usually the SSCP patterns can be read clearly after 16- to 20-h exposure. If the migration 

bands are still very weak after exposed for 20 h, exposure time should be prolonged to 

more than 48 h, sometimes even for as long as 2 wk. 

12. SSCP gels are analyzed by observing the pattern of bands resulting on the autoradiograms. 

The number of bands present is dependent upon the sequence amplified. When one 

sequence is amplified, the most simple pattern that can be observed consists of two 

bands, one corresponding to the upper strand of DNA, and the other to the lower strand 

of the amplified fragment. If a segment of single-stranded DNA assumes more than one 

conformation as it migrates through the gel, the result will be multiple bands (equal 

to the number of conformers). Knowledge of the sequence being amplified provides a 

control and a point of reference. Amplification of more than one sequence results in a 

composite pattern of bands corresponding to those of the constituent sequences. A band 

that corresponds to double-stranded DNA may also be visible lower in the gel as doublestranded 

DNA migrates more rapidly. Inclusion of a sample of nondenatured DNA (not 

heated) serves as a marker for double-stranded DNA. 

References 

1. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989) Rapid and sensitive detection of 

point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 

5, 874–879. 

2. Bosari, S., Marchetti, A., Buttitta, F., Graziani, D., Borsani, G., Loda, M., et al. (1995) 

Detection of p53 mutations by single-strand conformation polymorphisms (SSCP) gel 

electrophoresis. A comparative study of radioactive and nonradioactive silver-stained SSCP 

analysis. Diagn. Mol. Pathol. 4, 249–255. 

3. Kurvinen, K., Hietanen, S., Syrjanen, K., and Syrjanen, S. (1995) Rapid and effective 

detection of mutations in the p53 gene using nonradioactive single-strand conformation 

polymorphism (SSCP) technique applied on PhastSystem. J. Virol. Methods 51, 43–53. 

4. Neubauer, A., Brendel, C., Vogel, D., Schmidt, C. A., Heide, I., and Huhn, D. (1993) 

Detection of p53 mutations using nonradioactive SSCP analysis: p53 is not frequently 

mutated in myelodysplastic syndromes (MDS). Ann. Hematol. 67, 223–226. 

5. Ozcelik, H. and Andrulis, I. L. (1995) Multiplex PCR-SSCP for simultaneous screening for 

mutations in several exons of p53. Biotechniques 18, 742–744. 

6. Campbell, B. J. and Hirsch, V. M. (1994) Extensive envelope heterogeneity of simian 

immunodeficiency virus in tissues from infected macaques. J. Virol. 68, 3129–3137. 

7. Barron, K. S., Reveille, J. D., Carrington, M., Mann, D. L., and Robinson, M. A. (1995) 

Susceptibility to Reiter’s syndrome is associated with alleles of TAP genes. Arthritis 

Rheum. 38, 684–689. 

8. Barron, K. S. and Robinson, M. A. (1994) The human T-cell receptor variable gene segment 

TCRBV6S1 has two null alleles. Hum. Immunol. 40, 17–19. 

9. Han, M., Hannick, L. I., DiBrino, M., and Robinson, M. A. (1999) Polymorphism of human 

CD1 genes. Tissue Antigens 54, 122–127. 

10. Day, C. E., Schmitt, K., and Robinson, M. A. (1994) Frequent recombination in the human 

T-cell receptor beta gene complex. Immunogenetics 39, 335–342. 

11. Orita, M., Iwahana, H., Kanashi, H., and, Sekiya, T. (1989) Detection of polymorphisms of 

human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. 

Natl. Acad. Sci. USA 86, 2766–2770.

334 Han and Robinson

Sequencing 337 

49 

Sequencing 




The huge advances that have been made in human (and other species) genome 

projects have been lead by, and have themselves fueled, tremendous innovations in 

the field of sequencing. These innovations have lead to a specialization, with very 

expensive equipment, often in core sequencing centers or services. Until the cost of 

automated sequencing equipment falls considerably, the economics of scale mean that 

unless an investigator has a huge amount of sequencing to perform, they are most likely 

to be best served by using these services rather than by investing in the technology 

themselves. There is always a temptation in such situations to treat the sequencing as a 

black box, without worrying too much how the data are generated. This is a mistake. A 

clear understanding of the principals involved will not only aid the design of sequencing 

strategies but will also help in the interpretation of less than perfect data. 

DNA/RNA sequence analysis has become fundamental to the understanding of 

biological processes. The foundations of this science were established in 1977 when 

Maxam and Gilbert (1) described a method for sequencing by base-specific chemical 

cleavage. Subsequently, Sanger and co-workers (2) developed a method for enzymatic 

sequencing using chain terminators. Both techniques produce populations of labeled 

DNA fragments that can be electrophoretically resolved to reveal the base sequence. 

Many different strategies have been developed to improve on these initial approaches 

and to make genome-sequencing projects feasible; all owe a great debt to those original 

protocols. 

2. Chemical DNA Sequencing 

In the original Maxam-Gilbert method of DNA sequencing, target DNA is radioactively 

labeled at one end (3′or 5′ end), which acts as the reference point for determining 

the positions of the remaining bases. This labeled DNA is processed with four basespecific 

reactions. First, a base-specific chemical modification, then a chain cleavage 

of modified bases. 

These methods have fallen from popularity, both because of the toxicity of the 

reagents (dimethyl sulphate, hydrazine, potassium permanganate) and the development 



337

338 Stirling 

of simple and improved methods for enzymatic DNA. Although the chemical method 

is not widely used as the enzymatic method, it has some advantages and can be very 

useful in certain situations. Because it does not rely on the hybridization of a primer, 

very short sequences, such as oligonucleotides, can be analyzed. It is also useful 

for analyses of DNA modifications, such as methylation, and to study DNA–protein 

interactions (footprinting). 

3. Enzymatic DNA Sequencing 

Dideoxy sequencing reactions (Sanger method) are essentially primer extension 

reactions where ddNTPs are included in the mix. In the conventional dideoxy sequencing 

reaction, an oligo primer is annealed to a single-stranded DNA template and 

extended by DNA polymerase to synthesize a complementary copy of single-stranded 

DNA in the presence of four dNTPs, one of which is 35 S-labeled. Chain growth involves 

the formation of a phosphodiester bridge between the 3′-OH at the growing end of 

the primer and the 5′-phosphate group of the incorporated dNTP. Thus, overall chain 

growth is in the 5′→3′ direction. The reaction also contains one of four ddNTPs that 

terminate elongation when incorporated into the growing DNA chain. When a ddNTP 

is incorporated at the 3′ end of the growing primer chain, the elongation is terminated 

selectively at A, C, G, or T owing to the missing 3′ OH group of the primer chain. The 

enzymatic method is based on the ability of DNA polymerase to use both 2′ dNTPs and 

2′,3′ ddNTPs as substrates. After completion of the sequencing reactions, the products 

are subjected to electrophoresis on a high-resolution denaturing polyacrylamide gel 

and then autoradiographed to visualize the DNA sequence. 

For this form of sequencing, the purity and concentration of the template has to be 

very carefully controlled, and the template has to be rendered single stranded before 

the reaction will proceed. To reliably obtain good quality sequence from PCR products, 

these would first have to be cloned into a suitable vector. Any clone obtained is the 

product of a single molecule of PCR product, and so the likelihood of that sequence 

containing misincorporated bases is relatively high. Multiple clones have therefore to 

be sequenced to produce reliable data. 

4. Cycle Sequencing 

The introduction of thermostable DNA polymerase had the same revolutionary 

impact on sequencing protocols as in other areas (3). The ability to function at higher 

temperature resulted in template remaining single stranded for longer periods, overcame 

many problems of secondary structure, and allowed more stringent primer annealing 

conditions resulting on less background noise in sequencing data. In addition, repeated 

cycles of primer annealing and extension amplifies (linearly rather than exponentially as 

for PCR) even small amounts of sample DNA to generate more template. The ability to 

sequence very low template concentrations means that even relatively impure material, 

such as PCR products, can be used, simply by diluting out the impurities. 

5. Automation 

One of the major advances in sequencing technology has been the development of 

automated DNA sequencers, which automate the gel electrophoresis step, detection of 

band pattern, and analysis of bands. These machines are based on the enzymatic, cycle

Sequencing 339 

sequencing approach and use fluorescent rather than radioactive labels. This has the 

advantages of greater safety, generation of machine-readable data, and greater reagent 

stability. The downside of this is the relative expense of the equipment required. 

Fluorescent dyes can be incorporated as labeled primers, dNTPs. or ddNTPs. The use 

of four different dyes, one for each of the ddNTPs (dye terminator sequencing), has 

allowed one of the biggest improvements in throughput of these systems. Now, rather 

than the base-specific reactions being kept separate and run down individual lanes 

of a gel, they can be performed in the same reaction tube and analyzed in one lane, 

with fragments being separated by size and distinguished by the wavelength of the 

fluorescent emission. Automated sequencers based on capillary electrophoresis have 

been developed, which dispense with the gel-making step. Many specialized centers 

now use robotic systems to extract DNA template, perform PCR and sequencing reactions, 

and load 96-capillary sequencers. Sequence data generated can then be directly 

imported into databases and processed with little or no hands-on intervention. 

These developments still continue. Research is under way to develop the technology 

of mass spectrometry for DNA sequencing, and sequencing by hybridization is the 

subject of a great deal of development work. 

6. Direct Sequencing of PCR Products 

Unlike methods where the PCR product is cloned and a single clone is sequenced, 

direct sequencing of PCR products is usually unaffected by the relatively high error 

rate of Taq DNA polymerase because (unless there are only a few starting copies of 

template, and a misincorporation occurs in an early round of PCR) the vast majority of 

the amplified product will consist of the correct sequence. 

Direct sequencing of PCR products has significant advantages over the cloning 

strategy. It is a simple procedure that can be easily standardized and only a single 

sequence needs to be determined for each sample. Indeed, the procedures are so well 

standardized that there has been an exponential growth in the number of laboratories 

offering core-sequencing services for PCR products. Although the majority of such 

core laboratories provide an excellent service, there are a number of factors that will 

affect their ability to produce good quality data. 

7. Requirements for Good Quality Sequence from PCR Products 

• Optimize the PCR reaction to yield only a single product. If the same oligos are used 

to sequence as primed the PCR, they will also sequence from any nonspecific products, 

interfering with data quality. Primer-dimers may not interfere with the identification of 

a PCR product on agarose gel electrophoresis, but they serve as efficient template for 

sequencing, resulting in characteristic noise in sequence data close to the primer. 

• PCR should be performed with as little primer as possible. If labeled dideoxyterminator 

sequencing is used (probably the most common approach), residual PCR primer can serve 

as sequencing primer. Thus, even when only one PCR product is present, it is sequenced 

from each strand simultaneously, again interfering with data quality. There are a number of 

techniques available for the removal of unincorporated primers, from enzymatic digestion 

to column purification, but these are generally unnecessary if the primer concentration 

is limited in the PCR. 

• If PCR products are isolated from a gel prior to sequencing, great care should be taken 

to minimize the amount of salt carried over from the isolation procedure. High-salt

340 Stirling 

concentrations interfere with the processivity of the polymerase reactions, resulting in 

very short read lengths. 

• Primers should only be obtained from reliable sources and should be aliquoted to avoid 

repeated freeze thaw cycles. Any shorter primer species (e.g., n-1), in the PCR primer may 

not affect PCR efficiency. However, if the same primer is used for sequencing, a proportion 

of the fluorescent products will be primed from a shorter oligo. If the missing base is at the 

5′ end of the oligo, the product will be shorter, and hence the sequencing results will be 

confounded. This often results in a characteristic ‘shadow’ sequence. 

References 

1. Maxam, A. M. and Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. 

Acad. Sci. USA 74, 560–564. 

2. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain-terminating 

inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467. 

3. Innis, M. A., Myambo, K. B., Gelfand, D. H., and Brow. M. A. (1988) DNA sequencing 


reaction-amplified DNA. Proc. Natl. Acad. Sci. USA 85, 9436–9440.

Direct Automated Cycle Sequencing 341 

50 

Preparation and Direct Automated Cycle Sequencing 

of PCR Products 

Susan E. Daniels 


The polymerase chain reaction (PCR) is well known for being a rapid and versatile 

method for the amplification of defined target DNA sequences. This technique can be 

applied to a variety of research areas, such as the identification and typing of single 

nucleotide substitutions of DNA sequence polymorphisms, and genetic mapping (1–4). 

Since the introduction of PCR (5), a variety of methods for sequencing PCRgenerated 

fragments have been described. These are usually based on the Sanger 

chain-terminating dideoxynucleotide sequencing (6) rather than the Maxam and Gilbert 

chemical cleavage method (7). Manual dideoxy sequencing methods are labor intensive, 

time-consuming, involve radioisotopes, and have limitations in sequence ordering. 

However, a technique combining the PCR and dideoxy terminator chemistry simplifies 

the process of sequencing and is known as cycle sequencing (8). Automated or 

fluorescent DNA sequencing is a variation of the traditional Sanger sequencing 

using the cycle sequencing methodology, where fluorescent labels are covalently 

attached to the reaction products and data are collected during the polyacrylamide 

gel electrophoresis. 

The introduction of fluorescently labeled dideoxynucleotides as chain terminators 

presented the opportunity for the development of reliable cycle sequencing for PCR 

products. The sequencing reaction with the dye terminators is performed in a thermal 

cycler, and each of the four dideoxynucleotide triphosphates (ddNTPs) is labeled 

with a different fluorescent dye. This allows the four chain extension reactions to be 

conducted within a single tube, sparing considerable labor (9,10). The use of labeled 

chain terminators allows flexibility of sequencing strategy because the same primers 

can be used in the sequencing reaction. This eliminates the time and expense associated 

with a separate set of modified DNA sequencing primers and is well suited to high 

throughput sequencing. 

Using this method, it is possible to amplify a target DNA sequence, purify the 

resulting fragment, and obtain sequencing data within 24 h. Also, it has been used 



341

342 Daniels 

to sequence a 500-bp PCR fragment on an automated DNA sequencer with 99.3% 

accuracy (10–12). 

This chapter focuses on the techniques involved with the direct sequencing reactions 

rather than on the use of the machine because each automated DNA sequencer will be 

provided with an extensive manual for its operation. 

2. Materials 

All solutions should be made to the standard required for molecular biology. Use 

molecular-biology-grade reagents and sterile distilled water. The reagents for the cycle 

sequencing are available commercially. 

2.1. Purification of PCR Products Before Cycle Sequencing 

1. Ammonium acetate (4 M). 


3. 70% (v/v) ethanol. 

4. Tris-HCl (10 mM, pH 7.5), 1 mM EDTA. 

2.2. Cycle Sequencing 

Prism ready reaction DyeDeoxy terminator premix (1000 µL, Applied Biosystems 

[ABI]) consists of 1.58 mM A-dyedeoxy, 94.74 µM T-dyedeoxy, 0.42 µM G-dyedeoxy, 

47.37 µM C-dyedeoxy, 78.95 µM dITP, 15.79 µM dATP, 15.79 µM dCTP, 15.79 µM 

dTTP, 168.42 mM Tris-HCl (pH 9.0), 4.21 mM (NH 4 ) 2 SO 4 , 42.1 mM MgCl 2 , 0.42 U/µL 

AmpliTaq DNA polymerase. 

2.3. Purification of PCR Products After Cycle Sequencing 

1. Chloroform. 

2. PhenolH2Ochloroform (161814) at room temperature. 

3. Sodium acetate (2 M, pH 4.5). 

4. 100 and 70% (v/v) ethanol at room temperature. 

2.4. 6% Polyacrylamide Sequencing Gels 

1. 10× TBE: 890 mM Tris-borate, 890 mM boric acid, and 20 mM EDTA, pH 8.3. 

2. Urea (40 g). 

3. 12 mL of 40% (w/v) acrylamide stock solution (191 acrylamide/bis-acrylamide). 

4. dH 2 O (20 mL). 

5. Mixed-bed ion-exchange resin (1 g). 

6. TEMED. 

7. 10% (w/v) ammonium persulfate, freshly made. 

2.5. Loading Buffer 

1. 50 mM EDTA, pH 8.0. 

2. Deionized formamide. 

3. Methods 

3.1. Isopropanol Purification of PCR Products 

It is essential to remove excess PCR primers before using DyeDeoxy terminators 

for cycle sequencing (see Note 1).


1. Aliquot an appropriate amount of the PCR into a 0.6-mL microfuge tube, and dilute to 

a total of 20 µL with distilled water. 

2. Add 20 µL of 4 M ammonium acetate into the microfuge tube, mixing well. 

3. Add 40 µL of isopropanol into the tube, mix well, leave at room temperature for 10 min, 

and centrifuge the microfuge tube for 10 min at 12,000g. 

4. Carefully remove the supernatant and wash the pellet with 70% (v/v) ethanol. Then, briefly 

dry the pellet under vacuum. 

5. Resuspend the pellet in 20 µL of TE buffer. 

3.2. Cycle Sequencing of PCR Products 

The amount of PCR product should be estimated on an agarose gel before sequencing. 

Approximately 1 µg of double-stranded DNA template or 0.5 µg of single-stranded 

DNA template is required for each sequencing reaction. 

1. Mix the following reagents in a 0.6-mL microfuge tube: 5 mL of DNA template, 1 µL 

of primer (from a 3.2-pmol stock solution), and 4.5 µL of sterile dH 2 O (see Notes 4 

and 5). 

2. Add 9.5 µL of ABI Prism ready reaction DyeDeoxy terminator premix. 

3. Spin briefly to collect the reaction mix in the bottom of the tube and overlay with approx 

50 µL of mineral oil. 

4. Place the tubes in a thermal cycler (Perkin–Elmer Cetus [Warrington, UK] model 480 or 

9600) that has been preheated to 96°C. 

5. Immediately begin the cycle sequencing program, which is as follows: rapid thermal ramp 

to 96°C; 96°C for 30 s; Rapid thermal ramp to 50°C; 50°C for 15 s; Rapid thermal ramp 

to 60°C; and 60°C for 4 min for a total of 25 cycles. 

6. Try to keep the samples in the dark at 4°C until further processing because they are 

sensitive to light. 

7. Remove the excess DyeDeoxy terminators from the completed sequencing reactions. 

3.3. PhenolChloroform Extraction of Cycle Sequencing Products 

This step is essential to remove excess primers and unincorporated nucleotides. 

1. To each sample, add 80 µL of sterile dH 2 O. 

2. Either add 100 µL of chloroform to dissolve the oil or remove the oil with a pipet. 

3. Add 100 µL of phenolH 2 Ochloroform (681814) to the sample and mix well by 

vortexing. 

4. Centrifuge the sample at 12,000g for 1 min. Remove and discard the lower organic phase. 

5. Re-extract the aqueous layer and transfer the aqueous upper layer to a clean tube. 

6. Add 15 µL of 2 M sodium acetate and 300 µL of 100% ethanol to precipitate the extension 

products (see Note 7). 

7. Centrifuge at 12,000g for 15 min at room temperature. 

8. Carefully remove the supernatant and wash the pellet with 70% ethanol. Then, briefly dry 

the pellet under a vacuum (see Note 2). 

3.4. Preparation of Samples for Loading 

1. Add 4 µL of deionized formamide: 50 mM EDTA, pH 8.0 (51), to each sample tube, and 

mix well to dissolve the dry pellet. 

2. Centrifuge briefly to collect the liquid at the bottom of the tube. 

3. Before loading, heat the samples at 90°C for 2 to 3 min to denature. Then, transfer 

immediately onto ice.

344 Daniels 

4. Load all of the samples onto the automated DNA sequencer fitted with a 6% polyacrylamide 

gel using the manufacturer’s software. 

3.5. Preparation of 6% Polyacrylamide Sequencing Gel (see Note 3) 

1. Place 40 g of urea, 12 mL of 40% acrylamide stock, 20 mL of dH 2 O, and 1 g of mixedbed 

ion-exchange resin into a beaker and stir gently while warming. Continue to stir the 

solution until all the urea crystals have dissolved (see Notes 8 and 9). 

2. Filter the acrylamide through a 0.2-µM filter, degas for 5 min, and transfer to a 100-mL 

cylinder. 

3. Add 8 mL of filtered 10× TBE buffer and adjust the volume to 80 mL with dH 2 O. 

4. To polymerize the gel, add 400 µL of 10% APS (freshly made) and 45 µL of TEMED. 

Gently swirl to avoid adding air bubbles. 

5. According to the instructions provided for the automated DNA sequencer, run the 

sequencing gel and analyze the readouts as indicated in Fig. 1 (see Note 10). 

4. Notes 

1. Both purification steps can also be performed by spin columns, such as Centri-Sep or 

Quick Spin. Although they provide a quicker purification, they are an expensive alternative 

for those on a tight budget. 

2. The PCR primers can be used as the DNA sequencing primers, and should be at least an 

18 mer in length. Increasing the length will increase specificity and prevents priming at a 

secondary site. It will also decrease the chances for nonexact hybridization. 

3. The GC content of the primer should be between 50 and 60%. 

4. After ethanol or isopropanol precipitation, it is very important that the supernatant be 

carefully aspirated because the pellets are unstable and might be lost. 

5. The dried sequencing pellet can be stored in the dark at 4°C for several days if required. 

However, once the loading buffer has been added, the samples should be loaded within 

a few hours. 

6. The sequencing gel must polymerize for at least 1 h before use. A good time to prepare 

the gel is during the PCR of the cycle sequencing reactions. 

7. Although there are various ready-made acrylamide solutions on the market, it is recommended 

that you make your own solutions because better resolution will be achieved. 

However, 40% acrylamide can be purchased ready-made and gives good results. 

8. It has been shown that the use of formamide in the polyacrylamide gels can resolve 

compressions (13). 

9. During the phenol:chloroform extraction, if after the first spin two separate layers are not 

seen, then revortex the samples for 1 min and recentrifuge, after which an aqueous and 

organic phase should be obtainable. 

10. If using the ABI 373A “Stretch” automated DNA sequencers, then it is better to use a 

4.75% polyacrylamide gel, and from these machines, it is possible to obtain up to 1 kb 

of sequence with one run. 

11. If the thermal cycler in your laboratory is not a Perkin–Elmer Cetus, then it will be 

necessary to optimize your thermal cycler for the sequencing reactions. 

12. The addition of blue dextran to the loading buffer will make gel loading easier.


Fig. 1. Analyzed sequence data for a 350-bp PCR fragment amplified from genomic human DNA. The data were obtained 

using one of the primers used for PCR amplification. 

345

346 Daniels 

References 

1. Orita, M., Suzuki, Y., Sekeiya, T., and Hayashi, K. (1989) Rapid and sensitive detection of 

point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 

5, 874–879. 

2. Kwok, P. Y., Carlson, C., Yager, T. D., Ankener, W., and Nickerson, D. A. (1994) Comparative 

analysis of human DNA variations by fluorescence based sequencing of PCR products. 

Genomics 23, 138–144. 

3. Martin-Gallardo, A., McCombie, W. R., Gocayne, J. D., Fitzgerald, M. G., Wallace, S., 

Lee, B. M. B., et al. (1992) Automated DNA sequencing and analysis of 106 kilobases 

from human chromosome 19q 13.3. Nat. Genet. 1, 34–39. 

4. NIH/CEPH Collaborative Mapping Group. (1992) A comprehensive genetic linkage map 

of the human genome. Science 258, 67–86. 

5. Mullis, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerase 

catalysed chain reaction. Methods Enzymol. 155, 335–350. 

6. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain terminating 


7. Maxam, A. M. and Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. 

Acad. Sci. USA 74, 560–564. 

8. Carothers, A. M., Urlaub, G., Mucha, J., Grunberger, D., and Chasin, L. A. (1989) Point 

mutation analysis in a mammalian gene: Rapid preparation of total RNA, PCR amplification 

of cDNA, and Taq sequencing by a novel method. BioTechniques 7, 494– 499. 

9. McBride, L. J., Koepf, S. M., Gibbs, R. A., Nyugen, P., Salser, W., Mayrand, P. E., et al. 

(1989) Automated DNA sequencing methods involving polymerase chain reaction. Clin. 

Chem. 35, 2196–2201. 

10. Tracy, T. E. and Mulcahy, L. S. (1991) A simple method for direct automated sequencing 

of PCR fragments. BioTechniques 11, 68–75. 

11. Rosenthal, A. and Charnock Jones, D. S. (1992) New protocols for DNA sequencing with 

dye terminators. DNA Sequence 3, 61–64. 

12. Kelley, J. M. (1994) Automated dye terminator DNA sequencing, in Automated DNA 

Sequencing and Analysis (Adams, M. A., Fields, C., and Venter, J. C., eds.), Academic, 

London, pp. 175–181. 

13. Hawkins, T. L. and Sulston, J. E. (1991) The resolution of compressions in automated 

fluorescent sequencing. Nucleic Acids Res. 19, 2784.

Digoxigenin 347 

51 

Nonradioactive PCR Sequencing Using Digoxigenin 

Siegfried Kösel, Christoph B. Lücking, Rupert Egensperger, 

and Manuel B. Graeber 


Techniques for direct sequencing of polymerase chain reaction (PCR) products are 

of central importance to contemporary research in molecular biology and genetics. The 

rapidly growing number of cloned human disease genes increasingly allows sequencing 

of PCR amplicons for diagnostic purposes. Nonradioactive sequencing protocols are of 

particular use because health, environmental, and administrative risks are minimized 

compared with conventional isotopic methods. The PCR-based nonradioactive cycle 

sequencing protocol described in this chapter has been successfully used to sequence 

mitochondrial and nuclear genes in Parkinson’s and Alzheimer’s disease brains using 

DNA extracted from formalin-fixed and paraffin-embedded neuropathological material 

(1–3). This method, which allows sequence information of PCR products to be 

obtained within a single day, can be performed in a research or clinical laboratory using 

relatively inexpensive equipment.After initial PCR amplification, amplicons are purified 

using spin columns for affinity chromatography or ultrafiltration. Subsequently, cycle 

sequencing (4) is performed using 5′-digoxigenin end-labeled oligonucleotide primers. 

Because the nucleotide sequences of the PCR and sequencing primers can be identical, 

both reactions may be performed using the same thermalcycling protocol. This obviates 

the need for time-consuming optimization procedures. For visualization of sequencing 

results, sequencing reactions are separated on a standard sequencing gel, the gel is 

contact-blotted to a nylon membrane, and sequencing bands are visualized using 

alkaline phosphatase-conjugated antibodies (Fig. 1). 

Potential pitfalls of our method are primarily related to the extreme sensitivity of PCR. 

The need for positive and negative sample controls cannot be overemphasized. We use 

different rooms and different pipets for setting up PCRs, pipetting sequencing templates, 

and thermal cycling (5). In addition, aerosol-resistant pipet tips are always used. 

2. Materials 

2.1. Purification of Sequencing Templates 

1. 10× TNE: 100 mM Tris-HCl, pH 7.4, 1.0 M NaCl, 10 mM EDTA (see Note 1). 

2. Wizard PCR Preps DNA Purification System containing affinity chromatography spin 

columns, purification buffer, and resin (A7170, Promega, Madison, WI). Not contained 



347

348 Kösel et al. 

Fig. 1. Schematic drawing summarizing the essential steps of nonradioactive PCR sequencing 

using digoxigenin. 

in the kit are 1× TE: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA (6); 80% isopropanol; and 

2-mL disposable syringes (one per reaction) or, alternatively, Microcon-30 Concentrators 

(#42410, Amicon, Beverly, MA). 

3. Eppendorf tubes (15 mL). 

4. Eppendorf centrifuge (#5415C Eppendorf, Hamburg, Germany). 

5. Fluorometer (TKO 100, Hoefer, San Francisco, CA) for quantification of template 

concentrations using DNA dye Hoechst No. 33258 and calf thymus standard DNA 

(supplied with the fluorometer). 

2.2. Sequencing Reactions 

1. Sequencing primer, 5′digoxigenin end-labeled (1 pmol/µL), desalted, and HPLC-purified 

(see Note 2). 

2. Mineral oil (M-5904, Sigma, St. Louis, MO). 

3. Dig Taq DNA Sequencing Kit (#1449443, Boehringer Mannheim, Mannheim, Germany), 

containing Taq DNA polymerase (3 U/µL); sequencing buffer (250 mM Tris-HCl,


pH 8.0, 50 mM MgCl 2 ); loading buffer containing formamide; and Termination mixtures 

containing dNTPs and the appropriate ddNTP: 

ddATP (dATP, dCTP, dGTP, and dTTP, 25 µM each; 850 µM ddATP; 950 µM MgCl 2 ; 

pH 7.5). 

ddCTP (dATP, dCTP, dGTP, dTTP, 25 µM each; 400 µM ddCTP; 500 µM MgCl 2 ; 

pH 7.5). 

ddGTP (dATP, dCTP, dGTP, dTTP, 25 µM each; 75 µM ddGTP; 175 µM MgCl 2 ; 

pH 7.5). 

ddTTP (dATP, dCTP, dGTP, dTTP, 25 µM each; 1275 µM ddTTP; 1370 µM MgCl 2 ; 

pH 7.5). 

A second set of termination mixtures is shipped with the kit substituting 7-deaza-dGTP 

for dGTP. 

4. 0.5-mL thin-walled reaction tubes (N801-0537, Applied Biosystems, Foster City, CA). 

5. Eppendorf centrifuge. 

6. Thermal cycler for cycle sequencing (see Note 6 for reference). 

2.3. Preparation of Sequencing Gel 

1. 10× TBE: 0.9 M Tris, pH 8.3, 0.9 M boric acid, and 25 mM EDTA (6). 

2. 10% Ammonium persulfate (w/v) (should be prepared freshly before use). 

3. Sigmacote (SL-2, Sigma). 

4. GelMix 8 (#5545UA, Gibco BRL, Gaithersburg, MD), containing 7.6% acrylamide (w/v), 

0.4% N,N′-methylene bis-acrylamide, 7.0 M urea, 100 mM Tris-borate, pH 8.3, 1 mM 

Na 2 EDTA, 3 mM TEMED. 

5. 10-mL disposable syringes with needles. 

6. Scotch electrical tape 50 mm (FE-5000-0409-1, 3 M). 

7. Plastic foil (e.g., Saran Wrap). 

2.4. Gel Electrophoresis and Visualization of Sequencing Results 

1. 1× Tris-buffered saline (TBS) 50 mM Tris-HCl, pH 7.5, 150 mM NaCl. 

2. Alkaline phosphatase reaction buffer: 0.1 M Tris-HCl, pH 9.5, 50 mM MgCl 2 , 

0.1 M NaCl. 

3. Stock solutions of 70% (v/v) and 100% N,N-dimethyl formamide. 

4. Digoxigenin Detection Kit for Glycoconjugate and Protein Analysis (#1210220, Boehringer 

Mannheim), containing: antidigoxigenin antibodies conjugated to alkaline phosphatase; 

blocking reagent (purified casein fraction); nitroblue tetrazoliumchloride, 77 mg/mL in 

70% N,N-dimethyl formamide; and X-Phosphate (5-bromo-4-chloro-3-indolylphosphate, 

4-toluidinium salt), 50 mg/mL in 100% N,N-dimethyl formamide. 

5. Nylon membrane, positively charged (#1417240, Boehringer Mannheim). 

6. Whatman chromatography paper (#3030917, 3MM Whatman International Ltd., Maidstone, 

UK). 

7. Plastic hybridization bags. 

8. Scalpel blade. 

9. Standard sequencing equipment: sequencing apparatus (Model S2, Gibco BRL) and 

high-voltage power supply (PS 9009, Gibco BRL). 

10. Ultraviolet transilluminator (302 nm) for DNA crosslinking (Hoefer). 

11. Eppendorf centrifuge. 

12. Heating block or thermal cycler for denaturation of DNA. 

13. Electric sealer for closing hybridization bags.


3. Methods 

3.1. Purification of Sequencing Templates 

1. PCR is performed according to established protocols (7). After PCR amplification, PCR 

products are purified away from excess nucleotides and primers using either spin column 

chromatography (Wizard PCR Preps DNA Purification System, Promega, Madison, WI) 

or ultrafiltration (Microcon-30, Amicon). The purification systems are used according to 

manufacturer’s recommendation (see Note 3). 

2. Measure DNA concentration using the fluorometer and Hoechst dye No. 33258. The dye 

is dissolved in 1× TNE (prepare two stocks, 0.1 and 1 µg/mL, respectively). Calf thymus 

DNA (100 or 1000 ng/µL) is used as a standard for calibration (see Note 4). 

3. Purification results may be checked by electrophoresis of samples through a 2% highmelting-point 

agarose gel. 

3.2. Sequencing Reactions 

1. Sequencing reactions are set up in a total volume of 20 µL containing the follow: 13 µL of 

DNA template solution (2–4 pmol); dilute with sterile, double-distilled water, if necessary; 

3 µL of 5′-digoxigenin end-labeled primer (1 pmol/µL); 2 µL of 10× reaction buffer 

(250 mM Tris-HCl, pH 8.0, 50 mM MgCl 2 ); and 2 µL of Taq polymerase (3 U/µL). 

2. For each sequencing reaction, transfer 4 µL of the above mixture to four thin-walled PCR 

tubes, each containing 2 µL of the respective termination mixture (ddATP, ddCTP, ddTTP, 

and ddGTP; see Note 5). 

3. Overlay samples with 20 µL of mineral oil, and centrifuge for a few seconds in an 

Eppendorf tube, centrifuge at full speed. 

4. Cycle sequencing is performed using a thermal cycling protocol empirically optimized for 

the T m of the sequencing primer. When using sequencing primers of the same sequence 

and length as those used for PCR, a thermal cycling protocol identical to the one used for 

PCR usually gives good results (see Note 6). 

3.3. Preparation of Sequencing Gel 

For gel electrophoretic separation of sequencing reactions, an 8% denaturing 

polyacrylamide gel and standard sequencing equipment are used. 

1. Clean glass plates thoroughly with 70% ethanol. Cover inner surface of one plate with 

a few drops or Sigmacote and let evaporate for 5 to 10 min. Set up glass plates with 

spacers and seal edges airtight using Scotch electrical tape. Put two strong metal clamps 

on each side. 

2. Add 450 µL of 10% ammonium persulphate to one bottle (75 mL) of GelMix 8 and 

mix gently. Slowly fill the space between the glass plates (avoid air bubbles!). Let gel 

polymerize for at least 1 h at room temperature. (Wear protective gloves when handling 

unpolymerized acrylamide.) 

3. After polymerization of gel, remove clamps and electrical tape from the lower end of 

the glass plates and transfer gel to sequencing apparatus. Fill the upper and lower buffer 

chambers with 500 mL of 1× TBE each. Rinse sample wells of gel with 1× TBE using a 

10-mL disposable syringe with needle. 

3.4. Gel Electrophoresis and Visualization of Sequencing Results 

3.4.1. Electrophoresis and Contact Blotting 

1. Add 3 µL of loading buffer to each tube containing the sequencing reactions with the 

respective “A,” “C,” “G,” and “T” termination mixtures. Centrifuge for a few seconds


to mix, and denature samples for at least 2 min at 85°C using a heating block or 

thermal cycler. 

2. Transfer 6 µL of each sample to the wells of the sequencing gel. Run gel at 35 mA for 2 to 

4 h (until the upper dye front has reached the bottom end of the gel). 

3. Remove glass plates from electrophoresis apparatus. Carefully take off the glass plate 

covered with Sigmacote on the inner side using a scalpel blade as a lever. Cover gel with 

nylon membrane (avoid air bubbles!) and cover with one layer of Whatman filter paper. 

Put on second glass plate and add approx 2 kg of weight. Leave for 30 min (see Note 7). 

Protect nylon membrane with one layer of plastic foil. 

4. Crosslink nylon membrane (plastic wrapped, blotted side down) on an ultraviolet light box 

at 302 nm for 3 min (see Note 8). The membrane may now be air-dried, sealed in a plastic 

bag (see Note 9), and stored at 4°C until further use. 

3.4.2. Visualization of Sequencing Bands 

Visualization of sequencing results is performed in plastic hybridization bags (one 

blot per bag) at room temperature using the Digoxigenin Detection Kit (Boehringer). 

After crosslinking, wet blots may be used immediately for immunological detection. 

The following recipe applies to a 4∞4 lane gel (gently agitate membrane, except during 

the final step when incubating with substrate solution). 

1. Incubate nylon membrane (in hybridization bag) for at least 30 min in approx 30 mL of 

blocking solution (0.5 g/100 mL TBS; see Note 10). 

2. Wash blot three times in approx 100 mL of TBS (10 min each). 

3. Incubate membrane with 50 mL of alkaline phosphatase-conjugated antidigoxigenin 

antibody for 1 h (50 µL antiserum/50 mL of TBS). 

4. Wash three times in TBS (20 min each). 

5. Prepare 30 mL of substrate solution (mix immediately before use): 150 µL of NBT 

(77 mg/mL in 70% N,N-dimethyl formamide [v/v]); 112 µL X-phosphate (50 mg/mL in 

N,N-dimethyl formamide); and 30 mL of alkaline phosphatase buffer, pH 9.5. 

Thoroughly remove washing solution from membrane. Add substrate solution. During 

this incubation step, cover plastic bag with black light protector and do not agitate (see 

Note 11). 

6. Stop developing process when faint sequencing bands are beginning to appear. Add approx 

1 L of deionized water to hybridization bag. Cut bag open and carefully remove membrane. 

Allow membrane to air-dry on sheets of Whatman filter paper or paper towels. Store 

stained, dried membranes in the dark (see Note 12). An example of a stained membrane 

is shown in Fig. 2. 

4. Notes 

1. Molecular biology-grade reagents are used for all experiments. 

2. Oligonucleotide primers for PCR and sequencing may be designed by hand, but use of a 

computer program, such as Oligo (National Biosciences, Oslo, Norway), greatly facilitates 

this task. We have had good experience with primers ranging from 18 to 25 bp in length 

for both PCR and sequencing. The sequencing primer may be internally nested or identical 

in position and/or length to the primer used for PCR. Primers used in our laboratory were 

synthesized on an Applied Biosystems 394 DNA synthesizer at the Genzentrum of the 

University of Munich. Sequencing primers were custom-made and hapten-labeled using 

digoxigenin-3-O-methylcarbonylε-amino-caproic acid-N-hydroxy-succinimide ester and 

a 5′-oligopeptide linker (#1333054, Boehringer Mannheim).


Fig. 2. Sequencing results obtained with primers ND3 5′-TCC CCA CCA TCA TAG CCA-3′ 

and ND4 5′-GGG TTT TGC AGT CCT TAG-3′, which amplify a 302-bp segment of the 

mitochondrial ND2 gene (3). Sequencing results were visualized using alkaline phosphataseconjugated 

antibodies directed against digoxigenin and NBT/X-phosphate as an enzymatic 

substrate. Contact blot of an 8% standard sequencing gel. 

3. Purification of PCR products using the Wizard PCR Preps DNA Purification System: Add 

50 to 100 µL of PCR product to 100 µL of purification buffer in an Eppendorf tube and 

mix. Then, add 1 mL of purification resin and mix thoroughly. Pipet mixture into a 2-mL 

syringe and push into a Wizard Prep column. Wash column with 2 mL of 80% isopropanol 

and spin for 20 s in an Eppendorf centrifuge at full speed. Let isopropanol evaporate (takes 

approx 5 min), and transfer column to new Eppendorf tube. Elute DNA by adding 50 µL 

of 1× TE to the column. After 1 min, spin column for 20 s to recover DNA completely. 

When ultrafiltration is used for purification of PCR products, 50 to 100 µL of PCR 

product are diluted with approx 400 µL of double-distilled water and transferred to a 

Microcon-30 concentrator. Centrifugation of the Microcon-30 column is done according 

to manufacturer’s recommendation (e.g., 10 min at 12,000g) in an Eppendorf centrifuge. 

Important: Avoid contamination of both types of columns with mineral oil used for 

overlaying PCR. 

4. A fluorometer is used to measure nanogram amounts of DNA. The TKO 100 (Hoefer) is 

a useful and reasonably priced alternative to full-sized spectrophotometers for measuring 

concentrations of double-stranded DNA. DNA concentrations as low as 10 ng/µL may be 

reliably determined using a standard setup of the TKO. For measuring the concentration of 

PCR products, the fluorometer is first calibrated with DNA standard (100 or 1000 ng/µL 

calf thymus DNA, depending on the DNA concentrations to be determined): 1 µL of


standard DNA is mixed with 1 mL of 1× TNE containing Hoechst dye No. 33258 and 

added to the quartz cuvet. Concentration of the Hoechst dye is 0.1 or 1 µL/mL in 1X TNE, 

depending on the concentration of the calibration standard. 

5. Termination mixtures containing 7-deaza-dGTP are used to avoid band compression 

artifacts when sequencing guanine–cytosine-rich regions. 

6. Similar to PCR, the success of Taq cycle sequencing depends on buffer conditions, 

especially the concentration of Mg 2+ ions and pH. Buffer conditions for PCR and cycle 

sequencing may be optimized using commercial “optimizer” kits (e.g., K1220-01, 

Invitrogen, Leek, Netherlands). We have used Taq polymerases from Perkin–Elmer and 

Boehringer Mannheim with comparable success for both PCR and sequencing. Thermal 

cyclers from Perkin–Elmer (TC 480) and Biometra (Trio Thermo block) also gave 

comparable results in our hands. Sequencing protocols using smaller numbers of cycles, 

e.g., 20 to 25 may reduce the intensity of shadow bands. 

7. Do not extend blotting time and do not use higher weights. 

8. Protect eyes and skin against ultraviolet light (wear goggles, mask, coat, and gloves)! 

9. To save on reagents, hybridization bags should be tightly sealed. However, leave one “long 

end,” because bags will need to be reopened and resealed during subsequent incubation 

steps. 

10. Blocking reagent (Boehringer Mannheim) should be prepared freshly before use. Dissolve 

blocking reagent at 50°C in TBS, and let cool down to room temperature. Blots can be 

stored in blocking solution at 4°C for a few days. 

11. To avoid diffuse or spotty background, the volume of the substrate solution should be 

sufficiently large to cover the nylon membrane completely. Also, avoid folds in the 

hybridization bag. Sequencing bands should become visible within 15 min on incubation. 

Do not move the membrane during that time. Because the visualization process involves an 

enzymatic reaction, lowering the temperature of the incubation solutions may lengthen incubation 

times. We recommend developing at room temperature and checking the intensity of 

the stained sequencing bands by briefly lifting the dark cover from time to time. 

12. The intensity of the sequencing bands may increase during the first few hours after the final 

incubation has been finished (if alkaline phosphatase and NBT/X-phosphate are used for 

visualization as in the present protocol). Therefore, the incubation with substrate solution 

should be stopped as soon as the first sequencing bands are clearly readable. Important: 

Stained, dried nylon membranes should not be exposed to sunlight because they will 

bleach rapidly. However, stained membranes can be stored safely for many months in 

the dark. For long-term documentation, we recommend taking photographs. Sequencing 

results may also be documented permanently by photocopying stained blots onto paper 

or overhead transparencies. 

References 

1. Kösel, S. and Graeber, M. B. (1993) Non-radioactive direct sequencing of PCR products 

amplified from neuropathological specimens. Brain Pathol. 3, 421– 424. 

2. Kösel, S. and Graeber, M. B. (1994) Use of neuropathological tissue for molecular 

genetic studies: parameters affecting DNA extraction and polymerase chain reaction. Acta 

Neuropathol. 88, 19–25. 

3. Kösel, S., Egensperger, R., Mehraein, P., and Graeber, M. B. (1994) No association of 

mutations at nucleotide 5460 of mitochondrial NADH dehydrogenase with Alzheimer’s 

disease. Biochem. Biophys. Res. Commun. 203, 745–749. 

4. Krishnan, B. R., Blakesley, R. W., and Berg, D. E. (1991) Linear amplification DNA 

sequencing directly from single phage plaques and bacterial colonies. Nucleic Acids Res. 

19, 1153.


5. Kwok, S. and Higuchi, R. (1989) Avoiding false positives with PCR. Nature 339, 

237–238. 


Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 

7. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., et al. (1988) 

Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. 

Science 239, 487– 491.

Thermal Asymmetric PCR 355 

52 

Direct Sequencing by Thermal Asymmetric PCR 

Georges-Raoul Mazars and Charles Theillet 


Direct sequencing of polymerase chain reaction (PCR) products (1) has proven to 

be a powerful method in the generation of nucleic acid sequence data. Using these 

techniques, it is possible to produce microgram quantities of pure target DNA and 

subsequently its nucleotide sequence in a few hours, even, theoretically, from one 

single RNA or DNA molecule. However, problems have been encountered, and these 

have been attributed to the strong tendency of the short double-strand DNA templates 

to reanneal. In fact, compared with double-stranded plasmid DNA, which can be 

permanently denatured by alkali treatment and then form intermolecular interactions 

compatible with good sequencing efficiency, optimized conditions for direct sequencing 

are required before reannealing with short PCR product. 

To obviate this, strategies have been developed, such as the generation of singlestrand 

DNA template by asymmetric PCR (2,3). Methods use either a disequilibrated 

concentration ratio between the two primers or a two-step amplification, both of which 

have their shortfalls. The first method is based on a large number of cycles, which is 

a potential source of misincorporation of errors, and optimized conditions enough to 

produce single-strand DNA that are strongly primer dependent. Moreover, it often has 

been the case that only one strand can easily be sequenced. The second case requires 

two physical separation steps, in which product contamination may occur. 

Here, we propose a method combining the advantages of both symmetric and 

asymmetric PCR. It is based on a thermal asymmetry between the Tm of both primers. 

Annealing temperature of each primer is calculated with the formula: 69.3 + 0.41 

(%GC) – 650/L, with L = primer length. PCR primers are designed to obtain a difference 

in T m of at least 10°C. In the first step, double-stranded material is produced 

during 20 to 25 cycles (to minimize the yield of spurious products) using the lower 

Tm. During the second step, single-stranded DNA is generated using the higher 

T m (Fig. 1). 

Consequently, one primer is dropped out and linear amplification is obtained. 

The final quantity of single-stranded product is comparable with the one produced 

by Gyllensten and Erlich’s method (2). We applied thermal asymmetry to several 

sequences, which, in our hands, were difficult to sequence both from double-stranded 

DNA or with the Gyllensten and Erlich asymmetric PCR products (Fig. 2). 



355

356 Mazars and Theillet 

Fig. 1. Schematic representation of thermal asymmetric PCR. 

These PCR fragments comprised the following: (1) exons 7 and 8 of the p53 gene 

and (2) exon 1 of HRAS. This latter sequence is particularly GC-rich, and as part 

of another study, primer A was synthesized with a 40-bp GC stretch (to make a GC 

clamp). In conclusion, thermal asymmetric PCR allows direct sequencing of both 

strands with high reproducibility and reduced risk of contamination. 

2. Materials 

All solutions should be made according to the standard required for molecular 

biology, such as molecular biology-grade reagents and sterile distilled water. All 

reagents for sequencing are available commercially. 

2.1. PCR Amplification 

1. Primers were synthesized on Applied Amplifications, and PCR was performed on a 

Perkin–Elmer Cetus thermal cycler. 

2. 1× Taq polymerase buffer: 10 mM Tris-HCl, pH 8.3, 2 mM MgCl 2 , 50 mM KCl, 0.01% 

gelatin; 100 µM of dNTPs. 

3. Taq polymerase was purchased from Perkin–Elmer and used at 1 U/reaction.


Fig. 2. Autoradiograph of a PCR product sequenced by thermal asymmetric PCR. 

2.2. Purification and Sequencing of the PCR Product 

2.2.1. Sequencing Reagents 

1. Annealing buffer (5× concentrate): 200 mM Tris-HCl, pH 7.5, 100 mM MgCl 2 , 250 mM 

NaCl, 0.1 M dithiothreitol (DTT). 

2. Labeling nucleotide mixture (one for each dideoxy nucleotide): Each mixture contains 

80 µM dGTP, 80 µM dATP, 80 µM dTTP, 80 µM dCTP, and 50 mM NaCl. In addition, 

the “G” mixture contains 8 µM dideoxy-dGTP; the “A” mixture, 8 µM ddATP; the “T,” 

8 µM ddTTP; and the “C” 8 µM ddCTP. 

3. Stop solution: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% 

xylene cyanol FF. 

4. Labeled dATP is [α- 35 S] dATP from Amersham, and specific activity should be 1000 

to 1500 Ci/mol. 

2.2.2. Purification 

Purification should be performed in Centricon 30 column (Amicon). 

3. Methods 

3.1. PCR Conditions 

PCR conditions should be as follows: in a total volume of 25 µL, 20 pmol of each 

primer, 1× Taq polymerase buffer, and 1 U of Taq polymerase were incubated with 50 ng

358 Mazars and Theillet 

of genomic DNA. P53 primer A1 cttagtacctgaagggtgaaatattc (T m 1 = 60°C), P53 primer 

B1 gtagtggtaatctactgggacggaacagc (T m 2 = 69°C), P53 primer A2 taatctactgggacgga 

(T m 3 = 50°C), P53 primer B2 cccaagacttagtacctgaagggtg (T m 4 = 64°C). Cycling 

conditions were for 25 cycles: 92°C (30 s); T m 1 or 3 (30 s); 72°C (90 s), followed by 

10 cycles: 92°C (30 s); T m 2 or 4 (30 s); 72°C (90 s). 

3.2. Preparation of the PCR Product 

1. Transfer PCR product directly by pipetting in a Centricon 30 and add 2 mL of water. 

2. Spin at 5000g in a fixed-angled rotor in a Beckman-type centrifuge for 30 min at room 

temperature. 

3. Add 2 mL of water. Spin again for 30 min and invert column and spin for 5 min at 1500g. 

This procedure efficiently removes the excess of dNTPs from the PCR. Volume recovered 

is typically 20 to 50 µL. 

4. Typically, 7 µL of this purified product are used for single-strand sequencing according to 

the manufacturer’s directions of United States Biochemicals (Cleveland, OH). 

3.3. Sequencing Protocol 

3.3.1. Annealing Template and Primer 

1. For each template, a single annealing (and subsequent labeling) reaction is used. Combine 

the following: 

a. Primer 0.5 pmol (1 µL) 

b. DNA 7 µL 

c. Annealing buffer 2 µL 

2. Warm the capped tube to 65°C for 2 min, and then allow the mixture to cool slowly to 

room temperature over a period of about 30 min. 

3.3.2. Labeling Reaction 

1. To the annealed template-primer add the following: 

a. DTT (0.1M) 1 µL 

b. Labeling nucleotide mix 2 µL 

c. [α-α- 35 S] dATP 5 µCi (typically 0.5 µL) 

d. Sequenase 3 U from United States Biochemicals 

2. Total volume should be approx 15 µL; mix thoroughly and incubate for 2 to 5 min at 


3.3.3. Termination Reactions 

1. Label four tubes “A,” “C,” “G,” and “T.” Fill each with 2.5 µL of the appropriate dideoxy 

termination mixture. 

2. When the labeling reaction is complete, transfer 3.5 µL of it to the tube (prewarmed to 

37°C) labeled G. Similarly, transfer 3.5 µL of the labeling reaction to each of the other 

three tubes (A, T, and C). 

3. After 2 to 5 min of incubation at 37°C, add 4 µL of stop solution to each termination 

reaction, mix, and store on ice. 

4. To load the gel, heat the samples to 75 to 80°C for 2 min, and load 2 to 3 µL in each 

lane. Prerun a sequencing gel for 30 min, load, and run until bromophenol is just out 

of the gel. 

5. Fix gel as usual and dry on Whatman 3MM paper. Correct sequencing yields a detectable 

signal using a bench-top Geiger counter. 

6. Expose overnight without Saran paper at room temperature.


4. Notes 

1. Instability of diluted solution of primers conserved at –20°C can sometimes be problematic. 

We recommend storing oligonucleotides as a dried powder and resuspending them in 

water prior to use. 

2. Estimation of the yield of single-strand DNA produced can be achieved by Southern 

blotting: run a 2% agarose gel, blot following standard conditions, and probe with one of 

the PCR primers. Two bands should appear if you use higher T m primer or only one band 

if you use lower T m primer (corresponding to double-stranded DNA). An alternative 

strategy is to add α-dCTP[ 32 P] for the second step of amplification at high temperature: 

labeled single-stranded DNA should be exclusively produced. 

3. We also sequenced PCR fragments after SSCP analysis. In this case, shifted SSCP bands 

were excised from the gel with a sterile razor blade and eluted in 50 µL of distilled water 

for 1 h at 65°C. A 1.5-µL aliquot of the eluate was subjected to thermal asymmetric PCR. 

4. A good sequence can be obtained even if no primer is added for the sequencing reaction. 

The reason is that the low T m primer from PCR is not completely removed by Centricon 

30 purification. 

5. The present protocol has been optimized for classical radioactivity labeled DNA sequencing, 

but should easily be adapted to automated fluorescent sequencing using fluorescent 

dye terminators. 

References 

1. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. F., Higuchi, R., Horn, R. T., et al. (1988) 


Science 239, 487– 491. 

2. Gyllensten, U. B. and Erlich, H. A. (1988) Generation of single-stranded DNA by the 

polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. 


3. Wilson, R. K., Chen, C., and Hood, L. (1990) Optimization of asymmetric polymerase 

chain reaction for rapid fluorescent DNA sequencing. BioTechniques 8, 184–189.

360 Mazars and Theillet

Solid-Phase Minisequencing 361 

53 

Analysis of Nucleotide Sequence Variations 

by Solid-Phase Minisequencing 

Anu Suomalainen and Ann-Christine Syvänen 


The Sanger dideoxynucleotide sequencing method has been simplified by a number 

of methodological improvements, such as the use of the polymerase chain reaction 

(PCR) technique for generating DNA templates in sufficient quantities followed 

by affinity-capture techniques for convenient and efficient purification of the PCR 

fragments for sequencing, or altenatively the use of cyclic Sanger sequencing reactions 

that are easy to automate with laboratory robots, and the development of instruments 

for automatic on-line analysis of fluorescent products of the sequencing reactions 

(references to this book, solid phase sequencing, cyclic sequencing). Despite these 

technical improvements, the requirement for gel electrophoretic separation remains 

an obstacle when sequence analysis of large numbers of samples are needed, as in 

DNA diagnosis, or in the analysis of sequence variation for genetic, evolutionary, or 

epidemiological studies. 

We have developed a method for analyzing DNA fragments that differ from each 

other in one or a few nucleotide positions (1) denoted solid-phase minisequencing, in 

which gel electrophoretic separation is avoided. Analogous to the methods for solidphase 

sequencing of PCR products, the solid-phase minisequencing method is based 

on PCR amplification using one biotinylated and one unbiotinylated primer, followed 

by affinity-capture of the biotinylated PCR product on an avidin- or streptavidincoated 

solid support. The nucleotide at the variable site is detected in the immobilized 

DNA fragment by a primer extension reaction: A detection step primer that anneals 

immediately adjacent to the nucleotide to be analyzed is extended by a DNA polymerase 

with a single labeled nucleotide complementary to the nucleotide at the variable site 

(Fig. 1). The amount of the incorporated label is measured, and it serves as a specific 

indicator of the nucleotide present at the variable site. 

We have used the solid-phase minisequencing method for detecting numerous 

mutations causing human genetic disorders, for analyzing allelic variation in genetic 

linkage studies, and for identifying individuals (2–4). The protocol described below 

is generally applicable for detecting any variable nucleotide. The method suits well for 

analyzing large numbers of samples because it comprises simple manipulations in 



361

362 Suomalainen and Syvänen 

Fig. 1. Steps of the solid-phase minisequencing method. 1. PCR with one biotinylated (black 

ball) and one unbiotinylated primer. 2. Affinity-capture of the biotinylated PCR product in 

streptavidin-coated microtiter wells. 3. Washing and denaturation. 4. The minisequencing primer 

extension reaction. 5. Measurement of the incorporated label. 6. Calculation of the result.


a microtiter plate or test tube format and the result of the assay is obtained as an 

objective numeric value, which is easy to interpret. Furthermore, the solid-phase 

minisequencing method allows quantitative detection of a sequence variant present as a 

minority of less than 1% in a sample (2,3,5,6). We have used the sensitive quantitative 

analysis for detecting point mutations in malignant cells present as a minority in a cell 

population (5) and for analyzing heteroplasmic mutations of mitochondrial DNA (3,6). 

The high sensitivity is an advantage of the minisequencing method compared with 

dideoxynucleotide sequencing, in which a sequence variant must be present as 10 to 

20% of a mixed sample to be detectable. A limitation of the solid-phase minisequencing 

method is that it is restricted to analyzing variable nucleotides only at positions 

predefined by the detection step primers used. The method is based on the use of 

equipment and reagents that are available from common suppliers of molecular 

biological products, facilitating easy setup. In the future, high-throughput analysis of 

nucleotide sequence variation will be performed by rapid, automatic methods based 

on homogeneous detection principles or alternatively using methods in microarray 

or chip formats. The minisequencing reaction principle is applicable for both types 

of assay formats (7,8). 

2. Materials 

2.1. Equipment 

1. Programmable heat block, and facilities to avoid contamination in PCR. 

2. Microtiter plates with streptavidin-coated wells (e.g., Combiplate 8, Labsystems, Helsinki, 

Finland; see Note 1). 

3. Multichannel pipet and microtiter plate washer (optional). 

4. Shaker at 37°C. 

5. Water bath or incubator at 50°C. 

6. Liquid scintillation counter. 

2.2. Reagents 

All the reagents should be of standard molecular biology grade. Use sterile distilled 

or deionized water. 

1. Thermostable DNA polymerase. We use Thermus aquaticus (5 U/µL, Promega or Perkin– 

Elmer-ABI) or Thermus brockianus (Dynazyme II, 2 U/µL, Finnzymes, Espoo, Finland) 

DNA polymerase. Store at –20°C (see Note 2). 

2. 10× concentrated DNA polymerase buffer: 500 mM mM MgCl 2 , 1% (v/v) Triton X-100, 

and 0.1% (w/v) gelatin or 10× concentrated buffer supplied with the DNA polymerase 

enzyme. Store at –20°C. 

3. dNTP mixture: 2 mM dATP, 2 mM dCTP, 2 mM dGTP, and 2 mM dTTP stored at –20°C. 

4. PBS/Tween: 20 mM sodium phosphate buffer, pH 7.5, and 0.1% (v/v) Tween 20 store at 

4°C. 50 mL is enough for several full-plate analyses. 

5. TENT (washing solution): 40 mM Tris-HCl, pH 8.8, 1 mM EDTA, 50 mM NaCl, and 

0.1% (v/v) Tween 20. Store at 4°C. Prepare 1 to 2 L at a time, which is enough for several 

full-plate analyses. 

6. NaOH (50 mM; make fresh every 4 wk) stored in a plastic vial at room temperature 

~20°C). 

7. [ 3 H]-labeled deoxynucleotides (dNTPs): dATP to detect a T at the variant site, dCTP to


detect a G, etc. (Amersham-Pharmacia Biotech; [ 3 H]dATP, TRK 633; dCTP, TRK 625; 

dGTP, TRK 627; dTTP, TRK 576), stored at –20°C (see Note 3). 

8. Scintillation fluid (for example Hi-Safe II, Wallac, Turku, Finland) stored at room 

temperature (~20°C). 

2.3. Primer Design 

1. PCR primers: One PCR primer of each pair is biotinylated at its 5′ end during the synthesis 

using a biotin-phosphoramidite reagent (for example Amersham–Pharmacia Biotech or 

Perkin-Elmer–ABI; see Note 4). 

2. The detection step primer for the minisequencing analysis is a 20-mer oligonucleotide 

complementary to the biotinylated strand of the PCR product, designed to hybridize with 

the 3′ end immediately adjacent to the variant nucleotide to be detected (see Fig. 1) 

The minisequencing primer should be at least five nucleotides nested in relation to the 

unbiotinylated PCR primer. 

3. Methods 

3.1. PCR for Solid-Phase Minisequencing Analysis 

The PCR is performed according to routine protocols, except that the amount of 

the biotin-labeled primer used is reduced not to exceed the biotin-binding capacity of 

the microtiter well (see Note 1). For a 50-µl PCR, we used 10 pmol of biotin-labeled 

primer and 50 pmol of the unbiotinylated primer. The PCR should be optimized (i.e., 

the annealing temperature and template amount) to be efficient and specific. To be 

able to use [ 3 H] dNTPs, which are low-energy β-emitters, for the minisequencing 

analysis, 1/10 of the PCR product should produce a single visible band after agarose 

gel electrophoresis, stained with ethidium bromide. There is no need for purification 

of the PCR product before the minisequencing analysis. 

3.2. Solid-Phase Minisequencing Analysis 

1. Affinity capture: Transfer 10-µL aliquots of the PCR product and 40 µL of the PBS/Tween 

solution to two streptavidin-coated microtiter wells (see Note 5). Include a control reaction, 

that is, a well with no PCR product. Seal the wells with a sticker and incubate the plate 

at 37°C for 1.5 h with gentle shaking. 

2. Discard the liquid from the wells and tap the wells dry against a tissue paper. 

3. Wash the wells three times at room temperature as follows: pipet 200 µL of TENT solution 

to each well, discard the washing solution and empty the wells thoroughly between the 

washings (see Note 6). 

4. Denature the captured PCR product by adding 100 µL of 50 mM NaOH to each well, 

incubate at room temperature for 3 min. Discard the NaOH and wash the wells as in 

step 3 above. 

5. Prepare for each DNA fragment to be analyzed two 50-µL mixtures of nucleotide-specific 

minisequencing solution, one for detection of the normal and one for the mutant nucleotide 

(see Note 7). Mix 5 µL of 10× Taq DNA polymerase buffer, 10 pmol of detection step 

primer, 0.2 µCi (usually equals to 0.2 µL) of one [ 3 H] dNTP, 0.1 U of Taq DNA polymerase, 

and dH 2 O to a total volume of 50 µL. It is obviously convenient to prepare master mixes 

for the desired number of analyses with each nucleotide. 

6. Pipet 50 µL of one nucleotide-specific mixture per well, incubate the plate at 50°C for 

10 min in a water bath or 20 min in an oven (see Note 8). 

7. Discard the contents of the wells and wash them as in step 3.


8. Release the detection step primer from the template by adding 60 µL of 50 mM NaOH and 

incubating for 3 min at room temperature. 

9. Transfer the eluted primer to the scintillation vials, add scintillation reagent, and measure 

the radioactivity, that is, the amount of incorporated label, in a liquid scintillation counter 

(see Note 9). 

10. The result is obtained as counts per minute (cpm) values. The cpm value of each reaction 

expresses the amount of the incorporated [ 3 H] dNTP. Calculate the ratio (R) between the 

mutant and normal nucleotide cpms. In a sample of a subject homozygous for the mutant 

nucleotide the R will be >10, in a homozygote for the normal nucleotide R


temperatures for the primer annealing may be required. 

9. Streptavidin-coated microtiter plates made of scintillating polystyrene are available (Wallac, 

Finland). In this case the final washing, denaturation and transfer of the eluted detection 

primer can be omitted, but a scintillation counter for microtiter plates is needed (11). 

10. The ratio between the cpm values for the two nucleotides reflects the ratio between the 

two sequences in the original sample. Therefore, the solid-phase minisequencing method 

can be used for quantitative PCR analyses (2–6). The R value is affected by the specific 

activities of the [ 3 H] dNTPs used, and if either the mutant or the normal sequence allows 

the detection step primer to be extended by more than one [ 3 H] dNTP, this will obviously 

also affect the R value. Both of these factors can easily be corrected for when calculating 

the ratio between the two sequences. Alternatively, a standard curve is constructed by 

mixing the two sequences in known ratios and plotting the obtained R-values as a function 

of the ratios to obtain a linear standard curve (3,5,6). The test results can then be interpreted 

from the standard curve without the need of taking the specific activities of the number of 

[ 3 H] dNTPs incorporated into account. 

References 

1. Syvänen, A.-C., Aalto-Setälä, K., Harju, L., Kontula, K., and Söderlund, H. (1990) A 

primer-guided nucleotide incorporation assay in the genotyping of apolipoprotein E. 

Genomics 8, 684–692. 

2. Suomalainen, A. and Syvänen, A.-C. (2000) Quantitative analysis of human DNA sequences 

by PCR and solid-phase minisequencing. Mol. Biotechnol. 15, 123–131. 

3. Suomalainen, A., Kollmann, P., Octave, J.-N., Söderlund, H., and Syvänen, A.-C. (1993) 

Quantification of mitochondrial DNA carrying the tRNA 

Lys 8344 point mutation in myoclonus 

epilepsy and ragged-red-fiber disease. Eur. J. Hum. Genet. 1, 88–95. 

4. Syvänen, A.-C. (1999) From gels to chips: “Minisequencing” primer extension for analysis 

of point mutations and single nucleotide polymorphisms. Hum. Mutat. 13, 1–10. 

5. Syvänen, A-C., Söderlund, H., Laaksonen, E., Bengtström, M., Turunen, M., and Palotie, A. 

(1992) N-ras gene mutations in acute myeloid leukemia: accurate detection by solid-phase 

minisequencing. Int. J. Cancer 50, 713–718. 

6. Suomalainen, A., Majander, A., Pihko, H., Peltonen, L., and Syvänen, A.-C. (1993) 

Quantification of tRNA 

Leu 3243 point mutation of mitochondrial DNA in MELAS patients 

and its effects on mitochondrial transcription. Hum. Mol. Genet. 2, 525–534. 

7. Chen, X. and Kwok, P. Y. (1997) Template-directed dye-terminator incorporation (TDI) 

assay: a homogeneous DNA diagnostic method based on fluorescence resonance energy 

transfer. Nucleic Acids Res. 15, 347–353. 

8. Pastinen, T., Perola, M., Niini, P., Terwilliger, J., Salomaa, V., Vartiainen, E., et al. (1998) 

Array-based multiplex analysis of candidate genes reveals two independent and additive 

risk factors for myocardial infarction in the Finnish population. Hum. Mol. Genet. 7, 

1453–1462. 

9. Pastinen, T., Partanen, J., and Syvänen, A.-C. (1996) Multiplex, fluorescent solid-phase 

minisequencing for efficient screening of DNA sequence variation. Clin. Chem. 42, 

1391–1397. 

10. Sitbon, G., Hurtig, M., Palotie, A., Lönngren, J., and Syvänen, A.-C. (1997) A colorimetric 

mini-sequencing assay for the mutation in codon 506 of the coagulation factor V gene. 

Thrombosis Haemostasis 77, 701–703. 

11. Ihalainen, J., Siitari, H., Laine, S., Syvänen, A.-C., and Palotie, A. (1994) Towards automatic 

detection of point mutations: use of scintillating microplates in solid-phase minisequencing. 

BioTechniques 16, 938–943.

Inosine-Containing Primers 367 

54 

Direct Sequencing with Highly Degenerate 

and Inosine-Containing Primers 

Zhiyuan Shen, Jingmei Liu, Robert L. Wells, and Mortimer M. Elkind 


Among the many techniques of cloning new genes, one approach involves degenerate 

primers (1–7). The approach usually requires the following three steps: 

1. Using degenerate primers to amplify part of the gene of interest by PCR: The degenerate 

primers’ sequences may be designed from known protein sequences or conserved regions 

of a gene family (e.g., ref. 2,4). Because deoxyinosine can base pair with all of the four 

deoxyribonucleotides, it has been substituted for specific nucleic acids in degenerate 

primers to reduce the number of different primer sequences that would otherwise be 

needed in the reaction (2,7,8). 

2. A determination of which amplified PCR product(s) is from the gene of interest: If the 

target gene and the primers are only partially homologous, a moderate annealing stringency 

in PCR is usually necessary to obtain amplification. Moderate stringency may result in 

multiple PCR products. Although from the size of the PCR products it may be possible 

to predict which is from the gene of interest, sequencing analysis of the PCR products 

may be required. 

3. The screening of a cDNA library using the correct PCR product as a probe and cloning 

the gene of interest. 

Sequencing the amplified PCR product is one of the most important steps in this 

approach to gene cloning. To sequence the PCR fragment amplified by degenerate 

inosine-containing primers, the PCR fragment may be cloned into a sequencing vector, 

such as M13 bacteriophage. Sequencing is straightforward if primers specific to the 

vector are used. Theoretically, this method allows any unknown cloned DNA fragment 

to be sequenced. However, the Taq polymerase, which is used to amplify the target 

fragment, is thought to have relatively high misincorporation rates for dNTPs, or ~10 –4 . 

Hence, it is possible that a copy of the product may contain one or more incorrect 

nucleotides. If such a copy has been cloned into the sequencing vector, the resulting 

sequencing data would be incorrect for that particular clone. Direct sequencing of PCR 

products can circumvent this problem because most of the fragments are exact replicas 

of the target molecule. Thus, the majority of the products used for sequencing would 

have the right nucleotide at a specified position and result in the correct sequencing 



367

368 Shen et al. 

ladder. Also, direct sequencing of PCR products avoids the time-consuming cloning 

of PCR products, and most of the available direct PCR sequencing protocols require 

relatively small amounts of template. 

Many protocols are available for the direct sequencing of PCR products. Most of 

the protocols require specific sequencing primers. However, this means at least part of 

the specific base sequence of the template is needed. This requirement may not be met 

and, in many cases, information about the internal sequence of a gene may be lacking. 

This shortcoming may apply to the PCR products of degenerate inosine-containing 

primers of the cDNA of a new gene. Therefore, one may be forced to use the same 

degenerate inosine-containing primers that were used in the PCR step for direct 

sequencing. When primers have low degeneracy, they may be treated as sequencespecific 

primers, and some of the direct-sequencing protocols, such as those described 

in this volume, may be used with success. When only highly degenerate inosinecontaining 

primers are available, these methods may not succeed. 

To sequence a PCR product amplified via the use of a highly degenerate inosinecontaining 

primers, several general factors must be kept in mind. 

1. The sequencing primer(s) must anneal specifically to one site on the DNA fragment that is 

to be sequenced, that is, a secondary annealing site must be avoided. Therefore, stringent 

primer annealing temperatures are necessary. 

2. A sufficient quantity of the specific primer should anneal to the correct site. Consequently, 

the primer annealing temperature cannot be too high. 

3. Reassociation of the double-stranded DNA template should be minimized. This requirement 

generally can be met by using optimal PCR protocols for the sequencing reactions. 

To perform the requirements above, a primer-labeling method, in which the primer 

is labeled at the 5′ end, may be worth considering. Linear PCR is used to generate 

the labeled dideoxynucleotide-terminated sequences (9,10). The use of this method 

minimizes problems of template reassociation and/or mismatching of the primer 

because the annealing time is relatively short. Also, the annealing temperature is higher 

than it would be in most protocols that use DNA polymerases other than Taq, such as 

T4 DNA polymerase, but the method requires a 5′ end-labeling step for which 35 S is 

generally not suitable compared with 32 P because of its lower specific activity and the 

lesser efficiency with which some enzymes label 5′ ends with α- 35 S ATP versus α- 32 P 

ATP. Only 32 P can be used, even though its greater radiation hazard owing to its higher 

β-particle emission and its shorter half-life make it less convenient. Furthermore, 

when highly degenerate primers are used, higher primer concentrations in the reaction 

mixture are needed to insure that sufficient specific priming will occur. The preceding 

increases the hazard as well as the cost. 

To assure that sequencing primer(s) anneal to a DNA template specifically, to 

eliminate the need for 5′ end labeling, and to avoid reassociation of the double-stranded 

DNA template, a two-step cycle-sequencing protocol is described to sequence products 

amplified with degenerate inosine-containing primers. This method uses the same 

degenerate primers that were used in PCR amplification. The method can be broken 

down into two steps of linear PCR. The first step is for labeling the primers, and the 

second is for the random dideoxy termination. As shown in Fig. 1, in the first step, 

primers were extended and labeled with α- 35 S -dATP. The extension is limited and 

performed under conditions of high stringency, low dNTP concentration, and a short


Fig. 1. Procedure of cycle sequencing with degenerate inosine-containing primers. Two 

linear PCR steps are involved. 1. Label PCR uses low dNTP concentrations, a low temperature, 

and short times for primer annealing/elongation to produce incomplete extension of specific 

primers. As a result, specific primers are labeled and extended. The extended and labeled 

primers have a higher melting temperature than the native printers. 2. Termination PCR using 

a higher annealing/elongation temperature and is performed with higher dNTP concentrations 

and in the presence of ddNTPs. Only the extended and labeled primers are involved in the 

termination reaction. 

interval so that the specific primer in the mixture is favored and a limited length of 

primer extension is achieved. In the second step, dideoxynucleotide terminations are 

effected at a more stringent elevated annealing/elongation temperature. The result is 

that only the extended and labeled primers enter into the termination reactions. 

We have used this method to sequence amplified cytochrome p450 cDNA fragments 

with a highly degenerate inosine-containing primer (1,2). In our case, a set of degenerate 

primers was used to amplify a presumably novel cytochrome p450 gene(s). The upstream 

sense primer was a mix of 192, 20mer, containing three inosines that theoretically could 

anneal to 12,288 different sequences. The downstream antisense primer was a mix of 

144, 23 mer, containing five inosines or 147,456 different possible sequences. 

In what follows, we will only describe the sequencing reactions. Procedures for 

sequencing gel electrophoresis can be found in Chapter 51. 

2. Materials 

1. A thermal cycler: Cetus Perkin–Elmer Model 480 (see Note 1). 

2. PCR tubes (0.5 mL).



4. Gel-purification kits/reagents, such as QIAEX Gel Extraction Kit (Qiagen #20020, 

Chatsworth, CA) or QiaOuick Gel Extraction Kit (Qiagen #28704). 

5. All buffers and solutions must be free of DNase. 

6. α- 35 S-dATP (10 µCi/µL 1000 Ci/mmol; Amersham Corp). 

7. Sequencing primers (degenerate primers) dissolved in H 2 O, or 0.1× TE buffer. 

The sequencing reaction reagents can be homemade. However, we recommend purchasing 

them from a commercial company to ensure uniform performance. In the following 

materials, we include the catalog number for US Biochemicals (Cleveland, OH). 

8. Reaction buffer (USB #71030): 260 mM Tris-HCl, pH 9.5; 65 mM MgCl 2 . 

9. ∆Taq DNA polymerase (USB #71059) or Taq DNA polymerase, (USB# 71057): 32 U/µL. 

10. Taq DNA polymerase dilution buffer (USB #71051): 10 mM Tris-HCl, pH 8.0, 1 mM 

2-mercaptoethanol, 0.5% Tween-20, and 0.5% Nonidet P-40. 

11. Four separate primer label mixes: dGTP label mix: 3.0 µM (USB #71034); dATP label 

mix: 3.0 µM (USB #71036); dTTP label mix: 3.0 µM (USB #71037); and dCTP label 

mix: 3.0 µM (USB #71038). 

12. Four separate termination mixes: ddG terminator mix: 15 µM each dGTP, dATP, dTTP, 

dCTP, and 22.5 µM ddGTP (USB #71020); ddA termination mix: 15 µM each dGTP, dATP, 

dTTP, dCTP, and 300 µM ddATP (USB #71035); ddT termination mix: 15 µM each dGTP, 

dATP, dTTP, dCTP, and 450 µM ddTTP (USB #71040); and ddC terminator mix: 15 µM 

each dGTP, dATP, dTTP, dCTP, and 75 µM ddCTP (USB #71025). 

13. Stop/gel-loading solution (USB #70724): 95% formamide, 20 mM EDTA, 0.05% bromophenol 

blue, and 0.05% xylene cyanol FF. 

14. 1× TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 

3. Methods 

3.1. Preparation of DNA as a Sequencing Template (see Note 2) 

1. After gel electrophoresis, PCR fragment(s) of interest is cut out from the gel. 

2. DNA in the gel is purified with the Qiagen gel-purification kit, and final PCR products are 

resuspended in a proper amount of 0.1× TE buffer. 

3. To estimate the amount of PCR product, run an aliquot of the PCR products on an agarose 

gel. The amount of DNA may be estimated by a comparison with the amount of DNA 

that was used in the mol-wt ladder. 

In the following steps, always keep tubes on ice, unless otherwise indicated. 

4. Prepare the following labeling PCR mix (see Note 3): 

H 2 O 10–8 µL 

DNA (in 0.1× TE) (need total of 25–100 ng) 11–9 µL 

Reaction buffer 12 µL 

Degenerate primers (5–200 µM) 11 µL 

dGTP label mix 11 µL 

dCTP label mix 11 µL 

dTTP label mix 11 µL 

α- 35 S-dATP (10 µCi/µL >1000 Ci/mmol) 10.5 µL 

Taq DNA polymerase (4 U/µL) (diluted in Taq dilution buffer) 12 µL 

Total volume 17.5 µL 

Cover the label PCR mix with 10–20 µL of mineral oil. 

3.2. Labeling PCR (see Note 4) 

1. Run the following PCR program: presoak at 94°C for 3 to 5 min followed by 45 cycles 

of 95°C for 30 s and 52°C for 30 s.


2. Transfer 15 to 16 µL of the above labeled mixture to a new tube. Avoid carryover of any 

mineral oil. This can be done easily by putting the pipetting tip directly below the oil 

without touching the wall of the tube. 

3. Optional (see Note 5): Load 1 to 2 µL with 1 µL of gel-loading buffer to a sequencing 

gel to check the labeling efficiency. 

4. Termination PCR mix: For each of the labeled mixes, prepare four tubes labeled as “G,” 

“A,” “T,” and “C.” To each of the tubes, add 4 µL of termination mix G, A, T, or C (this can 

be done toward the end of label-PCR procedure). Add 3.5 µL of the label mix to each of 

the tubes. Cover the termination PCR mix with 8 to 10 µL of mineral oil. 

5. Termination PCR: Cycle between 95°C for 30 s and 72°C for 90 s (see Note 6). 

6. While the termination PCR is under way, prepare four clean 0.5-mL tubes labeled G, A, T, 

or C. To each of them add 4 µL of stop/gel-loading solution. 

7. Transfer 6 to 7 µL of termination mix to these tubes with the stop/loading solution. 

Avoid carryover of mineral oil. Mix and spin down briefly and store at –20°C (good for 

up to 1 mo). These samples are ready for the sequencing gel (use 3 µL to load a gel). 

See Chapter 51. 

8. Sequencing results: run sequencing gel, perform autoradiography, and read the sequence 

(see Note 7). 

4. Notes 

1. Cetus Perkin–Elmer thermal cycler Model 9600 also may be used. If it is, use 0.1-mL 

tubes; no mineral oil on the top of the reaction solution is needed. The PCR program 

should be adjusted accordingly in the procedure. 

2. Other methods of DNA preparation are also acceptable as long as “clean” DNA is 

obtained. 

3. Other {a- 35 S-labeled nucleotides may also be used, but the label mix must be changed 

accordingly. The concentration of the stock of degenerate primers in the reaction is 

dependent on the degree of degeneracy. In our case, the stock concentration of our >100∞ 

degenerate primer was 200 µM. Because radioactive 35 S is used for these experiments, 

always be careful and follow the safety operation procedure for your institute. Check 

with your radiation safety officer for the authorized amount of radioactivity that you can 

handle at any one time. 

4. Depending on the sequencing primer, the annealing/elongation temperature or time may 

have to be optimized to give proper primer extension and labeling. The purposes of the 

label PCR is to have a sufficient amount of specific primer in the primer mix to anneal to a 

specific site on the DNA template and to extend the annealed primer for a limited nucleotide 

length with Taq DNA polymerase. The first purpose can be achieved by choice of an optimal 

annealing temperature and/or time. In our case (200 pmol of the 20 mer with inosine and 

a degeneracy of more than 100∞), we used 52°C and 30 s. Depending on circumstances, 

this temperature and the annealing time may need to be adjusted. The method of generating 

a limited elongated primer plus labeling of the primer is accomplished by using a shorter 

annealing/elongation time at a suboptimal temperature (for Taq activity), but still a stringent 

temperature for annealing and a low dNTP concentration. In this way, it is not necessary to 

know the sequence of the downstream flanking region of the sequencing primer. 

5. Loading 1 to 2 µL of labeled mix to run a gel to check that the length of primer extension 

and label efficiency is optional. This can be run along with the sequencing sample after 

all the reactions are finished. Using our p450 degenerate sequencing primers under these 

labeling PCR conditions, we obtained an average primer extension of 15 to 25 bp. 

6. The temperature used for both the annealing of labeled/extended primers to the DNA 

template for the elongation/termination reaction was 72°C. Only the prelabeled and pre-


extended primers, which are the specific primers in the primer mix, would be allowed 

during the termination/elongation because of the elevated temperature. If more template 

DNA is available, fewer cycles may be used. 

7. Depending on the length of labeled primers, the readable sequence will vary. For our 

case of highly degenerate inosine-containing primers of p450 genes (see Subheading 1. 

for a description of our p450 primers) a ladder from 25 bp downstream of the primer 

was readable up to 300 bp. 

8. A similar protocol of this method would be to omit one of the four dNTPs in the label step 

and use at least one α- 35 S-labeled dNTP in the labeling mix. This will give an incomplete 

elongation of the sequencing primer during the labeling step because the primer extension 

will stop at the proper position when the omitted nucleotide is not present. The elongated 

primers may be labeled if the labeled nucleotide is by chance present between the sequence 

primer and the omitted nucleotide. This method is useful to sequence DNA when some 

sequence information immediately downstream from the sequencing primer is available. In 

such a case, one can decide which nucleotide to omit or to label in the label mix. 

References 

1. Shen, Z., Liu, J., Wells, R. L., and Elkind, M. M. (1993) Cycle sequencing using degenerate 

primers containing inosines. BioTechniques 15, 82–89. 

2. Shen, Z., Wells, R. L., Liu, J., and Elkind, M. M. (1993) Identification of a cytochrome 

p450 gene by reverse transcription-PCR using degenerate primes containing inosines. Proc. 

Natl. Acad. Sci. USA 90, 11,483–11,487. 

3. Shen, Z., Liu, J., Wells, R. L., and Elkind, M. M. (1994) cDNA cloning, sequence analysis, 

and induction by aryl hydrocarbons of a murine cytochrome p450 gene, Cyplbl. DNA 

Cell Biol. 13, 763–769. 

4. Shen, Z., Denison, K., Lobb, R., Gatewood, J., and Chen, D. J. (1995) The human and 

mouse homologs of yeast RAD52 genes: cDNA cloning, sequence analysis, assignment 

to human chromosome 12pl2.2-pl3, and mRNA expression in mouse tissues. Genomics 

25, 199–206. 

5. Compton, T. (1990) Degenerate primers for DNA amplification, in PCR Protocol, a Guide 

to Methods and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., 

eds.), Academic, San Diego, CA, pp. 39–45. 

6. Lee, C. C. and Caskey, C. T. (1990) cDNA cloning using degenerate primers, in PCR 

Protocol, a Guide to Methods and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J., 

and White, T. J., eds.), Academic, San Diego, CA, pp. 46–59. 

7. Knoth, K. S., Roberds, S., Poteet, C., and Tamkun, M. (1988) Highly degenerate inosinecontaining 

primers specifically amplify rare cDNA using the polymerase chain reaction. 

Nucleic Acids Res. 16, 10932. 

8. Erlich, H. A., Gelfand, D., and Sninsky, J. J. (l99l) Recent advances in the polymerase 

chain reaction. Sciences 252, 1643–1651. 

9. Murray, V. (1989) Improved double strand DNA sequencing using the linear polymerase 

chain reaction. Nucleic Acids Res. 17, 8889. 

10. Smith, D. P., Jonstone, E. M., Little, S. P., and Hsiung, H. M. (1990) Direct DNA sequencing 

of cDNA inserts from plaques using the linear polymerase chain reaction. Biotechniques 

9, 48–52.

Unknown Genomic Sequences 373 

55 

Determination of Unknown Genomic Sequences 

Without Cloning 

Jean-Pierre Quivy and Peter B. Becker 


The inherent problems of sensitivity and specificity that one encounters when trying 

to determine a particular nucleotide sequence directly in its genomic context can be 

overcome by selective amplification of the region of interest. This amplification of 

the target DNA is usually achieved by one of two strategies: The relevant piece of 

DNA may be cloned and therefore amplified in a bacterial cell or, alternatively, the 

desired fragment may be amplified in vitro using PCR technology. Both strategies have 

drawbacks. The cloning of a specific genomic sequence is labor intensive, lengthy, 

and sometimes even difficult to achieve. The PCR amplification requires that enough 

sequence information is known to be able to design the two specific amplification 

primers and is therefore limited to sequencing alleles of already-known DNA. There 

are, however, many cases that would benefit from the determination of unknown 

genomic sequence close to a known piece of DNA. With a particular cDNA in hand, one 

may wish, for example, to determine genomic gene sequences, such as the promoter 

of the gene, its introns, or 5′- and 3′-nontranscribed regions. The protocol presented 

here uses ligation-mediated polymerase chain reaction (LM-PCR) to amplify unknown 

genomic DNA next to a short stretch (about 100 bp) of known sequence and details 

a convenient procedure to determine the new sequence by dideoxy sequencing (1). 

The procedure may form the basis for “walking sequencing” strategies to determine 

large regions of continuous sequence information starting from a limited piece of 

known DNA. 

The central feature of the LM-PCR technique is the ligation of a known short 

oligonucleotide, the “linker,” to selected ends of genomic DNA fragments (Fig. 1). 

These generic linker sequences provide the second primer for amplification of linked 

fragments in combination with an oligonucleotide based on known sequences. LM-PCR 

was first introduced for genomic footprinting and chemical sequencing (2,3). The 

disadvantages of chemical sequencing over the chain termination method (1) prompted 

us to adapt LM-PCR technology for direct dideoxy sequencing of genomic DNA (4). 

The underlying procedure is derived from a variation of the original LM-PCR protocol 

called “Linker Tag Selection LM-PCR” (5). 



373

374 Quivy and Becker 

Fig. 1. The use of Linker Tag Selection LM-PCR for genomic dideoxy sequencing. Bold 

lines denote known sequences, and thin lines the unknown sequences to be determined. The 

arrows and dotted lines indicate primer extension reactions. R: Strategic restriction site. P1, P2, 

P3, and LP stand for the primers 1, 2, 3, and the linker primer, respectively. The biotin moiety on 

the linker is represented by a filled circle, and the streptavidin-coated paramagnetic beads by the 

shaded boxes. (H): Radiolabeled P3 is used to prime dideoxy sequencing reactions. 

The steps of the reaction are outlined in Fig. 1. A restriction enzyme is selected 

that cleaves the genomic DNA somewhere within the unknown sequence but within 

1 kb from the known sequence for which the specific primers have been designed. 

Cleavage creates a defined end (A). The cleaved genomic DNA is denatured, and 

the gene-specific primer 1 is annealed to the known sequence and extended by a 

polymerase until the end of the restriction fragment (B). This creates a blunt end to 

which a short double-stranded linker is ligated (C). The linker DNA consists of two 

complementary oligonucleotides, the longer one being biotinylated at its 5′-end. After 

denaturation, the specific primer 2, representing sequences more 3′ from primer 1 on 

the lower strand of the known sequence, is then annealed to the upper strand, which 

now carries the biotinylated linker oligonucleotide at its 5′-end. The primer is again 

extended to the end (D) creating a double-stranded fragment that contains a region 

of unknown DNA flanked by known sequences. The genomic sequences can now be


Fig. 2. Genomic sequences of the Drosophila hsp27 promoter region obtained following the 

outlined procedure. Arrows indicate the full-length restriction fragment. (A) Long and short 

gel runs of the same sequencing reaction obtained using the enzyme NruI, which cut 821 bases 

upstream of the 5′-end of primer 1. (B) Upper part of a sequence obtained using the enzyme PstI 

cutting 332 bases away from the 5′-end of primer 1. The sequence of the linker oligonucleotide 

at the end of the genomic sequence can be unambiguously identified. 

amplified by PCR using a combination of the biotinylated linker primer and primer 

2 (E). The biotinylated amplification products are then immobilized on streptavidincoated 

paramagnetic beads and purified from the PCR in a magnetic field (F). This 

step efficiently removes unincorporated primers, which interfere with the subsequent 

sequencing reaction. The immobilization also facilitates the handling of the template 

fragments during the subsequent steps and specifically allows the sequencing of a singlestranded 

template. The immobilized fragments are denatured, and the complementary 

strand is removed by washes (G). Radioactively labeled specific primer 3, again located 

3′ to primer 2 on the lower strand, now serves to prime a standard chain termination 

sequencing reaction that finally generates the sequencing ladder (H). Sequences start to 

be readable about 25 bases 3′ from primer 3, and may extend for up to 1 kb depending on 

the location of the restriction site and the efficiency of the overall process (Fig. 2A). 

Important features of the procedure are the use of a proofreading polymerase for the 

PCR amplification (the Vent DNA polymerase possesses a 3′-5′ exonuclease activity)


that decreases the error rate during the amplification, and the use of an enzyme without 

the 3′-5′ exonuclease activity (e.g., Vent Exo) for efficient single primer extensions. 

The immobilization of the amplified fragments on paramagnetic beads exploiting the 

strong streptavidin/biotin interaction is crucial for the efficiency of the sequencing 

reaction because it allows the efficient removal of interfering primers from the PCR and 

permits the use of a single-strand template (4,5). The attachment of the sequenced DNA 

fragment to the solid support does not create a steric hindrance for the polymerase. 

Frequently, the sequence of the linker oligonucleotide itself can be determined at the 

very end of the genomic sequence (see Fig. 2B). 

The length of sequence determined critically depends on the ability to resolve long 

fragments with single nucleotide resolution, provided that the restriction site used for 

linker ligation is not too close to the known sequence. Fragments of over 800 bp have 

yielded reliable sequence information (Fig. 2A). Longer sequences can be obtained 

in walking strategies where the newly determined sequence is in turn used to design 

further reaching sets of primers. The presented strategy critically relies on the previous 

identification of a suitable restriction site, ideally between 0.5 and 1 kb away from 

the known sequence. Too short fragments will yield little new sequence information, 

whereas large fragments (exceeding 1 kb) do not work, presumably because of 

decreasing efficiencies in DNA denaturation and primer extensions reactions. Because 

any kind of restriction enzyme will work, a site can be conveniently identified on a 

Southern blot testing a small selection of enzymes that cut the genome at a reasonable 

frequency. Alternatively, a selection of enzymes can simply be tried at random in an 

LM-PCR sequencing reaction. To increase the chances that the reaction will work, the 

genomic DNA may be cleaved with a whole cocktail of enzymes that collectively have 

a high likelihood to produce a suitable restriction fragment. 

2. Materials 

2.1. Purification and Restriction of Genomic DNA 

1. Suspension of nuclei from desired organism (see Note 1). 

2. 0.5 M EDTA, pH 8.0. 

3. RNase A, DNase free, 10 mg/mL (Boehringer, Mannheim). 

4. Aqueous solution of N-lauroylsarkosine (sarkosyl), 20% (P/V) (Sigma). 

5. Proteinase K, 10 mg/mL (Merck). 

6. Phenol, highest quality, neutralized, and equilibrated with TE (10 mM Tris-HCl, pH 7.5; 

1 mM EDTA; Aurresco). 

7. Phenol/chloroform/isoamyl alcohol mixture (25241; Aurresco). 

8. Chloroformisoamyl alcohol (241; Merck). 

9. 0.3 M sodium acetate, pH 5.2. 

10. Ethanol 100%. 

11. Ethanol 80%. 

12. TE: 10 mM Tris-HCl, pH 7.5, 1 mM EDTA. 

13. Restriction enzyme with suitable 10× reaction buffer (see Note 2). 

2.2. Primer Design, Primer Purification, and Annealing 

of the Linker Primer (see Note 3) 

The primers were synthesized on an ABI 394 DNA synthesizer and gel purified 

(see Subheading 3.2.).


1. Primer 1 (P1): a 18-22 mer with a calculated T m around 45 to 50°C. Working concentration: 

0.5 pmol/µL. 

2. Primer 2 (P2) should have the same melting temperature as the long-linker primer (see 

Note 4) used for the PCR amplification, in our case a 25 to 27 mer with a calculated T m 

of 60 to 65°C. The guanine-cytosine content is usually between 45 and 55%. It does not 

need to overlap with P1, but a 5-bp overlap has worked. It should be internal to primer 2 to 

increase the specificity of the overall reaction. Working concentration: 10 pmol/µL. 

3. Primer 3 (P3): an 18 to 22 mer with a calculated T m around 45 to 50°C, but longer 

oligos with higher GC contents will also work. It should be internal to P2 to increase the 

specificity. It will be 32 P kinased with an SA of 10 7 cpm/pmol (see Subheading 3.3.). 

Working concentration: 0.2 pmol/µL. 

4. Long-linker oligonucleotide: 5′ CACCCGGGAGATCTGAATTC 3′ (see Note 4). It is 

biotinylated at its 5′-end during synthesis by incorporation of a biotin-2-o-propylphosphoramidite. 

It should be unphosphorylated. 

5. Short-linker oligonucleotide: 5′ GAATTCAGATC 3′, dephosphorylated. 

6. Oligo loading mix: 10% glycerol in formamide. 

7. Denaturing polyacrylamide gel: 14.5% acrylamide, 0.5% bis-acrylamide, 7 M urea, 1× TBE. 

Size: 25 × 25 × 0.1 cm. 

8. Formamide loading buffer: 96% formamide, 0.05% xylene cyanol, 0.05% bromophenol 

blue, 10 mM EDTA. 

9. PE buffer: 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% phenol (v/v). 

10. Chloroformisoamyl alcohol (241; Merck). 

11. 5 M LiCl. 

12. 1 M MgCl 2 . 

13. Ethanol 100%. 

14. Ethanol 80%. 

15. TBE: 90 mM Tris-borate, 1 mM EDTA, pH 8.3. 

2.3. Kinasing of Primer 3 

1. P3 at 10 pmol/µL. 

2. Polynucleotide kinase buffer 10×: 700 mM Tris-HCl, pH 7.6, 100 mM MgCl 2 , 50 mM DTT. 

3. γ 32 PATP, 5000 Ci/mmol (Redivue, Amersham). 

4. Polynucleotide kinase 10 U/µL (NE Biolabs). 

5. 50 mM EDTA, pH 8.0. 

6. G-25 fine spin columns (Boehringer, Mannheim). 

2.4. First Primer Extension 

1. P1 at 0.5 pmol/µL in TE, pH 7.5. 

2. 1 N NaOH. 

3. TES buffer: 560 mM TES, free acid (Sigma), 240 mM HCl, 100 mM MgCl 2 . 

4. Vent buffer (10×): 100 mM KCl; 100 mM (NH 4 ) 2 SO 4 , 200 mM Tris-HCl, pH 8.8, 20 mM 

MgSO 4 , 0.1% Triton X-100 (NE Biolabs). 

5. dNTP solution: 10 mM dNTPs, (Boehringer, Mannheim); keep in small aliquots at –20°C. 

Do not freeze/thaw more than three times. 

6. Vent Exo DNA polymerase, 2 U/µL (NE Biolabs). 

2.5. Ligation 

1. Ligase buffer (10×): 500 mM Tris-HCl, pH 7.5, 100 mM MgCl 2 , 100 mM DTT, 10 mM 

ATP, 250 µg/mL BSA (NE Biolabs).


2. Solution of 40% PEG 8000 (Sigma), filtered through a 0.22-µm filter. It will take some 

time to dissolve the PEG in water. Incubate at room temperature on a rotating wheel for 

several hours. It also takes some force to filter the solution using a syringe. 

3. T4 DNA ligase, 400 U/µL (NE Biolabs). 

4. Annealed linker (see Subheading 3.4.). 

2.6. PCR 

1. TE: 10 mM Tris-HCl, pH 8.5; 1 mM EDTA, pH 8.5. 

2. Phenolchloroformisoamyl alcohol (25241; Aurresco). 

3. Solution of 7.5 M ammonium acetate containing 25 µg/mL yeast tRNA (Boehringer 

Mannheim). Crude yeast tRNA has to be cleaned by multiple organic extractions and 

ethanol precipitation. 

4. Vent buffer (see Subheading 2.4.). 

5. dNTP solution (see Subheading 2.4.). 

6. 100 mM MgSO 4 . 

7. P2 solution, 10 pmol/µL (see Subheading 2.2.). 

8. Long-linker primer, 10 pmol/µL (see Subheading 2.2.). 

9. Vent DNA polymerase 2 U/µL (NE Biolabs). 

10. Perkin–Elmer thermal cycler. 

11. PCR tubes (Perkin–Elmer). 

12. Mineral oil (PCR-grade). 

2.7. Tag Selection of the PCR Products 

1. Dynabeads M-280 streptavidin (Dynal, Oslo, 10 mg/mL). 

2. Magnetic particle concentrator (MPC, Dynal). 

3. Phosphate-buffered saline (PBS), pH 7.4. 

4. PBS, pH 7.4; 0.01% BSA (molecular biology grade). 

5. BW solution: a 11 mixture of TE and 5 M NaCl. 

2.8. Sequencing Reaction (see Note 7) 

1. MPC. 

2. 150 mM NaOH, freshly prepared. 

3. TE, pH 7.5. 

4. Vent buffer (see Subheading 2.4.). 

5. Termination mixes made up in 1× vent buffer: 

A-mix: 900 µM ddATP, 30 µM dATP, 100 µM dCTP, 100 µM dGTP, 100 µM dTTP. 

C-mix: 480 µM ddCTP, 30 µM dATP, 37 µM dCTP, 100 µM dGTP, 100 µM dTTP. 

G-mix: 400 µM ddGTP, 30 µM dATP, 100 µM dCTP, 37 µM dGTP, 100 µM dTTP. 

T-mix: 720 µM ddTTP, 30 µM dATP, 100 µM dCTP, 100 µM dGTP, 33 µM dTTP. 

6. Labeled P3 (see Subheading 3.3.). 

7. Circumvent sequencing buffer 10×: 100 mM KCl, 100 mM (NH 4 ) 2 SO 4 , 200 mM Tris-HCl, 

pH 8.8, 50 mM MgSO 4 (NE Biolabs). 

8. Triton X-100 solution, 3% (v/v) in water. 

9. Vent Exo DNA polymerase, 2 U/µL (NE Biolabs). 

10. Formamide loading buffer (see Subheading 2.2.). 

11. Sequencing gel. 

12. Fixing solution: 10% acetic acid, 10% methanol. 

13. Dupont NEN reflection films and corresponding cassettes.


3. Methods 

3.1. Purification of Genomic DNA and Restriction (see Note 1) 

1. Isolate nuclei from cells of interest by suitable methods (see Note 1) and spin them down 

to obtain the nuclear pellet. 

2. Resuspend the pellet in 1 mL of 0.5 M EDTA. Avoid harsh vortexing and vigorous pipetting 

to prevent shearing (see Note 1). 

3. Add 25 µL of RNase A and 25 µL of Sarkosyl, mix by inverting the tube, and incubate 

for 3 h at 37°C on a rotating wheel. 

4. Add 25 µL of proteinase K, mix by inverting the tube, and incubate overnight at 37°C 

on a rotating wheel. 

5. Add 1 mL of phenol and mix by inverting the tube several times. Spin to separate the 

phases and collect the lower phase and interphase (the lower phase is the aqueous phase 

owing to the high density of 0.5 M EDTA). 

6. Repeat step 5, but do not take the interphase. 

7. Add 1 mL of phenolchloroform and collect the upper phase (which is now the aqueous 

phase). 

8. Dialyze overnight (or longer) against TE, pH 7.5, with at least four changes of TE. Avoid 

a large increase in volume by keeping the dialysis bag tight. 

9. Precipitate DNA with one-tenth vol of 0.3 M Na acetate and 2.5 vol of cold absolute 

ethanol. 

10. Spin at 4°C to collect DNA pellet, wash with 80% ethanol, remove residual ethanol, but 

do not dry too long since the DNA will be difficult to redissolve. 

11. Dissolve DNA in TE, pH 7.5, and store at 4°C. 

12. Restriction digest of genomic DNA: Digest 10 µg of DNA with 1 U/µg of restriction 

enzyme according to the manufacturer’s recommendation (see Notes 2 and 4) for at least 

3 h (up to overnight). 

13. Extract DNA once with phenol, once with phenol:chloroform, once with chloroform, and 

precipitate with one-tenth vol of 0.3 M Na acetate and 2.5 vol of cold 100% ethanol. 

14. Spin at 4°C, wash DNA pellet with 80% ethanol, and remove residual ethanol in the 

SpeedVac. Again, do not dry too long. Resuspend DNA in TE, pH 7.5, and adjust 

concentration to 1 µg/µL (OD at Aµ260). 

15. Extract once more with chloroform, and remove traces of chloroform in the SpeedVac. 

3.2. Purification of Oligonucleotide Primers and Annealing 

of the Linker Fragment 

1. Dry down 75 nmol of the oligonucleotide in the SpeedVac concentrator and dissolve in 

75 µL of oligo loading mix. Heat for 5 min at 75°C and load 5∞15 µL onto a prerun 

denaturing polyacrylamide gel. In a separate slot load some formamide-loading buffer 

to monitor the run. Electrophorese until the bromophenol marker dye migrates to two 

thirds of the gel. 

2. By ultraviolet shadowing (6), locate the band corresponding to the full-length oligonucleotide 

and excise from the gel using a razor blade. 

3. Transfer the polyacrylamide gel slice to a 1.5-mL reaction tube containing 1 mL of PE 

buffer and incubate overnight at 37°C. 

4. Filter the supernatant through a 0.22-µm filter, prewetted with PE, with the help of a 

2-mL syringe. 

5. Wash another 100 µL of PE buffer through the filter. 

6. Extract the pooled PE solutions with chloroform and dispense 2∞450 µL of the upper 

phase into fresh tubes.


7. Precipitate the oligonucleotides by the addition of 36 µL of 5 M LiCl, 4.5 µL of 1 M 

MgCl 2 , and 1 mL cold 100% ethanol. 

8. Mix by vortexing and let precipitate at –70°C for 15 min. 

9. Spin at 4°C for 20 min in a tabletop centrifuge, wash the pellet with 80% ethanol, dry in 

the SpeedVac, and resuspend the oligonucleotide in TE, pH 7.5. 

10. Determine the concentration (OD at A 260 ) and dilute some aliquots to the working 

concentration. 

11. Annealing of linker oligos: combine in a 1.5-mL reaction tube: 20 pmol/µL of each linker 

oligonucleotide in 250 mM Tris (pH 7.5), 5 mM MgCl 2 . Heat at 95°C for 5 min, transfer 

to a beaker containing boiling water, and allow to cool slowly at room temperature for 5 h 

(up to overnight in the cold room). Aliquot the linker solution and store at –20°C. Aliquots 

are only used once and never refrozen. 

3.3. Kinasing of Primer 3 

1. Combine in a tube 1 µL of P3 (10 pmol), 3 µL of 10× T4 polynucleotide kinase, and 

10.5 µL of water. 

2. Add 15 µL of γ 32 PATP and 0.5 µL of polynucleotide kinase. 


4. Add 20 µL of 50 mM EDTA, pH 8.0, and heat at 65°C for 10 min. 

5. Purify the labeled oligonucleotide from the unincorporated label by a G-25 spin column. 

3.4. First Primer Extension 

1. Combine in a tube: 0.5 to 1 µg of restricted genomic DNA (see Subheading 3.1. and Note 4), 

1 µL P1 (0.5 pmol), 1 µL 1 N NaOH, and water to 8 µL. 


3. Immediately add 2 µL of TES buffer and mix. 

4. Spin to collect and incubate for 10 min at room temperature. 

5. Add 9 µL of a mix containing 2 µL of 10× Vent buffer, 0.4 µL of 10 mM dNTPs, 

6.6 µL of H 2 O. 

6. Incubate at 50°C for 10 to 20 min. 

7. Add 1 µL of the Vent Exo (2 U). 


9. Chill on ice, spin to collect liquid, and proceed immediately to ligation. 

3.5. Ligation 

1. Prepare a premix containing 5 µL of 10× ligase buffer, 19 µL of 40% PEG 8000, and 

5 µL of annealed linker (20 pmol/µL). Mix well by pipetting since the resulting solution 

is very viscous. 

2. Add 29 µL of this premix to the first primer extension reaction (see Section 3.4.). 

3. Add 1 µL of T4 DNA ligase (400 U), mix well by pipetting, and incubate overnight 

at 17°C. 

3.6. PCR 

1. To the ligation reaction, add 150 µL of TE, pH 8.5, and mix by vortexing. 

2. Add 150 µL of phenolchloroformisoamyl alcohol (25241) mix by vortexing, and 

then spin for 5 min. 

3. Collect the upper aqueous phase and transfer to a tube containing 10 µL of 7.5 M 

NH 4 Ac/yeast tRNA. Add 750 µL of cold 100% ethanol, mix by vortexing, and let 

precipitate for 15 min at –20°C.


4. Centrifuge for 20 min at 4°C, remove the supernatant, wash the pellet with 500 µL of 80% 

ethanol, and dry in the SpeedVac. 

5. Dissolve DNA in 20 µL of water, transfer to a 500-µL PCR tube, and keep on ice. 

6. Prepare a premix containing 5 µL of 10× Vent buffer, 1 µL of 10 mM dNTPs, 1 µL of 

100 mM MgSO 4 (see Note 5), 1 µL of P2 solution, 1 µL of long-linker primer, and 19.5 µL 

of water. 

7. Immediately before use, add 1.5 µL of Vent DNA polymerase (3 U) to the premix and 

mix by pipetting. Add premix to the PCR tube containing the DNA, then add two drops 

of mineral oil, and keep on ice. 

8. Transfer the tube to the thermal cycler (one droplet of mineral oil in sample holders) 

preheated to 95°C, incubate for 2.5 min at 95°C, and subject to 18 cycles as follows: 95°C 

for 1 min, 60°C for 2 min (see Note 5), and 76°C for 3 min. Allow an increase of 5 s/cycle 

for the extension step, and end the cycling by a 10-min incubation at 76°C. 

9. The PCR can be used immediately for the labeling step or stored frozen at –20°C. 

3.7. Linker Tag Selection of the PCR Product 

1. Resuspend the Dynabeads M-280 streptavidin well and take 50 µL (500 µg beads) into 

a 1.5-mL reaction tube. 

2. Concentrate in the magnetic rack (MPC, Dynal), and remove the supernatant (0.01% 

BSA; see Note 6). 

3. Wash the beads with 100 µL of PBS (pH 7.4), concentrate, and remove the supernatant. 

Repeat this step. 

4. Resuspend beads in 100 µL of PBS/0.01% BSA by pipetting up and down until a 

homogenous suspension is achieved. Concentrate and remove supernatant. 

5. Wash the beads with 100 µL of BW solution by pipetting up and down until no aggregates 

are seen. Concentrate again. Repeat this step. 

6. Finally resuspend the beads in 100 µL of BW solution. The beads are now ready to be 

used. 

7. Add the PCR to the beads and mix well. Avoid mineral oil, which spoils the magnetic 

separation of beads (we do not recommend a chloroform extraction because traces of this 

solvent adversely affects later steps in the reaction). 

8. Incubate the tube on a rotating wheel at room temperature for 30 min. Assure that the beads 

do not sediment in the tube but also avoid a spreading of the liquid over the entire tube 

wall. A suitable agitation can be obtained by adjusting the rotation angle. 

9. Concentrate beads and discard supernatant. 

10. Wash the beads with 100 µL of BW solution. 

3.8. Template Denaturation and Sequencing Reaction (see Note 7) 

1. Resuspend beads well in 100 µL 150 mM NaOH by pipetting up and down. Incubate 

at room temperature for 5 min with occasional gentle agitation, and then for 2 min 

at 50°C. 

2. Spin shortly to collect condensed liquid and beads trapped in the lid. Concentrate beads. 

3. Remove the supernatant and resuspend the beads in 100 µL of 150 mM NaOH. Spin 

shortly to collect all the NaOH solution and concentrate beads. 

4. Discard supernatant, resuspend the beads in 100 µL of TE, pH 8.5, and concentrate again. 

Repeat this wash with TE. 

5. Resuspend the beads in 50 µL of Vent buffer and keep on ice. 

6. Prepare four tubes labeled A, C, G, and T containing 3 µL of the respective termination 

mixes (see Subheading 2.8.).


7. Prepare a premix containing 0.2 pmol labeled P3, 1.5 µL of 10× circumvent sequencing 

buffer, 1 µL of Triton X-100, and add water to 15 µL. 

8. Concentrate beads and then remove supernatant. 

9. Resuspend the beads in 15 µL of premix. 

10. Transfer 3.5 µL of this bead suspension into each tube containing a termination mix and 

mix by pipetting. 

11. Heat at 95°C for 10 s and then transfer to 50°C. Incubate for 10 to 20 min with occasional 

gentle resuspension. 

12. Add 1 µL of Vent Exo (2 U) to each tube, mix well, and immediately transfer to 76°C. 

13. Incubate for 10 min and then chill on ice. 

14. Spin to collect liquid, concentrate beads, and discard supernatant. 

15. Resuspend beads in 50 µL of water, spin shortly to collect liquid, and concentrate beads. 

16. Carefully remove all liquid and resuspend the beads in 4 µL of formamide loading 

buffer0.15 NaOH (21). Mix well to dissolve all aggregates (see Note 8). 

17. Leave for 5 min at room temperature. 

18. Incubate 3 min at 76°C, spin to collect liquid, and chill on ice. 

19. Concentrate beads and then transfer supernatant into a fresh tube on ice. 

20. Check with a hand monitor that most of the radioactivity is in the supernatant. The bead 

pellet always contains radioactivity owing to trapped P3. Usually, we do not re-extract 

the beads. 

21. Load on a prerun sequencing gel (see Chapter 51); reactions can be stored at –20°C. 

22. Fix gel in fixing solution, dry onto blotting paper, and expose the dried gel to X-ray film 

in the presence of an intensifying screen. Readable sequences are usually obtained after 

overnight exposure. 

4. Notes 

1. The genomic DNA used for genomic sequencing needs to be clean and undegraded. Any 

shearing of the DNA during preparation and handling before the first primer extension must 

be avoided. Nicks between the restriction site and the P1 priming site will be converted to 

blunt ends during the first primer extension and will give rise to a background of dominant 

bands in all four sequencing lanes. We detail here one particular protocol that consistently 

yields high molecular weight genomic DNA of good quality. In principle, other methods 

can be followed. In any case, we advise to start a DNA prep with a nuclei isolation. Some 

suggestions for how to prepare nuclei have been described (7,8). 

2. Enzymes that produce blunt ends, with 5′- or 3′-overhangs can be used because the 

fragment is anyway converted to a blunt end after the first primer extension. 

3. All oligonucleotides should be gel-purified (see Subheading 3.2.) and stored in water or 

TE, pH 7.5, at two concentrations: a stock solution (determined after the purification) and 

a diluted working solution that should not be frozen and thawed more than five times. 

The sequence-specific primers 1–3 need to be designed for each new sequencing project. 

The long and short linker oligonucleotides are constant. The distances between primers 

1/2 and 2/3 should not be longer than 10 bases; overlaps of up to 5 bp are tolerated, 

but not required. 

4. This protocol was used to sequence in the context of the Drosophila genome, which 

required changes from the original protocol described for mammalian DNA. If sequences 

are to be determined in the context of the 10 times more complex mammalian genome, 

a few parameters have to be adjusted: The amount of starting DNA used should be 

increased about five times, and the longer-linker oligos should be taken from the original 

procedure (3).


5. The annealing temperature and the optimal magnesium concentration may be optimized 

specifically for each primer, but the given conditions worked reasonably well for most 

of the primers we tested. 

6. In general, beads are concentrated by placing the 1.5-mL reaction tube on the magnetic 

rack for 10 to 20 s. If left for too long, the bead pellets become too tight and therefore 

difficult to resuspend. The supernatant is removed with a pipet tip with the tube still in 

the rack. Great care is taken at every step to resuspend the beads well by pipetting the 

suspension up and down. A drying of the bead pellets should also be avoided. 

7. The reagents used for sequencing (see Subheadings 2.8. and 3.8.) are available as a kit 

(Circumvent sequencing kit, NE Biolabs). 

8. Subheading 3.8., step 19 allows the separation of the labeled fragments from the beads, 

which facilitates gel loading. However, the presence of the beads in the sample load does 

not adversely affect the migration of DNA fragments. 

References 

1. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain-termination 


2. Pfeifer, G. P., Steigerwald, S. D., Mueller, P. R., Wold, B., and Riggs, A. (1989) Genomic 

sequencing and methylation analysis by ligation mediated PCR. Science 246, 810–813. 

3. Mueller, P. R., Garrity, P. A., and Wold, B. (1993) Ligation mediated PCR for genomic 

sequencing and footprinting, in Current Protocols in Molecular Biology vol. 2 (Ausubel, 

F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., et al, eds.), 

Current Protocols, New York, pp. 15.5.1–15.5.26. 

4. Quivy, J.-P. and Becker, P. B. (1994) Direct dideoxy sequencing of genomic DNA by 

ligation-mediated PCR. Biotechniques 16, 238–241. 

5. Quivy, J.-P. and Becker, P. B. (1993) An improved protocol for genomic sequencing and 

footprinting by ligation-mediated PCR. Nucleic Acids Res. 21, 2779–2781. 


Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 

7. Wu, C. (1989) Analysis of hypersensitive sites in chromatin. Methods Enzymol. 170, 

269–289. 

8. Bellard, M., Dretzen, G., Giangrande, A., and Ramain, P. (1989) Nuclease digestion of 

transcriptionally active chromatin. Methods Enzymol. 170, 317–346.

384 Quivy and Becker

Cloning PCR Products 385 

56 

Cloning PCR Products for Sequencing in M13 Vectors 

David Walsh 


Although numerous methods are now available for direct sequencing of polymerase 

chain reaction (PCR) products, cloning of amplified DNA for sequencing in M13 vectors 

remains an attractive approach because of the high quality of sequence information 

generated from single-stranded bacteriophage DNA templates. 

Cloning of PCR products is in theory straightforward but in practice is often 

problematical, as widely reported (1–4). Difficulties are generally ascribed to modifications 

of the DNA termini by Taq DNA polymerase. After completion of thermal cycling, 

the enzyme may remain associated with DNA ends and thus interfere with subsequent 

ligations, unless specific steps are included for its removal or inactivation. Carryover of 

Taq DNA polymerase and residual dNTPs into restriction digests can also result in 

end filling of 5′-overhangs (5), severely reducing the efficiency of cohesive-ended 

cloning strategies using restriction sites within PCR primers. Removal of Taq DNA 

polymerase by proteinase K digestion (6) or repeated phenol/chloroform extractions 

(5) circumvents these problems. 

Furthermore, the terminal transferase activity of Taq DNA polymerase catalyzes the 

nontemplate-directed addition of a single nucleotide, almost invariably deoxyadenosine 

(dA), to the 3′ ends of amplified DNA molecules (7). The resulting “ragged ends” must 

be removed if blunt-end ligation to SmaI-cut vector is required. This is best achieved 

by utilizing the strong 3′ to 5′ exonuclease activity of T4 DNA polymerase, which 

in the presence of low concentrations of dNTPs removes 3′ overhangs from doublestranded 

DNA. Cloning of amplified DNA into linearized 5′-dephosphorylated vector 

also necessitates the presence of 5′ phosphate groups on the PCR products, achieved by 

kinasing either the primers before amplification or the PCR product itself. Conveniently, 

3′-dA removal by T4 DNA polymerase and 5′-phosphorylation by T4 polynucleotide 

kinase can be performed simultaneously (8). 

Difficulties in cloning PCR products as blunt-ended molecules may be avoided 

by incorporating restriction sites into the PCR primers and cloning products more 

efficiently as cohesive-ended molecules. The major problem encountered here is the 

failure of some restriction endonucleases to cleave toward the ends of DNA fragments. 

The presence of 4 bp 5′ to the recognition sequence is sufficient for efficient cutting 



385

386 Walsh 

by most, but not all M13 polylinker enzymes (>75% digestion in 2 h by EcoRI, KpnI, 

AvaI, XmaI, PstI, BamHI, SacI, and XbaI, but 7.5 (nucleic-acidgrade) 

and chloroform (AR-grade). Store at 4°C in a dark glass bottle. 

2. Chloroform/isoamyl alcohol (241): Store at 4°C. 

3. Spin filtration device, such as Amicon Microcon (Beverly, MA) or Promega Wizard 

PCR purification unit (Madison, WI). 

4. Variable-speed microcentrifuge. 

5. TE buffer: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 

6. T4 DNA polymerase. 

7. 10× T4 DNA polymerase buffer: 500 mM NaCl, 100 mM Tris-HCl, pH 7.9, 100 mM 

MgCl 2 , and 10 mM DTT, 500 µg/mL BSA. 

8. T4 polynucleotide kinase. 

9. 10× polynucleotide kinase (PNK) forward reaction buffer: 500 mM Tris-HCl, pH 7.5, 100 

mM MgCl 2 , 50 mM DTT, 500 µg/mL BSA. 

10. T4 DNA ligase. 

11. 10× T4 DNA ligase buffer: 500 mM Tris-HCl, pH 7.8, 100 mM MgCl 2 , 100 mM DTT, 

250 µg/mL BSA. 

12. Calf intestinal alkaline phosphatase (CIP). 

13. 10× CIP buffer: 200 mM Tris-HCl, pH 8.0, 10 mM MgCl 2 , 10 mM ZnCl 2 . 

14. Restriction enzymes at 10 U/µL and 10× reaction buffers. 

15. 0.5 M EDTA, pH 8.0. 


17. Absolute ethanol, stored at –20°C. 

18. Ultrapure stock of all four dNTPs: Make 20 mM stock in sterile water and store at –20°C. 

Avoid freeze/thaw. 

19. 10 mM ATP: Store in aliquots at –20°C. Avoid freeze/thaw. 

20. 60% (w/v) PEG 8000 in water, filter-sterilized. Store at room temperature away from 

direct sunlight. 

21. Ultrapure low-melting-point agarose. 

22. Glass bead DNA isolation kit, such as Geneclean (Bio101, Madison, WI).


23. M13 RF DNA purchased from supplier or prepared in-house by CsCl density gradient 

centrifugation. 

24. Isopropyl-β-thiogalactopyranoside (IPTG): 20 mg/mL stock in sterile water, stored 

at –20°C. 

25. 5-Bromo-4-chloro-3-indolyl-βD-galactoside (X-gal): 20 mg/mL stock in dimethyl formamide, 

stored at –20°C in glass vial. 

26. Escherichia coli strain containing the F plasmid (e.g., JM101, JM107) and maintained 

on M9 minimal agar. 

3. Methods 

3.1. Purification of PCR Products from Taq DNA Polymerase, Primers, 

and dNTPs (see Notes 1 and 2) 

1. Extract the completed PCR with an equal volume of chloroform. Spin in a microfuge at 

13,000g for 2 min to separate the aqueous and organic phases. 

2. Extract the upper aqueous phase twice with an equal volume of phenolchloroform and 

once with an equal volume of chloroform/isoamyl alcohol. 

3. Transfer the upper aqueous layer (up to 100 µL) into a Microcon unit housed in a 1.5-mL 

Eppendorf tube and add 400 µL of TE buffer. Spin in a microfuge at 500g for 15 min 

(Microcon-100) or at 14,000g for 6 min (Microcon-50). Add a further 400 µL of TE to 

the sample reservoir, and spin as before. Volume retained will now be 50 to 100 µL. If 

required (PCR product present in low yield), concentration down to a volume of 10 to 20 

µL is achieved by a further spin cycle. Each cycle reduces the concentration of salts, PCR 

primers, and dNTPs by approx 95%. 

4. Invert the unit in a fresh tube and spin at 500g for 2 min to recover purified PCR product. 

5. Check recovery by agarose gel electrophoresis of an aliquot of the concentrated product. 

If amplified DNA is to be cloned by cohesive-end ligation via restriction sites 

incorporated into PCR primers, and these sites are known to cut efficiently, the purified 

product can now be digested with restriction endonucleases without further processing. 

PCR products to be cloned by blunt-end ligation or via digestion with restriction 

enzymes that cut inefficiently at DNA termini should be processed as follows. 

3.2. Simultaneous End Repair and Phosphorylation 

of PCR Products (see Notes 3 and 4) 

1. Set up a reaction containing: 100 ng to 1 µg of purified PCR product, 3 µL of 10× T4 DNA 

polymerase buffer, 100 µM each dNTP, 1 mM ATP, 0.5 U T4 DNA polymerase, 5 U T4 

polynucleotide kinase, and H 2 O to 30 µL. Incubate at 25°C for 20 min. 

2. Stop the reaction by incubating at 75°C for 10 min in the presence of 5 mM EDTA, 

pH 8.0. 

3. Increase the volume to 100 µL with H 2 O, and perform one extraction with phenol/ 

chloroform and one with chloroform/isoamyl alcohol. 

4. Remove the aqueous phase to a fresh tube, and add 0.1 vol 3 M sodium acetate, pH 5.3, and 

2.5 vol cold absolute ethanol. Mix well and store at –20°C for 1 h or at –70°C for 20 min. 

Precipitate DNA by centrifugation at 13,000g for 10 min in a microfuge. 

5. Remove the supernatant carefully and add 0.5 mL cold 70% ethanol to the pellet. Spin 

again at 13,000g for 2 min. Discard the supernatant as before, vacuum dry the pellet 

(2–5 min), and finally dissolve DNA in 10 µL of TE.

388 Walsh 

PCR products are now flush-ended and phosphorylated at their 5′ ends, ready for 

direct cloning into SmaI-cut, dephosphorylated M13 vector or for concatamerization, 

as required. 

3.3. Concatamerization/Digestion of PCR Products (see Notes 5–8) 

1. To 10 µL PCR product, add 2 µL of 10× T4 DNA ligase buffer, 7 µL 60% PEG 8000 (20% 

final), and 2 U T4 DNA ligase. Incubate at room temperature overnight. 

2. Increase the volume to 100 µL with water, and perform one extraction with 

phenol:chloroform. Avoiding the white PEG precipitate at the interface, remove 10 µL 

of the aqueous phase to check extent of concatamerization by electrophoresis through 

0.8% agarose. Run out alongside an aliquot of the original PCR product and DNA size 

markers (see Note 8). 

3. If concatamerization is judged to be successful (PCR product present as trimers and 

larger species), extract the remaining 90 µL once with chloroform/isoamyl alcohol and 

precipitate with sodium acetate/ethanol as above. Dissolve in 20 µL TE. 

4. Add 10 U of appropriate restriction enzyme(s), 3 µL 10× reaction buffer, and H 2 O to 

30 µL. Incubate at the required temperature for 1 h. 

If cutting with two enzymes that have different salt requirements, digest with the 

low-salt enzyme first, heat-inactivate at 65°C for 20 min (or phenol-extract heat-stable 

enzymes), then adjust salt concentration with 1 M NaCl, and add 10 U of the second 

enzyme. Where two enzymes require completely different buffers, phenol/chloroformextract 

and sodium acetate/ethanol-precipitate the DNA in between each digest. 

5. Check to ensure the digest now contains only monomer-size PCR product by agarose gel 

electrophoresis. If larger species remain, indicating incomplete digestion of concatamers, 

add more enzyme and continue digestion. 

6. When digestion is complete, electrophorese the digest mixture through 0.8% low-meltingpoint 

agarose and recover the PCR product by glass bead isolation using Geneclean. 

3.4. Preparation of M13 Vector DNA for Ligation 

3.4.1. Digestion with Restriction Endonucleases 

Where digestion of the vector with two enzymes is required, the ability of each 

enzyme to cleave toward the end of linear DNA molecules should be considered to 

determine the preferred order of sequential addition New England Biolabs catalog, 

Reference Appendix; (see Note 9). Enzymes that cut less efficiently toward DNA 

termini should be used first. In this situation where directional cloning is required, 

digest M13 derivatives containing the polylinker in both orientations, for example, 

M13mp18 and M13mp19. 

1. Set up the following digest: 1 µg M13 RF DNA, 5 U restriction enzyme, 2 µL 10× reaction 

buffer, and H 2 O to 20 µL. 

2. Incubate for 1 h at the appropriate temperature (25°C for SmaI and 37°C for all other polylinker 

enzymes). Remove 1 µL to analyze extent of digestion by electrophoresis through 

0.8% agarose. If digestion is not complete, add more enzyme and continue incubation. 

3. When complete, extract the digest once with phenol:chloroform and precipitate DNA with 

sodium acetate/ethanol as in Subheading 3.2., steps 4–6. Dissolve the DNA pellet in 10 µL 

of TE and digest with a second enzyme if required. 

M13 DNA cut with a single enzyme should now be treated with calf intestinal 

alkaline phosphatase to reduce recircularization during ligation.


3.4.2. Dephosphorylation of Vector DNA 

1. To 1 µg linearized M13 DNA in 10 µL TE, add CIP 0.05 U for 5′ overhangs, 0.5 U for 

3′ overhangs or blunt ends, 5 µL of 10× CIP buffer, and H 2 O to 50 µL of total volume. 


3. Inactivate CIP by heating the reaction to 75°C for 10 min in the presence of 5 mM EDTA, 

pH 8.0. 

4. Extract the reaction once with phenol:chloroform and recover DNA by sodium acetate/ 

ethanol precipitation as in Subheading 3.2., steps 4–6. Dissolve the DNA pellet in 

20 µL of TE., 

5. Check recovery of M13 vector and insert DNA by electrophoresing an aliquot of each 

through 0.8% agarose. 

3.5. Ligation of PCR Products into M13 Vectors (see Notes 10 and 11) 

1. Set up the ligation reaction and add components in the following order: 50 ng of M13 

vector DNA, 1 µL of 10 mM ATP (1 mM final), 1 µL of 10× ligation buffer, 1– 4 µL of 

DNA insert (3- to 5-fold molar excess), 5 U T4 DNA ligase for blunt termini, 1 U T4 DNA 

ligase for cohesive termini, and H 2 O to 10 µL of total volume. 

2. Set up a negative control ligation in which an equal volume of water is substituted for 

the PCR DNA insert and a positive control ligation containing an appropriate blunt- or 

cohesive-ended restriction fragment, preferably of a similar size to the PCR product. 

3. Incubate overnight at 14°C for cohesive-end ligations or at room temperature for blunt-end 

ligations. 

4. Transform 2.5 to 5 µL of the ligation reaction into E. coli-competent cells and plate in a 

soft agar overlay containing 0.33 mM IPTG and 0.03% X-gal. Identify recombinant phage 

clones by blue/white selection (see Note 11). 

4. Notes 

1. The use of a spin filtration unit to purify the PCR product from unincorporated nucleotides 

and primers is only recommended if the PCR mixture does not contain unwanted species 

larger than the nucleotide cutoff value of the unit. For the Microcon-100, this corresponds 

to 300 bases (single-stranded) or 125 bp (double-stranded). If larger unwanted products are 

present, the target product should be purified by electrophoresis through low-melting-point 

agarose followed by adsorption to glass beads. 

2. If a spin filtration device is not available, PCR products can be partially purified from 

residual primers and dNTPs by precipitation with sodium acetate/ethanol, followed by 

a 70% ethanol wash. Better removal of such reactants can be achieved by adjusting to 

2 M ammonium acetate and adding 2 vol of ethanol, although it should be noted that 

ammonium ions are a strong inhibitor of T4 DNA polymerase and must be thoroughly 

removed by extensive washing in 70% ethanol before the end-repair step. 

3. Occasionally, PCR products end-repaired and kinased as described may fail to clone as 

blunt-ended molecules, most probably because of the persistence of Taq DNA polymerase 

bound at DNA termini. In this situation, residual enzyme can be removed by adding to 

the sample 50 µg/mL proteinase K in 10 mM Tris-HCl, pH 7.8, 5 mM EDTA, 0.5% (v/v) 

SDS, and incubating at 37°C for 30 min. Extract with phenol/chloroform, and precipitate 

PCR products with sodium acetate/ethanol. 

4. It is important not to exceed the recommended amount of T4 DNA polymerase enzyme or 

the incubation time of 20 to 30 min for the end-repair reaction, since both may result in 

excessive exonuclease activity and nonblunt “nibbled ends.” T4 DNA polymerase also has 

excessive exonuclease activity at higher temperatures (37°C).

390 Walsh 

5. For palindromic restriction enzyme sites, concatamerization of PCR products containing 

terminal half-sites reconstitutes the site. For example, end-to-end ligation of DNA 

molecules with terminal sequences GGA-3′ and 5′-TCC reconstitutes the BamHI recognition 

sequence. This allows the use of shorter PCR primers containing fewer extraneous 

nucleotides that do not hybridize to the target sequence. 

6. Intermolecular joining of PCR products is stimulated by macromolecular exclusion 

molecules, such as PEG 8000, with maximal stimulation occurring in the range 15 to 

25% (w/v). 

7. Concatamerization and digestion of PCR products containing nucleotides 5′ to the restriction 

site generates a small cohesive-ended fragment that can coprecipitate with the fulllength 

product and give rise to false positives on ligation into M13. Purification of the 

required product by glass bead isolation from low-melting-point agarose before cloning 

is therefore recommended. Eighty to ninety percent of clear plaques examined should 

then be found to contain the required insert. This figure falls to 10 to 20% if purification 

is not performed. 

8. To allow analysis of concatamerized PCR products by gel electrophoresis, PEG must first 

be removed by extracting with phenol/chloroform because the presence of the polymer 

prevents entry of DNA into agarose. 

9. When digesting M13 RF DNA with two enzymes that cut at closely spaced sites in the 

polylinker, it is preferable to perform the digests sequentially, rather than simultaneously, 

even when both enzymes are active in the same buffer, in order to maximize the cutting 

efficiency of each enzyme. 

10. The number of clear plaques that can be expected depends on the strategy being followed. 

Cloning via direct cutting of efficiently recognized terminal restriction sites should yield 

50 to 100 clear plaques per transformation. Rather fewer, typically 10 to 20, are produced 

by the concatamerization/digestion and blunt-end approaches. 

11. M13 clones containing the required insert can quickly be identified by PCR using primers 

used for the original amplification. Use sterile toothpicks to transfer phage particles from 

individual clear plaques into 0.5-mL microcentrifuge tubes containing all components of 

the original PCR mixture minus the template. Vortex lightly and add mineral oil. Heat 

to 95°C for 2 min to lyse phage and then perform 25 cycles of the original temperature 

regimen. Analyze by agarose gel electrophoresis. 

References 

1. Buchman, G. W., Schuster, D. M., and Rashtchian, A. (1992) Rapid and efficient cloning of 

PCR products using the CloneAmp system. Focus 14, 41– 45. 

2. Crowe, J. S., Cooper, H. J., Smith, M. A., Sims, M. J., Parker, D., and Gewert, D. (1991) 

Improved cloning efficiency of polymerase chain reaction (PCR) products after proteinase 

K digestion. Nucleic Acids Res. 19, 184. 

3. Krowczynska, A. M. and Henderson, M. B. (1992) Efficient purification of PCR products 

using ultrafiltration. Biotechniques 13, 286–289. 

4. Liu, Z. and Schwartz, L. M. (1992) An efficient method for blunt-end ligation of PCR 

products. Biotechniques 12, 28–30. 

5. Bennett, B. L. and Molenaar, A. J. (1994) Cloning of PCR products can be inhibited by Taq 

polymerase carryover. BioTechniques 16, 32. 

6. Hitti, Y. S. and Bertino, A. M. (1994) Proteinase K and T4 DNA polymerase facilitate the 

blunt-end subcloning of PCR products. Biotechniques 16, 802. 

7. Clarke, J. M. (1988) Novel non-templated nucleotide addition reactions catalysed by 

prokaryotic and eukaryotic DNA polymerases. Nucleic Acids Res. 16, 9677–9686.


8. Wang, K., Koop, B. F., and Hood, L. (1994) A simple method using T4 DNA polymerase to 

clone polymerase chain reaction products. Biotechniques 17, 236. 

9. New England Biolabs catalog (1994) Reference Appendix, pp. 180,181. 

10. Kaufman, D. L. and Evans, G. A. (1990) Restriction endonuclease cleavage at the termini 

of PCR products. Biotechniques 9, 304. 

11. Jung, V., Pestka, S. B., and Pestka, S. (1993) Cloning of polymerase chain reactiongenerated 

DNA containing terminal restriction endonuclease recognition sites, in Methods 

in Enzymology, vol. 218 (Wu, R., ed.), Academic, London, pp. 357–362. 

12. Pfeiffer, B. H. and Zimmerman, S. B. (1983) Polymer-stimulated ligation: Enhanced bluntor 

cohesive-end ligation of DNA or deoxyribonucleotides by T4 DNA ligase in polymer 

solutions. Nucleic Acids Res. 11, 7853–7871.

392 Walsh

The Vectorette Method 393 

57 

DNA Rescue by the Vectorette Method 

Marcia A. McAleer, Alison J. Coffey, and Ian Dunham 


A major advance in physical mapping of the human genome was the development of 

yeast artificial chromosome (YAC) vectors (1). This has enabled the cloning of pieces 

of DNA several hundred kilobases in length (2). The availability of such large cloned 

genomic DNA fragments means that by ordering a series of overlapping YAC clones, 

a contiguous stretch of DNA, several megabases in length, can be isolated around a 

genomic region of interest (e.g., the region of a chromosome linked to a particular 

disease gene). The successful isolation of terminal sequences of a given YAC can be 

very useful in assembling an ordered “contig” of YAC clones. Such terminal clones may 

be used directly as hybridization probes or sequenced and used to generate sequence 

tagged sites (STSs) to identify overlaps between, and isolate other, members of the 

contig. Several methods have been used to this end, including PCR with vector-specific 

primers in combination with primers designed either for repetitive elements, such as Alu 

sequences (3), or in combination with random nonspecific primers (4). However, these 

techniques rely on a suitable repetitive element or random primer sequence occurring 

close enough to the end of the YAC so as to be amplified by PCR. Furthermore, probes 

isolated in this manner may well contain highly repetitive sequences that, if unsuccessfully 

blocked, will increase nonspecific signal in any subsequent hybridization 

procedures (5). 

The vectorette method was originally described by Riley et al. (6). YAC DNA is 

digested with a restriction enzyme, and the resulting fragments are ligated to a linker 

molecule to create a vectorette “library,” that is, a complex mixture of restriction 

fragments with linker ligated to each end. Within this library are fragments that contain 

the YAC vector/genomic DNA junction, which includes the terminal sequences of 

the YAC (Fig. 1). 

The linker molecule consists of two long (>50 nucleotides) preannealed oligonucleotides 

incorporating a suitable 5′-overhang corresponding to the restriction enzyme 

used in the initial YAC digest. Blunt-ended linkers may also be used. Although the 

oligonucleotides comprising the linker are complementary at the 5′- and 3′-ends, there 

is a region of noncomplementarity in the middle where the two strands are unable to 

pair and a vectorette “bubble” is formed. The PCR is then performed on this mixture 

using one of two vector-specific primers (designed either for the centric or acentric 



393

394 McAleer, Coffey, and Dunham 

Fig. 1. A schematic representation of the vectorette method. Solid boxes represent genomic 

DNA, and the hatched boxes represent YAC vector sequence. YAC DNA is digested with a 

restriction enzyme, X. After ligation to annealed vectorette oligos, products are amplified 

with a vectorette-specific primer (P2) and a primer specific for one or other of the YAC vector 

arms (P1). Only fragments containing vector/insert junction are amplified. Confirmation of the 

presence of the cloning site (CS) within the amplified fragment can be obtained by digestion 

of the hybrid fragment with the enzyme that cuts at the cloning site, releasing a fragment 

diagnostic of the vector arm (Table 2) together with one or more fragments corresponding to 

the genomic DNA insert. CS = cloning site. 

vector arms) in combination with a linker-specific primer. The linker-specific primer 

corresponds to the sequence of the linker ligated to the 5′-end of each DNA strand and 

has no complement on the other strand of the “bubble.” It is therefore unable to anneal 

to template until the complementary sequence has been generated by priming off the 

vector-specific sequence. Thus, only those fragments containing binding sites for the 

vector-specific primer (i.e., DNA including and immediately adjacent to the cloning 

site of the YAC vector) will be successfully amplified by the PCR. The amplification 

products may then be used as DNA probes, for DNA sequencing, or may be cloned 

into a suitable vector. 

A recent adaptation of the vectorette method has been used to isolate possible 

gene fragments from selected regions of the genome without prior knowledge of gene 

sequence (7). This method is termed Island Rescue PCR (IRP), and relies on the fact 

that nearly all housekeeping genes and over 40% of tissue-specific genes have a CpG 

island in or near the 5′-end of the gene (8). Such CpG islands have a significantly 

increased C + G content compared with the bulk of genomic DNA. These CpG


islands can be detected in native human genomic DNA, by rare-cutting restriction 

endonucleases that recognize unmethylated CpG-containing sequences. The principles 

of the vectorette method described above are used except the YAC DNA in this instance 

is digested with restriction endonucleases that specifically recognize CpG-containing 

sequences, for example, SacII, EagI. Therefore, YAC DNA will be cut at CpG-rich sites, 

which may be associated with a gene. The mixture is then ligated to the preannealed 

vectorette oligos, and PCR in this instance is driven by an Alu-specific primer together 

with the vectorette oligo described above. Northern blot analysis may then be used 

to test that amplified sequences are associated with expressed mRNAs. There are 

two main drawbacks to this method. First, because DNA in yeast is not differentially 

methylated, all CpG-containing restriction sites will be cut whether or not they are 

associated with an unmethylated island in native genomic DNA. Therefore, a portion 

of the amplified fragments may not be associated with an expressed mRNA. Second, 

as with all Alu-PCR based methods, there is a requirement for an Alu sequence close 

enough to the restriction site to allow amplification by the Taq polymerase. However, 

in terms of transcript mapping, where the previously described methods, for example, 

direct selection/cDNA enrichment (9), exon trapping (10), probing cDNA libraries 

directly with radiolabeled YAC DNA (11), all have limitations, IRP may prove to 

be a rapid and useful technique for the identification of transcriptional units within 

complex sources of DNA. 

Although the vectorette method was originally developed for rescuing the vectorinsert 

junctions of YACs, it may be used to isolate sequences adjacent to any known 

sequence, for example, the identification of intron/exon boundaries in a specified 

gene (12). This chapter describes in detail the application of the vectorette method to 

isolating terminal sequences from YACs. 

2. Materials 

All solutions should be made to the standard required for molecular biology, that is, 

using sterile distilled water and molecular-biology-grade reagents. 

1. T4 DNA ligase, 1 U/µL and 5X T4 DNA ligase buffer (0.25 M Tris-HCl, pH 7.6, 50 mM 

MgCl 2 , 5 mM ATP, 5 mM DTT, 25% [w/v] polyethylene glycol-8000; Gibco BRL, Paisley, 

Scotland). 

2. The sequences of the oligonucleotides used in this chapter are given in Table 1 and are 

taken from ref. (13). The vector-specific primers are designed against pYAC4 (these can 

be replaced with appropriate vector primers or Alu-specific primers if performing IRP). 

The vectorette oligonucleotides described are suitable for blunt-ended ligations. If desired, 

a suitable overhang at the 5′-end of the “top” strand oligonucleotide may be incorporated 

to facilitate “sticky ended” ligations. 

Oligonucleotides were synthesized by phosphoramidite chemistry on an Applied 

Biosystems 392 DNA/RNA synthesizer. After deprotection (7 h at 55°C), oligonucleotides 

are dried in a centrifugal evaporator (alternatively, the standard ethanol precipitation 

procedure may be used). Oligonucleotides used in PCR are resuspended in H 2 O to a 

concentration of 20 µM. Vectorette oligonucleotides are purified by high-performance 

liquid chromatography (12% polyacrylamide gel electrophoresis may also be used). Before 

use, equimolar quantities of the “top” and “bottom” oligonucleotides are preannealed in 

25 mM NaCl by heating at 65°C for 5 min and left to cool to room temperature. A working 

concentration of 1 µM is used in ligations. All oligonucleotides are stored at –20°C.


Table 1 

Oligonucleotide Sequences for Vectorette PCR 

Vectorette oligonucleotides (for blunt-ended ligations) 

“Top” strand 

CAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGA 

AGGGAGAG 

“Bottom” strand 

CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTC 

TCCTTG 

Universal vectorette primer 224 

CGAATCGTAACCGTTCGTACGAGAATCGCT 

pYAC4-specific primers 

Centric (“left”) arm 

1089 CACCCGTTCTCGGAGCACTGTCCGACCGC 

Sup4-2 

GTTGGTTTAAGGCGCAAGAC 

pYACL (13) 

AATTTATCACTACGGAATTC 

Acentric (“right”) arm 

1091 ATATAGGCGCCAGCAACCGCACCTGTGGCG 

Sup4-3 

GTCGAACGCCCGATCTCAAG 

pYACR (13) 

CCGATCTCAAGATTACGGAATTC 

All oligonucleotide sequences are written in the 5′→3′ direction. 

3. PCR is performed using a GeneAmp PCR reagent kit (Perkin–Elmer, Warrington, UK) 

in 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , 0.01% (w/v) gelatin containing 

200 µM of each dNTP and 1.0 µM of each primer. Amplitaq is added to a concentration 

of 1.25 U/50 µL reaction and Perfect Match (Stratagene, Cambridge, UK) to a concentration 

of 5 U/50 µL reaction and overlaid with mineral oil (Sigma, Poole, UK). DNA 

amplification is performed in an Omnigene thermocycler (Hybaid, Teddington, UK). 

3. Methods 

1. Take half an agarose plug (approx 50–100 µL containing 1–2 µg DNA) of miniprep YAC 

DNA (DNA in solution may also be used; see Note 1) and wash as follows: 3 × 20 min 

in 10 mM Tris-HCl, 0.1 mM EDTA, pH 7.4 (1 mL/plug) at 50°C. 1 × 20 min in 10 mM 

Tris-HCl, 0.1 mM EDTA, pH 7.4 (1 mL/plug) at room temperature. 

2. Preincubate plugs for 30 min at 37°C in 100 µL of the appropriate enzyme buffer (see 

manufacturer’s recommendation). 

3. Remove buffer, and replace with 100 µL of fresh enzyme buffer containing 20 to 30 U 

of restriction enzyme (see Note 2), and incubate overnight at the recommended temperature 

(usually 37°C). After digestion, the plug may be cut into three, and one portion 

electrophoresed through a 1.0% agarose mini gel alongside a similar amount of untreated 

YAC DNA to test for complete digestion. One slice may be stored dry at 4°C and redigested 

if incomplete digestion has occurred. 

4. Incubate one third of the agarose plug from step 3 in 1 mL of 1× ligation buffer for 

1 h on ice. 

5. Replace with 100 µL of fresh 1× ligation buffer. To this add 10 µL of preannealed bluntended 

vectorette linker (at 1 µM; see Subheading 2., item 2), that is, 10 pmol of linker. 

6. Heat to 65°C for 15 min to melt the agarose plug, and then equilibrate at 37°C 

(approx 5 min).


Fig. 2. Three vectorette “libraries” were created using the blunt-ended restriction enzymes: 

PvuII (lanes 1 and 2), StuI (lanes 3 and 4), and RsaI (lanes 5 and 6). PCR was performed using 

oligos specific for the centric arm of the pYAC4, 1089, and the universal vectorette oligo, 224. 

In A, 5 µL of Perfect Match have been added to each PCR, whereas in B, this has been omitted. 

Ten microliters of untreated product were loaded on a 2.5% agarose minigel in lanes 1, 3, and 

5, whereas samples in lanes 2, 4, and 6 were first digested with EcoRI to release the vector 

arm from the genomic fragment. Lane 7 contains HaeIII fragments of ΦX RF DNA (Gibco 

BRL, Paisley, Scotland). StuI-digested YAC has failed to produce a PCR product (A, lanes 3 and 

4), probably through the lack of an enzyme site close to the vector/insert junction. PvuII- and 

RsaI-digested YAC yields products of approximately 800 and 500 bp (lanes 1 and 5), respectively, 

which on digestion with EcoRI release vector fragments (V) of the predicted size 287 bp together 

with the terminal PvuII and RsaI fragments of the YAC insert (500 and 200 bp). 

7. When the reaction mix is equilibrated, add 1 µL of T4 DNA ligase (1 U/µL) and incubate 

at 37°C. After 1 h, add 400 µL of 10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0, and mix 

thoroughly. The vectorette library may now be stored in aliquots at –20°C. 

8. Two sets of PCR mixes need to be prepared for each vectorette library constructed. The 

first contains a primer, 1091, specific for the “right” arm of the YAC vector (i.e., the 

acentric arm encoding the URA3 gene) together with the vectorette-specific oligo (224), 

whereas the second contains a primer, 1089, specific for the “left” arm of the YAC vector 

(i.e., the centric arm, which contains the CEN4 gene) together with 224 (see Table 1). 

Each reaction is carried out in 50 µL buffer described in Subheading 2., item 3, including 

5 µL of Perfect Match (see Note 3 and Fig. 2) using the following cycling conditions: 

94°C for 1 min, 1 cycle, followed by 93°C for 1 min, 65°C for 1 min, and 72°C for 3 min, 

38 cycles, and followed by 72°C for 5 min, 1 cycle. For IRP, see Note 4 for suggested 

primer sequences. 

9. Confirmation that PCR products originate from the terminal sequences of YAC clones can 

be obtained by demonstrating the presence of the YAC vector cloning site in the hybrid 

fragment. This is done by digesting the PCR product with a restriction enzyme that cleaves 

within the cloning site. To 9 µL of PCR product, add 1 µL of 10× restriction enzyme 

buffer (see manufacturer’s recommendation), 10 U of enzyme, and incubate for 1 h at 

37°C. When the vector is pYAC4, 10 U of EcoRI may be added directly to 9 µL of PCR 

product, without addition of enzyme buffer. Restriction fragments can be visualized on a 

2.5% agarose minigel containing ethidium bromide (0.5 µg/mL; Fig. 2). Note: ethidium 

bromide is a powerful mutagen and gloves should be worn at all times. The distances 

from the primer sequences described in Subheading 2., item 3 to the EcoRI cloning site 

of pYAC4 are given in Table 2.


Table 2 

Positions of Primer Sequences Described in Table 1 with Respect 

to the EcoRI Sequence in the Cloning Site of pYAC4 

Centric arm 

Acentric arm 

1089→EcoRI 287 bp 1091→EcoRI 172 bp 

Sup4-2→EcoRI 40 bp Sup4-3→EcoRI 29 bp 

pYACL→EcoRI 17 bp pYACR→EcoRI 20 bp 

10. A second PCR may be performed to reduce the amount of vector DNA contained in the 

amplified product. A nested vector-specific primer that anneals closer to the cloning site 

(Tables 1 and 2) is used in combination with the vectorette-specific oligo. Either use 

1 µL of the primary PCR or toothpick the fragment found to cut with EcoRI in step 9 

(not the restriction digestion product) directly from the agarose gel into a PCR containing: 

for “left” arm products: Sup4-2 + 224 or pYACL + 224, and for “right” arm products: 

Sup4-3 + 224 or pYACR + 224. The same cycling conditions as those described in step 8 

are used, but the annealing temperature is reduced to 59°C and only 20 cycles are 

performed. Ten microliters may be visualized on a 2.5% agarose minigel. 

11. PCR products may now either be sequenced directly, radiolabeled and used as a hybridization 

probe (see Note 5), or subcloned using a suitable cloning system, such as pCR-Script 

SK (Stratagene) or TA-cloning system (Invitrogen, Leek, The Netherlands). 

4. Notes 

1. Use approx 1 µg of solution DNA for each restriction enzyme digest. Reactions should be 

performed in the buffers recommended by the manufacturers for 4 h at the specified 

temperature. Before ligation (Subheading 3., step 5), enzymes should be heat-inactivated 

(65°C for 15 min is usually sufficient), extracted with phenolchloroform (equal volume of 

ratio 11), ethanol-precipitated by standard methods (2 vol 95% ethanol with one-tenth vol 

3 M sodium acetate, pH 5.6) and resuspended to a concentration of 250 ng/µL. Ligations 

can be performed in a volume of 10 µL with 1 µL preannealed vectorette oligos. 

2. It is important to check that there are no recognition sites for a given restriction endonuclease 

between the sequences corresponding to the vector-specific primers and the 

cloning site. If such a site were present, it would be cleaved in the initial digest and a 

vector-only fragment would be amplified. Suitable enzymes for pYAC4 are RsaI, PvuII, 

and StuI. 

3. The addition of Perfect Match to the PCR reduces the number of nonspecific bands generated 

(compare Fig. 2A with B), although some laboratories have found little difference 

on its omission. 

4. IRP is a variant of Alu-vectorette PCR that can be used to generate probes from YACs as an 

alternative to Alu-PCR. For IRP, the universal vectorette primer 224 is used together with 

primer sequences that recognize a human Alu repeat. For example: 5′-GGATTACAGGC- 

GTGAGCCAC-3′ and 5′-GATCGCGCCACTGCAC TCC-3′ (both sequences taken from 

ref. 7). The thermocycling conditions described in Subheading 3., step 8 may also be 

used for these two sets of primers. 

5. Probes generated by this method may contain highly repetitive sequences. Therefore, it is 

advisable to pre-reassociate the labeled probe with total human genomic DNA prior to any 

hybridization procedure. Make probe up to 250 µL with H 2 O. Add 125 µL of 10 mg/mL 

sonicated total human DNA (Sigma) and boil for 5 min. Snap-chill on ice for 5 min, and 

then add probe to hybridization as normal.


References 

1. Burke, D. T., Carle, G. F., and Olson, M. V. (1987) Cloning of large segments of exogenous 

DNA into yeast by means of artificial chromosome vectors. Science 236, 806–812. 

2. Cohen, D., Chumakov, I., and Weissenbach, J. (1993) A first-generation physical map of 

the human genome. Nature 366, 698–701. 

3. Nelson, D. L., Ledbetter, S. A., Corbo, L., Victoria, M. F., Ramirez-Soli, R., Webster, T. D., 

et al. (1989) Alu polymerase chain reaction: A method for rapid isolation of human-specific 

sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86, 6686–6690. 

4. Wesley, C. S., Myers, M. P., and Young, M. W. (1994) Rapid sequential walking from 

termini of cosmid, P1 and YAC inserts. Nucleic Acids Res. 22, 538–539. 

5. Cole, C. G., Patel, K, Shipley, J., Sheer, D., Bobrow, M., Bentley, D. R., et al. (1992) 

Identification of region-specific yeast artificial chromosomes using pools of Alu elementmediated 

polymerase chain reaction probes labelled via linear amplification. Genomics 

14, 931–938. 

6. Riley, J., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., et al. (1990) A novel, 

rapid method for the isolation of terminal sequences from yeast artificial chromosome 

(YAC) clones. Nucleic Acids Res. 18, 2887–2890. 

7. Valdes, J. M., Tagle, D. A., and Collins, F. S. (1994) Island rescue PCR: A rapid and 

efficient method for isolating transcribed sequences from yeast artificial chromosomes and 

cosmids. Proc. Natl. Acad. Sci. USA 91, 5377–5381. 

8. Larsen, F., Gundersen, G., Lopez, R., and Prydz, H. (1992) CpG islands as gene markers 

in the human genome. Genomics 13, 1095–1107. 

9. Lovett, M., Kere, J., and Hinton, L. (1991) Direct selection: A method for isolation of 

cDNAs encoded by large genomic regions. Proc. Natl. Acad. Sci. USA 88, 9628–9632. 

10. Buckler, A. J., Chang, D. D., Graw, S. L., Brook, J. D., Haber, D. A., Sharp, P. A., et al. 

(1991) Exon amplification: A strategy to isolate mammalian genes based on RNA splicing. 

Proc. Natl. Acad. Sci. USA 88, 4005– 4009. 

11. Elvin, P., Slynn, G., Black, D., Graham, A., Butler, R., Riley, J., et al. (1990) Isolation 

of cDNA clones using yeast artificial chromosome probes. Nucleic Acids Res. 18, 

3913–3917. 

12. Roberts, R. G., Coffey, A. J., Bobrow, M., and Bentley, D. R. (1993) Exon structure of the 

human dystrophin gene. Genomics 16, 536–538. 

13. Coulson, A., Kozono, Y., Lutterbach, B., Shownkeen, R., Sulston, J., and Waterston, R. 

(1991) YACs and the C. elegans genome. Bioessays 13, 413–417.

400 McAleer, Coffey, and Dunham

Sequencing Difficult Templates 401 

58 

Technical Notes for Sequencing Difficult Templates 



There are a number of template types that are generally recognized as being difficult 

to sequence. These can include sequences with a high guanine–cytosine (G/C) content, 

sequences that are very rich in adenine/thymine (A/T), sequences with a marked 

secondary structure, or large regions of homopolymer. There is no one solution to 

these difficulties; however, there are a number of approaches that can be used to improve 

the quality of sequencing data obtained from each type of problem sequence. 

2. High G/C Content 

Sequences with high G/C content have higher melting temperatures, and the 

incorporation of the dye-labeled terminators is also less efficient. The addition of 

DMSO to a final concentration (v/v) of 5% or betaine (final concentration of 1 M ) to 

cycle sequencing reactions can greatly improve results. Changing the cycling conditions 

to use a higher melting temperature can help, as can the use of altered sequencing 

chemistry. Applied Biosystems produce a dGTP Big Dye kit where dITP normally 

used in big dye chemistry is replaced with dGTP. Adding more Taq and dNTPs can 

also help. 

3. A/T-Rich Sequences 

A / T-rich sequences are generally not as difficult as G/C-rich templates. A /T-rich 

primers will have low melting temperatures and so may need to be longer (24–26 bases) 

to increase the melting temperature closer to 55°C. Dye primer sequencing is generally 

more even through A /T regions. 

4. Secondary Structure 

Sudden loss of sequencing data generally indicates a problem with secondary 

structure. Where there are runs of Gs followed by runs of Cs, for instance, hairpin loops 

can form, impeding the progress of the polymerase and resulting in a stop in the data. 

Any of the approaches suggested for high G/C content sequences can be used. 



401

402 Stirling 

5. Homopolymer Regions 

Enzyme slippage can occur when a run of the same bases occur consecutively 

(sometimes less than 10 for G and C). One solution is to use an anchored primer. This 

consists of a string of the repeated base, followed by a degenerate 3′ position of the 

other three bases. This allows the sequence to be resumed after the homopolymer but 

gives no information regarding the number of bases in the repeat. Designing a primer 

30 to 40 bases from the start of the homopolymer and increasing the Taq concentration 

can improve the chances of reading through the homopolymer.

PRINS and In Situ PCR 405 

59 

PCR-Based Detection of Nucleic Acids 

in Chromosomes, Cells, and Tissues 

Technical Considerations on PRINS and In Situ PCR 

and Comparison with In Situ Hybridization 



The polymerase chain reaction (PCR) is an extremely sensitive technique allowing 

the detection of rare and low copy nucleic acid sequences (up to 1–10 copies in DNA 

or mRNA extracts from 1 million cells) by solution-phase amplification using specific 

primer sets and Taq DNA polymerase and visualization of the resulting PCR products 

by gel electrophoresis and blotting techniques (see chapters in this book). However, 

the obligatory cell and tissue destruction required for nucleic acid extraction does not 

permit the correlation of results with histopathological features or the localization 

of targets in specific cell types. This may now be overcome by combining recently 

developed micromanipulation systems, such as laser-assisted microdissection, to isolate 

the cells of interest (up to the level of a single cell) from a large population of cells 

or from the tissue, and to apply single-cell PCR on the extracted nucleic acids (for a 

review, see ref. 1). Alternatively, and in case it is unknown in which cell a certain target 

nucleic acid, for example, a virus particle, may be present, cellular localization of 

DNA and RNA can be accomplished by in situ hybridization (ISH). This procedure has 

a history of more than 30 years and has been improved continuously. In particular, the 

development of nonradioactive approaches and the recent implementation of tyramide 

signal amplification have made ISH a powerful technique for use in many applications 

(2). Some 10 to 15 years ago, however, ISH detection limits were only in the range of 

10 to 20 copies of mRNA or viral DNA per cell, and probe detection periods could be 

very long when using radioactive procedures (3–5). Hence, in the end of the 1980s and 

1990s, several strategies had been developed to improve the threshold levels as well as 

the efficiency of nucleic acid detection in situ, such as target and signal amplification 

methods (Table 1). In this chapter, we focus on the technical aspects of the primed in 

situ labeling (PRINS) and in situ PCR procedures, originally introduced by Koch et al. 

(6) and Haase et al. (7), respectively, as examples of nucleic acid target amplification 

methods. The pros and cons of both techniques will be discussed and compared with 



405

406 Speel, Ramaekers, and Hopman 

Table 1 

Approaches to Amplify Nucleic Acid Target Sequences and (Immuno) 

Cytochemical Detection Signals in situ (Adapted from ref. 2) 

Target 

Reference 

Nucleic acid target amplification 

In situ polymerase chain reaction (in situ PCR) DNA (This chapter) 

Primed in situ labeling (PRINS) DNA (This chapter) 

and repeated /cycling PRINS 

Rolling circle amplification Hybridized (55) 

oligonucleotide 

(Padlock probe) 

In situ reverse transcriptase (RT) PCR RNA (8–10,13) 

In situ self-sustained sequence replication (3SR) RNA (56) 

In situ transcription /PRINS RNA (57,58) 

Detection signal amplification 

Branched DNA amplification (59) 

Catalyzed reporter deposition /tyramide signal amplification (CARD/ TSA) (2,14) 

Mirror image complementary antibodies (MICA) (60) 

Enzyme antibody polymer system (EPOS/EnVision) (61,62) 

Enzyme-labeled antibody–avidin conjugates (63) 

End Product Amplification (anti-DAB antibody strategy) (64) 

the current protocols for ISH using tyramide signal amplification. Special emphasis 

will be on the conditions needed to achieve an optimal balance between nucleic acid 

detection in situ and preservation of cell and tissue morphology, including discussions 

on sample fixation and pretreatment, oligonucleotide/probe hybridization, in situ 

primer extension and amplification, and detection of incorporated reporter molecules. 

For more comprehensive reviews and applications of PRINS, in situ PCR, and ISH, 

we refer to the literature (2,8–17). 

2. PRINS 

2.1. PRINS vs ISH 

Particularly in the field of cytogenetics, the PRINS labeling technique has become an 

alternative to ISH for the localization of nucleic acid sequences in chromosome and cell 

preparations (6,8,12,17). Occasionally, its application to the detection of chromosome 

copy numbers and viral DNA in frozen and formaldehyde-fixed, paraffin-embedded 

tissue sections have been reported (12,18,19). Whereas in an ISH approach a nucleic 

acid probe with incorporated reporter molecules is hybridized to its cellular target, the 

PRINS method is based on the use of high concentrations of unlabeled primers (restriction 

fragment, PCR product, or oligonucleotide) that allow a very fast hybridization 

(annealing) to denatured, complementary target sequences in situ (Fig. 1). 

These primers serve as initiation sites for in situ chain elongation catalyzed by 

Taq DNA polymerase (in the appropriate buffer containing 1.5 mM MgCl 2 ) using the 

target DNA as a template. DNA labeling takes place during the elongation step 

when labeled nucleotides are incorporated. Fluorochrome-labeled nucleotides can 

be detected directly by fluorescence microscopy, while haptenized (e.g., biotin,


Fig. 1. Basic differences between in ISH, PRINS, and cycling PRINS DNA labeling and 

direct and indirect in situ PCR. *Incorporated reporter molecule (fluorochrome or hapten [biotin, 

digoxigenin, dinitrophenyl]), which can be detected as described in Subheading 2.1. 

digoxigenin, dinitrophenyl) nucleotides can be visualized by the additional application 

of fluorochrome- or enzyme-conjugated avidin or antibody molecules, followed by 

fluorescence microscopy or brightfield visualization of enzyme reaction products 

(2). Image recording and analysis is usually performed by using a CCD camera or 

confocal scanning laser microscope. In this overview, the use of radioactivity as reporter 

molecule will not be considered because of disadvantages related to cost, instability, 

biohazard potential, the time required for autoradiographic detection, and the poor 

resolution of the final in situ signals. 

2.2. Sample Fixation and Processing 

In methanolacetic acid (31)-fixed metaphase spreads (adhered to noncoated glass 

slides), a PRINS reaction with oligonucleotides specific for centromeric or telomeric 

repeats usually runs for only 5 to 30 min, resulting in bright and easily localized signals 

and a high signal-to-noise ratio (Fig. 2A). 

Nevertheless, background staining might occur because of nicks in the chromosomal 

DNA that may act as primers for unspecific labeling. Thus, it is recommended to 

use freshly prepared chromosome preparations or optionally perform a DNA ligase 

reaction to close the nicks before PRINS labeling (17,20). Also, in interphase cells 

and frozen tissue sections, these repetitive target sequences can be efficiently detected 

provided that the specimens are adhered to coated (e.g., organosilane) glass slides, 

fixed in methanolacetic acid (31), and pretreated with a mild protease digestion 

(e.g., 100 µg/mL pepsin or 0.025% proteinase K; Fig. 2B and refs. 12,18). Because 

of the thorough fixation, short denaturation temperature, and speed of the reaction, the 

morphology of chromosomes and cell nuclei in methanolacetic acid (31)-fixed cell 

preparations is usually well preserved. On frozen and formaldehyde-fixed, paraffin-


Fig. 2. (A) Fluorescence PRINS labeling of chromosome 9 centromeres with digoxigenin/ 

sheep anti-digoxigeninFITC in human metaphase spreads and Vectashield embedding with 

propidium iodide (PI) counterstaining. (B) Brightfield diaminobenzidine visualization of 

chromosome 9 centromeres labeled with biotin by PRINS and detected with AvidinPeroxidase 

in hematoxylin counterstained cell nuclei in the urothelium. (C and D) Fluorescence doublecolor 

PRINS labeling of chromosome 7 (C) and 9 (D) centromeres with, respectively, biotin/ 

AvidinTexasRed and digoxigenin/sheep anti-digoxigeninFITC in human metaphase spreads and 

Vectashield embedding with diamidinophenylindole (DAPI) counterstaining. (E) Fluorescence 

ISH detection of 1 to 2 integrated HPV 16 genomes (8 kb) in the SiHa cell line using 

digoxigenin-labeled HPV 16 genomic DNA and rhodamin-labeled tyramide signal amplification, 

and Vectashield embedding with DAPI counterstaining. (F) Fluorescence PRINS labeling 

after pepsin pretreatment and thermal cycling in buffer without PCR reagents, of chromosome 

9 centromeres with digoxigenin/sheep anti-digoxigeninFITC in urothelium and Vectashield 

embedding with DAPI counterstaining.


embedded tissue sections, however, nuclear morphology may be less well preserved 

after PRINS DNA labeling because in our experience more powerful tissue pretreatment 

steps (extensive protein removal) are required than used for ISH to allow for an 

efficient in situ primer elongation step (18). In combination with the high denaturation 

temperature, as a result, discrete nuclear morphology is more difficult to maintain. 

Although the small size of oligonucleotides used for PRINS (usually 18 to 35 nucleotides) 

greatly facilitates their accessibility to genomic target sequences in comparison 

with the larger probes used for ISH, the subsequent in situ primer elongation reaction, 

thus, appears to be the success-determining step in the PRINS procedure. Particularly 

on tissue sections, this requires more extensive pretreatment steps than necessary for 

optimal ISH, which is a perhaps unexpected but important finding to realize. 

2.3. Primers and Hybridization Conditions 

The specificity of the PRINS reaction is dependent on the choice of the primer 

sequences as well as the conditions of primer annealing and extension used. Both single 

and paired primers have been described for use in PRINS. On basis of interchromosomal 

differences in the α-satellite and other satellite DNA repeats, human chromosomespecific 

PRINS primers have been designed for all human chromosomes, except for 

chromosome 14 and 22, which are detected simultaneously with a single 14/22 primer 

(21,22). Chromosome-specific PRINS primers have also been constructed for other 

species, such as the pig (23), as well as for other human DNA repeat regions, including 

telomeres and ALU sequences (24–26) and for specific single-copy genes (27,28). 

Optimization of the stringency of primer annealing (in sufficient reaction volume to 

prevent evaporation leading to concentration and temperature shifts), which reduces 

mispriming during the PRINS reaction, has been established by substituting the initially 

used thermoblocks or waterbaths by programmable thermal cyclers equipped with a 

flat plate block, which allow for precise and durable temperature control (up to 0.2°C 

accuracy). As a consequence, semi-automated PRINS protocols are now available, 

which offer a high reproducibility of nucleic acid labeling (8,9,29,30). 

2.4. Multicolor PRINS and Combination with Immunocytochemistry 

Multicolor detection of up to three DNA target sequences in situ have been performed 

using subsequent PRINS reactions with different primers and labeled oligonucleotides 

(30–33). This enables several targets to be analyzed simultaneously (Fig. 2C,D), 

which, for example, can make the evaluation of chromosome aberrations in clinical 

samples more robust. In addition, multicolor PRINS might be especially valuable in 

cases where only one or a few cells are available for analysis, for example, preimplantation 

genetic diagnosis. A prerequisite of performing multiple PRINS reactions in 

sequence is to stop the first PRINS reaction adequately and to avoid the further labeling 

of the first produced DNA strand with differently labeled nucleotides used in the 

subsequent PRINS reaction. This can be achieved by incubation with ddNTPs and 

Klenow DNA polymerase to block the free 3′ ends of the produced DNA strand (16,33), 

although others have reported that this step can be omitted, probably because of either 

complex chromatin conformations or incomplete DNA denaturation after relatively 

long extension reactions in the first PRINS reaction that hamper the access of Taq


polymerase (31,32). In principle, the number of in situ DNA targets to be detected 

simultaneously can be extended further by increasing the number of subsequent PRINS 

reactions applying different reporters/fluorochromes or combinations of two or more 

reporters in different ratios. However, the efficiency of this procedure is expected to 

decrease after multiple sequential PRINS reactions and, therefore, ISH is the preferred 

technique to use for the localization of more than 3 targets (Table 2 and refs. 34,35). 

PRINS has also been successfully combined with the immunocytochemical detection 

of proteins in multicolor approaches to, for example, immunophenotype cells harboring 

a specific chromosomal aberration or viral infection, to investigate chromosome 

distribution and segregation in cells during processes such as polyploidization and 

aneuploidization, and to identify possible relationships of different families of DNA 

sequences with, for example, proteins associated with different chromosome-specific 

structures, such as the kinetochore complex (see Chapter 63). 

Particularly, the rapidity, improved probe accessibility and lack of formamide for 

hybridization, thereby preventing the destruction of protein epitopes, are advantages of 

applying PRINS instead of ISH in these procedures. 

2.5. Improvement of the Detection Sensitivity 

The major drawback of PRINS for a long time proved to be its inability to convincingly 

detect single-copy gene sequences (27). This is caused by the fact that the in situ 

primer extension by Taq DNA polymerase in the biological material (adhered to glass 

slides) is limited to relatively short lengths (in the range of maximum a few hundreds 

of basepairs), probably caused by (1) the local chromatin organization of the target 

sequence; (2) the binding of (part of) the target to remnant proteins or the glass slide; 

and/or (3) the presence of nicks in the DNA where the polymerase reaction will stop 

(12). As a consequence, a single PRINS reaction to localize a single copy gene sequence 

with one primer (pair) will hardly result in a positive signal in the microscope, as 

the current detection sensitivity with ISH is approx 1 to 5 kb (2,36). The problem 

has now been overcome by using either multiple target-specific primers in a single 

PRINS reaction combined with reporter detection by the tyramide signal amplification 

procedure (28) or repeated PRINS reactions with the same reaction mixture and primers 

on specimen preparations (also called cycling PRINS) (8,20,29,37,38 and Chapter 60). 

Essential improvements of the first approach consisted of (1) the treatment of 1-d-old 

metaphase slides with 0.02 N HCl to remove loosely bound protein and thereby to 

render the DNA more accessible to the primer; (2) the use of multiple (four to five) 

primers for one locus; (3) one PRINS reaction and stringent washings in SSC to achieve 

optimal specificity; (4) the use of TaqStart, a monoclonal antibody against Taq DNA 

polymerase, which prevents nonspecific amplification and formation of primer-dimers; 

and (5) the use of biotin incorporation combined with biotin-labeled tyramide signal 

amplification (28). With this procedure a couple of single-copy genes have been 

detected in chromosome preparations with high efficiency (39). It will be interesting 

to see whether this approach can be applied to clinical cell and tissue specimens as 

well, for example, for rapid and reliable detection of microorganisms and chromosomal 

alterations in cancer specimens. Alternatively, cycling PRINS has been used on 

metaphase spreads and blood smears to detect low and single-copy DNA sequences 

resulting in more intense (up to 15×) fluorescence in situ signals than seen after a single


PRINS reaction (Fig. 1, refs. 20,29,37,38,40). The repeated PRINS reactions appear 

to label not only the target sequence (as observed after the last PRINS cycle) but also 

the DNA that has been synthesized during the preceding cycles. Several protocols have 

been described with suggestions for optimal gene localization, including (1) the use 

of single or multiple primers generating DNA products of 250 to 550 bp in length; (2) 

alternative fixation and pretreatment protocols (e.g., ethanol and microwave treatment 

instead of methanol:acetic acid [31] fixation); 3) the use of a hot start (applying the 

reaction mixture and/or Taq polymerase at the annealing or a higher temperature to 

the slide to avoid mispriming or primer oligomerization during PRINS/PCR) before 1 

to 20 PRINS cycles, eventually preceding by PCR with the same primers but without 

labeled nucleotides; and (4) adaptation of the PRINS reaction volume and conditions 

on the glass slide during cycling. However, despite these recommendations, a main 

concern comprises the reproducibility of cycling PRINS, because in most studies 

variable and relatively low frequencies (10–70%) of chromosomes or cells harboring 

PRINS signals were reported. Besides the discussed possibilities that may result in 

background (nicks, mispriming), the major disadvantage of applying multiple cycles 

of PRINS (or PCR, see later) on cell and tissue preparations is the inevitable diffusion 

of newly synthesized DNA products, inextricably bound up with the denaturation 

steps, from the site of synthesis inside and/or outside the cells, followed by possible 

extracellular generation of amplificants (Fig. 1. refs. 9,20,29,41–43). Several studies 

have provided evidence for this phenomenon by demonstrating the expected DNA 

products using gel electrophoresis of the reaction mixture after cycling PRINS. The 

observation of stronger but often more diffuse and less discretely localized PRINS 

signals in only a low percentage of chromosomes or cell nuclei fits in with the 

view that labeled DNA in these cases is retained at or near the site of synthesis by 

possible entrapment in the chromatin or nonspecific binding to the surrounding cellular 

structures, whereas diffusion of DNA away from the site of synthesis has been taken 

place in the remaining negative chromosomes or nuclei. That diffusion occurs may be 

explained by the fact that methanolacetic acid (31) fixation is an effective procedure 

to extract proteins, thus limiting the possibillities to entrap synthesized DNA molecules 

efficiently in the chromosome structures. Although postfixation in paraformaldehyde 

after cycling PRINS has been suggested to reduce diffusion of produced DNA (17), this 

will of course only be of help in the chromosomes and nuclei harboring signals. 

Thus, because of several drawbacks concerning the efficiency and reproducibility of 

cycling PRINS in localizing either low or single-copy DNA sequences in situ, a single 

PRINS reaction with multiple primers combined with tyramide signal amplification 

is recommended for this purpose (as a rapid alternative to ISH with locus-specific 

probes). 

3. In Situ PCR 

3.1. In Situ PCR vs Cycling PRINS 

In line with the development of PRINS, several groups working in the fields of 

pathology and microbiology have introduced the successful combination of PCR and 

ISH to visualize specific amplified nucleic acid sequences in cell and particularly 

formaldehyde-fixed, paraffin-embedded tissue preparations. Most studies have focused 

on the detection of (pro)viral (foreign) nucleic acid sequences, but in addition the

Table 2 

Comparison of PRINS, in Situ PCR, and ISH for Localization of DNA Target Sequences in Situ 

PRINS In situ PCR ISH 

Main application Chromosome and gene identification and Detection of altered genes or foreign As for PRINS and in situ PCR, and 

quantification in cells and chromosomes (e.g., viral) DNA in paraffin-embedded localization of DNA sequences to study 

for use in clinical and cancer genetics and tissue section for use in molecular 3D organization of the interphase nucleus 

preimplantation genetic diagnosis pathology 

Crucial steps Primer diffusion to DNA target Primer diffusion to DNA target Probe diffusion to DNA target 

(see Fig. 1) Primer hybridization Primer hybridization Probe hybridization 

Primer elongation and DNA labeling 

Primer elongation (and DNA labeling) 

by Taq polymerase by Taq polymerase 

PCR while limiting diffusion of newly 

synthesized DNA products 

Procedure 

Specimen, fixative, and Ch: Methanolacetic acid (31) Ce, Ti: 4–10% (para)formaldehyde Ch, Ce: Methanolacetic acid (31), 

preferred protein removal Ce, Ti: Methanolacetic acid (31) and tuned proteinase K digestion to allow Ce: 70% ethanol and mild pepsin 

procedure and mild pepsin digestion reagents to access the target DNA Ti: 4–10% (para)formaldehyde combined 

(Ch = chromosomes, but to limit diffusion of PCR products with strong pepsin and 1M sodium 

Ce = cells, thiocyanate or microwave 

Ti = tissues) 

Main probe type Single or multiple Oligonucleotide primer pair Cloned genomic or cDNA (1–100 kb) in 

Oligonucleotide(s) (20–30 mer) (20–30 mer) plasmid, cosmid, PAC or BAC vector 

DNA labeling in situ Specimen denaturation Incorporation of labeled Hybridization of a denatured, labeled 

Primer annealing nucleotides during PCR (10–30 cycles) DNA probe on the pretreated, denatured 

Incorporation of labeled on the pretreated specimen specimen 

nucleotides by DNA polymerase (= direct in situ PCR), or PCR followed 

by FISH detection of amplified DNA 

(= indirect in situ PCR) 

Specificity Primer annealing Primer annealing and/or ISH after PCR Probe hybridization and stringent washes 

Label detection Direct (fluorochromes) or Idem Idem 

indirect (antibody detection 

and signal amplification) 

Advantages Good accessibility of reagents by High sensitivity (target few hundred bp) Good accessibility of reagents by 

optimal protein removal optimal protein removal 

412 Speel, Ramaekers, and Hopman

Direct labeling during 1 PCR cycle 

Relative high sensitivity (target 1–5 kb) 

Multiple-target detection (up to 3) 

High specificity and efficiency 

Use of primers with different 

Accurate DNA localization 

annealing temperatures 

Well-preserved morphology 

Relative accurate DNA localization Multi-target detection (up to 32) 

Short turnaround time (few hours) 

Disadvantages Limited primer elongation due to nicks Only reasonable accessibility of PCR Relative long turnaround time (1–2 days) 

and target DNA bound to the glass slide reagents and poor primer elongation due 

Relative low sensitivity (single-copy DNA) to suboptimal protein removal at the start 

Relative poor morphology on tissue 

Increasing number of PCR cycles improves 

Subsequent PRINS reactions needed primer elongation but also diffusion of PCR 

for multiple-target PRINS products. This results in: 

Nonspecific incorporation of labeled 

Low amplification efficiency, variable 

nucleotides (nicks, mispriming) leading reproducibility and poor DNA localization 

to limited signal-to-noise ratio 

Relative poor morphology due to heating 

steps in the PCR procedure 

Further disadvantages: 

Nonspecific incorporation of labeled 

nucleotides at nicks (direct in situ PCR) and 

amplification due to mispriming 

Only single-target detection 

Relative long turnaround time (1–2 days) 

Comments Muliple oligonuclotides and signal Signal amplification may improve Signal amplification have improved 

amplification have improved signal-to- signal-to-noise ratio signal-to-noise ratio and evaluation 

noise ratio and enabled single copy of results 

gene detection 

PRINS and In Situ PCR 413


technique has also been applied to identify endogenous DNA and RNA sequences in 

human cells (for reviews, see refs. 8–10,13). In situ PCR techniques are theoretically 

straightforward and comprise (1) sample fixation and pretreatment to improve the 

accessibility of the target nucleic acid sequences by the PCR primers, nucleotides, and 

Taq polymerase enzymes and to avoid diffusion of PCR-generated amplificants; (2) 

PCR amplification in the cell by Taq polymerase using the target DNA as a template; and 

(3) direct (by incorporation of labeled nucleotides during PCR) or indirect (by ISH 

with labeled nucleic acid probes) detection of the amplified nucleic acid molecules. 

Visualization of labeled target or probe DNA can be performed as described in 

Subheading 2.1. Thus, in principle direct in situ PCR is identical to the cycling PRINS 

procedure described above when cellular DNA is directly labeled during PCR cycling 

(Fig. 1). Consequently, the conditions for optimal chromosome labeling by (cycling) 

PRINS will also apply for the direct in situ PCR approach, although they need to be 

adapted for the specimen of interest and the fixative used to process cells and tissues. 

3.2. Sample Fixation and Processing 

It has been reported that 4 to 10% buffered formaldehyde is the fixative of choice for 

successful in situ PCR on cells and (frozen) tissues and that these specimens should be 

adhered to coated (e.g., organosilane) glass slides to prevent loss of tissue adherence 

during the in situ PCR procedure (5,9). In addition, cell and tissue preparations need 

to be subjected to a protease (pepsin, trypsin, or protease K) treatment to create holes 

in cellular membranes and remove cross-linked DNA-binding proteins from nuclear 

DNA, thereby facilitating the accessibility of the nucleic acids in situ by the PCR and 

detection reagents, as well as the ISH probes (in the indirect in situ PCR procedure). 

Importantly, for every protease and tissue, the optimal balance between time and 

concentration should be determined (usually 5 to 30 min of 2 mg/mL protease at room 

temperature or 37°C) to avoid overdigestion, leading to poor tissue morphology and 

possible leakage (diffusion) of amplified products from the cell in which they were 

generated, or insufficient protein removal, resulting in a decreased or completely absent 

in situ signal caused by very inefficient or failure of amplification (5,9). A striking 

point to notice here is that the generally used protease pretreatment for in situ PCR 

is less powerful than the one applied usually for optimal ISH on formaldehyde-fixed, 

paraffin-embedded preparations, in which prior to the protease digestion treatments with 

1 M sodium thiocyanate and, optionally, 85% formic acid/0.3% H 2 O 2 are performed 

to achieve optimal conditions for ISH while preserving nuclear morphology (44). 

Although this may still be sufficient to allow the PCR reagents to reach the target DNA, 

we know from our own results that efficient in situ primer extension rather requires a 

more powerful tissue pretreatment step than used for ISH (see Subheading 2.2. and 

3.3.2.). Indeed, we have not been able to detect human centromere repeats by PRINS 

labeling using tissue pretreatment conditions optimal for ISH with centromere-specific 

plasmid probes (unpublished results), indicating that in situ primer extension during the 

first couple of cycles of PCR on the slide is most likely impossible or very inefficient. 

This might in part explain the low amplification efficiency (restricted sensitivity) 

often obtained by in situ PCR, which furthermore can be caused by diffusion of the 

synthesized DNA amplificants outside the cell (see Fig. 1 and below).


3.3. In Situ Amplification and Detection of Intracellular PCR Products 

PCR protocols with optimal stringency of primer annealing and using generally 

longer extension times, increasing concentrations of Taq polymerase and MgCl 2 , and /or 

the addition of bovine serum albumin in the reaction mixture on the cell and tissue 

preparations as compared with solution-phase PCR have been established by using 

the newly designed programmable thermal cyclers as described for (cycling) PRINS 

(see Subheading 2.3. and refs. 5,9,30). After PCR amplification, visualization of 

intracellular PCR products is achieved either directly through immunohistochemical 

detection of labeled nucleotides (see Subheading 2.1.) that have been incorporated 

into PCR products during thermal cycling (direct in situ PCR) or indirectly by ISH 

with a labeled probe and subsequent immunohistochemical detection (see Chapter 

63 and refs. 5,9). 

3.3.1 Direct In Situ PCR 

Although direct in situ PCR is more rapid than indirect in situ PCR by eliminating 

the need for subsequent ISH, this procedure has proved unreliable with respect to 

the specificity of the results obtained (9,43,45). Even when the hot start procedure 

is performed (see Subheading 2.4.), the direct detection approach yields significant 

false-positive results, especially when working with tissue sections that have been dried 

at 56 to 65°C for several hours (introduction of nicks in the DNA) (5,9). This is the 

result of a number of artifacts, including incorporation of labeled nucleotides into (1) 

nonspecific PCR products resulting from mispriming (“endogenous priming” artifacts) 

and primer oligomerization, which seems to occur less likely inside nuclei (5) but may 

play a role during extracellular amplification of diffused DNA products); (2) singleand 

double-stranded nicks introduced by tissue fixation, cutting, and drying; and (3) 

fragmented DNA undergoing “repair” by DNA polymerase (“repair” artifacts). Repair 

artifacts may particularly be evident in apoptotic cells or samples that have been 

pretreated with DNase before in situ reverse transcriptase PCR for mRNA detection 

(9,45). These artifacts may only slightly be reduced by using an exonuclease-free 

DNA polymerase or by carrying out a DNA ligase reaction to close the nicks or a 

ddNTP reaction to prevent a subsequent extension reaction (9,17,33). Thus, caution 

and adequate use of appropriate controls are recommended in the interpretation of data 

produced by direct in situ PCR (Table 3 and Subheading 3.4.). 

3.3.2. Indirect In Situ PCR 

The indirect in situ PCR technique, therefore, is the preferred approach to use, 

because the intracellular target-specific PCR products are identified by ISH, whereas 

the nonspecific amplificants will not be detected. Probes targeted to regions in between 

the primers used for PCR, usually oligonucleotide probes of 20 to 40 bases, represent 

the ideal ISH probes for reasons of specificity because they assure that the detected 

signal is the PCR product and not the result of for example primer oligomerization. ISH 

with these small probes, however, is usually less sensitive than with cDNA or genomic 

probes. Because primer oligomerization seems not to occur inside nuclei during PCR 

(10), the latter probes are recommended because of the increased number of reporter 

molecules they carry, leading to a higher detection sensitivity. Immunohistochemical

Table 3 

Summary of Control Experiments Required for DNA Detection by PRINS, in situ PCR, and ISH (Modified from ref. 9). 

Method Control experiment Purpose 

General Use of known positive and negative control samples Control for specificity and sensitivity 

as well as mixtures of these (cells) in different ratios 

Immunophenotpying the cell types of interest 

Control for specificity and sensitivity 

Solution-phase PCR on extracted DNA of sample under 

Control for sensitivity, false negative results and DNA quality 

study or directly on mildly fixed cell suspension 

Omission of primary antibody in immunohistochemical 

Control for background induced by endogenous enzyme activity 

detection (colorimetric detection) or nonspecific sticking of secondary 

and/or tertiary detection reagents to sample and/or glass slide 

Use of no, random, or irrelevant (labeled) primers/probes, 

Control for background induced by endogenous enzyme activity 

or vector sequences without a target-specific insert (colorimetric detection) or non-specific sticking of probe 

and/or detection reagents to sample and/or glass slide 

(Cycling) PRINS Omission of DNA polymerase Control for background induced by endogenous enzyme activity 

and (colorimetric detection) or nonspecific sticking of detection 

Direct in situ PCR reagents to sample and/or glass slide 

Omission of primers 

Control for artifacts related to endogenous priming, DNA repair 

and extension of nicks present in the DNA 

Indirect in situ PCR Omission of DNA polymerase Control for effect of amplification and sensitivity of ISH 

416 Speel, Ramaekers, and Hopman


detection of labeled nucleotides within target or probe DNA can be performed as 

described previously (Subheading 2.1. and refs. 2,46). Because of the autofluorescence 

often present in tissue preparations, the limited stability of fluorochromes, and the 

preference of histopathologists to analyze permanent preparations by brightfield 

microscopy, colorimetric detection systems have been most frequently used (5,9). In 

these procedures, the activity of alkaline phosphatase or horseradish peroxidase, coupled 

to (immuno)histochemical reagents (e.g., antibodies or (strept)avidin molecules), is 

visualized by enzyme precipitation reactions (NBT/BCIP and DAB are most often used, 

respectively). Strikingly, in most cases suboptimal detection formats have been used, 

combining, for example, only a single antibody layer (alkaline phosphatase-conjugated 

anti-digoxigenin Fab fragments) with a relatively poor localizing enzyme reaction 

(NBT/BCIP) and omitting the possibility to apply the sensitive tyramide signal 

amplification procedure (2,14). As a consequence, relatively poor signal-to-noise ratios 

have often been obtained, which may further contribute to the restricted increase in 

detection sensitivity obtained by (in)direct in situ PCR when compared with ISH. 

Moreover, this might also explain in part the relatively low sensitivity reported with 

the ISH procedure when the PCR step is omitted, resulting in a detection limit of only 

20 to 40 viral copies per cell (4,5). As can be seen in Fig. 2E, current optimal ISH 

protocols (44) are able to identify the 1 to 2 copies of HPV 16 DNA integrated in the 

genome in the often used SiHa control cell line without any prior PCR step. 

Because the combination of PCR and ISH in the indirect in situ PCR method 

is essential to guarantee that the obtained signal is specific, one may consider this 

approach also as a rather cumbersome ISH method, in which sample pretreatment 

consists of fixation and protease digestion in combination with heating (thermal 

cycling) during nucleic acid amplification (by PCR). Moreover, the increase in detection 

sensitivity as compared with conventional ISH is rather limited even after optimization 

of the procedures, and cell morphology and nucleic acid localization are often poor 

(see Subheading 3.4. and Table 2). Furthermore, the question arises if the increase 

in the final ISH signal intensity is really caused by the in situ amplification of target 

sequences alone, or is rather the result of heating the specimen by thermal cycling, 

because it has been shown that microwaving or thermal cycling without in situ PCR can 

also result in increased sensitivity of ISH (47,48). In this respect, we have reported a 

similar effect localizing human centromere 9-specific DNA in routinely-fixed, paraffinembedded 

tissue sections, where only after pepsin digestion in combination with 

thermal cycling in buffer without PCR reagents it proved to be possible to perform a 

primed in situ labeling reaction with a chromosome 9-specific primer with positive 

outcome (Fig. 2F and ref. 14). 

Indirect in situ PCR protocols are available for the simultaneous detection of two 

DNA targets in formaldehyde-fixed, paraffin-embedded tissue sections as well as 

for the detection of DNA in combination with a protein detected subsequently by 

immunohistochemistry (49). However, without using appropriate controls (Table 3) 

to adequately address the possible leakage of synthesized DNA molecules to targetnegative 

sites, as is the principal drawback of indirect in situ PCR, caution is recommended 

by interpretation of the data.


3.4 Sensitivity and Evaluation of In Situ PCR Results 

Only a few studies have tried to give an indication of the increase in in situ signal 

intensity by comparing indirect in situ PCR with ISH. In the most optimal situation, 

a 50-fold increase in sensitivity has been reported when cell preparations were used 

(7,50). This relatively poor result after PCR amplification thus lies far beneath the 

amplification efficiency that can be achieved by solution-phase PCR. As has been 

discussed above, this is the result of many factors, including suboptimal sample 

pretreatment, inefficient and nonspecific in situ primer extension, as well as diffusion of 

PCR products because of the denaturation steps during PCR. In addition, background 

signals introduced by the ISH procedure, as a result of nonspecific binding of probe and 

detection reagents to the sample and the coated glass slide as the result of suboptimal 

stringent washings after probe hybridization and application of too less diluted probe 

and/or detection conjugates, may even further contribute to a decrease of the difference 

in signal intensity between in situ PCR and ISH. Because so many factors may influence 

the final signal intensity observed, it is not advisable to use in situ PCR results for 

quantification purposes. 

Nevertheless, an amplification factor of 10- to 50-fold would still be a very acceptable 

increase in sensitivity, provided that reproducible and specific results would be 

obtained by indirect in situ PCR. However, despite the fact that the detection of one 

target copy per cell have been reported by using a single primer pair that amplifies 

a sequence of a few hundred basepairs (5,10), indirect in situ PCR appears also to 

be hampered by restricted specificity of results and, moreover, is unable to distinctly 

localize nucleic acid sequences in cell and tissue preparations (9,51). Even when 

assuming that PCR conditions are optimal and artifacts caused by mispriming and 

nicks are eliminated, the diffusion of generated PCR products from the site of synthesis 

inside and/or outside the cell is an almost impossible process to control. Therefore, 

many creative approaches intended to minimize the impact of diffusion have been 

described, such as optimal sample fixation and pretreatment, reduction of PCR cycle 

numbers, generation of longer or more complex PCR products, incorporation of labeled 

nucleotides to make bulkier PCR products, and the embedding of samples in agarose 

or protein matrices (9,43,50,52). Nevertheless, in most cases only a discrimination 

between positive and negative nuclei can be determined, whereas for example the 

number and site of viral integration in the nucleus, as shown in Fig. 2E by ISH, 

as well as the discrimination between viral integration and replication, are almost 

impossible to identify. 

Thus, appropriate controls at each step in the (in)direct in situ PCR procedure are 

essential to demonstrate specificity and to correctly interpret the results (Table 3 and 

refs. 5,9,42). Control experiments should include (1) samples that either harbor or 

lack the target of interest (or a known mixture of these cells to verify the expected 

result) or use of irrelevant primers that cannot find targets in the cells under study (e.g., 

viral-specific primers in uninfected cells); (2) omission of the DNA polymerase from 

the PCR mixture to detect nonspecific sticking of ISH probes and detection reagents 

to the slide; (3) omission of primers to detect artifacts related to endogenous priming 

(nicks in the DNA) and DNA repair in the direct in situ PCR approaches. In case 

of reverse transcription in situ PCR to detect (m)RNA sequences in situ, RNase


pretreatment of samples and the omission of the reverse transcription step are important 

controls. 

4. Conclusion 

During the past 10 to 15 yr, several strategies have been developed to improve the 

threshold levels of nucleic acid detection in situ by either labeling and/or amplification 

of target nucleic acid sequences (prior to ISH), for example, (cycling) PRINS and in 

situ PCR, or by amplification of the detection signals after the hybridization procedure, 

for example, PRINS or ISH followed by tyramide signal amplification (Table 1). 

Although PRINS and in situ PCR have been developed and applied in different research 

disciplines and only sporadically have been compared with each other and/or with ISH 

in the same study, all three techniques have been extensively studied and optimized 

to cope with the central question how to achieve the most optimal balance between 

specific in situ nucleic acid detection with a high signal-to-noise ratio and preservation 

of cell and tissue morphology. As a result, all techniques are capable to detect repetitive 

as well as single copy DNA sequences to date. However, because of evident differences 

in specificity, reproducibility, and detection sensitivity between PRINS, in situ PCR, 

and ISH, in our opinion the most suitable technique to be used for nucleic acid detection 

in biological samples is ISH, optionally combined with tyramide signal amplification 

to achieve the highest sensitivity. 

In methanol:acetic acid (31)-fixed chromosome and cell preparations, a single 

PRINS reaction is a suitable alternative to ISH allowing for the rapid, specific, and 

reliable localization of repetitive and single copy DNA sequences (28,39). In the latter 

case, PRINS should be conducted with multiple carefully selected and target-specific 

oligonucleotide primers and be combined with tyramide signal amplification. The exact 

detection limit, however, is unknown, and will be dependent on the ratio between the 

obtained specific PRINS signal and the background noise resulting from mispriming 

and labeling of nicks in the DNA, for which control experiments should be performed. 

Cycling PRINS is not recommended because until now this technique has not proved 

to be reliable with respect to efficiency and specificity because of problems of DNA 

diffusion and nonspecific labeling of DNA (29,38,40,51). Although initially the turnaround 

time (usually 16 h) and the generation and expensive purchase of probes have 

been considered as real disadvantages of ISH as compared with PRINS (12), the current 

situation is clearly a different one. ISH can be performed in very short turnaround times 

if repetitive and directly labeled probes are used. Furthermore, ISH probes are well 

available now because of the complete sequencing of the human and other genomes, 

and although still expensive can be used for the specific localization of DNA probes 

even under 1 kb (36) as well as for the simultaneous localization of 24 or more DNA 

targets in chromosomes and cells (34,35). In contrast, in a single PRINS reaction a 

huge amount of primer(s) is used together with Taq DNA polymerase and the amount 

of hapten-labeled nucleotides that is normally used for labeling of 1 to 2 µg of ISH 

probe. In addition, the use of tyramide signal amplification required for the localization 

of single copy genes will lead to high costs if applied for clinical diagnostics as a 

result of the fact that it is a patented trademark. Moreover, only a limited number of 

targets can be detected simultaneously by subsequent PRINS reactions, and additional


advantages of PRINS over ISH, for example, the ability to discriminate between human 

centromeres 13 and 21 for chromosome enumeration analysis in prenatal diagnosis, 

have been counteracted by the development of specific probe sets that combine 

chromosome-specific single-copy or chromosome painting probes for discrimination. 

In methanolacetic acid (31)-fixed and protease-pretreated frozen tissue sections 

and cell preparations (touch preparations, blood smears, smears of bone marrow 

aspirates) so far only repetitive sequences have been visualized efficiently by a single 

PRINS reaction (8,12,18). Single-copy DNA sequences have been successfully detected 

by cycling PRINS and ISH (2,40), but because of the drawbacks involved with the 

use of the cycling PRINS procedure as described above an ISH approach is preferred 

for this purpose. The most optimal results have been obtained by applying (single 

or multiple-target) ISH to 70% ethanol-fixed samples that have been pretreated with 

pepsin (44,53). 

A couple of studies have compared DNA detection, particularly genomic human 

papillomavirus DNA, in formaldehyde-fixed, paraffin-embedded cell and tissue preparations 

by in situ PCR, PRINS, and ISH (5,19,51,54). With all techniques HPV-specific 

sequences were efficiently detected, but only the one or two HPV 16 DNA sequences, 

known to be integrated in the genome of the human SiHa cell line, could be visualized by 

ISH or indirect in situ PCR (see also Fig. 2E). Interestingly, two of these studies (51,54) 

reported the use of ISH in combination with tyramide signal amplification as the method 

of choice, since it provided the same sensitivity and a much better reproducibility and 

reliability than the more cumbersome and poorly reproducible indirect in situ PCR 

method. Apparently, under optimal conditions ISH combined with the high amplification 

power of the signal amplification system can result in the same detection limits as 

can be reached by the relatively low amplification efficiency of indirect in situ PCR 

(as compared with solution-phase PCR). Furthermore, it provides optimal localization 

of signals and discrimination between viral integration and replication within wellpreserved 

cells and nuclei (Hopman et al., manuscript in preparation). This is almost 

impossible to achieve with in situ PCR because of diffusion of PCR products in the cell 

nucleus as well as leakage out of the nucleus to target-negative cells, which is still the 

most important disadvantage of an in situ PCR approach. 

References 

1. Hahn, S., Zhong, X. Y., Troeger, C., Burgemeister, R., Gloning, K., and Holzgreve, W. 

(2000) Current applications of single-cell PCR. Cell. Mol. Life Sci. 57, 96–105. 

2. Speel, E. J. M. (1999) Detection and amplification systems for sensitive, multiple-target 

DNA and RNA in situ hybridization: looking inside cells with a spectrum of colors. 

Histochem. Cell Biol. 112, 89–113. 

3. Höfler, H., Childers, H., Montminy, M. R., Lechan, R. M., Goodmann, R. H., and Wolfe, 

H. J. (1986) In situ hybridization methods for the detection of somatostatin mRNA in tissue 

sections using antisense RNA probes. Histochem J. 18, 597–604. 

4. Burns, J., Graham, A. K., Frank, C., Fleming, K. A., Evans, M. F., and McGee, J. O’. D. 

(1987) Detection of low copy human papillomavirus DNA and mRNA in routine paraffin 

sections of cervix by non-isotopic in situ hybridization. J. Clin. Pathol. 40, 858–864. 

5. Nuovo, G. J. (2000) In situ localization of PCR-amplified DNA and cDNA, in In situ 

hybridization protocols. Methods in Molecular Biology (Darby, I. A., ed.), Humana Press, 

Totowa, NJ, pp. 217–238.


6. Koch, J., Kölvraa, S., Petersen, K. B., Gregersen, N., and Bolund, L. (1989) Oligonucleotidepriming 

methods for the chromosome-specific labelling of alpha satellite DNA in situ. 

Chromosoma 98, 259–265. 

7. Haase, A. T., Retzel, E. F., and Staskus, K. A. (1990) Amplification and detection of 

lentiviral DNA inside cells. Proc. Natl. Acad. Sci. USA 87, 4971– 4975. 

8. Gosden, J. R., ed. (1997) PRINS and In Situ PCR protocols. Methods in Molecular Biology, 

Vol. 71, Humana Press, Totowa, NJ. 

9. Long, A. A. and Komminoth, P. (1997) In situ PCR, in PRINS and in situ PCR protocols. 

Methods in Molecular Biology, Vol. 71 (Gosden, J. R., ed.), Humana Press, Totowa, NJ, 

pp. 141–161. 

10. Nuovo, G. J. (1997) PCR in situ hybridization, protocols and applications, 3rd ed., 

Lippincott-Raven, New York. 

11. Totos, G., Tbakhi, A., Hauser-Kronberger, C., and Tubbs, R. R. (1997) Catalyzed reporter 

deposition: a new era in molecular and immunomorphology—Nanogold-silver staining and 

colorimetric detection and protocols. Cell Vision 4, 433– 442. 

12. Wilkens, L., Tchinda, J., Komminoth, P., and Werner, M. (1997) Single- and double-color 

oligonucleotide primed in situ labeling (PRINS): applications in pathology. Histochem. 

Cell Biol. 108, 439– 446. 

13. Herrington, C. S. and O’Leary, J. J. (1998) PCR In Situ Hybridization: A Practical 

Approach, Oxford University Press, Oxford, U.K. 

14. Speel, E. J. M., Hopman, A. H. N., and Komminoth, P. (1999) Amplification methods to 

increase the sensitivity of in situ hybridization. Play card(s). J. Histochem. Cytochem. 

47, 281–288. 

15. Darby, I. A. (2000) In Situ Hybridization Protocols. Methods in Molecular Biology, Vol. 

123, Humana Press, Totowa, NJ. 

16. Coullin, P., Roy, L., Pellestor, F., Candelier, J.-J., Bed”hom, B., Guillier-Gencik, Z., et al. 

(2002) PRINS, the other in situ DNA labeling method that is useful in cellular biology. 

Am. J. Med. Genet., in press. 

17. Hindkjœr, J., Bolund, L., and Kolvraa, S. (2001) Primed in situ labeling, in Methods in Cell 

Biology, Vol. 63–64, Academic Press, San Diego, pp. 55–68. 

18. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N. 

(1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS)-labeled DNA 

in chromosome preparations and frozen tissue sections. BioTechniques 20, 226–234. 

19. Ramael, M., Van Steelandt, H., Stuyven, G., Van Steenkiste, M., and Degroote, J. (1999) 

Detection of human papilloma virus (HPV) genomes by the primed in situ labelling 

technique. Pathol. Res. Pract. 195, 801–807. 

20. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotideprimed 

in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3, 931–936. 

21. Koch, J., Hindkjœr, J., Kolvraa, S., and Bolund, L. (1995) Construction of a panel of 

chromosome-specific oligonucleotide probes (PRINS-primers) useful for the identification 

of individual human chromosomes in situ. Cytogenet. Cell. Genet. 71, 142–147. 

22. Pellestor, F., Girardet, A., Lefort, G., Andréo, B., and Charlieu, J.-P. (1995) Selection of 

chromosome specific primers and their use in simple and double PRINS technique for rapid 

in situ identification of human chromosomes. Cytogenet. Cell. Genet. 70, 138–142. 

23. Roguel-Gaillard, C., Hayes, H., Coullin, P., Chardon, P., and Vaiman, M. (1997) Swine 

centromeric DNA repeats revealed by primed in situ (PRINS) labeling. Cytogenet. Cell 

Genet. 79, 79–84. 

24. Gosden, J., Hanratty, D., Starling, J., Fantes, J., Mitchell, A., and Porteous, D. (1991) Oligonucleotide-primed 

in situ DNA synthesis (PRINS): A method for chromosome mapping, 

banding, and investigation of sequence organization. Cytogenet. Cell. Genet. 57, 100–104.


25. Krejci, K. and Koch, J. (1999) An in situ study of variant telomeric repeats in human 

chromosomes. Genomics 58, 202–206. 

26. Go, Y., Rakotoarisoa, G., Kawamoto, Y., Randrianjafy, A., Koyama, N., and Hirai, H. (2000) 

PRINS analysis of telomeric sequence in seven lemurs. Chrom. Res. 8, 57–65. 

27. Cinti, C., Santi, S., and Maraldi, N. M. (1993) Localization of a single copy gene by PRINS 

technique. Nucleic Acids Res. 21, 5799–5800. 

28. Kadandale, J. S., Tunca, Y., and Tharapel, A. T. (2000) Chromosomal localization of single 

copy genes SRY and SOX3 by primed in situ labeling (PRINS). Microbial. Comparative 

Genomics 5, 71–74. 

29. Harrer, T., Schwinger, E., and Mennicke, K. (2001) A new technique for cyclic in situ 

amplification and a case report about amplification of a single copy gene sequence in human 

metaphase chromosomes through PCR-PRINS. Hum. Mutat. 17, 131–140. 

30. Pellestor, F. (2002) PRINS and cycling PRINS on chromosomes and sperm cells, in 

Chromosome Analysis Protocols, 2nd ed, Methods in Molecular Biology (Speel, E. J. M., 

and Hopman, A. H. N., eds.), Humana Press, Totowa, NJ, in press. 

31. Volpi, E. V. and Baldini, A. (1993) MultiPRINS: A method for multicolor primed in situ 

labeling. Chrom. Res. 1, 257–260. 

32. Hindkjœr, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L. (1994) Fast, 

sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRINS). 

Cytogenet. Cell. Genet. 66, 152–154. 

33. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) Multi-PRINS: 

multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific 

chromosomes and produce bands. Hum. Genet. 95, 29–33. 

34. Schröck, E., Du Manoir, S., Veldman, T., Schoell, B., Wienberg, J., Ferguson-Smith, M. A., 

et al. (1996) Multicolor spectral karyotyping of human chromosomes. Science 273, 

494– 497. 

35. Speicher, M. R., Ballard, S. G., and Ward, D. C. (1996) Karyotyping human chromosomes 

by combinatorial multi-fluor FISH. Nat. Genet. 12, 368–375. 

36. Schriml, L. M., Padilla-Nash, H. M., Coleman, A., Moen, P., Nash, W. G., Menninger, J., 

et al. (1999) Tyramide signal amplification (TSA)-FISH applied to mapping PCR-labeled 

probes less than 1 kb in size. BioTechniques 27, 608–613. 

37. Terkelsen, C., Koch, J., Kolvraa, S., Hindkjœr, J., Pedersen, S., and Bolund, L. (1993) 

Repeated primed in situ labeling: formation and labeling of specific DNA sequences in 

chromosomes and nuclei. Cytogenet. Cell Genet. 63, 235–237. 

38. Troyer, D. L., Goad, D. W., Xie, H., Rohrer, G. A., Alexander, L. J., and Beattle, C. 

W. (1994) Use of direct in situ single-copy (DISC) PCR to physically map five porcine 

microsatellites. Cytogenet. Cell Genet. 67, 199–204. 

39. Tharapel, S. A. and Kadandale, J. S. (2002) Primed in situ labeling (PRINS) for evaluation 

of gene deletions in cancer. Am. J. Med. Genet., in press. 

40. Paskins, L., Brownie, J., and Bull, J. (1999) In situ polymerase chain reaction and cycling primed 

in situ amplification: improvements and adaptations. Histochem. Cell Biol. 111, 411– 416. 

41. Jonveaux, J. (1991) PCR amplification of specific DNA sequences from routinely fixed 

chromosomal spreads. Nucleic Acids Res. 19, 1946. 

42. Höfler, H. (1993) In situ polymerase chain reaction: toy or tool? Histochemistry 99, 

103–104. 

43. Teo, I. A. and Shaunak, S. (1995) Polymerase chain reaction in situ: An appraisal of an 

emerging technique. Histochem. J. 27, 647–659. 

44. Hopman, A. H. N. and Ramaekers, F. C. S. (1998) Processing and staining of cell and tissue 

material for interphase cytogenetics, in Current Protocols in Cytometry (Robinson, J. P., 

ed.), John Wiley & Sons, New York, pp. 8.5.1–8.5.22.


45. Sällström, J. F., Zehbe, I., Alemi, M., and Wilander, E. (1993) Pitfalls of in situ polymerase 

chain reaction (PCR) using direct incorporation of labelled nucleotides. Anticancer Res. 

13, 1153. 

46. Speel, E. J. M., Hopman, A. H. N., and Komminoth, P. (2000) Signal amplification for DNA 

and mRNA in situ hybridization, in In Situ Hybridization Protocols. Methods in Molecular 

Biology (Darby, I. A., ed.), Humana Press, Totowa, NJ, pp. 195–216. 

47. Sperry, A., Jin, L., and Lloyd, R. V. (1996) Microwave treatment enhances detection of 

RNA and DNA by in situ hybridization. Diagn. Mol. Pathol. 5, 291–296. 

48. Pilling, A., Endersby-Wood, H., and Jones, S. (1997) Increased sensitivity of in situ 

hybridization: implications for in situ amplification. Diagn. Mol. Pathol. 6, 174. 

49. Nuovo, G. J. (2001) Co-labeling using in situ PCR: A review. J. Histochem. Cytochem. 

49, 1329–1339. 

50. Komminoth, P., Long, A. A., Ray, R., and Wolfe, H. J. (1992) In situ polymerase chain 

reaction detection of viral DNA, single copy genes and gene rearrangements in cell 

suspensions and cytospins. Diagn. Mol. Pathol. 1, 85–97. 

51. Wiedorn, K. H., Kühl, H., Galle, J., Caselitz, J., and Vollmer, E. (1999) Comparison of in 

situ hybridization, direct and indirect in situ PCR as well as tyramide signal amplification 

for the detection of HPV. Histochem. Cell Biol. 111, 89–95. 

52. Patterson, B., Till, M., Otto, P., Goolsby, C., Furtado, M., McBride, L., and Wolinsky, S. 

(1993) Detection of HIV-1 DNA and messenger RNA in individual cells by PCR-driven in 

situ hybridization and flow cytometry. Science 260, 976–979. 

53. Speel, E. J. M., Richter, J., Moch, H., Egenter, C., Saremaslani, P., Rütimann, K., et al. 

(1999) Genetic differences in endocrine pancreatic tumor subtypes detected by comparative 

genomic hybridization. Am. J. Pathol. 155, 1787–1794. 

54. Zehbe, I., Hacker, G. W., Su, H., Hauser-Kronberger, C., Hainfeld, J. F., and Tubbs, R. 

(1997) Sensitive in situ hybridization with catalyzed reporter deposition, streptavidinnanogold, 

and silver acetate autometallography. Am. J. Pathol. 150, 1553–1561. 

55. Lizardi, P. M., Huang, X., Zhu, Z., Bray-Ward, P., Thomas, D. C., and Ward, D. C. 

(1998) Mutation detection and single-molecule counting using isothermal rolling-circle 

amplification. Nat. Genet. 19, 225–232. 

56. Höfler, H., Pütz, B., Mueller, J., Neubert, W., Sutter, G., and Gais, P. (1995) In situ 

amplification of measles virus RNA by the self-sustained sequence replication reaction. 

Lab. Invest. 73, 577–585. 

57. Tecott, L. H., Barchas, J. D., and Eberwine, J. H. (1988) In situ transcription: specific 

synthesis of complementary DNA in fixed tissue sections. Science 240, 1661–1664. 

58. Mogensen, J., Kolvraa, S., Hindkjœr, J., Petersen, S., Koch, J., Nygård, M., et al. (1991) 

Nonradioactive, sequence-specific detection of RNA in situ by primed in situ labeling 

(PRINS). Exp. Cell Res. 196, 92–98. 

59. Player, A. N., Shen, L.-P., Kenny, D., Antao, V. P., and Kolberg, J. A. (2001) Single-copy 

gene detection using branched DNA (bDNA) in situ hybridization. J. Histochem. Cytochem. 

49, 603–611. 

60. Mangham, D. C. and Isaacson, P. G. (1999) A novel immunohistochemical detection 

system using mirror image complementary antibodies (MICA). Histopathology 35, 

129–133. 

61. Pastore, J. N., Clampett, C., Miller, J., Porter, K., and Miller, D. (1995) A rapid immunoenzyme 

double labeling technique using enzyme polymer system (EPOS) reagents. 

J. Histotechnol. 18, 35–40. 

62. Kämmerer, U., Kapp, M., Gassel, A. M., Richter, T., Tank, C., Dietl, J., and Ruck, P. 

(2001) A new rapid immunohistochemical staining technique using the EnVision antibody 

complex. J. Histochem. Cytochem. 49, 623–630.


63. Van Gijlswijk, R. P. M., Van Gijlswijk-Janssen, D. J., Raap, A. K., Daha, M. R., and 

Tanke, H. J. (1996) Enzyme-labeled antibody-avidin conjugates: new flexible and sensitive 

immunochemical reagents. J. Immunol. Methods 189, 117–127. 

64. Chen, B.-X., Szabolcs, M. J., Matsushima, A. Y., and Erlanger, B. F. (1996) A strategy for 

immunohistochemical signal enhancement by end-product amplification. J. Histochem. 

Cytochem. 44, 819–824.

Cycling Primed In Situ Amplification 425 

60 

Cycling Primed In Situ Amplification 

John H. Bull and Lynn Paskins 


Primed in situ amplification (PRINS) is a technique for the visualization of specific 

sequences, usually repeat sequences, in fixed cell nuclei. When viewed on the microscope, 

the resulting signals can be seen as spots within nuclei, providing a means to 

visualize telomeres, centromeric regions, Alu repeats, or other sequences. 

At its simplest, the PRINS reaction is a primer extension conducted under a sealed 

coverslip on a microscope slide. A mix of oligonucleotide primer, dNTPs (including 

a labeled dNTP), and Taq DNA polymerase is applied to a preparation of fixed cell 

nuclei on the slide, which is placed on a heating block and subjected to a round of 

denaturation, annealing, and extension. During this process, the nuclei are held in place 

while the DNA strands are made available for oligonucleotide annealing and extension 

by the polymerase. Unincorporated nucleotides are washed off, and the incorporated 

labeled nucleotide is detected typically by fluorescence (1,2). 

PRINS has many applications in common with the widely used fluorescence in situ 

hybridization (FISH) technique (3). However, PRINS has significant advantages in the 

speed of the reaction, avoidance of toxic chemicals, lack of dependence on a carefully 

controlled stringency wash step, and in the use of easily synthesized oligonucleotides 

rather than expensive probes. For example, specific primers can be used for most 

human chromosomes or pairs of chromosomes (4), giving discrete subnuclear spots 

that allow chromosome enumeration. The target sequence is typically satellite repeat 

(e.g., α-satellite, a family of 171-bp repeat units present at the centromeres of human 

chromosomes) and the strength of the signal is a function of the number of repeat 

units at the target site. 

Cycling PRINS represents a modification where the primer extension is repeated 

several times (see Fig. 1), with the result that multiple labeled DNA strands are 

synthesized with a concomitant increase in signal (5). This has obvious advantages in 

sensitivity, but in practice there are constraints to the signal build-up in cycling PRINS, 

which center around the fixation method used to prepare the nuclei or cells. PRINS 

depends on unimpeded access of reagents to the nuclear DNA. As the newly primed 

strand is synthesized, it is held in place by base pairing to the nuclear template DNA. 

When the reaction is cycled, there may be nothing to stop the newly synthesized strand 

diffusing away from the site of synthesis. In our laboratory, this problem appears 



425

426 Bull and Paskins 

Fig. 1. Results of cycling PRINS using α-satellite primers for specific chromosomes (see 

Subheading 3.1.), DIG-dUTP incorporation and FITC detection. (A) cultured lymphoblast 

cells settled onto a slide labeled for chromosome X, (B) peripheral blood smear also labeled for 

chromosome X, and (C) smear of bone marrow aspirate labeled for chromosome 7. See Note 4 

for details of cell preparation.


most severe when the cytoplasm has been stripped away, as in typical methanol/acetic 

acid fixed metaphase spread preparations used in cytogenetic analysis (6). The naked 

nucleus provides no barrier to diffusion, and although PRINS is very efficient, cycling 

PRINS confers no advantage as a steady state of signal is reached after the first cycle. 

Many elaborate schemes can be imagined to overcome this, involving crosslinking 

agents, looped or circular structures, and photoactivatable anchors. The method 

described here simply uses ethanol fixation of whole cells. When ethanol is used, 

signal retention in cycling PRINS is markedly improved (7). Background labeling 

of the nuclear DNA is increased with this fixative, but this is easily counteracted by 

microwave boiling of the slides before the PRINS reaction is set up. Using an extended 

initial denaturation step also helps reduce background. 

The method described here is applicable to cell preparations, such as blood smears, 

cytospin, or gravity-settled cell preparations. Once dry, the slides can be fixed and stored 

for several months before cycling PRINS analysis. Although it is presently limited 

to whole cell preparations and seems incompatible with the analysis of metaphase 

spreads, it is simple, robust, and effective. 

2. Materials 

2.1. Slide Preparation 

1. Glass slides and coverslips: high-grade, dust-free slides are a sound investment and 

require no further preparation (e.g., Menzel Glaser Super Premium, Fisher Scientific, 

Loughborough, UK). Coated slides can be useful if there are doubts around loss of valuable 

cells (see Note 1). Coverslips can be 22 × 22 mm or bigger. 

2. Cell preparation (see Subheading 3.2.). 

3. Ethanol (100%). 

4. Slide staining jar, for example, a Coplin jar. 

5. 10 mM Tris-HCl, 5 mM EDTA, pH 7.0. 

6. Anti-bumping granules (Merck). 

7. 800-W Microwave oven (e.g., Matsui M162TC). 

8. Graded ethanol solutions: 100%, 90%, and 70% v/v with water. 

2.2. Cycling PRINS 

1. AmpliTaq Gold DNA polymerase (PE Biosystems). 

2. 10× PCR buffer: 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 200 mM MgCl2 (see Note 2). 

3. dNTPs (Amersham Pharmacia Biotech Inc., Uppsala, Sweden). Dilute to make a 50× stock 

solution of 10 mM each dATP, dCTP, dGTP; and 1.8 mM dTTP. 

4. Digoxygenin-11-dUTP (DIG-dUTP; 10 nmol/µL, Roche Molecular Biochemicals, Lewes, 

UK) (see Note 3). 

5. Oligonucleotide primer (50 µM, see Subheading 3.1.). 

6. Double distilled water. 

7. High-grade clean coverslips and rubber solution (see Note 4) or Amplicovers and 

Ampliclips (PE Biosystems). 

8. Flat-bed or slide-adapted thermal cycling (“PCR”) machine (e.g., Hybaid, Ashford, UK 

or PE Biosytems). 

9. Stop buffer: 500mM NaCl, 50 mM EDTA, pH 7.0. 

10. Water bath at 65°C.


2.3. Detection 

1. Water bath at 45°C, and staining jar (e.g., a Coplin jar). 

2. Incubator set at 37°C and sandwich box. 

3. 20× SSC: 3.0 M NaCl, 0.30 M tri-sodium citrate, pH 7.3. 

4. Wash buffer: 4× SSC (diluted from 20× stock), 0.05% Triton×-100. 

5. Dried skimmed milk powder. 

6. Blocking buffer: Wash buffer with the addition of 5% skimmed milk powder (which can 

be stored for a few days at 4°C). 

7. Anti DIG-FITC (Roche Molecular Biochemicals). Store at –20°C in 5-µL aliquots. 

8. Antifade mountant (e.g., Vectashield, Vector Laboratories, Burlingame CA). 

9. Counterstain: propidium iodide solution (20 µg/mL, Sigma, Dorset, UK) (see Note 5). 

10. Fluorescence microscope with appropriate filters for FITC and PI (e.g., Zeiss Axioskop ® , 

Carl Zeiss, Thornwood, NY). 

3. Methods 


These protocols were tested using α-satellite-specific primers for DYZ1 (D599: 

TGGGCTGGAATGGAAAGGAATCGAAAC), DXZ1 (E563: ATAATTTCCCATA- 

ACTAAACACA), D17Z1 (E571: AATTTCAGCTGACTAAACA), D7Z1 (E528: 

AGCGATTTGAGGACAATTGC), and D3Z1 (E570: TCTGCAAGTGGATATTTAAA) 

(1). It has been suggested that one or more of these are used to set up the technique 

when using human cells (see Note 5). 

3.2. Cell Preparation 

The type of cells you use will of course depend on your experimental system. Aim to 

prepare cells in a monolayer, preferably slightly separated from each other, with several 

hundred cells in an area of 20 to 30 mm 2 for ease of location at the microscopy stage 

(see Note 5). In practice, 10 to 20 cells may be all that is needed for good results. 

Human peripheral blood leukocytes provide a robust positive control and, satisfyingly, 

are easily available in plentiful and cheap supply (see Note 6). The majority red 

cells do not interfere with the PRINS reaction. 

1. Obtain a few drops of blood from your finger using a suitable puncture device (e.g.. 

Haemolance, HaeMedic AB, Munka Ljungby, Sweden). 

2. Spot approx 5 µL whole blood onto one end of a slide. Use a second microscope slide to 

spread the blood. This is done by holding the end of the second slide at an angle of roughly 

45 degrees onto the blood spot, allowing it to spread under the edge, then pushing with 

some force to smear the cells. When done properly, a monolayer or “feather” of cells a few 

mm wide will form at the end of the smear (see Note 5). With practice, it is easily possible 

to make 2 or 3 small smears per slide, each using 1 to 2 µL of blood. This is useful if space 

on the flat-block PCR machine is limiting. 

3. Allow to air dry. 

3.3. Fixation 

1. Fix by immersion in ethanol (see Note 7) for 5 min at room temperature (1 min is sufficient 

for blood smears). 

2. Remove slides, drain, and air dry. Slides can be used immediately or stored at 4°C for 

several months.


3.4. Microwave Pretreatment 

1. Place about 10 anti-bumping granules in a 50-mL Coplin jar and add the microscope slides. 

Slides can be placed back to back so that a jar contains 10 slides. 

2. Fill the jar with 10 mM Tris-HCl, 5 mM EDTA (40–50 mL). 

3. Place the jar in the center of the microwave oven, switch on full power until boiling, 

and boil for a further 50 s. 

4. Quickly transfer the slides to a staining jar containing 70% ethanol at room temperature. 

Leave for 1 min. 

5. Pass through 90% and 100% ethanol for 1 min each. Slides can either be air dried for 

immediate use or stored at 4°C in 100% ethanol for several months if desired. 

3.5. Cycling PRINS 

Reaction volumes will vary with your system (see Note 8). As a rough guide, 

22- × 22-mm coverslips require about 15 µL, and 50- × 22-mm coverslips or Amplicovers 

require about 40 µL. 

1. Prepare 100-µL reaction mix as follows: 2 µL of dNTP mix, 0.4 µL of DIG-dUTP, 10 µL of 

10× PCR buffer, 2 µL (10 units) of AmpliTaq Gold DNA polymerase, 2 µL oligonucleotide 

primer, and 83.6 µL water. 

2. Place 15 to 40 µL on the slide area, according to the cell preparation area and size of your 

coverslip, or 40 µL for Amplicovers. 

3. For coverslips, seal with rubber solution and allow this to dry (a fan or laminar flow cabinet 

speed this up). For Amplicovers, follow manufacturers’ instructions. 

4. Transfer the slides to a flat block thermal cycler. A suitable program for the primers 

described is: 18 min at 95°C (to activate the AmpliTaq Gold DNA polymerase: reduce 

to 5 min for standard Taq), then 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min 

for 15 cycles (see Note 8). 

5. Peel off rubber glues, or take off Amplicovers, and immerse slides in a Coplin jar containing 

stop buffer at 65°C. Coverslips may come off with the glue, if not they will fall off readily 

in the stop bath. After 1 min, transfer slides to a jar containing wash buffer (we have also 

used 2× SSC, 45°C for 5 min to stop the reaction). 

3.6. Detection 

Do not allow slides to dry during this process. 

1. Prepare blocking buffer, and pipet 40 µL on to a clean cover slip. Shake the slide free 

of excess wash buffer, then pick up the cover slip with slide. Leave the slide at room 

temperature for 5 min. 

2. Dilute the anti-DIG FITC 1/100 in blocking buffer (e.g., add 500 µL of blocking buffer 

to a 5-µL aliquot. This is usually a suitable dilution, although batch-to-batch variation 

may be encountered). 

3. Remove the coverslip from the slide and drain the excess fluid by shaking or briefly 

blotting one edge against an absorbent paper towel. Pipet 40 µL of diluted anti-DIG FITC 

on to the coverslip and replace the slide. Incubate in a moist chamber (e.g., a sandwich 

box lined with damp filter paper) at 37°C for 30 min. 

4. Wash the slides 3× for 2 min in prewarmed wash buffer (42°C) in a Coplin jar. 

5. Prepare mountant: add 3.75 µL of propidium iodide (see Note 9) stock to 100 µL of 

Vectashield.


6. Shake the slide free of excess liquid and mount as follows: pipet 40 µL of mountant on 

to a clean coverslip and pick up the coverslip with the slide. Place between two layers of 

tissue and press to spread the mountant and expel the excess. Seal with rubber solution 

(for long term storage) and allow to dry. 

7. Slides can be viewed at once or stored for up to a few months in the dark at 4°C without 

significant loss of signal. Typical results are shown in Fig. 1. 

4. Notes 

1. Coated slides are often used in histological procedures where harsh treatments can cause 

loss of sample from the slide surface. They can be bought from Fisher or PE Biosystems 

or prepared by using poly L-Lysine or aminopropyltriethoxysilane (8). The Amplicover ® 

and Ampliclip ® system, together with slides, supplied by PE Biosystems (Foster City, 

CA) provides an alternative option for sealing the reaction solution onto the slide surface, 

but also requires use of their In Situ PCR 1000 thermal cycler and tool for assembling 

the slide chamber. Although relatively expensive, this is the best system for more than 

five cycles of PRINS. 

2. The relatively high concentration of MgCl 2 is to counteract loss of solution phase Mg 

thought to occur during cycling. 

3. Alternatively, biotin-labeled dUTP can be used at the same concentration, in which case 

a suitable detection reagent is avidin-FITC (Vector Labs). This can be substituted for 

anti-DIG FITC, at a 1500 dilution. 

4. Most commercially available brands for cycle puncture repair perform adequately. Rema 

Tip Top (Munich, Germany) is recommended. 

5. Hematological smears work well, as do cytocentrifuge preparations of lymphocytes or 

neutrophils or cultured cells. Cells prepared by these methods are flattened and have a 

distinct morphological appearance, which is an advantage in interpreting and recording 

results because subnuclear spots tend to be in the same focal plane. We have used standard 

hematological preparations, such as bone marrow or peripheral blood smears, Giemsastained 

slides, and archival slides stored at room temperature, for over a year without 

problems. For cultured cells, or leukocyte preparations made from fresh blood (e.g., 

Lymphoprep, Sigma), cytocentrifuge (“cytospin”) preparations are ideal (e.g., Shandon or 

Hiraeus cytocentrifuges and equipment). Alternatively, cells can be allowed to settle on 

coated slides for 10 to 20 min then allowed to dry after draining off liquid. These methods 

are easy to perform, but molecular biologists unfamiliar with cytological preparations 

might benefit from a tutorial in a hospital hematology or histology laboratory. Crystallized 

solids from support medium or isotonic solutions are not usually problematic because they 

are removed in the fixation and microwaving procedure. For extra phenotypic information, 

immunocytochemical staining can be done, and signals can be visualized alongside PRINS 

signal (7,9). 

6. Hygiene precautions (i.e., hand washing) should be taken. The implications of sampling 

one’s own blood might merit consideration: An inadvertent diagnosis of aneuploidy may 

cause distress! Chromosomes 3, 7, and 17 should be safe in this regard. 

7. Ethanol fixation works by precipitating proteins irreversibly from solution. Other precipitating 

fixatives we have successfully used include methanol and acetone. 

8. Reactions can be performed under coverslips or using the PE Applied Biosystems system 

(Amplicovers and Ampliclips). If using coverslips, some slides may start to dry out after 

around 10 cycles, but this will depend on the size of your coverslip and the type of rubber 

solution used to seal it to the slide. We find that 5 to 7 cycles is a good compromise. Using 

the PE system, we have cycled up to 70 times.


9. Propidium iodide binds specifically to DNA and emits a red fluorescence distinct from 

FITC. If desired, DAPI (4′,6-Diamidino-2-phenylindole 2 HCl; Sigma) can also be used 

at the same concentration. This emits a strong blue fluorescence, which sometimes aids in 

locating the cells on the slide. As an alternative detection system, Texas Red-conjugated 

reagents are available for detection of DIG or biotin. This can be combined with the DAPI 

counterstain, leaving the green channel free for detection of a third label, for example, 

via immunostaining (7,9). 

References 


in situ synthesis (PRINS). Hum. Mol. Genet. 3, 931–936. 

2. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, S. (1994) 

Fast, sensitive multicolour detection of nucleic acids in situ by primed in situ labelling 

(PRINS). Cytogenet. Cell Genet. 66, 152–154. 

3. Trask, B. J. (1991) Fluorescence in situ hybridization: Applications in cytogenetics and 

gene mapping. Trends Genet. 7, 149–54. 

4. Koch, J., Hindkjaer, J., Kolvraa, S., and Bolund, L. (1995) Construction of a panel of 


of individual human chromosomes in situ. Cytogenet. Cell Genet. 71, 142–147. 

5. Gosden, J. and Hanratty, D. (1993) PCR in situ: A rapid alternative to in situ hybridisation 

for mapping short, low-copy number sequences without isotopes. BioTechniques 15, 

78–83. 

6. Spowart, G. (1994) Mitotic metaphase chromosome preparation from peripheral blood for 

high resolution, in Methods in Molecular Biology, Vol. 29: Chromosome Analysis Protocols 

(Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 1–10. 

7. Paskins, L., Brownie, J., and Bull, J. (1999) In situ polymerase chain reaction and cycling 

primed in situ amplification: improvements and adaptations. Histochem. Cell Biol. 111, 

411– 416. 

8. Jackson, P. and Blyth, D. (1993) Immunolabelling techniques for light microscopy, 

in Immuncytochemistry, a Practical Approach (Beesley, J. E., ed.), IRL, Oxford, UK. 

pp. 15– 42. 

9. Speel, J. M., Lawson, D., Ramaekers, C. S., Gosden, J. R., and Hopman, A. H. N. (1997) 

Combined immunocytochemistry and PRINS DNA synthesis for simultaneous detection 

of phenotypic and genomic parameters in cells, in Methods in Molecular Biology, Vol. 71: 

PRINS and in Situ PCR Protocols (Gosden, J.R., ed.), Humana, Totowa, NJ, pp. 53–60.

432 Bull and Paskins

Direct and Indirect In Situ PCR 433 

61 

Direct and Indirect In Situ PCR 

Klaus Hermann Wiedorn and Torsten Goldmann 


In recent years, the development of in situ technologies has made good progress. 

In situ hybridization (ISH) has become an important tool and has enabled the pathologist 

to demonstrate infectious pathogens or mRNAs in tissue sections or cytospins without 

destruction of morphology, thus enabling the assignment of signals to individual cells 

or cell compartments (1–9). 

Although ISH has contributed substantially to the diagnosis and understanding of 

neoplastic and infectious diseases, the detection of low copy DNA and RNA sequences 

by conventional ISH remained difficult in the past because of the relatively low 

sensitivity of ISH, irrespective of whether the investigation was performed using 

radioactive or nonradioactive hybridization probes (8,9a,10–15). Nonradioactive 

probes, especially biotin and digoxigenin (DIG), which are less hazardous to work 

with, can be much more quickly developed, allow a much higher spatial resolution, 

and have been shown to be at least as sensitive as radioactive probes (10–14). Several 

different detection systems (14,16–20) have been used to enhance signal intensities. 

Nevertheless, conventional ISH usually will enable detection of high to medium copy 

number nucleic acids only. 

However, target amplification by in situ PCR (IS-PCR) or reverse transcription 

in situ PCR (RT-IS-PCR) have been shown to even allow the detection of low copy 

number DNAs or RNAs (1,4–6,8,15,21–23). There exist two different approaches to 

IS-PCR: direct and indirect IS-PCR (Fig. 1). 

Indirect IS-PCR requires an additional ISH step and is more cumbersome but will 

usually yield reliable results. Direct IS-PCR is often hampered by nonspecific products, 

especially when performed on paraffin-embedded tissue sections. These false positives 

in direct IS-PCR are predominantly primer-independent artifacts resulting from DNA 

repair and endogenous priming (5,21,22,24,25). These pathways are also operative in 

indirect IS-PCR but will not produce false positives because no labeled nucleotides are 

incorporated during the amplification step. Primer-dependent artifacts like mispriming 

can be controlled by hot start maneuvers, although this is in general not quite as easy 

as in solution-phase PCRs. In addition, diffusion artifacts may be involved in the 

generation of false-positive cells in paraffin-embedded tissues undergoing direct as well 



433

434 Wiedorn and Goldmann 

Fig. 1. IS-PCR can be performed with indirect and direct approach. With direct IS-PCR 

during amplification, unlabeled and labeled nucleotides are used in the reaction mix. Thus, 

labeled nucleotides are incorporated into the PCR products. Therefore, subsequent to the 

amplification, direct detection of the labeled PCR products can be performed. In contrast with 

indirect IS-PCR, only unlabeled nucleotides are used with the reaction mix. Therefore, the 

amplicons are unlabeled, and for detection of the PCR products subsequent to the amplification, 

an ISH with a labeled internal probe (a probe that does not contain the primer sites) has to be 

performed. Thus, the detection cannot be performed until after ISH is finished. 

as indirect IS-PCR, although they are predominantly associated with cell suspensions 

(4,22). Optimized fixation and permeabilization as well as reduction of PCR cycle 

numbers to less than 30 cycles are likely to minimize but not totally exclude this 

phenomenon. With RT-IS-PCR, in contrast to solution-phase PCR, an additional 

problem will arise. Depending on the primers chosen, false-positive nuclear signals 

may arise because usually the primers will anneal to cDNA as well as to genomic 

DNA in the nucleus (which is eliminated during RNA extraction and additional DNAse 

digestion for removing residual DNA in approaches using solution phase RT-PCR) and 

will therefore not only generate PCR-products in the cytoplasm but also in the nucleus. 

To circumvent this problem, cDNA-specific primers, which will only anneal to the 

cDNA, may be designed for RT-IS-PCR (15). In addition, a DNAse pretreatment may 

be performed before RT-IS-PCR to destroy the genomic DNA. However, the general 

potential of this technique is controversially discussed (5,15,26). 

Nonetheless, although direct IS-PCR will contain more risks for false-positive 

results, both methods are described in this chapter especially because direct IS-PCR 

offers a more convenient way and will yield reliable results when performed on 

nonparaffin-embedded samples like cytospins. 

2. Materials 

1. In situ Thermal cycling machine (Hybaid AGS, Heidelberg, Germany; Shandon, Frankfurt, 

Germany) (see Note 1). 

2. Wash Module (Hybaid AGS, Heidelberg, Germany; Shandon, Frankfurt, Germany). 

3. SuperFrostPlus slides (Menzel Gläser, Braunschweig, Germany) (see Note 2).


4. Cover Slips (Omnilab, Germany). 

5. Microtome (Leica, Germany). 

6. Heating Oven for 220°C (WTB Binder, Germany). 

7. Water bath (e.g., GFL 1083, GFL, Germany). 

8. Pattex Supermatic 200plus (Henkel, Düsseldorf, Germany). 

9. Forceps. 

10. Laboratory gas burner. 

11. DEPC (Sigma, Deisenhofen, Germany, Cat-No. D5758). 

12. 5 NNaOH (Merck, Germany). 

13. 1 NHCl (Merck, Germany). 

14. NaCl (Merck, Germany). 

15. NaH 2 PO 4 H 2 O (Merck, Germany). 

16. Na 2 HPO 4 2H 2 O (Merck, Germany). 

17. Tris-HCl (Sigma, Deisenhofen, Germany). 

18. EDTA (Sigma, Deisenhofen, Germany). 

19. 10× phosphate-buffered saline (PBS): 1.3 M NaCl, 5 mM NaH 2 PO 4 , 95 mM Na 2 HPO 4 . 

Adjust to pH 7.2 with orthophosphoric acid. 

20. 5% buffered formalin pH 7.2 (Frontell, Germany). 

21. 4% buffered paraformaldehyde, pH 7.2. Dissolve 40 g of paraformaldehyde (Merck ultra 

pure 4005, Germany) in 1× PBS. Adjust to pH 7.2 with NaOH and fill up to 1000 mL with 

1× PBS. Filter through Wathman No 1. 

22. 100% ETOH (Merck, Germany). 

23. Xylene (Merck, Germany). 

24. Taq Polymerase 5 U/µL (Roche Diagnostic GmbH, Mannheim, Germany, Cat No. 

1146173). 

25. 0.1 M Tris-HCl, 0.1 M NaCl, pH 7.5. 

26. 1 M MgCl 2 (Sigma, Deisenhofen, Germany). 

27. CaCl 2 (C3306, Sigma, Deisenhofen, Germany). 

28. 20× SSC: 3 M NaCl and 0.3 M Na 3 Citrate. Adjust to pH 7.0 with HCl. 

29. Bovine serum albumin (BSA) 20 mg/ mL (Roche Diagnostic GmbH, Mannheim, Germany, 

Cat-No. 711454). 

30. 10% SDS (Sigma, Deisenhofen, Germany, Cat-No. L 4522). 

31. 100% deionized formamide (Sigma, Deisenhofen, Germany, Cat-No. F9037). 

32. Dextran sulfate (Sigma, Deisenhofen, Germany, Cat-No. D8906): 50% dextran sulfate. 

Dissolve 50 mg in 100 mL of DEPC-treated distilled water. Heat to 60°C and shake to 

speed up the dissolving. 

33. DIG Wash and Block Buffer Set (Roche Diagnostic GmbH, Mannheim, Germany, Cat-No. 

1585762) containing 10× washing buffer, 10× blocking solution (=10% blocking solution), 

10× detection buffer, 10× maleic acid buffer. 

34. NBT 100 mg/mL (Nitroblue tetrazolium chloride; Roche Diagnostic GmbH, Mannheim, 

Germany Cat-No. 1383213). 

35. BCIP 50 mg/mL (5-Brom-4-chlor-3-indoyl-phosphate) (Roche Diagnostic GmbH, Mannheim, 

Germany, Cat-No. 138221). 

36. Mounting media (as supplied; Permount SP15-500, Fisher Scientific, Wiesbaden, 

Germany). 

37. Counterstain (Nuclear Fast Red and Eosin, Merck, Germany). 

38. Anti-Dig or Anti-biotin antibody conjugates (Roche Diagnostic GmbH, Mannheim, 

Germany Cat-No. 1426303, 1426311, 1093274, 1207733). 

39. Hybridization probes (Eurogentec, Belgium or MWG Biotech, Ebersberg, Germany). 

40. DNAse (Roche Diagnostic GmbH, Mannheim, Germany, Cat-No. 776785).


41. Proteinase K solution: Proteinase K (Roche Diagnostic GmbH, Mannheim, Germany; 

250 µg/mL), 100 mM Tris-HCl and 50 mM EDTA. 

42. 10× Target Retrieval (Dako, Hamburg, Germany, Cat-No. S1700). 

43. DNAse solution: 40 mM Tris-HCl, pH 7.4, 6 mM MgCl 2 , 2 mM CaCl 2 , and 1 U/µL RNAse 

free DNAse (Roche Diagnostic GmbH, Mannheim, Germany). 

44. IL6 PCR mix: 10 mM Tris-HCl, pH 9.2, 50 mM KCl, 3 mM MgCl 2 , 0.2 mM dNTPs 

(Roche Diagnostic GmbH, Mannheim, Germany); 0.1% BSA (Roche Diagnostic GmbH, 

Mannheim, Germany); 10 µM DIG-11-dUTP (Roche Diagnostic GmbH, Mannheim, 

Germany) (see Note 3); 5 U/sample Taq-Polymerase (Roche Diagnostic GmbH, Mannheim, 

Germany); and 0.4 µM of sense and antisense primer. 

45. Sequence of IL6 primers (see Note 4): sense primer: 5′ CTTCTCCACAAGCGCCTTC-3′; 

antisense primer: 3′ CTAAGTTACTCCTCTGAACGG-5′. 

46. A typical hybridization mix is composed of (exact compositions depends on the probe in 

use): 2× up to 5× SSC; up to 50% formamide; 5% up to 10% dextran sulfate (see Note 5); 

0.1% SDS; 0.1% BSA; 1% up to 2% blocking solution; 250 µg/ mL fish sperm DNA 

(Roche Diagnostic GmbH, Mannheim, Germany); 1–10 ng/µL hybridization probe. 

Additionally for RT-IS-PCR: 

47. DNAse/RNAse solution: 40 mM Tris-HCl, pH 7.4, 6 mM MgCl 2 , 2 mM CaCl 2 , 1 U/µL 

RNAse free DNAse (Roche Diagnostic GmbH, Mannheim, Germany), and500 µg/mL 

RNAse (Roche Diagnostic GmbH, Mannheim, Germany). 

48. Reverse transcription buffer (RT-buffer): 50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM 

MgCl 2 , 0.5 mM dNTPs (Roche Diagnostic GmbH, Mannheim, Germany), 10 mM DTT 

(GibcoBRL, Karlsruhe, Germany), 1 U/µL RNAsin (Promega, Mannheim, Germany), 

2 U/µL M-MLV-RT (GibcoBRL, Karlsruhe, Germany) (see Note 6), 0.1 µg/µL Random 

Hexamers (Roche Diagnostic GmbH, Mannheim, Germany). 

3. Methods 

If not otherwise mentioned, all incubations are performed at ambient temperature 

(20°C). Incubations on the thermocycler are performed using the humidity chamber. 

Samples are processed without coverslips and sealing if not otherwise mentioned. 

3.1. Prevention of DNAse and RNAse Contamination 

1. Incubate all slides, coverslips and microtome blades for 12 h at 220°C to inactivate DNAse 

and RNAse (see Notes 7 and 8). 

2. If RNA detection is required, include 0.1% DEPC in all solutions and incubate overnight. 

3. Autoclave solutions for 20 min at 1.2 bar (15 psi) at 121°C. 

3.2. Fixation 

Incubate tissues for 24 h in 5% buffered formalin (for detection of DNA) or 4% 

buffered paraformaldehyde (for detection of mRNA) (see Note 9). With cell suspensions 

and cytospins a 30 min incubation is usually sufficient. 

3.3. Paraffin Embedding 

The distilled water used to dilute ETOH should be autoclaved and prepared with 

DEPC-treated water to ensure the absence of DNAse and RNAse. 

1. Incubate tissue for 30–60 min in 70% ETOH. 

2. Incubate tissue for 30–60 min in 80% ETOH.






7. Incubate tissue for 60 min in xylene100% ETOH (11). 

8. Incubate tissue 2 × 60 min in xylene. 

9. Incubate tissue 3 × 60 min in paraffin. 

10. Allow to cool and harden the paraffin for several hours. 

3.4. Preparation of Samples 

3.4.1. Tissue Sections 

1. Use Teflon coated SuperFrostPlus slides (see Note 2). 

2. Cut section of 2- to 5-µm thickness (see Note 10). 

3. Change the microtome blade frequently and clean thoroughly with xylene after each block 

to prevent crosscontamination between samples. 

4. Incubate slides overnight at 50°C. 

3.4.2. Cytospins 

1. Centrifuge cells on slides. 

2. Incubate slides for at least 30 min at 50°C. 

3.5. Deparaffinization 

1. Incubate slides for 10 min at 70°C. 

2. Incubate slides for 10 min in fresh xylene (see Note 11). 

3. Incubate slides for 2 min in fresh xylene. 

4. Incubate 2 × 1 min in 100% ETOH. 

5. Incubate 1 min in 90% ETOH. 



8. Incubate 1 min in distilled water. 

9. Dry Slides for up to 10 min at 37°C (on the thermocycler). 

3.6. Permeabilization 

The following permeabilization protocols are for optimized fixation conditions and 

may vary with fixation conditions and tissues (see Notes 9 and 12). 

3.6.1. By Protease 

1. Incubate 15 min at 37°C (on the thermocycler) with 100 µL of Proteinase K solution. 

2. Incubate 2 × 5 min in 0.1 M Tris-HCl, 0.1 M NaCl, pH 7.5. 

3.6.2. By Target Retrieval 

1. Put slides in a Coplin jar filled with 1 × Target Retrieval (Dako). Place Coplin jar in a 

waterbath and incubate 35 min at 95°C. 

2. Place Coplin jar outside the water bath and allow to cool for 20 min. 

3. Incubate 2 × 5 min in 0.1 M Tris-HCl, 0.1 M NaCl, pH 7.5. 

3.7. DNAse Treatment 

1. Incubate in 100 µL of DNAse solution at 37°C for 12 h on the thermocycler. Cover slides 

with coverslips.


2. Incubate 4 min at 95°C. 

3. Incubate 2 × 5 min in 0.1 M Tris-HCl, 0.1 M NaCl, pH 7.5, in a Coplin jar. 

3.8. DNAse/RNAse Treatment 

If destruction of RNAse is necessary too (for example to generate negative controls), 

a combined DNAse/RNAse treatment is recommended. Proceed as mentioned under 

Subheading 3.7., but use the DNAse/RNAse solution. 

3.9. Quenching 

If Peroxidase/AEC or -/DAB systems are used during the detection then quenching 

is required to inactivate endogenous peroxidase. 

1. Incubate 30 to 45 min in 100 µL of 0.6% hydrogen peroxide (see Note 13). 




5. Dry Slides for 5 min at 37°C (on the thermocycler). 


For all RT and IS-PCR, the Omnislide and MISHA thermocyclers have to be set to 

simulated slide control and calibration factor 100. 

If you are investigating DNA targets, then proceed to Subheading 3.11. 

1. Incubate for 60 min at 39°C in 15 to 20 µL of RT-buffer per sample on the thermocycler. 

Cover sample with coverslips and seal with PattexSupermatic200Plus (see Note 14). 

2. Stop reaction by incubation at 92°C for 10 min. 

3. Remove coverslips (see Note 15) and discard reaction mixture. 

3.11. IS-PCR 

Use aerosol resistant pipet tips for preparing the PCR. 

1. Prepare PCR mix without Taq-Polymerase in Eppendorf tubes. 

2. Heat PCR mix to 80°C. 

3. Heat slides to 80°C on the thermocycler. 

4. Add Taq-Polymerase to PCR mix and vortex briefly. 

5. Pipet 16 µL of the PCR mix onto the specimen. 

6. Immediately cover with a coverslip using a forceps and seal with PattexSupermatic 

200Plus. 

7. Heat forceps in a laboratory gas burner before proceeding to the next sample to avoid 

cross contamination. 

8. Repeat steps 5–7 for each specimen. 

9. Start the PCR program. 


The PCR protocol for IL6 is composed of one cycle at 92°C for 5 min, 32 cycles each 

with 1 min denaturation step at 92°C, 1 min annealing step at 56°C, 2 min extension 

step at 72°C. The program is finished by an additional extension for 7 min at 72°C. 

3.12. ISH 

This step is only necessary if indirect IS-PCR is performed. Otherwise proceed to 

Subheading 3.13. All reactions are performed on the thermocycler.


1. Prepare fresh hybridization mix without fish sperm DNA. 

2. Denature fish sperm DNA for 10 min at 100°C in a water bath. 

3. Cool fish sperm DNA on ice for 2 min. 

4. Add fish sperm DNA to the hybridization mix. 

5. Pipet 16 µL of the hybridization mix onto each sample. 

6. Immediately cover with a coverslip using a forceps and seal with PattexSupermatic200Plus 


7. Heat forceps in a laboratory gas burner before proceeding to the next sample to avoid 

cross contamination. 

8. Incubate 10 min at 95°C. 

9. Incubate 1 to 16 h between 30 to 65°C (see Note 16). 


3.13. Washing and Detection 

1. Incubate 2 × 5 min in 0.1× SSC at 20°C (see Note 17). 

2. Incubate 10 min in 0.1× SSC at 45°C in the Wash Module (see Note 17). 

3. Incubate 1 min in 1× washing buffer (DIG Wash and Block buffer Set, Roche Diagnostic 

GmbH, Mannheim, Germany). 

4. Incubate 60 min in 1× blocking solution at 37°C. 

5. Add 100 µL of 1250 diluted Anti-DIG-AP-conjugate per sample and incubate 60 min 

at 37°C on the thermocycler. 

6. Incubate 2 × 5 min in 1× washing buffer at 20°C. 

7. Incubate 2 × 5 min in 1× detection buffer at 20°C. 

8. Incubate in 100 µL per sample freshly made substrate solution (up to 12 h) in the 

dark. Substrate solution is composed of (per mL): 4.5 µL NBT, 3.5 µL BCIP, 992 µL 

of detection buffer (all reagents Roche Diagnostic GmbH, Mannheim, Germany) (see 

Note 18). 

9. Counterstain 10 min with nuclear fast red or eosin at 20°C (intensity of counterstain may 

be adjusted by reducing or prolonging incubation period). 

10. Mount with Permount SP15-500 (Fisher Scientific). 

3.14. Controls 

Several controls have to be performed to ensure the specificity of the results. 

1. Omission of RT (should result in cells showing no signal). 

2. Omission of Taq-Polymerase (should result in cells showing no signal). 

3. Omission of primers (should result in cells showing no signal). 

4. RT IS-PCR of a housekeeping gene, such as GAPDH, or actin to ensure that the reverse 

transcription and PCR was successful because GAPDH should be demonstrable in each 

cell. Furthermore, this should indicate if the permeabilization was successful. 

5. PCR of Alu-repeats to ensure that PCR and permeabilization was successful. 

6. Omission of the Anti-Dig-POD or Anti-DIG-AP to detect endogenous enzyme activity. 

7. Tissues that are definitively negative for the sequence under investigation. If such tissues 

are not available, the control samples may be treated either with DNAse, RNAse or both. 

8. Tissues that are definitively positive for the sequence under investigation. 

Furthermore, at least in the phase of establishing a new PCR protocol for new 

primers, all IS-PCRs should be controlled by simultaneous solution-phase PCRs on 

serial sections of the same samples.



Primers should be designed to be cDNA specific (if RNA targets are under investigation), 

that is, to span an intron (15) to disable amplification of genomic sequences 

during RT-IS-PCR. Furthermore, primers should be chosen to give small amplification 

products because the efficiency of IS-PCR will be reduced with longer products. 

3.16. Closing Remarks 

PCR has become an important diagnostic as well as research tool in molecular biology, 

clinical chemistry, and pathology. With the invention of IS-PCR, the amplification 

power of solution-phase PCR with no limitations in the amount of template was hoped 

to be transferred to the in situ techniques. Unfortunately, this has become reality only 

partly because IS-PCR is often hampered by poor reproducibility, specificity, and 

reliability (8,9) and by the cumbersome protocol. For semiquantitative in situ studies of 

gene expression in combination with image analysis, RT-IS-PCR seems to be of little 

value because of the tremendously varying amplification efficiency of IS-PCR (15,27). 

For these applications, ISH with subsequent signal amplification by biotinyl tyramide 

proved to be the method of choice. This approach has been shown to be an excellent 

alternative for IS-PCR. With respect to most applications, generally signal amplification 

procedures are more suitable than target amplification by direct or indirect IS-PCR 

and exhibit a sensitivity similar to that of IS-PCR (2,8,9,25,28). Adequate choice 

of hybridization probes provided signal amplification allows even the detection of 

single-copy virus sequences (28). 

4. Notes 

1. We have made good experience with the Omnislide in situ Thermocycler (Hybaid AGS 

Germany) and the MISHA (Shandon Germany) because the slides are fitted horizontally 

onto the blocks in the humidity chamber thus requiring sealing only during the PCR 

whereas those apparatus where slides have to be fitted vertically onto the blocks require 

sealing during each step of the procedure resulting in a much more cumbersome protocol. 

For achieving reliable results, it is of utmost importance to use thermocyclers specially 

designed for in situ PCR procedures. For detailed instructions regarding the setup of the 

thermocycler and protocols, see instruction manual and (29). 

2. Although expensive (E 0.50 per slide) we recommend the use of Teflon coated SuperFrost- 

Plus slides (Menzel-Gläser, Braunschweig, Germany). These behaved well with respect to 

adhesion of tissue even after prolonged cycling protocols and because of the hydrophobic 

Teflon coating around the well do not require the cumbersome use of hydrophobic pens to 

outline the reaction area. Hydrophobic pens usually have to be used several times during 

a PCR protocol to guarantee a closed border around the tissue sample. However, repeated 

application of the hydrophobic pens requires drying of the slide and the tissue, which can 

produce strong background staining. 

Slides with at least two wells should be used so that controls can be run on the same 

slide simultaneously. In this case, Teflon coating will effectively prevent contamination 

between the two samples. We used slides with wells of 17-mm diameter each. The volumes 

indicated during the protocol proofed well in covering samples of this size but have to be 

adjusted for wells with different diameters. 

3. DIG-dUTP is omitted if indirect IS-PCR is performed. Instead of DIG-dUTP, biotinlabeled 

nucleotides can be used too. 

4. Unlike in solution-phase, PCR primers for IS-PCR should be designed to give amplicons


of 200 to 800 bp because with larger amplicons the amplification efficiency will be reduced 

dramatically and will often result in false negative samples. 

5. Because dextran sulfate may produce background staining, especially if higher concentrations 

are used, reduce the amount of dextran sulfate to diminish the background staining. 

For ISH in contrast to filter hybridization, usually 10% dextran sulfate is the upper limit. 

6. The reverse transcription can also be performed with other transcriptases, such as 

Superscript (GibcoBRL, Karlsruhe, Germany). In this case, the protocol has to be adjusted 

accordingly. 

7. For SuperFrostPlus slides, this is only a precaution as when stored (dust free) and 

handled under appropriate conditions, we have encountered neither DNAse nor RNAse 

contamination. 

8. Coverslips may be siliconized prior to the incubation at 220°C if adherence of tissue 

sample to the coverslips is observed during the PCR procedure. 

9. To obtain reproducible results, it is essential that fixation is always performed at the same 

temperature and for the same time. Otherwise, the permeabilization conditions have to 

be adapted and optimized for each PCR. A difference of 5°C during fixation may give 

false negative results because of changes in cell permeability. Unfortunately, tissue in 

molecular pathology is usually not fixed under standardized conditions. Therefore, several 

permeabilization conditions have to be tested for each sample. 

To improve fixation and therefore DNA and RNA preservation, tissues should be cut 

to the minimum size prior to fixation. 

For mRNA detection paraformaldehyde will yield a better preservation of RNA than 

formalin. Perform fixation at 4°C where possible. The extraction of RNA from formalinor 

paraformaldehyde-fixed tissues for doing a solution-phase PCR to verify the in situ 

results especially when establishing a new protocol is usually very ineffective. For these 

applications, we recommend the use of the Hope fixative (patent pending, Dr. Olert, Institut für 

Kinderpathologie, Universität Mainz, Germany available at DCS, Hamburg, Germany) which 

additionally yields a much better preservation of RNA compared to other fixatives. 

10. Thinner sections show better adhesion to slides during IS-PCR, although this reduces the 

number of target sequences, which may result in some negative cells. 

11. Use fresh reagents for each incubation. Because xylenes saturate rapidly with paraffin use 

200 mL of fresh xylene for each batch of 15 to 20 slides. 

12. Although fixed under the same conditions, different tissues may require adapted permeabilization 

parameters. When optimizing permeabilization parameters with respect to 

morphology, it is usually better to prolong Proteinase K incubation than to increase the 

concentration of Proteinase K (15). If diffusion artifacts are a major problem the reduction 

of the concentration of Proteinase K with simultaneous prolongation of incubation turned 

out to be advantageous (15). If you encounter background staining this may be reduced 

by the use of target retrieval instead of Proteinase K (15). Proteinase K (250 µg/ mL) is 

optimal for portio and condylomata biopsies fixed for 24 h in buffered formalin whereas 

for leukocytes 10 to 30 µg/mL Proteinase K and for bronchial epithelial cells 30 to 

50 µg/mL Proteinase K performed well. Leukocytes and bronchial epithelial cells were 

fixed with 4% buffered paraformaldehyde for 30 min. 

13. The concentration of endogenous peroxidase varies significantly between tissues. Leukocytes 

exhibiting high endogenous peroxidase levels usually require longer incubation 

(45 min) than other tissues. If you encounter signals in your negative controls try to 

diminish those signals either by prolongation of the quenching reaction or by increasing 

the concentration of H 2 O 2 up to 3%. 

14. Evaporation control is of the utmost importance for reliable and reproducible results as 

unspecific signals because of the evaporation of the reaction mixture may result from insuf-


ficient sealing. From the many methods for sealing, the use of Pattex Supermatic200Plus 

offers a convenient and reliable way to prevent leakage (15,29,30). It is easier to handle 

than nail polish with the same good sealing capacity. Furthermore, it seems to represent a 

biocompatible adhesive as it does not interfere with enzyme activity during PCR. 

15. Coverslips can easily be removed by an initial scalpel cut along the sealed edge, which 

is to be lifted first. To facilitate the removal of the coverslips, the slides can be stored at 

4°C for 1 to 2 min to completely harden the gluten if it is still viscous after the incubation 

at 92°C (8,15,29). 

16. The lower the temperature and the shorter the incubation period, the better will be 

morphology which, nevertheless, is negatively affected by the IS-PCR procedure. 

17. Temperatures, concentration of SSC, and incubation period have to be adjusted for the 

probe in use. 

18. Antibody concentrations have to be adapted for different probes and according to the 

efficiency of the PCR. One can choose from a wide variety of chromogens. Furthermore, a 

peroxidase-based system can be used using AEC+ or DAB+ (Dako) as chromogens, which 

usually will result in more localized signals (8,28) than those achieved with NBT/BCIP. 

Detection solutions and antibody concentrations have to be adjusted. 


The authors are indebted to Prof. Dr. Dr. E. Vollmer for making it possible to participate 

in the development of this technology and H. Kühl for excellent technical assistance. 

References 

1. Chen, R. H. and Fuggle, S. V. (1993) In situ cDNA polymerase chain reaction. A novel 

technique for detecting mRNA expression. Am. J. Pathol. 143, 1527–1534. 

2. Goldmann, T., Becher, B., Wiedorn, K. H., Pirow, R., Deutschbein, M. E., Vollmer, E., 

et al. (1999) Epipodite and fat cells as sites of hemoglobin synthesis in the branchiopod 

crustacean Daphnia magna. Histochem. Cell Biol. 112, 335–339. 

3. Heniford, B. W., Shum-Siu, A., Leonberger, M., and Hendler, F. J. (1993) Variation in 

cellular, E. G.F receptor mRNA expression demonstrated by in situ reverse transcriptase 

polymerase chain reaction. Nucleic Acids Res. 21, 3159–3166. 

4. Long, A. A., Komminoth, P., and Wolfe, H. J. (1992) Detection of HI.V provirus by in situ 

polymerase chain reaction. N. Engl. J. Med. 327, 1529. 

5. Nuovo, G. J. (1994) PCR in Situ Hybridization Protocols and Applications, Second Ed., 

Raven Press, New York. 

6. Patel, V. G., Shum-Siu, A., Heniford, B. W., Wieman, T. J., and Hendler, F. J. (1994) 

Detection of epidermal growth factor receptor mRNA in tissue sections from biopsy 

specimens using in situ polymerase chain reaction. Am. J. Pathol. 144, 7–14. 

7. Snijders, P. J. F., van den Brule, A. J. C., Schrijnemakers, H. F. J., Snow, G., Meijer, C. 

J. L. M., and Walboomers, J. M. M. (1990) The use of general primers in the polymerase 

chain reaction permits detection of a broad spectrum of human papillomavirus genotypes. 

J. Gen. Virol. 71, 173–181. 

8. Wiedorn, K. H., Kühl, H., Galle, J., Caselitz, J., and Vollmer, E. (1999) Comparison of insitu 

hybridization, direct and indirect in-situ PCR as well as tyramide signal amplification 

for the detection of HPV. Histochem. Cell Biol. 111, 89–95. 

9. Wiedorn, K. H., Goldmann, T., Kühl, H., Galle, J., and Vollmer, E. (1999) GenPoint : 

A new biotinyl tyramide based signal amplification system for significantly increasing 

sensitivity of in situ hybridization (ISH). Elec. J. Pathol. Histol. 994–999.


9a. Furuta, Y., Shinohara, T., Sano, K., Meguro, M., and Nagashima, K. (1990) In situ 

hybridization with digoxigenin-labelled DNA probes for detection of viral genomes. 

J. Clin. Pathol. 43, 806–809. 

10. Allan, G. M., Todd, D., Smyth, J. A., Mackie, D. P., Burns, J., and McNulty, M. S. (1989) In 

situ hybridization: an optimised detection protocol for a biotinylated DNA probe renders it 

more sensitive than a comparable 35 S-labeled probe. J. Virol. Methods 24, 181–190. 

11. Burns, J., Graham, A., Frak, C., Fleming, F., Evans, M., and McGee, J. (1987) Detection of 

low copy human papilloma virus DNA and mRNA in routine paraffin sections of cervix by 

non-isotopic in situ hybridization. J. Clin. Pathol. 40, 858–864. 

12. Furuta, Y., Shinohara, T., Sano, K., Meguro, M., and Nagashima, K. (1990) In situ 

hybridization with digoxigenin-labelled DNA probes for detection of viral genomes. 

J. Clin. Pathol. 43, 806–809. 

13. Nuovo, G. J. and Richart, R. M. (1989) A comparison of biotin and 35 S-based in situ 

hybridization methodologies for detection of human papilloma-virus DNA. Lab. Invest. 

61, 471–476. 

14. Syrjänen, S., Partanen, P., Mäntyjärvi, R., and Syrjanen K. (1988) Sensitivity of in situ 

hybridization techniques using biotin- and 35S-labeled human papillomavirus (HPV) DNA 

probes. J. Virol. Methods 19, 225–238. 

15. Wiedorn, K. H., Lang, D., Köhl, H., Galle, J., and Vollmer, E. (1999) Sensitive in situ 

detection of modulated expression levels of interleukin 6 (IL6) and interleukin 8 (IL8) in 

bronchial epithelium and leucocytes using cDNA specific primers and direct RT in-Situ- 

PCR. Elec. J. Pathol. Histol. 993–996. 

16. Herrington, C. S., Burns, J., Graham, A. K., Evans, M., and McGee, J. O. (1989) Interphase 

cytogenetics using biotin and digoxigenin labeled probes I: relative sensitivity of both 

reporter molecules for detection of HPV 16 in CaSki cells. J. Clin. Pathol. 42, 592–600. 

17. Holm, R., Karlsen, F., and Nesland, J. M. (1992) In situ hybridization with nonisotopic 

probes using different detection systems. Mod. Pathol. 5, 315–319. 

18. Lassus, J., Niemi, K.-M., Marjamaki, A., Syrjanen, S., Kartamaa, M., Lehmus, A., et al. 

(1992) Comparison of four in situ hybridization methods, based on digoxigenin- and 

biotin-labelled probes, in detecting HPV DNA in male condylomata acuminata. Int. 

J. STD AIDS 3, 196–203. 

19. Mifflin, T. E., Bowdwn, J., Lovell, M. A., Burns, D. E., Hayden, F. G., Graschel, D. H. M, 

et al. (1987) Comparison of radioactive and biotinylated DNA probes for the detection of 

cytomegalovirus. Clin. Biochem. 20, 231–235. 

20. Niedobitek, G., Finn, T., Herbst, H., and Stein, H. (1989) In situ hybridization using 

biotinylated probes. An evaluation of different detection systems. Pathol. Res. Pract. 

184, 343–348. 

21. Komminoth, P. and Long, A. A. (1993) In situ polymerase chain reaction. An overview 

of methods, applications and limitations of a new molecular technique. Virchows Archiv. 

64, 67–73. 

22. Komminoth, P. and Long, A. A. (1995) In situ polymerase chain reaction—methodology, 

applications and nonspecific pathways, in PCR Applications Manual, Boehringer Mannheim, 

Mannheim, pp. 97–106. 

23. Long, A. A., Komminoth, P., and Wolfe, H. J. (1993) Comparison of indirect and direct in 

situ polymerase chain reaction in cell preparations and tissue sections. Detection of viral 

DNA gene rearrangements and chromosomal translocations. Histochemistry 99, 51–162. 

24. Söllström, J. F., Zehbe, I., Alemi, M., and Wilander, E. (1993) Pitfalls of in situ polymerase 

chain reaction (PCR) using direct incorporation of labelled nucleotides. Anticancer Res. 

13, 1153–1154.


25. Komminoth, P. and Werner, M. (1997) Target and signal amplification: approaches to 

increase the sensitivity of in situ hybridization. Histochem. Cell Biol. 108, 325–333. 

26. Komminoth, P., Adams, V., Long, A. A., Roth, J., Saremaslani, P, Flury, R., et al. (1994) 

Evaluation of methods for hepatitis C virus (HCV) detection in liver biopsies: Comparison 

of histology, immunohistochemistry, in situ hybridization, reverse (RT) PCR and in situ RT 

PCR. Pathol. Res. Pract. 190, 1017–1025. 

27. Wiedorn, K. H., Schaaf, B., Kühl, H., Spuck, S., Galle, J., Dalhoff, K., et al. (1999) 

Granulocyte Colony Stimulating Factor (G-CSF) induced modulation of cytokine expression: 

A semiquantitative in situ analysis using target amplification by reverse transcriptase 

in situ PCR (RT IS PCR) as well as signal amplification by in situ hybridization (ISH) 

with catalyzed reporter deposition (CARD). Verhandlungen der Deutschen Gesellschaft 

für Zytologie 21, 63–65. 

28. Wiedorn, K. H., Goldmann, T., Kühl, H., Rohrer, Ch., and Vollmer, E. (2000) Single-copy 

virus detection by GenPoint in situ hybridisation on the Eppendorf Mastercycler. BioTech 

Int. 12, 12–13. 

29. Wiedorn, K. H. (1996) In situ Hybridisierungshandbuch zum MISHA in situ Thermocycler, 

in Misha Multipler In-Situ-Hybridisierungsautomat für die In-Situ-Hybridisierung und 

Polymerase-Kettenreaktion (PCR), Shandon, Frankfurt. 

30. Stapleton, M. J., Levin, M. C., and Jacobson, S. (1994) DNA Amplification within cells on 

slides: Advances in evaporation and temperature control. Cell Vision 1, 177–181.

RT In Situ PCR 445 

62 

Reverse Transcriptase In Situ PCR 

New Methods in Cellular Interrogation 

Mark Gilchrist and A. Dean Befus 


The advent of the reverse transcriptase polymerase chain reaction (RT-PCR) 

technique represents a quantum leap in sensitivity over preceding methods of detecting 

mRNA transcripts, such as Northern blotting. With the arrival of such sensitive 

techniques, it has become possible to amplify RNA transcripts from very small amounts 

of template nucleic acid, thus opening new avenues of research that were previously 

off limits because of difficulties in obtaining adequate quantities and quality of RNA 

(1,2). However, RT-PCR suffers from the same limitations as its predecessor because 

the isolation of RNA necessitates the destruction of the cells/tissue involved, thus 

preventing the identification of the specific cell source of the mRNA (3). Conversely, 

in situ hybridization allows the specific localization of mRNA to the cells of origin, 

but the methodology is much less sensitive than RT-PCR (3). A methodology that 

combines the best attributes of in situ hybridization (specific cellular localization) and 

RT-PCR (high sensitivity) would be desirable. RT in situ PCR provides these attributes, 

allowing for the location and detection of low copy RNA species, amplified within 

individual intact cells (4). 

The method (Fig. 1) involves fixation of cells in suspension, followed by controlled 

digestion of the crosslinked cellular proteins with a proteolytic enzyme. This allows 

the entry of the RT and PCR reagents into the cell. Next, genomic DNA is removed 

by a DNase digestion step, thus ensuring that only mRNA is amplified. Subsequent 

steps of RT and PCR are then undertaken, using a “labeled” reporter nucleotide, which 

results in its direct incorporation into the PCR product. This is followed by a detection 

step that visualizes the amplified mRNA, either by chromogenic or radioactive means 

(Fig. 1). The specificity of the reaction can be then established by several methods 

(see Note 1). 

Methods of RT in situ PCR, although sharing fundamental steps, have varied greatly 

between laboratories (5–7). On the basis of our experience, RT in situ PCR seems to be 

best suited for the detection of mRNA in single-cell suspensions, in which fixation and 

pretreatments can be optimally controlled (8). The method outlined below is similar to 

that developed by Nuovo et al. 4,5) and has been adopted and built upon through our 



445

446 Gilchrist and Befus 

Fig. 1. Schematic representation of the steps involved in the general protocol outlined in 

the text. After fixation of the cells in suspension, the crosslinks that formed during fixation are 

reduced by limited protease digestion. To remove the possibility of amplifying DNA during 

the PCR, a DNase step is then performed to remove contaminating genomic DNA. A reverse 

transcription reaction is then performed to convert the mRNA to cDNA. PCR amplification with 

gene specific primers is then completed. The PCR product is then detected by chromogenic, 

fluorescent or radioactive means. Many commonly used RT in situ PCR procedures follow 

similar guidelines, differing in specific details, such as fixative used, protease used, digestion 

time, and method of detection. 

experiences. The inclusion of appropriate controls in every run helps insure accurate 

results. Controls to indicate that genomic DNA has been removed as a source of 

false-positive signals (negative control), or failure of PCR amplification because 

of inadequate protease digestion or flaws in the RT-PCR protocol resulting in falsenegative 

results (positive control) must be tested on every slide. Therefore, a slide 

schematic of the necessary controls and test spots is included to aid in the elimination 

of spurious results (Fig. 2). 

2. Materials 

1. Phosphate-buffered saline (PBS): 130 mM NaCl, 10 mM sodium phosphate, pH 7.4. Store 

at room temperature. 

2. 10% neutral buffered formalin (BDH). Store at room temperature. 

3. Heparinase I (for heparin containing mast cell populations; Sigma). 

4. Heparinase buffer: 5 mM Tris-HCl, pH 7.5, 1 mM CaCl 2 , 7.5 U RNasin. 

5. Pepsin (5000 U/mL), made fresh in 0.01 N HCl for immediate use (Boehringer 

Mannheim). 

6. RNase-free DNase I (Boehringer Mannheim). 

7. DNase solution: DNase I (10 U/µL) in 0.1 M sodium acetate, pH 5.0, 5 mM MgSO 4 .


Fig. 2. Schematic of the appropriate controls, how they are achieved, and the expected results 

that indicate a successful reaction. 

8. Primers (see Subheading 4.6.). The following primer pair yields a 295-bp amplicon for rat 

TNF mRNA: 5-TACTGAACTTCGGGGTGATCGGTCC-3 and 5-CAGCCTTGTCCCTT 

GAAGAGAACC-3. 

9. M-MLV RT enzyme (Gibco/BRL). 

10. Reverse transcription buffer: 75 mM KCl, 3 mM MgCl 2 , 50 mM Tris-HCl, 0.1 M DTT 

(pH 8.3), 1 µM antisense primer or 25 µg/mL oligo-(dT) 12–18 primer, and 2500 U/mL 

M-MLV RT enzyme. 

11. Taq DNA polymerase (Gibco/BRL). 

12. PCR buffer: 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 4.5 mM MgCl 2 , 80 µM mixed dNTP, 

16 µM digoxigenin-11-dUTP, 1.2 µM each primer, and 120 U/mL Taq polymerase. 

13. Digoxigenin-11-dUTP (Boehringer Mannheim). 

14. Anti-Digoxigenin antibody, alkaline phosphatase conjugated (Boehringer Mannheim). 

15. Wash buffer 1: 0.1 M TRIS, 0.15 M NaCl, pH 7.5. 

16. Wash buffer 2: 0.1 M TRIS, 0.15 M NaCl, pH 9.5. 

17. Chromagen: 4-nitro blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3-indoyl phosphate 

(BCIP) (Boehringer Mannheim). 

18. Substrate solution : 10µL of NBT, 7.5 µL of BCIP in 2 mL of buffer 2. 

19. Water, di-ethyl pyrocarbonate (DEPC) treated, RNase free. 

20. Silane-coated glass slides. 

21. Thermal cycling PCR machine or dedicated in situ PCR machine. 

3. Methods 

3.1. Cell Fixation 

1. Cells collected from tissue culture flasks, blood, or other sources are collected in a 15-mL 

polypropylene tube.


2. Cells are pelleted by centrifugation in a tabletop centrifuge at 800g for 5 min at 4°C. 

3. Cells should be washed once by resuspending in 10 mL of PBS and centrifuged again 

at 800g for 5 min at 4°C. 

4. The supernatant is discarded, and the pelleted cells are then fixed in 10 mL of 10% neutral 

buffered formalin for 16 h at room temperature (see Note 2). 

5. After fixation the cells are twice washed in DEPC water, recovering the cells each time by 

centrifugation at 800g for 5 min at 4°C. 

6. The cells are then resuspended in DEPC water. 

7. Cells are then dropped (75 µL) onto slides in three discrete areas and allowed to air dry 

at room temperature. Cell concentration should be between 5000 to 10,000 cells per 

droplet/spot. (Fig. 2) (see Note 3). 

3.2. Protease Digestion 

1. Dissolve 20 mg of pepsin in 9.5 mL of DEPC-treated water and then add 0.5 mL of 0.2 N 

HCl. The final concentration of pepsin should be 5000 U/mL. 

2. Add 200 µL of this mix to each spot on the slide (see Note 4). The digestion time has 

to be standardized for each cell type (see Note 5). For mast cell lines we use a digestion 

time of 45 min at 37°C. 

3. After the digestion is completed, the pepsin is inactivated with a 1-min wash in DEPC 

water in a Coplin jar. 

4. Then, wash the slides in 100% ethanol for 1 min. 

5. Allow to air dry at room temperature (see Note 6). 

3.3. Pretreatments (Optional) 

In our studies of mast cells, the presence of granule-associated heparin in most 

preparations is a major obstacle (9). Heparin is a potent inhibitor of RT and Taq 

polymerase enzymes, and therefore a heparinase digestion step must be included to 

remove heparin before proceeding. 

1. 50 µL of heparinase digest buffer containing 333 U/mL of heparinase I is added to the 

slide and incubated for 2 h at room temperature. 

2. Wash the slides in DEPC water for 1 min. 

3. Then wash the slides in 100% ethanol for 1 min. 

4. Allow the slides to air dry at room temperature. 

3.4. DNase Treatment 

This step is used to remove chromosomal DNA. It is added to the negative control 

and test cell spots only. Complete removal of genomic DNA is essential for correct 

interpretation of the test cells. 

1. The negative control and the test cell spots are treated with 50 µL of DNase solution per 

spot, and incubated overnight at 37°C. 

2. After the overnight digestion, wash the slides in DEPC water for 1 min. 




1. Add 50 µL of the master mix to the test spot ONLY (see Note 7). 

2. Incubate 1 h at 37°C in a moist chamber. Transcripts of low abundance may require longer 

incubation of the RT step (see Note 8).


3. Wash slides in DEPC treated water for 1 min. 



3.6. PCR 

1. Place 50 µL of the PCR master mix on EACH spot (see Note 9). 

2. A good starting program for the TNF primers is outlined: 94°C for 2 min, followed by 

30 cycles of: 94°C for 1 min , 45°C for 2 min, 72°C for 2 min, and a final step at 4°C 

until ready to develop the slides. However, this may require optimization for each gene 

and cell type studied (see Note 10). 

3. Once the slides have finished cycling, remove the coverslip and transfer the slides to 

wash buffer 1 for 5 min. 

4. Do not allow the slides to air dry from this point on. 

3.7. Digoxigenin Detection and Color Development 

This step uses an alkaline phosphatase (AP)-labeled anti-digoxigenin antibody to 

detect the incorporated digoxigenin-dUTP. Color development is accomplished with 

NBT/BCIP Chromagen, which is oxidized to a purple/blue color by AP. 

1. Prepare a 1300 dilution (see Note 11) of anti-DIG antibody using wash buffer 1 as the 

diluent. Add 150 µL of the diluted antibody to the slide. Incubate the slides in a moist 

chamber for 30 min at room temperature. 

2. Wash the slides with wash buffer 2 for 5 min. 

3. Prepare the substrate solution. 

4. Add the substrate solution to the slides and develop for 5 min to 1 h at room temperature. 

Monitor the purple/blue color development under the microscope. 

5. Stop the color reaction by washing the slides in water. 

6. Wash the slides for 1 min in 100% ethanol. 

7. Wash in xylene, 1 min. 

8. Mount using Permount and a coverslip. 

3.8. Controls and Expected Results 

The positive control (–DNAse, –RT, +PCR) should show intense nuclear staining in 

>90% of the cell population. This indicates incorporation of digoxigenin into strand 

breaks of genomic DNA by Taq polymerase and ensures that the protease digestion 

and PCR were adequate (Fig. 3b). 

The negative control (+ DNAse, –RT, +PCR) should show no staining. This indicates 

that all genomic DNA has been digested and thus any staining in the test is caused 

by mRNA expression (Fig. 3c). 

The test (+ DNAse, +RT, +PCR), if positive, should show staining predominantly 

over the cytoplasm and not in the nucleus. The cytoplasm is the correct cellular 

compartment for most mRNA (Fig. 3a), although it may have an intense perinuclear 

localization, especially in highly granulated cells (8). 

3.9. Future Directions 

Initial development of RT in situ PCR lent itself immediately to areas of pathology 

and detection of viruses important in human disease. Publications in the field provided 

new insights into the pathogenesis and involvement of viruses, such as human papilloma 

virus (HPV) in cervical carcinoma (10) and Human Immunodeficiency Virus (HIV)


Fig. 3. RT in situ PCR detection of mRNA in a rat mast cell line (RCMC 1.11.2) to show 

representative results. (A) Positive signal localized in the cytoplasm of RCMC indicating the 

presence of TNF mRNA. (B) Positive control showing nuclear staining only and indicating that 

protease digestion, PCR, and detection steps are optimized. (C) Negative control showing no 

staining, indicating that genomic DNA is not causing a nonspecific signal. Original magnification 

×1000; bar = 10 µm. 

(4,11). In both cases, viral nucleic acid was found to be latently expressed in many 

cells, a result that was only obtainable with RT in situ PCR. 

This methodology is now progressing into the area of cytokine research. Cytokine 

production and regulation has been difficult to study because of their low levels of 

expression and rapid turnover. Previously, our knowledge of cytokine expression and 

interaction was obtained from studies performed in cell culture systems, far removed 

from a true in vivo environment. With recent progresses in this method, it has become 

feasible to identify the source, kinetics and tissue distribution patterns of cytokines in 

situ, and their patterns of distribution in both health and disease (12,13). 

The future of RT in situ PCR looks promising. Growth in the area will progress with the 

ability to colocalize both mRNA signals by RT in situ PCR, combined with a technique 

such as immunohistochemistry for protein detection. Such a protocol will allow researchers 

the power to identify both protein and gene expression in the same cell, contributing 

greatly to the understanding of molecular interactions at the cellular level. 

4. Notes 

1. Several methods have been used to confirm the specificity of the products generated by this 

methodology (8). In our experience, the labeled PCR product can be directly isolated from 

the cells on the slide itself. Once isolated the product can be confirmed either by Southern 

blot analysis or by cloning and sequencing of the generated product. 

2. Fixation is a critical parameter in this protocol. A wide variety of fixatives have been 

used with success by other investigators, including 10% formalin, 4% paraformaldehyde, 

ethanol, and methanol/acetic acid (14,15). We have used 10% neutral-buffered formalin as 

our fixative of choice because of its good cell structural preservation qualities and minimal 

reactivity with RNA (16), thus facilitating good cDNA amplification. 

3. Because cells/sections must remain on the slide through the rigors of digestion, pretreatments, 

and thermocycling, they must be placed on silane-coated slides. We use slides 

available from Perkin–Elmer for our in situ studies. Other sources of slides, including 

those produced “in-house” as part of a regular regime for use in immunohistochemistry 

can also be used with excellent results. 

4. To keep the RT-PCR master mixes from evaporating during cycling, some method of 

covering the sections must be devised. We have used several techniques with similar 

success, including dedicated neoprene covers produced by Perkin–Elmer, as well as glass


coverslips anchored with nail polish, and polyethylene bags, cut to size and held in place 

with nail polish (5,17). It is important to remove ALL visible air bubbles because these will 

be expanded as a result of the cycling process, which can result in some parts of sections 

being inaccessible to the PCR reagents, resulting in false negatives. Different means of 

covering the cell spots will result in different volumes of reagent required for each step, 

and they should be adjusted accordingly to save costs. 

5. Protease digestion reduces the protein cross-links that form during the fixation step, thus 

allowing reagents to enter the cell. We currently use pepsin (5000 U/mL) at 37°C. The 

duration of pepsin digestion depends on the type of fixative used and the extent of fixation, 

with mast cell, macrophage, and lymphocyte cell lines taking ~45 min of digestion, 

whereas other cells such as in vivo derived mast cells requiring much less digestion 

(~15 min). However, other temperatures (22°C) and enzymes (trypsin, proteinase K) have 

been used by various groups (7). Both these enzymes can give excellent results as well. 

We have settled on pepsin as our enzyme of choice, as it works at low pH (3.0), and is thus 

easily inactivated by a wash in water (~pH 7.5). 

6. As a first step in the process of optimizing the digestion time and to become familiar with 

the methodology, we use a shortened protocol (5). This involves using a single slide, with 

each individual spot being subjected to a different digestion time (e.g., 20 min, 40 and 

60 min). After washing off the protease, the slide is then subjected to PCR and development, 

with no DNase or RT steps. By looking at the nuclear staining obtained with the different 

times, the investigator will be able to pick the time that gives >90% of the nuclei positive 

but maintains the cellular architecture. This optimal time can then be used for complete RT 

in situ PCR studies on this same batch of fixed cells. Some investigators have noted that they 

use >50% of the nuclei positive as an indication of optimal digestion (4,5). We generally see 

>90% positive nuclei and have chosen this as our optimal indicator of digestion. 

7. Recommended primer lengths are between 20 to 30 nucleotides. The PCR product should be 

at least 300 bp in length to assure that the amplicons remain inside the cell. The RT solution 

should contain an antisense primer capable of initiating first strand cDNA production. 

Oligo-dT can be used, although we have found that a gene specific primer works best. 

8. Numerous RT enzymes are commercially available. We have used both Maloney Murine 

Leukemia Virus (MMLV) and Avian Myeloblastosis Virus (AMV) RT enzymes with 

identical results. We do our RT steps at 37°C, and vary the time of incubation from 1 to 3 

h, depending on the signal seen with a specific cell type. 

9. The critical parameter in the composition of the PCR solution is the MgCl 2 concentration. 

We found that Mg 2+ concentration in the range of 3.0 to 5.0 mM works best, which is about 

four times higher than that used in solution-based PCR. This necessary increase in Mg 2+ 

concentration is thought to be caused by binding of Mg 2+ to the glass slides (5,7). 

10. If no product is detected with the cycling program given, then the program will have to 

be optimized. Take into account the T m of the primers being used, and vary the number of 

cycles. In general terms, we begin with an annealing temperature that is 5°C below that of 

the primer Tm. Furthermore, depending on the abundance of the mRNA being amplified, 

upwards of 35 cycles may be required to obtain a detectable signal. 

11. Transposed onto the technique of in situ RT-PCR is the necessity to detect the amplified 

product using immunohistochemical techniques. This introduces numerous other variables 

into the protocol. We have found that antibody concentrations of 0.75 to 3.75 µg/mL 

provide optimal signal with little background staining. 


The authors recognize Dr. Osamu Nohara for his contribution to the development of 

our understanding of this procedure.


References 

1. Mullis, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerasecatalysed 

chain reaction. Methods Enzymol. 155, 335–350. 

2. Veres, G., Gibbs, R. A., Scherer, S. E., and Caskey, C. T. (1987) The molecular basis of the 

sparse fur mouse mutation. Science 237, 415– 417. 

3. Long, A. A. (1998) In situ polymerase chain reaction: foundation of the technology and 

today’s options. Eur. J. Histochem. 42, 101–109. 

4. Nuovo, G. J., Forde, A., MacConnell, P., and Fahrenwald, R. (1993) In situ detection of 

PCR-amplified HIV-1 nucleic acids and tumor necrosis factor cDNA in cervical tissues. 

Am. J. Pathol. 143, 40– 48. 

5. Nuovo, G. J. (1992) PCR in situ Hybridization: Protocols and Applications. Raven Press, 

New York. 

6. Chen, R. H. and Fuggle, S. V. (1993) In situ cDNA polymerase chain reaction. Am. 

J. Pathol. 143, 1527–1534. 

7. Teo, I. A. and Shaunak, S. (1995) Polymerase chain reaction in situ: An appraisal of an 

emerging technique. Histochem. J. 27, 647–659. 

8. Nohara, O., Gilchrist, M., Dery, R. E., Stenton, G. R., Hirji, N. S., and Befus, A. D. (1999) 

Reverse transcriptase in situ polymerase chain reaction for gene expression in rat mast cells 

and macrophages. J. Immunol. Methods 226, 147–158. 

9. Gilchrist, M., MacDonald, A. J., Neverova, I., Ritchie, B., and Befus, A. D. (1997) 

Optimization of the isolation and effective use of mRNA from rat mast cells. J. Immunol. 

Methods 201, 207–214. 

10. Chiu, K. P., Cohen, S. H., Morris, D. W., and Jordan, G. W. (1992) Intracellular amplification 

of proviral DNA in tissue sections using the polymerase chain reaction. J. Histochem. 

Cytochem. 40, 333–341. 

11. Patterson, B. K., Till, M., Otto, P., Goolsby, C., Furtado, M. R., McBride, L. J., et al. (1993) 

Detection of HIV-1 DNA and messenger RNA in individual cells by PCR-driven in situ 

hybridization and flow cytometry. Science 230, 1350–1354. 

12. Hagimoto, N., Kuwano, K., Nomoto, Y., Kunitake, R., and Hara, N. (1997) Apoptosis and 

expression of Fas/Fas ligand mRNA in bleomycin-induced pulmonary fibrosis in mice. Am. 

J. Respir. Cell Mol. Biol. 16, 91–101. 

13. Peters, J., Krams, M., Wacker, H. H., Carstens, A., Weisner, D., Hamann, K., et al. (1997) 

Detection of rare RNA sequences by single-enzyme in situ reverse transcription polymerase 

chain reaction: High-resolution analysis of interleukin-6 mRNA in paraffin sections of 

lymph nodes. Am. J. Pathol. 150, 469– 476. 

14. O’Leary, J. J. (1994) Importance of fixation procedures on DNA template and its suitability 

for solution phase PCR and PCR in situ hybridization. Histochem. J. 26, 337–346. 

15. Long, A. A., Komminoth, P., and Wolf, H. J. (1993) Comparison of indirect and direct 

in situ polymerase chain reaction in cell preparations and tissue sections. Histochemistry 

99, 151–162. 

16. Teo, I. A. and Shaunak, S. (1995) PCR in situ: aspects which reduce amplification and 

generate false-positive results. Histochem. J. 27, 660–669. 

17. Patel, V. G., Shum-Siu, A., Heniford, B. W., Weiman, T. J., and Hendler, F. J. (1994) 

Detection of epidermal growth factor receptor mRNA in tissue sections from biopsy 

specimens using in situ polymerase chain reaction. Am. J. Pathol. 144, 7–14.

PRINS and Immunocytochemistry 453 

63 

Primed In Situ Nucleic Acid Labeling Combined with 

Immunocytochemistry to Simultaneously Localize DNA 

and Proteins in Cells and Chromosomes 



In the past decade, the primed in situ (PRINS) labeling technique has become an 

alternative to fluorescence in situ hybridization (ISH) for the localization of nucleic acid 

sequences in chromosome, cell, and tissue preparations (1–8). The PRINS method is 

based on the rapid annealing of unlabeled primers (restriction fragment, PCR product, 

or oligonucleotide) to complementary target sequences in situ. These primers serve 

as initiation sites for in situ chain elongation using Taq DNA polymerase and labeled 

nucleotides. Incorporated fluorochrome-labeled nucleotides can be detected directly by 

fluorescence microscopy, whereas haptenized (e.g., biotin, digoxigenin, dinitrophenyl) 

nucleotides can be visualized by the additional application of fluorochrome- or 

enzyme-conjugated avidin or antibody molecules (4,5,9,10), followed by fluorescence 

microscopy or brightfield visualization of enzyme reaction products. Particularly, 

rapidity, simplicity, and cost-effectiveness have made the PRINS technique a useful 

tool in cytogenetics and cell biology. Its detection sensitivity, however, seems to 

be limited to repetitive targets for a long time. Only recently, the combined use of 

multiple oligonucleotides for 1 locus together with tyramide signal amplification 

have shown the first reproducible results demonstrating single-copy gene detection 

by PRINS (11). 

With immunocytochemistry (ICC), specific information can be obtained regarding 

the presence or absence of proteins or antigens in chromosomes, cells, and tissue 

sections, thus allowing one to characterize the function of structural proteins in 

chromosomes or to phenotype cells (for example, their type of differentiation and 

proliferative activity). In addition, protocols have been developed to efficiently combine 

protein and nucleic acid detection in the same biological material to, for example, 

immunophenotype cells harboring a specific chromosomal aberration or viral infection, 

determine cytokinetic parameters of tumor cell populations that are genetically of 

phenotypically aberrant, and study the structural organization of chromosomes and the 

cell nucleus (10,12). The success and sensitivity of such a combined procedure depends 

on factors, such as preservation of cell morphology and protein epitopes, accessibility 



453


of nucleic acid targets, lack of crossreaction between the different protein and nucleic 

acid detection procedures, and good color contrast and stability of the fluorochromes 

and enzyme cytochemical precipitates applied. A variety of procedures have been 

reported that combine ICC and ISH (for a review, see ref. 10,12), in most cases 

applying ICC before ISH to prevent the destruction of antigenic determinants by 

the ISH procedure because of enzymatic digestion, postfixation, denaturation at 

high temperatures, and hybridization in formamide. For reasons of rapidity, probe 

accessibility, and lack of formamide for hybridization, the substitution of ISH by 

PRINS may be an extra advantage in such a combined procedure. 

Here, we present three protocols for combined ICC and PRINS DNA labeling. In the 

first procedure, a sensitive, high-resolution fluorescence alkaline phosphatase (APase)- 

Fast Red ICC staining method (13,14) is performed before subsequent PRINS labeling 

of DNA target sequences to enable the simultaneous detection of surface antigens 

(EGF receptor, neural cell adhesion molecule) and repeated chromosome-specific DNA 

sequences in somatic cell hybrid and tumor cell lines. The fact that the Apase-Fast Red 

precipitate withstand subsequent proteolytic digestion and denaturation steps guarantees 

the most optimal conditions for efficient PRINS labeling (15). The second procedure 

has been recently described to investigate chromosome distribution and segregation in 

cells during processes, such as polyploidization and aneuploidization. This protocol 

starts with the PRINS labeling of chromosome centromeres followed by the staining 

of the mitotic spindle by tubulin ICC, because the authors found the antibody epitope 

to be better preserved when ICC came after DNA labeling (16,17). The third protocol 

has been used on metaphase chromosomes to identify possible relationships of different 

families of DNA sequences with, for example, proteins associated with different 

chromosome-specific structures, such as the kinetochore complex. This approach again 

starts with ICC staining followed by PRINS DNA labeling (18,19). 

2. Materials 

2.1. Protocol 1 

2.1.1. Fluorescence Immunophenotyping by Alkaline Phosphatase Cytochemistry 

1. Cold methanol (–20°C), cold acetone (4 and –20°C), and cold 70% ethanol (–20°C). 

2. Normal goat serum (NGS). 

3. Monoclonal antibody EGFR1, directed against the epidermal growth factor receptor (a 

kind gift of V. van Heyningen, Edinburgh, UK). 

4. Monoclonal antibody 163A5, directed against a cell-surface marker of J1-C14 cells (20). 

5. Monoclonal antibody RNL1, directed against the neural cell adhesion molecule 

(N-CAM) (21). 

6. Alkaline phosphatase-conjugated goat anti-mouse IgG (GAMAPase) (Dako, Glostrup, 

Denmark). 

7. Naphthol-ASMX-phosphate (Sigma, St. Louis, MO). 

8. Fast Red TR (Sigma). 

9. Polyvinylalcohol (PVA), MW 40,000 (Sigma). 

10. 10× phosphate-buffered saline (PBS): 1.37 M NaCl, 30 mM KH 2 PO 4 , 130 mM Na 2 HPO 4 . 

11. APase buffer: 0.2 M Tris-HCl, pH 8.5, 10 mM MgCl 2 , 5% PVA. Dilute from stock solutions 

1 M Tris-HCl, pH 8.5 and 1 M MgCl 2 and add 5% (w/v) PVA. Dissolve PVA by using 

a microwave. 

12. Blocking buffer: 1× PBS (diluted from stock 10× PBS), 0.05% Triton X-100, 2–5% NGS.


Table 1 

Sequences of Oligonucleotide Primers Used in PRINS 

Name Human origin DNA sequence 

E528 Chromosome 7 centromere AGCGATTTGAGGACAATTGC 

G33 Chromosome 9 centromere AATCAACCCGAGTGCAATC 

G35 Chromosome 11 centromere GAGGGTTTCAGAGCTGCTC 

D600 Chromosome X centromere TCCATTCGATTCCATTTTTTTCGAGAA 

13. Washing buffer: 1× PBS, 0.05% Triton X-100. 

14. Glass coverslips 50 × 24 mm (Menzel Gläzer, Braunschweig, Germany). 


16. Coplin jars (50 or 100 mL). 

2.1.2 PRINS DNA Labeling 

1. Pepsin from porcine stomach mucosa (2500–3500 U/mg; Sigma). 

2. Ultrapure dNTP set (Amaersham Pharmacia Biotech, Little Chalfont, UK): 100 mM 

solutions of dATP, dCTP, dGTP, and dTTP. 

3. Biotin-16-dUTP, Digoxigenin-11-dUTP, and Fluorescein-12-dUTP (Roche Molecular 

Biochemicals, Basel, Switzerland). 

4. Oligonucleotide primer (see Table 1 and Note 1). 

5. Taq 1 DNA polymerase (Roche) or AmpliTaq (Perkin–Elmer). 

6. Bovine serum albumin (BSA; Sigma). 


8. FITC-conjugated avidin (AvFITC; Vector, Burlingame, CA). 

9. FITC-conjugated sheep anti-digoxigenin Fab fragments (SHADigFITC; Roche). 

10. Vectashield (Vector). 

11. 4′,6-diamidino-2-phenyl indole (DAPI; Sigma). 

12. 0.01 M HCl. 

13. 1× PBS: diluted from 10× PBS (see Subheading 2.1.1., item 10). 

14. Postfixation buffer: 1% formaldehyde (diluted from 37% formaldehyde (Merck, Darmstadt, 

Germany) in 1× PBS. 

15. 20 × SSC: 3 M NaCl, 300 mM trisodium citrate, pH 7.0. 

16. 10× Taq buffer: 500 mM KCl; 100 mM Tris-HCl, pH 8.3, 15 mM MgCl 2 , 0.1% BSA. 

17. PRINS stop buffer: 500 mM NaCl, 50 mM EDTA, pH 8.0. 

18. Blocking buffer: 4 × SSC (diluted from stock 20 × SSC), 0.05% Triton X-100, 5% 

skimmed milk powder. 

19. Washing buffer: 4 × SSC, 0.05% Triton X-100. 

20. Coplin jars (50 or 100 mL). 

21. Ethanol/37% HCl (1001)-cleaned microscope slides and coverslips (Menzel). 

22. Rubber cement. 

23. Water bath at 65°C. 

24. Thermal cycler (Hybaid Omnigene Flatbed; Hybaid, Ashford, UK; see Note 2). 


26. Incubator set at 37°C. 

27. Leica DM fluorescence microscope (Leica, Wetzlar, Germany) equipped with filter sets 

for DAPI, FITC, and TRITC. 

28. Kodak 400 ASA film. 

29. Black and white CCD camera and Isis 4 analysis software (Metasystems, Sandhausen, 

Germany).


Fig. 1. Fluorescence detection of (A) chromosome 9 centromeres with digoxigenin/ 

SHADigFITC in T24 cells after PRINS and Vectashield embedding with PI counterstaining. (B) 

chromosome 7 and 9 centromeres with, respectively, biotin/AvidinTexasRed anf digoxigenin/ 

SHADigFITC after double-target PRINS and Vectashield embedding with DAPI counterstaining. 

(C) EGF receptor with alkaline phosphatase-Fast Red and four chromosome 7 centromeres 

with biotin/avidinFITC in C121-TN6 cells after immunocytochemistry followed by PRINS 

and Vectashield embedding. (D) NCAM antigen with alkaline phosphatase-Fast Red and three 

chromosome 9 centromeres with digoxigenein/SHADigFITC in H460 cells after immunocytochemistry 

followed by PRINS and Vectashield embedding. 

30. Bio–Rad MRC 600 confocal scanning laser microsope equipped with the laser lines 488, 

568, and 648 nm (Bio–Rad Laboratories, Veenendaal, The Netherlands). 


2.2.1. PRINS DNA Labeling 


2. PRINS reaction mixture components: dNTPs, labeled dUTPs, oligonucleotide primers, and 

Taq DNA polymerases as described in Subheading 2.1.2., items 2–6 and 16. 

3. 1× PBS (diluted from 10× PBS, see Subheading 2.1.1., ref. 10) containing 0.1% EDTA 

and 0.2% BSA. 

4. Methanol: acetic acid (91), freshly prepared. 

5. 1× PBS (diluted from 10× PBS, see Subheading 2.1.1., ref. 10). 

6. Permeabilization buffer: 1× PBS containing 0.1% Triton X 100. 

7. A series of 70, 96, and 100% ethanol. 

8. Denaturation buffer: 70% formamide/2 × SSC pH 7.0.


9. Washing buffer: 4 × SSC (diluted from 20 × SSC, see Subheading 2.1.2., item 15), 

0.05% Triton X 100. 

10. Blocking buffer: 4 × SSC (diluted from 20 × SSC, see Subheading 2.1.2., item 15), 0.05% 

Triton X 100, 5% dried skimmed milk powder. 

11. Glass slides (Menzel). 

12. Coplin jars. 

13. Cytocentrifuge (Shandon, Astmoor, UK). 

14. Waterbath at 70°C. 

15. Thermal cycler (Hybaid Omnigene Flatbed; Hybaid). 

16. Incubator at 37°C. 

2.2.2. Immunofluorescence Detection of Mitotic Spindle 

1. Mouse monoclonal anti-β-tubulin antibody (Sigma). 

2. TRITC-conjugated donkey anti-mouse IgG F(ab′)2 fragments (DAMTRITC; Jackson 

Immunoresearch, West Grove, PE). 


4. Vectashield (Vector). 

5. DAPI (see Subheading 2.1.2., item 11). 

6. TOTO-3 iodide (Molecular Probes, Eugene, OR). 

7. Blocking buffer: 1× PBS (diluted from stock 10× PBS, see Subheading 2.1.1., item 9), 

0.05% Triton X-100, 2-5% NGS. 

8. Washing buffer: 1× PBS (diluted from stock 10× PBS, see Subheading 2.1.1., item 9), 

0.05% Triton X-100. 

9. 1× PBS. 

10. Vectashield (Vector) containing 0.5 µg/mL DAPI or 3000× diluted TOTO-3 iodide (from 

1 mM stock in DMSO). 


12. Coplin jar (50 or 100 mL). 

13. Fluorescence microscope, CCD camera, and confocal microscope (see Subheading 2.1.2., 

items 27–30). 


2.3.1. Immunofluorescence Detection of Structural Proteins in Chromosomes 


2. Primary antibody. 

3. FITC-conjugated secondary antibody. 

4. Alcohol-cleaned glass slides and coverslips (Menzel). 

5. Hypotonic solution: 75 mM KCl. 

6. Potassium chromosome medium (KCM) solution: 120 mM KCl, 20 mM NaCl, 10 mM 

Tris-HCl, pH 8.0, 0.5 mM EDTA, and 0.1% (v/v) Triton X-100. 

7. Blocking buffer: KCM containing 2 to 5% NGS. 

8. Fixation solution: KCM containing 10% formalin (from 37% stock solution; Merck). 

9. Cytocentrifuge (Shandon). 

10. Coplin jar (50 or 100 mL). 



1. Immersion solution: 0.1 M NaOH. 

2. Neutralization solution: 0.01 M Tris-HCl, pH 7.4.


3. Methanol:acetic acid (31). 

4. A series of cold (4°C) 70, 96, and 100% ethanol. 

5. Denaturation solution: 30 mM NaOH/1 M NaCl (pH >12). 

6. PRINS reaction, detection, and mounting components, as described in Subheading 2.1.2., 

items 2–26. 

7. Slide evaluation equipment, as described in Subheading 2.1.2., items 27–30. 

3. Methods 


3.1.1. Fluorescence Immunophenotyping by Alkaline Phosphatase Cytochemistry 

1. Hybrid (C121-TN6, J1-C14) and tumor (H460) cell lines are cultured on glass slides 

by standard methods (20,22,23), fixed in either cold methanol (–20°C) for 5 s and cold 

acetone (4°C) for 3 × 5 s, cold acetone (–20°C) for 10 min, or 70% ethanol (–20°C) for 

10 min, air-dried, and stored at –20°C until use (see Note 3). 

2. Incubate slides for 10 min at room temperature with 100 µL of blocking buffer under a 

coverslip in a humid chamber. 

3. Remove the coverslip, discard the blocking buffer, and incubate the slides for 30 to 45 min 

at room temperature with 50 µL of undiluted culture supernatant of the appropriate antigenspecific 

monoclonal antibody containing 2% NGS under a coverslip in a humid chamber. 

4. Wash slides for 2 × 5 min with washing buffer in a Coplin jar. 

5. Incubate slides for 30 to 45 min at room temperature with 50 µL of GAMAPase, diluted 

150 in blocking buffer (see Note 4), under a coverslip in a humid chamber. 

6. Wash slides for 5 min with washing buffer, and for 5 min with 1× PBS. 

7. Visualize the antigen with the alkaline phosphatase-Fast Red (APase-Fast Red) reaction: 

Mix 4 mL of APase buffer, 1 mg of naphthol-ASMX-phosphate in 250 µL of buffer without 

PVA and 5 mg of Fast Red TR in 750 µL of buffer without PVA just before use and overlay 

each sample with 100 µL under a coverslip. Incubate the slides for 5 to 15 min at 37°C 

and wash 3× 5 min with 1× PBS (see Notes 5–7). 


1. Process cells for PRINS as follows: wash slides for 2 min at 37°C with 0.01 M HCl, incubate 

the samples with 100 µg/mLpepsin in 0.01 M HCl for 20 min at 37°C, wash again with 

0.01 M HCl for 2 min, and post-fix the slides in 1% formaldehyde in 1× PBS for 10 min 

at room temperature. Wash cells in 1× PBS for 5 min at room temperature, followed by a 

wash step in 1× Taq buffer for 5 min at room temperature (all steps in a Coplin jar). 

2. Prepare the PRINS reaction mix on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 

110 with distilled water. Dilute 100 mM dTTP 1:100. Put together in a microcentriphuge 

tube: 1 µL of each of the diluted dNTPs, 1 µL of either 1mM Biotin-16-dUTP, Digoxigenin- 

11-dUTP, or Fluorescein-12-dUTP (see Note 8), 5 µL of 10× Taq buffer, 250 ng of 

oligonucleotide (see Note 9), 1 U Taq polymerase, and distilled water to 50 µL. 

3. Place 40 µL of this mixture under a coverslip on the slide, seal with rubber cement, air-dry 

the rubber cement, and transfer to the heating block of the thermal cycler. 

4. Each PRINS reaction cycle consists of 2 min at 94°C (denaturation of cellular DNA, see 

Note 10), 5 min at the appropriate annealing temperature (see Note 11) and 15 min at 

72°C for in situ primer extension. 

5. Stop the PRINS reaction by transferring the slides (after removal of the rubber solution 

seal) to 50 mLof PRINS stop buffer in a Coplin jar at 65°C for 1 min (see Note 12). 

6. Transfer the slides to washing buffer at room temperature and wash 5 min.


7. Place 40 µL of blocking buffer under a coverslip on the slide and leave for 5 min at room 

temperature in a humid chamber to reduce background staining in the detection procedures. 

8. Wash slides for 1 × 5 min in washing buffer in a Coplin jar. 

9a. For reactions using Biotin-16-dUTP: Dilute AvFITC 1:100 in blocking buffer and apply 

50 µL under a coverslip. Incubate slides for 30 min at 37°C in a humid chamber (see 

Note 13). 

9b. For reactions using Digoxigenin-11-dUTP: Dilute SHADigFITC 1100 in blocking buffer 

and treat as in 9a (see Note 13). 

9c. Fluorescein-12-dUTP needs no additional reporter and is simply mounted as described 

in 11 (see Note 13). 

10. Wash slides for 2 × 5 min in washing buffer in a Coplin jar. Optionally, you may wash the 

slides for 5 min in 1× PBS and dehydrate them. 

11. Mount the slides in Vectashield containing 0.5 µg/mLDAPI. 

12. Examine the slides under a fluorescence microscope. Selected cells can be either directly 

photographed using Kodak 400 ASA film, visualized with a charge-coupled device (CCD) 

camera, or scanned with a confocal scanning laser microscope (CSLM). 



1. Hybrid and tumor cell lines are cultured on glass slides, as described in Subheading 

3.1.1., step 1), or in suspension according to standard methods (16,17,20,22,23). Cells are 

rinsed in 1× PBS/0.1% EDTA/0.2% BSA, cytocentrifuged on glass slides at 65g for 4 min 

(in case of growth in suspension), fixed in methanolacetic acid (91) for 10 min at room 

temperature in a Coplin jar, and airdried. 

2. Rehydrate cells in 1× PBS for 5 min, permeabilize them with 0.1% Triton X 100 in 

1× PBS for 5 to 10 min (both in a Coplin jar), dehydrate in a series of 70, 96, and 100% 

ethanol and airdry. 

3. Denature slides in 70% formamide/2 × SSC, pH 7.0, for 2 min at 70°C in a Coplin jar, 

dehydrate in a series of 70, 96 (both at 4°C), and 100% ethanol, and airdry. 

4. Prepare the PRINS reaction mix and apply it on the prewarmed (annealing temperature) 

slides (on the block of the thermal cycler) as described in Subheading 3.1.2., steps 2 

and 3). 

5. Perform the PRINS reaction for 5 min at the appropriate annealing temperature (see Note 11) 

and for 15 min at 72°C for chain elongation on a thermal cycler. 

6. Stop the PRINS reaction by removing the coverslips (see Note 12) and wash the slides 

in washing buffer for 3 × 5 min at room temperature followed by a 5-min wash step in 

1× PBS (all steps in a Coplin jar). 

7. Apply a blocking and wash step as described in Subheading 3.1.2., steps 7 and 8. 

8. In case of PRINS labeling with Biotin-16-dUTP or Digoxigenin-11-dUTP, detect the 

haptens as described in Subheading 3.1.2., steps 9 and 10). 

3.2.2. Immunofluorescence Detection of the Mitotic Spindle 

1. Incubate the slides for 30 to 45 min at room temperature with 50 µL of mouse 

anti-β-tubulin primary antibody, diluted 150 in blocking buffer, under a coverslip in 

a humid chamber. 

2. Wash the slides for 2 × 5 min with washing buffer in a Coplin jar. 

3. Incubate slides for 30 to 45 min at room temperature with 50 µL of DAMTRITC, diluted 

1100 in blocking buffer (see Note 4), under a coverslip in a humid chamber.


4. Wash the slides for 2 × 5 min with washing buffer and for 5 min with 1× PBS (all steps 

in a Coplin jar). 

5. Mount slides in Vectashield containing 0.5 µg/mLDAPI or 3000× diluted TOTO-3 iodide. 

6. Examine the slides as described in Subheading 3.1.2., step 12. 


3.3.1. Immunofluorescence Detection of Structural Proteins in Chromosomes 

1. Prepare metaphase spreads from human peripheral blood lymphocytes as described 

previously (18,19). 

2. After hypotonic treatment of the cell suspension for 10 min at 37°C in 75 mM KCl, 

cytocentrifuge the cells onto alcohol-cleaned glass slides with 65–275g for 4 min and 

air dry for 2 min. 

3. Place slides in a Coplin jar containing KCM solution for 10 min at room temperature, 

followed by incubation for 10 min at room temperature with 100 µL of blocking buffer 

under a coverslip in a humid chamber. 

4. Incubate slides for 30 to 45 min at room temperature with 50 µL of the primary antibody, 

diluted in blocking buffer, under a coverslip in a humid chamber. 

5. Wash slides for 2 × 5 min with KCM in a Coplin jar. 

6. Incubate slides for 30 to 45 min at room temperature with 50 µL of FITC-conjugated 

secondary antibody, diluted in blocking buffer, under a coverslip in a humid chamber 

(see Note 4). 

7. Wash slides for 2 × 5 min with KCM, and fix the chromosomes in fixation solution for 5 

to 15 min at room temperature in a Coplin jar. 

8. Wash slides in destilled water, airdry and store in the dark at room temperature until use. 


1. To improve the signal intensity after PRINS labeling, the slides are immersed in 0.1 M NaOH 

for 10 to 40 s (see Note 14) followed by neutralization with 2 × 5-min washes in 0.01 M 

Tris-HCl, pH 7.4, and a wash in destilled water (all steps in a Coplin jar) before airdrying. 

2. Fix slides in methanolacetic acid (31) for 2 × 2 min in a Coplin jar (see Note 15), wash 

in 0.01 M Tris-HCl, pH 7.4, for 2 × 5 min in a Coplin jar, dehydrate slides in a series of 

cold (4°C) 70, 96, and 100% ethanol, and airdry (see Note 16). 

3. Denature chromosomal DNA in denaturation solution for 45 min at 4°C and neutralize in 

0.01 M Tris-HCl, pH 7.4, for 2 × 5 min at room temperature (all steps in a Coplin jar). 

4. Remove excess fluid by draining and blow slides dry with a jet of air. 

5. Perform PRINS reaction, mounting and evaluation of the slides as described in Subheading 

3.1.2., steps 2–12). 

4. Notes 

1. So far, specific oligonucleotide primers have been defined for the centromere regions 

of up to 20 chromosomes (7,24,25). Particularly, the ability of primers to differentiate 

between closely related sequences has made it possible to define α-satellite primers 

for some chromosomes indistinguishable by FISH with centromeric probes, such as 

for chromosomes 13 and 21, that only exhibit a one-base differerence at their 3′ end. 

Furthermore, a number of chromosome-specific telomere primers have been generated, as 

well as HPV-specific and single-gene-specific oligonucleotides (11,26,27). 

2. Several companies commercialize specialized thermal cyclers with a flat block, including 

Hybaid, Perkin–Elmer, Techne Corporation (Cambridge, UK), and MJ Research Inc. 

(Watertown, MA). Because of differences in the design of the heating block, PRINS


conditions always need to be optimized for the respective instrument used. Because an 

accurate temperature at the top surface of the slide is crucial for a successful PRINS 

reaction, some cyclers, such as the Hybaid Omnigene, possess incorporated software 

to compensate for the temperature difference between the block and the surface of the 

slide. 

3. Because on methanol-acetone fixed cells we frequently observed a poor preservation of 

cell morphology as well as fluorescent staining of the entire nucleus (by PRINS labeling), 

probably caused by nuclease activities that survive this mild type of fixation, other fixatives 

should be and have been successfully tested that are compatible with antigen detection and 

result in a better cell morphology and specific PRINS labeling. For example, a fixation with 

cold 70% ethanol (–20°C) for 10 min proved to be a valid alternative on H460 cells. 

4. If further amplification of the (immuno)cytochemical signal is needed, a third detection 

step may be added after this second incubation step. Alternatively, the avidin biotinylated 

enzyme (e.g., alkaline phosphatase) complex system may be applied as well as the tyramide 

signal amplification system (in combination with peroxidase conjugates). For details of 

possible reagents to use, see Note 13 (7,10,12). 

5. It is recommended to monitor the enzyme reaction under the microscope to adjust the 

reaction time to ensure the precipitate becoming discretely localized and not so dense that 

it shields nucleic acid sequences in the PRINS reaction. 

6. To ensure the specificity of the APase-Fast Red staining, a control slide with FITCconjugated 

secondary antibodies is recommended for comparison. Staining specificity 

can be lost if cells contain endogenous APase activity. This endogenous enzyme activity 

can be inhibited by the addition of levamisole (Sigma) to the reaction medium to a final 

concentration of 1–5 mM. 

7. Do not dehydrate the slides after the APase reaction because the precipitate dissolves in 

organic solvents. Optionally, you may air dry the slides after rinsing in distilled water. 

8. In the case of labeling with biotin-16-dUTP or fluorescein-12-dUTP a 4× decrease of 

the concentration of dTTP in the PRINS reaction mix resulted in significant stronger 

labeling of DNA sequences. Under the described standard conditions, digoxigenin- 

11-dUTP provides the highest sensitivity. However, all the modified nucleotides are suited 

for detection of one or multiple repeated sequences in situ. In this respect, the number of 

different fluorochrome- and hapten-labeled nucleotides is still increasing to date, which 

can be obtained from a number of companies, such as, e.g., Perkin–Elmer Life Science, 

Roche, Amersham, Dako, and Molecular Probes. 

9. The concentration of the appropriate oligonucleotide resulting in positive signals need to 

be determined by experiment. Generally, 250 ng/slide (50–250 pmol) in 40 µL is used for 

primers of 16 to 35 bases complementary to repeated sequences. 

10. Seperate denaturation of cellular DNA in 70% formamide/2xSSC, pH 7.0, for 2 min at 70°C 

before the PRINS reaction as is usually performed for chromosome preparations, resulted 

in no or only weak PRINS labeling of DNA sequences in the interphase nuclei of the cell 

preparations. Whether this is caused by inefficient primer annealing or extension is not clear. 

The same phenomenon is also observed for PRINS on frozen tissue sections (6,7). 

11. The optimum primer annealing temperature is only determined empirically. We usually 

try a series from 45 to 70°C in 5°C steps. 

12. For detection of multiple DNA targets by sequential PRINS reactions (MULTIPRINS), it 

was found essential to prevent the free 3′ ends of the newly synthesized DNA from being 

used as primers for subsequent reactions. This can be achieved by incubating the slides 

with Klenow DNA polymerase together with ddNTPs. The reaction mix is made up as 

follows: Dilute 5 mM of all four ddNTPs 110 with distilled water. Put together in a 

centrifuge tube 2.5 µL of each of the ddNTPs (Amersham Pharmacia), 5 µL of 10× Klenow


buffer (500 mM Tris-HCl, pH 7.2; 100 mM MgSO 4 ; 100 mM DTT; 1.5 mg.mLBSA), 1 U 

Klenow DNA polymerase (Roche), and distilled water to 50 µL. Incubate slide with 

40 µL under a coverslip for 1 h at 37°C in a humid chamber, followed by dehydration and 

airdrying before running the next PRINS reaction (5). 

13. Amplification of PRINS signals can be achieved as follows: 

a. AvFITC detection of Biotin-16-dUTP may be followed by incubation with biotinylated 

goat anti-avidin (Vector), 1100 diluted in blocking buffer, and again AvFITC. 

b. SHADigFITC detection of digoxigenin-11-dUTP may be followed by incubation 

with FITC-conjugated anti-sheep IgG (Roche), or as described for FITC-12-dUTP 

amplification. 

c. Fluorescein-12-dUTP signals may be amplified by incubation with monoclonal mouse 

or polyclonal rabbit anti-FITC (Dako) and FITC-conjugated rabbit anti-mouse IgG or 

swine anti-rabbit IgG (Dako). 

d. Amplification of PRINS signals may also be achieved by using peroxidase-mediated 

deposition of hapten- or fluorochrome-labeled tyramides (28–30). 

14. The time required will vary according to the repeated DNA family of sequences under study 

(size of target) and the cell type from which the chromosome preparations are made. 

15. This again may vary according to the cell type and target size under study. 

16. The slides can be stored in the dark for several weeks at room temperature at this stage. 

References 

1. Koch, J., Kölvraa, S., Petersen, K. B., Gregersen, N., and Bolund, L. (1989) Oligonucleotidepriming 

methods for the chromosome-specific labelling of alpha satellite DNA in situ. 

Chromosoma 98, 259–265. 

2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hindkjder, J., Kölvraa, S., et al. (1992) 

Fast one-step procedure for the detection of nucleic acids in situ by primer-induced 

sequence-specific labeling with fluorescein-12-dUTP. Cytogenet. Cell. Genet. 60, 1–3. 

3. Gosden, J., Hanratty, D., Starling, J., Fantes, J., Mitchell, A., and Porteous, D. (1991) 

Oligonucleotide-primed in situ DNA synthesis (PRINS): A method for chromosome 

mapping, banding, and investigation of sequence organization. Cytogenet. Cell. Genet. 

57, 100–104. 


in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3, 931–936. 

5. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) Multi-PRINS: 

multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific 

chromosomes and produce bands. Hum. Genet. 95, 29–33. 

6. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N. 

(1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS)-labeled DNA 

in chromosome preparations and frozen tissue sections. BioTechniques 20, 226–234. 

7. Gosden, J. R., ed. (1997) PRINS and In Situ PCR Protocols. Methods in Molecular Biology, 

Vol. 71, Humana Press, Totowa, NJ. 

8. Wilkens, L., Tchinda, J., Komminoth, P., and Werner, M. (1997) Single- and double-color 

oligonucleotide primed in situ labeling (PRINS): Applications in pathology. Histochem. 

Cell Biol. 108, 439– 446. 

9. Hindkjder, J., Koch, J., Terkelsen, C., Brandt, C. A., Kölvraa, S., and Bolund, L. (1994) 

Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling 

(PRINS). Cytogenet. Cell. Genet. 66, 152–154. 

10. Speel, E. J. M. (1999) Detection and amplification systems for sensitive, multiple-target 

DNA and RNA in situ hybridization: Looking inside cells with a spectrum of colors. 

Histochem. Cell Biol. 112, 89–113.


11. Kadandale, J. S., Wachtel, S. S., Tunca, Y., Sid Wilroy Jr., R., Martens, P. R., and Tharapel, 

A. T. (2000) Localization of SRY by primed in situ labeling in XX and XY sex reversal. 

Am. J. Med. Genet. 95, 71–74. 

12. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemical detection 

systems for in situ hybridization, and the combination with immunocytochemistry. Who is 

still afraid of red, green and blue? Histochem. J. 27, 833–858. 

13. Speel, E. J. M., Herbergs, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1994) Combined 

immunocytochemistry and fluorescence in situ hybridization for simultaneous tricolor 

detection of cell cycle, genomic, and phenotypic parameters of tumor cells. J. Histochem. 

Cytochem. 42, 961–966. 

14. Herbergs, J., Speel, E. J. M., Ramaekers, F. C. S., De Bruïne, A. P., Arends, J. W., 

and Hopman, A. H. N. (1996) Combination of lamin immunocytochemistry and in situ 

hybridization for the analysis of chromosome copy numbers in tumor cell areas with high 

nuclear density. Cytometry 23, 1–7. 

15. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. 

N. (1997) Combined immunocytochemistry and PRINS DNA synthesis for simultaneous 

detection of phenotypic and genomic parameters in cells, in PRINS and in situ PCR 

protocols, Methods in Molecular Biology, Vol. 71 (Gosden, J. R., ed.), Humana Press, 

Totowa, NJ, pp. 53–60. 

16. Roy, L., Coullin, P., Vitrat, N., Hellio, R., Debili, N., Weinstein, J., et al. (2001) Asymmetrical 

segregation of chromosomes with a normal metaphase/anaphase checkpoint in 

polyploid megakaryocytes. Blood 97, 2238–2247. 

17. Coullin, P., Roy, L., Pellestor, F., Candelier, J.-J., Bed’’hom, B., Guillier-Gencik, Z., et al. 

(2002) PRINS, the other in situ DNA labeling method that is useful in cellular biology. 

Am. J. Med. Genet. 107, 127–135. 

18. Jeppesen, P. (1994) Immunofluorescence techniques applied to mitotic chromosome 

preparations, in Chromosome Analysis Protocols, Methods in Molecular Biology (Gosden, 

J. R., ed.), Humana Press, Totowa, NJ, pp. 253–286. 

19. Mitchell, A. R. (1997) Chromosomal PRINS DNA labeling combined with indirect 

immunocytochemistry, in PRINS and in situ PCR protocols, Methods in Molecular Biology 

(Gosden, J. R., ed.), Humana Press, Totowa, NJ, pp. 61–70. 

20. Glaser, T., Housman, D., Lewis, W. H., Gerhard, D., and Jones, C. (1989) A fine-structure 

deletion map of chromosome 11p: analysis of J1 series hybrids. Somat. Cell Mol. Genet. 

15, 477–501. 

21. Boerman, O. C., Mijnheere, E. P., Broers, J. L. V., Vooijs, G. P., and Ramaekers, F. C. S. 

(1991) Biodistribution of a monoclonal antibody (RNL-1) against the neural cell adhesion 

molecule (NCAM) in athymic mice bearing human small-cell lung-cancer xenografts. Int. 

J. Cancer 48, 457– 462. 

22. Dorin, J. R., Inglis, J. D., and Porteous, D. J. (1989) Selection for precise chromosomal 

targeting of a dominant marker by homologous recombination. Science 243, 1357–1360. 

23. Carney, D. N., Gazdar, A. F., Bepler, G., Guccion, J. G., Marangos, P. J., Moody, T. W., 

et al. (1985) Establishment and identification of small cell lung cancer cell lines having 

classic and variant features. Cancer Res. 45, 2913–2923. 

24. Koch, J., Hindkjder, J., Kölvraa, S., and Bolund, L. (1995) Construction of a panel of 


of individual human chromosomes in situ. Cytogenet. Cell. Genet. 71, 142–147. 

25. Pellestor, F., Girardet, A., Lefort, G., Andréo, B., and Charlieu, J.-P. (1995) Selection 

of chromosome specific primers and their use in simple and double PRINS technique 

for rapid in situ identification of human chromosomes. Cytogenet. Cell. Genet. 70, 

138–142.


26. Krejci, K. and Koch, J. (1999) An in situ study of variant telomeric repeats in human 

chromosomes. Genomics 58, 202–206. 

27. Ramael, M., Van Steelandt, H., Stuyven, G., Van Steenkiste, M., and Degroote, J. (1999) 

Detection of human papilloma virus (HPV) genomes by the primed in situ labelling 

technique. Pathol. Res. Pract. 195, 801–807. 

28. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989) Catalyzed 

reporter deposition, a novel method of signal amplification. Application to immunoassays. 

J. Immunol. Methods 125, 279–285. 

29. Speel, E. J. M., Hopman, A. H. N., and Komminoth, P. (1999) Amplification methods to 

increase the sensitivity of in situ hybridization. Play card(s). J. Histochem. Cytochem. 

47, 281–288. 

30. Speel, E. J. M., Hopman, A. H. N., and Komminoth, P. (2000) Signal amplification for DNA 

and mRNA in situ hybridization, in In Situ Hybridization Protocols, Methods in Molecular 

Biology (Darby, I. A., ed.), Humana Press, Totowa, NJ, pp. 195–216.

Cloning and Mutagenesis 467 

64 

Cloning and Mutagenesis 




Strategies for cloning polymerase chain reaction (PCR) products and performing in 

vitro site-directed mutagenesis are legion, and the following chapters outline five robust 

and reliable protocols. Before embarking on such a strategy, however, it is worth considering 

if it is entirely necessary. Even high-fidelity, proofreading Taq polymerases carry the 

risk of misincorporated bases being included, especially late in the PCR, when dNTP 

concentrations may become limiting. Thus, if the product is cloned, there is a chance 

that the clone selected contains a misincorporated base. If the purpose of the exercise is 

simply to determine the sequence of the original template, it may be more appropriate 

to sequence the PCR product directly and so avoid such cloning bias. If the object is to 

produce a clone that can be further used in expression studies for instance, it is imperative 

that all cloned material is sequenced to verify its integrity, prior to expression. 

2. Cloning 

2.1. T Overhangs 

Taq polymerases lacking 3′ to 5′ exonuclease activity tends to add nontemplatedirected 

nucleotides to the ends of double-stranded DNA fragments. If blunt end 

cloning is to be used, these overhangs need to be “polished,” and Chapter 65 by 

Kai Wang provides an optimized method using T4 DNA polymerase. Because the 

predominant nucleotide added in this nontemplate-directed manner is adenosine, many 

successful protocols have used vectors with a thymidine overhang to direct the cloning. 

This allows rapid cloning into a shuttle vector, from which the fragment can then be 

restricted and cloned further. Alternatively, Horton and colleagues present an elegant 

protocol (Chapter 66) using T-linkers to enable cloning into specific sites. 

2.2. Restriction Site Primers 

Neither blunt-end cloning nor the use of T-overhang vectors allows directional 

cloning. If the region of template DNA to be amplified contains suitable restriction 

sites, the product can simple be digested and cloned in the same way as any other DNA 

fragment. If this is not feasible, it is possible to introduce restriction site sequences 



467

468 Pearson and Stirling 

into PCR products by having these sequences incorporated into the 5′ end of the PCR 

primer(s). The short restriction site sequence on the 5′ end of the PCR primer will not 

hybridize, but as long as the 3′ hybridizing region is long enough (i.e., its T m is high 

enough; ~20 mer), the primer will specifically bind to the appropriate site. The PCR 

product will thus have an additional DNA sequence at the 5′ end that will contain the 

endonuclease restriction site. A similar or different restriction site sequence can be 

added via the other PCR primer. If the other primer has a different restriction sequence, 

then the PCR fragment can be inserted in a directional-dependent manner in a host 

plasmid. There are a number of potential problems with this method that should be 

considered. There is no easy way to prevent internal sites containing similar restriction 

sequences from being cut when the end of the PCR product are cut. Care should 

therefore be taken to use restriction sites that are not present in the fragment to be 

amplified. Restriction sequences are inverse repeat sequences, thus the potential exists 

for primer dimer association and resultant non-productive annealing. Finally, when 

restriction sites are located very close to the end of an amplified fragment, the efficiency 

of cleavage of those sites can be markedly impaired. It may therefore be necessary 

to include not just the restriction site but an additional 5 to 10 bases to avoid this 

problem. 

3. Mutagenesis 

In vitro site-directed mutagenesis is an invaluable technique for studying protein 

structure–function relationships, gene expression, and vector modification. Several 

methods have appeared in the literature, but many of these methods require singlestranded 

DNA as the template. The reason for this, historically, has been the need 

for separating the complementary strands to prevent reannealing. Use of PCR in 

site-directed mutagenesis accomplishes strand separation by using a denaturing step 

to separate the complementing strands and allowing efficient polymerization of the 

PCR primers. PCR site-directed methods thus allow site-specific mutations to be 

incorporated in virtually any double-stranded plasmid, eliminating the need for M13- 

based vectors or single-stranded rescue. 

Three divergent strategies for mutagenesis are outlined in the following chapters; 

however, several points applicable to all three should be here. First, it is often desirable 

to reduce the number of cycles during PCR when performing PCR-based site-directed 

mutagenesis to prevent clonal expansion of any (undesired) second-site mutations. 

Limited cycling, which would result in reduced product yield, can be offset by 

increasing the starting template concentration. Second, a selection must be used to 

reduce the number of parental molecules coming through the reaction. This is of 

particular importance when the parental molecules are used in high concentrations. 

Third, because of the tendency of some thermostable polymerases to add nontemplatedirected 

nucleotides to the ends of double-stranded DNA fragments, it is often necessary 

to incorporate an end-polishing step into the procedure prior to end-to-end ligation of 

the PCR-generated product containing the incorporated mutations in one or both PCR 

primers (see Subheading 2.1.). 

Finally, even if the presence of the desired mutation is confirmed by restriction 

digest or sequencing, it is essential to sequence the entire region of manipulated 

DNA to ensure that there has been no undesirable mutation introduced by the PCR 

processes.

T4 DNA Polymerase 469 

65 

Using T4 DNA Polymerase 

to Generate Clonable PCR Products 

Kai Wang 


Polymerase chain reaction (PCR) mediated through Taq DNA polymerase has 

become a simple and routine method for cloning, sequencing, and analyzing genetic 

information from very small amounts of materials (1). Taq DNA polymerase, like some 

other DNA polymerases, lacks 3′ to 5′ exonuclease activity and will add nontemplatedirected 

nucleotides to the ends of double-stranded DNA fragments. Because of the 

strong preference of the Taq polymerase for dATP, the nucleotide added is almost 

exclusively an adenosine (2). This results in generating “ragged” unclonable amplification 

products (2,3). Restriction endonuclease sites are often incorporated into the 

amplification primers so that clonable PCR products can be generated by restriction 

enzyme cleavage (4). However, the possible secondary sites located within amplified 

products often complicate the cloning and interpretation of PCR results. A cloning 

system exploiting the template-independent terminal transferase activity of Taq 

polymerase has been reported (5–7). However, a special vector with thymidine (T) 

overhanging ends has to be used in the process. 

T4 DNA polymerase has very strong exonuclease and polymerase activities in a 

broad range of reaction conditions (8). By adapting its strong enzymatic activities, 

a simple and efficient method to generate clonable PCR fragments with T4 DNA 

polymerase has been developed (9). The T4 DNA polymerase not only repairs the ends 

of the PCR products, but it also removes the remaining primers in the reaction with its 

strong single-stranded exonuclease activity. Therefore, this method usually does not 

require multiple sample handling, buffer changes, or gel purification steps. Instead, a 

simple alcohol precipitation step is used to purify the PCR products. 

The blunt-end cloning protocol can be modified for sticky-end cloning. Even 

though this may increase cloning efficiency to a certain extent, a purification step, 

to remove excess deoxynucleotides from PCRs, has to be added before adding T4 

DNA polymerase. 



469

470 Wang 

2. Materials 

2.1. PCR 

1. DNA template containing the sequence of interest. 

2. Oligonucleotide primers. 

3. Taq DNA polymerase. 

4. 10× PCR and enzymatic repair buffer: 500 mM Tris-HCl, pH 9.0, 25 mM MgCl 2 , 500 mM 

NaCl, and 5 mM DTT. Commercial 10× PCR buffer also works well. 

5. 1.5 mM 10× deoxynucleotides (dNTP) solution. Concentrated stock solution (100 mM ) can 

be obtained from Amersham Biosciences (Piscataway, NJ) or Boehringer Mannheim 

(Indianapolis, IN). 

6. Gel electrophoresis and PCR equipment. 

2.2. End Repair and Blunt-End Cloning 

1. Enzymes (T4 DNA polymerase, T4 polynucleotide kinase, and T4 DNA ligase). Enzymes 

can be purchased from Boehringer Mannheim, Invitrogen (Carlsbad, CA) or any other 

provider. 

2. 1 mM of ATP solution. Concentrated stock solution (100 mM) can be obtained from 

Boehringer Mannheim. 


4. Vector (blunt end and dephosphorylated). 

5. 10× Ligase buffer: 660 mM Tris-HCl, pH 7.6, 66 mM MgCl 2 , 10 mM ATP, 1 mM spermidine, 

and 10 mM DTT. Commercially available 10× ligase buffers also works well. 

6. TE buffer: 10 mM Tris-HCl, pH 7.5, 1 mM EDTA. 

7. 5 M NaCl. 

2.3. End Repair and Sticky-End Cloning 

1. Sephacryl S-400 spin column. A commercial spin column (MicroSpin S-400HR) can be 

obtained from Pharmacia. 

2. Enzymes (T4 DNA polymerase, T4 polynucleotide kinase, and T4 DNA ligase). Enzymes 

can be purchased from Boehringer Mannheim, Invitrogen, or any other provider. 

3. ATP and dNTPs. 


5. Vector (digested and dephosphorylated). 

6. 10× Ligase buffer: 660 mM Tris-HCl, pH 7.6, 66 mM MgCl 2 , 10 mM ATP, 1 mM spermidine, 

and 10 mM DTT. Commercially available 10× ligase buffers also works well. 

7. 0.5 M EDTA, pH 8.0. 

8. 5 M NaCl. 

3. Method 


For blunt-end cloning, no special primer is needed. However, secondary structure 

and stretch of homopolymer should be avoided. For sticky-end cloning, depending on 

restriction site selected, specific sequences should be included so that compatible ends 

can be generated after T4 DNA polymerase treatment (see Subheading 3.4.). 

3.2. PCR 

1. Prepare the following in a PCR tube: 5 µL of 10× PCR buffer; 0.25 µg of genomic DNA; 

1 µM of each primer; 0.15 mM of each deoxynucleotide (5 µL of 1.5 mM stock dNTP 

solution), 1 U Taq polymerase, and deionized H 2 O to a final volume of 50 µL.


2. Amplification conditions largely depend on the specific applications. However, a general 

cycling profile can be used in most experiments: 94°C for 7 min (initial denaturation); 94°C 

for 30 s (amplification), 55°C for 45 s, 72°C for 90 s; and 72°C for 10 min (extension). 

3. Examine the PCR amplification results with agarose gel electrophoresis (see Note 1). 

3.3. End Repair and Blunt-End Cloning 

1. Add the following to PCR tubes directly to repair the PCR products (see Note 2): 1 U 

of T4 DNA polymerase; 1 UL of 4 mM dNTP solution (optional; see Note 3); 5 U of T4 

polynucleotide kinase (see Note 4); and 1 µL of 1 MM ATP. 

2. Incubate the reaction tubes at 25°C (room temperature) for 20 min (see Notes 5 and 6). 

Stop the reactions by adding 3 mL of 0.5 M EDTA, pH 8.0. 

3. Incubate the reaction tubes at 70°C for 10 min to inactive the enzymes. 

4. Precipitate the PCR products by adding 5 µL of 5 M NaCl and 60 µL of isopropyl alcohol 

(see Notes 7, ref. 8). 

5. Resuspend the DNA fragments in 20 µL of TE or water. 

6. Take 2 µL of DNA (containing approx 20–50 ng of PCR product) and mix with ligase 

and vector for ligation (see Note 8): 1 µL of 10× ligase buffer; 1 µL of T4 ligase; 

2 µL of repaired DNA; dephosphorylated vector (60–150 ng); and add deionized H 2 O 

to a final volume of 10 µL. 

7. Incubate at 16°C overnight. 

8. Dilute the ligation reaction fivefold in TE buffer. Use 2 µL of the diluted ligation reaction 

for transformation (see Note 9). 

3.4. End Repair and Sticky-End Cloning 

An EcoRI site is used as an example in the following protocol Fig. 1). However, 

depending on the desired cloning site, a different combination of dNTP should be 

added in the “repair” reaction (see Subheading 3.4., step 2). 

1. Spin through the PCR mixture (40 µL) in a pre-equilibrated Sephacryl S-400HR spin 

column (see Note 10) to remove excess dNTP. 

2. Add the following to the column-purified PCR fragments to generate sticky ends: 5 µL 

of 10× PCR buffer; 1 U of T4 DNA polymerase; 5 U of T4 polynucleotide kinase; 1 µL 

of 4 MM dCTP and dGTP; 1 µL of 1 MM ATP; and add deionized H 2 O to a final volume 

of 50 µL. 

3. Incubate the reaction tubes at 25°C (room temperature) for 20 min. Stop the reaction by 

adding 3 µL of 0.5 M EDTA, pH 8.0. 

4. Heat inactivate the enzymes by placing the reaction tubes at 70°C for 10 min. 

5. Precipitate the PCR products by adding 5 µL of 5 M NaCl and 60 µL of isopropyl 

alcohol (8). 

6. Resuspend the DNA fragments in 20 µL of TE or water. 

7. Take 2 µL of DNA (containing approx 20–50 ng of DNA) and mix with ligase and EcoRI 

digested, dephosphorylated vector for cloning: 1 µL of 10× ligase buffer; 1 µL of T4 

ligase; 2 µL of repaired DNA; dephosphorylated vector (60–150 ng); and add deionized 

H 2 O to a final volume of 10 µL 

8. Incubate at 16°C overnight. 

9. Dilute the ligation reaction fivefold in TE buffer. Use 2 µL of the diluted ligation reaction 

for transformation (see Note 9). 

4. Notes 

1. In case of multiple PCR products from a single reaction, the specific products should 

be purified by gel electrophoresis based on size after repair reaction. Several different

472 Wang 

Fig. 1. A brief outline of the strategy used to generate sticky-end PCR products with T4 

DNA polymerase. 

methods can be used to purify DNA fragments from agarose gel, such as phenol extraction 

from low-melting gel (8), the “glassmilk” method, or simple low-speed centrifugation 

(10). The phenol extraction method has been found to be less expensive and able to recover 

a sufficient amount of clean DNA for cloning. 

2. This protocol uses one buffer for all the enzymes that include Taq polymerase in PCR, 

T4 polymerase, and T4 polynucleotide kinase in end-repair reaction. Therefore, a slightly 

higher concentration of reagents and enzymes can be added in the reaction. 

3. T4 DNA polymerase can be added directly into the PCR tube without providing additional 

nucleotides. However, T4 DNA polymerase balances its exonuclease and polymerase 

activities based on the concentration of available deoxynucleotides. Depending on the 

length of amplification products, number of amplification cycles, and nucleotide sequence 

composition of amplified region, the remaining nucleotide concentration after PCR 

amplification may be different from experiment to experiment. To avoid unnecessary 

confusion, supplemental nucleotides are routinely added for end-repair reaction. 

4. T4 polynucleotide kinase is not needed when vector used has not been treated with 

phosphatase previously. However, dephosphorylated vector should be used to increase 

the cloning efficiency.


5. Room temperature (25°C) was chosen for the reaction since T4 DNA polymerase has 

excessive exonuclease activity at 37°C. 

6. The T4 polynucleotide kinase works well at room temperature as opposed to the higher 

reaction temperature (37°C) regularly used (8). 

7. Although the PCR products purified directly by alcohol precipitation after end repairing 

are sufficient for routine cloning, passing the repaired PCR product mixtures through a 

gel filtration column prior to the alcohol precipitation can greatly enhance the cloning 

efficiency. 

8. In the ligation reaction, we routinely used 11 molar ratio between vector (dephosphorylated) 

and insert. Generally more than 200 recombinant clones can be obtained with 0.4 µL 

of the ligation reaction. Therefore, a single ligation reaction for each PCR product is 

sufficient for most applications. 

9. Because of its reliability and high transformation efficiency, commercial CaCl 2 -treated 

competent cells are used for the transformation step. The bacteria strain we routinely used 

is DH10B (BRL; MAX efficiency DH10B competent cells). However, various competent 

cells can be purchased from companies, such as Stratagene and Invitrogen. 

10. Prepacked Sephacryl S-400HR spin columns (MicroSpin S-400HR) can be purchased 

from Pharmacia. Alternatively, the spin columns can be prepared from bulk gel filtration 

matrix (Sephacryl S-400HR, Pharmacia) as described in other protocol books (8). The 

filtration medium (prepacked or bulk filtration matrix) contains 20% alcohol; therefore, 

the spin columns should be washed and equilibrated with TE. 

References 

1. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., et al. (1985) 


Science 230, 1350–1354. 

2. Clark, J. M. (1988) Novel non-templated nucleotide addition reactions catalyzed by 

procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677–9686. 

3. Scharf, S. (1990) PCR Protocols: A Guide to Methods and Applications, Academic Press, 

San Diego, CA. 

4. Jung, V., Pestka, S. B., and Pestka, S. (1990) Efficient cloning of PCR generated DNA 

containing terminal restriction endonuclease recognition sites. Nucleic Acids Res. 18, 

6156. 

5. Mead, D. A., Pey, N. K., Herrnstadt, C., Marcil, R. A., and Smith, L. M. (1991) A universal 

method for the direct cloning of PCR amplified nucleic acid. Bio/Technology 9, 657. 

6. Kovalic, D., Kwak, J., and Weisblum, B. (1991) General method for direct cloning of DNA 

fragments generated by the polymerase chain reaction. Nucleic Acids Res. 19, 4560. 

7. Marchuk, D., Drumm, M., Saulino, A., and Collins, F. (1991) Construction of T-vectors, 

a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids 

Res. 19, 1154. 


Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 

9. Wang, K., Koop, B. F., and Hood, L. (1994) A simple method using T4 DNA polymerase to 

clone polymerase chain reaction products. Biotechniques 17, 236–238. 

10. Heery, D. M., Gannon, F., and Powell, R. (1990) A simple method for subcloning DNA 

fragments from gel slices. Trends Genet. 6, 173.

474 Wang

T-Linker Strategy 475 

66 

A T-Linker Strategy for Modification 

and Directional Cloning of PCR Products 

Robert M. Horton, Raghavanpillai Raju, and Bianca M. Conti-Fine 


The propensity of Taq polymerase to add 3′-A overhangs (1,2) to polymerase chain 

reaction (PCR)-amplified DNA has made possible a simple method for cloning PCR 

products into a T-vector (Invitrogen, San Diego, CA) (3–5). Here, we present a related 

strategy that uses T-linkers to add sequences, such as restriction sites, to the ends 

of PCR products (see Note 1). A single-base T overhang at the end of a synthetic 

double-stranded oligonucleotide linker allows ligation of the linker to the unpolished 

ends of a PCR product. This avoids the expense of adding the “extra” sequences to 

sequence-specific primers. 

1.1. Examples 

Two T-linker designs are presented here. In each case, the T-linker is a doublestranded 

synthetic oligonucleotide composed of complementary oligos (either TL-A 

and TL-B for the NdeT linker or HisTL-A and HisTL-B for the HisT-linker) with a 

single 3′ overhanging t at one end. 

1.1.1. NdeTL 

The basic principles involved in using a T-linker are shown using the Nde-T-linker 

in Fig. 1. This T-linker contains complete EcoRI and NotI sites, and a third site (NdeI) 

is partially present, except for its final g; the overhanging t is part of this site. The 5′ 

end of TL-B is phosphorylated (indicated by an asterisk) so that it can be ligated. The 

other end of the linker contains a sticky HindIII-compatible end, which was not used 

in the approach described here. However, because this 5′ overhang is filled in by the 

polymerase during PCR, these extra bases serve as a “clamp” or spacer, which permits 

the EcoRI site to be cut. 

The overhanging t of the linker matches the a added by the polymerase and directs 

the ligation of TL-B, allowing reamplification of the sequence using TL-A as a primer. 

The resulting molecule contains the original PCR-amplified sequence flanked by 

inverted repeats of the T-linker. 

If one of the sequence-specific primers has a g at its 5′ end, an NdeI site will be 

formed. This site is “split” between the T-linker and the PCR product to be cloned. In 



475

476 Horton, Raju, and Conti-Fine 

Fig. 1. Cloning of PCR products with a T-linker. (A) Oligonucleotide design. (B) Addition 

of the T-linker to a PCR product. The parenthetical g and NdeI indicate that if a g is the first base 

in the PCR product, the NdeI site will be completed. (C) Sequence from a pBluescript KS II+ 

plasmid containing a T-linker-reamplified insert cloned into its EcoRI site. This sequence was 

obtained using an fmol cycle sequencing kit (Promega, Madison, WI). The base representing 

the overhanging t of the T-linker is indicated by the solid triangle to the right of the sequence. 

Since the PCR product begins with a g, a complete NdeI site is formed. 

this way, very minor restraints in the PCR primer sequences (having one start with g, 

but not the other) can be used to complete the site at only one end of the reamplified 

product. One simple application of this idea is directional cloning (see Notes 2 and 3). 

The use of this T-linker is illustrated in Fig. 1. A portion of a T-cell receptor V region 

was amplified from Jurkat tumor line cDNA using primers Vb8-1cpe5 and hpVbe3. 

The ligated products were reamplfied with TL-A and cloned into the EcoRI site of 

pBluescript KS II + . The sequence of the resulting product is shown in Fig. 1C. At 

the bottom of the gel is sequence from the polylinker of the vector to the EcoRI site, 

followed by the T-linker. The overhanging t is marked. The g completing the NdeI site 

is the first base of Vb81cp.5. 

1.1.2. HisTL 

Our second example adds another level of sophistication, as shown in Fig. 2. Here 

an additional ability of the T-linker is brought into use. A new and useful sequence 

is added in addition to the restriction sites, namely a “histidine tag” sequence, which 

will be used for affinity purification of the expressed recombinant α3 protein on a Ni 2+ 

column (Qiagen, Chatsworth, CA). Note that the HindIII site is created only at the 

3′ end of the product in this case, because only the 3′ primer begins with t. The 

histidine tag portion is removed from the 3′ end by cutting with HindIII. No special 

sequences have been added to the sequence-specific primers hacpe5 and hacpe3, but 

their positions have been chosen to take advantage of the design of the HisT-linkers. 

The initial PCR-amplified sequence begins with a full codon to put the sequence in


Fig. 2. Using a T-linker to add a “histidine tag” to one end of a PCR product. (A) Oligonucleotide 

design. The NdeI site allows the product to be cloned into an appropriate expression 

vector, in which translation begins at the ATG codon included in this site. The amino acids that 

make up the histidine tag are shown, and the reading frame is indicated by vertical bars between 

codons. The NotI site in HisTL-A is in parentheses because it would not be expected to cut so 

close to the end of a DNA molecule (although it should be possible to use it if the primer were 

phosphorylated and the products ligated to form concatamers). Its main purpose is to serve as 

a clamp to allow efficient cutting at the NdeI site. (B) Sequence at the junction between the 

HisT-linker and the 5′ end of the PCR-amplified sequence. The 5′ primer begins at the first base 

in a codon, to put the sequence in frame with the histidine tag. (C) Sequence at the 3′ junction. 

The 3′ primer begins with ta; the complementary ta in the other strand is converted to a stop 

codon “taa” when the extra a is added by Taq polymerase. Because the 5′ primer begins with c, 

the HindIII site is completed only at the 3′ end of the molecule. This allows directional cloning 

of the product, and removal of the T-linker sequences from the 3′ end.


the proper reading frame with the His tag. It ends with “ta”; the “a” added by the 

polymerase finishes the termination codon (taa) and is included in the HindIII site. 

2. Materials 

1. cDNA template: This was reverse transcribed from total RNA using Superscript RNase 

H-reverse transcriptase (Life Sciences) and an oligo (dT) primer using manufacturers 

instructions. 

2. Reagents for PCR: 10× buffer: 500 mM KCl, 100 mM Tris-HCl, pH 8.3; red sucrose is 

a PCR-compatible gel-loading dye consisting of ~1 mM cresol red in 60% sucrose (6); 

Taq DNA polymerase, 10 mM dNTP mix, 10 mM MgCl 2 solution (Perkin–Elmer Cetus, 

Norwalk, CT). 

3. Reagents for agarose gel electrophoresis. 

4. GeneClean (Bio 101, La Jolla, CA). 

5. Ligation reagents: T4 DNA ligase (Stratagene, La Jolla, CA) 8 U/µL, ligase buffer supplied 

by manufacturer, 10 mM ATP (Pharmacia, Piscataway, NJ), and PEG 8000 (Aldrich, 

Milwaukee, WI). Recently, we have used T4 ligase buffer from Life Technologies (Gibco- 

BRL, Gaithersburg, MD), which already contains ATP and PEG. 

6. T-linker oligonucleotides: 

a. Nde-T-linkers: TL-A: (23-mer) 5′-agcttgaattcgcggccgcatat-3′; TL-B: (18-mer)* 

5′-tatgcggccgcgaattca-3′; 

b. His-T-linkers: HisTL-A: (55-mer) 5′-gcggccgcatatgggatcctcacatcatcatcaccatcactcgagtggccaagct-3′; 

HisTL-B: (21-mer) *5′-gcttggccactcgagtgatgg-3′ 

The 5′ end of each “B” oligonucleotide is phosphorylated (represented by the *) so 

that it can be ligated to the (nonphosphorylated) end of the PCR product. The 5′ end 

of the “A” oligonucleotide is not phosphorylated. The “B” oligo only needs to be long 

enough to bind the “A” oligo during the ligation and in the annealing steps of the early 

rounds of reamplification. A 5′ overhang on oligo “A” is not a problem, because this is 

filled in by the polymerase during reamplification. 

c. Dissolve primers at a stock concentration of 10 µM, which is generally considered 

20× for PCR. After mixing T-linker primers, they are at a final concentration of approx 

5 µM for ligation reactions. 

7. Ampligrease (see ref. 7): plain petroleum jelly, Vaseline brand, or generic is suitable. 

Apply quality control checks as described (7). 

8. Reagents for bacterial culture, including competent Escherichia coli, appropriate antibiotic, 

LB agar. 

9. 95% ethanol containing 2% (w/v) potassium acetate. 


3. Methods 

3.1. PCR 

The HisT-linker was used to clone the coding region of the α3 subunit of the 

nicotinic acetylcholine receptor from human bronchial epithelium (manuscript in 

preparation; see Note 2) into the E. coli expression vector pT7-7 (8). The following 

sequence-specific primers were used: 

Vb8-1cpe5: 

hpVbe3: 

ha3cpe5: 

ha3cpe3: 

5′-ggagttatccagtcacc-3′ 

5′-gggaattcgtcgactgctggcrcagarrta-3′ 

5′-ccagtggccagggcctcaga-3′ 

5′-tatgcatcttccctggccatca-3′


1. Perform PCRs under fairly standard conditions. For example, for cloning the α3 subunit 

of the nicotinic receptor, the conditions for amplification were as follows: 3 µL of 10× 

PCR buffer, 4.5 µL of 10 mM MgCl 2 , 3 µL of dNTPs (2 mM each), 6 µL of red sucrose, 

16.5 µL of H 2 O, 0.75 µL of ha3cpe5 primer (10 µM), 0.75 µL of ha3cpe3 primer (10 µM ), 

1 µL of cDNA template, and 0.25 µL of Taq polymerase. 

2. Perform PCR using 40 cycles at 94, 52, and 72°C, each for 0.5 min, in a programmable 

circulating air oven (ProOven, Integrated Separation Systems). 

3. Products were purified by agarose gel electrophoresis and GeneClean (Bio 101; see 

Chapter 18). 

3.2. Ligation (see Note 4) 

1. Assemble ligation reactions as follows: 2 µL of purified PCR product, 7.5 µL of H 2 O, 

2 µL of 10× ligase buffer, 1 µL of (0.5 mM final) 10 mM ATP (if not in buffer), 2.5% 

(5% final) 40% PEG 8000 (optional), 2 µL of T-linkers (5 µM in 500 mM NaCl), and 

1 µL of ligase (1 U/µL dilution). 

2. Incubate at room temperature for 20 min to overnight. 

3.3. Reamplification with T-Linker Primer 

1. After ligation of the T-linker, reamplfy the products as follows: 5 µL of 10× PCR buffer, 7.5 

µL of 10 mM MgCl 2 , 5 µL of dNTPs, 10 µL of Red sucrose, 16.5 µL of H2O, 5 µL of TL-A 

(or HisTL-A) primer (10 µM ), ligation mixture, and 0.35 µL of Taq polymerase. 

2. Cover the sample with mineral oil and amplify with 40 two-step cycles of 94°C for 

0.5 min and 72°C for 2.5 min. (see Note 5). 

3.4. Alternative Method: One-Tube Ligation/Reamplification 

The whole T-linker reaction can be set up in one tube to make a “kit-like” product. 

This is done using a meltable barrier, as for hot-start PCR (we use AmpliGrease; ref. 7). 

The “top mix” contains the ligation reaction, to which the PCR-amplified band is 

added. After a suitable incubation to allow ligation, the reaction is heated to melt the 

barrier, and the second PCR is begun: 

1. Set up a 100-µL PCR mix (see Subheading 3.1.) in a tube. Add only TL-A (or HisTL-A) 

as a primer, and no template. 

2. Dispense approx 35 µL of petroleum jelly (AmpliGrease) onto the side of the tube with 

a syringe. 

3. Heat the tube so that the grease melts to cover the bottom mix. 

4. Allow to cool so that the grease resolidifies. 

5. Add approx 30 µL of mineral oil on top of the grease. 

6. Add 4 µL of ligation mix through the oil so the droplet rests above the grease barrier. The 

ligation mix is made as a master mix containing the following: 2 µL of T-linkers (5 µM each 

in 50 mM NaCl), 2 µL of 10× ligase buffer, 1 µL of 10 mM ATP (if not in buffer), 0.5 µL 

of ligase (8 U/µL), and 10.5 µL of H 2 O. 

7. Add 1 µL of the PCR product to be cloned into the droplet of top ligation mix. 

8. Use the following reaction conditions: 25°C for 1 h (ligation); 94°C for 15 s, 55°C for 15 s, 

and 72°C for 45 s for 30 amplification cycles (see Note 6). 

3.5. Digestion and Cloning 

The reamplified PCR product now has the restriction sites from the T-linker at its 

ends, and may be cloned using standard procedures. The protocol we usually use is 

as follows:


1. Run a small portion of the reamplified product on a checking gel to make sure you have 

enough of the correctly sized product with which to work. About 5 µL should give a clear 

band. With care, you should be able to use this same gel to check your DNA at several 

stages of the process. Do not let it dry out! 

2. Add ~1 µg of uncut (supercoiled) plasmid vector to the tube containing the reamplified 

material. This will both act as a carrier during the purification process and help to make 

the effects of the restriction digests more obvious. You will probably not be able to see 

the slight size differences resulting from cutting off the ends of the T-linkers, but you 

should be able to see the difference as the vector is cut, and goes from being supercoiled 

to being linear. 

3. Extract the DNA twice with phenol:chloroform and once with chloroform. 

4. Precipitate the DNA by adding 2 vol of 95% ethanol containing 2% potassium acetate to 

the aqueous supernatant and spin on high speed in a microcentrifuge at 4°C for 30 min. 

Discard the supernatant and carefully rinse the pellet with cold 75% ethanol. 

5. Resuspend the DNA pellet in distilled water and add the appropriate 10× restriction 

enzyme buffer. Add restriction enzymes and incubate until the vector is completely in the 

linear form on a checking gel. Directional cloning will require cutting with two enzymes. 

Manufacturers generally provide charts that indicate which buffer works reasonably well 

with both enzymes. Run a lane with uncut vector on the checking gel. Uncut vector should 

have three bands representing supercoiled, nicked circular, and (sometimes) linear forms. 

Cut vector should only have the linear form. Even small amounts of uncut vector will lead 

to high backgrounds on nonrecombinants. 

6. Run the digested material on a preparative agarose gel and cut out the vector and insert 

bands. Minimize exposure to ultraviolet light. 

7. Recover the DNA separately from each band. Many protocols are available for this: We 

usually use GeneClean for inserts larger than 250 bp. 

8. Run about one-tenth to one-fifth of the DNA extracted from the band on a checking gel 

to roughly estimate the amount of DNA recovered. The relative amounts of DNA in each 

band are crudely estimated by visually comparing the brightness of the bands to those with 

a known amount of DNA. The vector bands should contain more or less known quantities 

of DNA, if you know how much you started with, and assume about 70% was recovered 

from the preparative gel. 

9. Mix vector and insert in at least a 21 molar ratio and ligate. Use about 100 ng of vector 

per ligation. The ligation should resemble the following (for a larger insert, more DNA 

is needed for the same molar ratio): 100 ng vector (2.5 kb), 20 ng insert (250 bp), 2 µL 

of 10× ligation buffer, 1 µL of 10 mM ATP (if not in buffer), 0.5 µL of T4 DNA ligase, 

and up to 16.5 µL of H 2 O. 

10. Dilute the ligation 1:5, and use 1 µL to transform 20 µL of competent E. coli. Plate on 

appropriate antibiotic medium. 

11. Recombinant colonies can be screened using PCR. Depending on which restriction site 

was used, you may be able to screen with a T-linker primer. For example, with inserts 

cloned nondirectionally using the EcoRI site of the NdeT-linker, NdeTL-A can be used for 

screening. Make a master mix for as many reactions as you need, in which a 10-µL reaction 

contains: 1 µL of 10× PCR buffer, 1 µL of dNTPs (2 mM each), 1.5 µL of MgCl 2 (10 mM ), 

2 µL of red sucrose dye, 1 µL of NdeTL-A (10 µM ), and 0.25 µL of Taq polymerase. Cover 

these small reactions with oil while picking colonies to prevent evaporation. 

12. Touch a recombinant colony with the tip of a sterile toothpick, dip the end of the toothpick 

through the oil into the reaction, and swirl. Do not add enough bacteria to the reaction 

to make it cloudy. Just a few bacteria are sufficient. Too much bacterial matter, or


small amounts of agar, will inhibit the reaction. Be sure to include one reaction of a 

nonrecombinant (“blue”) colony as a negative control. 

13. Heat to 94°C for 1 min. 

14. Amplify for 30 cycles using the following parameters: 94°C for 15 s, 55°C for 15 s, 

and 72°C for 45 s. 

4. Notes 

1. Why not use a T-vector? The method of choice for routine cloning of PCR products is 

probably a T-vector. One of the more important considerations is that with a T-vector you 

do not need to digest the insert with a restriction enzyme, so you do not need to worry about 

whether or not the insert contains that site. Also, reamplification with the T-linker provides 

another set of opportunities for the polymerase to introduce errors. However, T-linkers have 

several differences that can provide advantage in certain circumstances. 

a. The efficiency of ligation can theoretically be increased because much higher concentrations 

of linkers can be achieved. 

b. The efficiency of ligation does not need to be as high because the ligated product can 

be reamplified with one of the linker oligonucleotides to give a product that has added 

restriction sites at the ends. 

c. Oligonucleotides, such as those used to construct the T-linker, are quite stable, and 

remain usable for many years. Stability has been a problem with some of the commercially 

available T-vectors. 

d. Because the ends of a PCR product can be precisely defined and/or modified, and 

because T-linkers can be custom-made, it is possible to “split” a DNA sequence, such 

as a restriction site, between the PCR product and the T-linker so that a complete site 

is formed only at one end of the final product, without having to include the entire 

site in the primer made for amplifying a specific gene. This can save on the cost of 

oligonucleotides but still allow directional cloning. 

e. T-linkers should be more flexible in terms of using a variety of restriction sites in a 

variety of vectors. 

2. The directional cloning of the coding sequence for the α3 acetylcholine receptor subunit 

illustrated in Fig. 2 was accomplished by selecting the locations of the primers so that a 

HindIII site was created at only one end. However, by random chance, in one case of four, 

a PCR product made with primers not designed to complete the NdeI site will have a g at 

a given end, and will thus end up with an NdeI site. Similarly, one of 16 randomly chosen 

products will have NdeI sites at both ends. Thus, 3 of 16 randomly chosen PCR products 

will have a g at only one end, and could be cloned directionally using this T linker. A set 

of such linkers, with each depending on the presence of a different single nucleotide 

at the end of the PCR product, could therefore be used to directionally clone 75% of 

randomly chosen PCR products. Potential restriction enzymes for such complementable 

sites in T-linkers would be: 

Site ends in 

Restriction enzymes 

. . . t(g) NdeI, PvuII (blunt), Pm1I (blunt) 

. . . t(c) EcoRI, EcoRV (blunt), AatII, SacI 

. . . t(a) SnaBI (blunt) 

. . . t(t) Hind III, SspI (blunt) 

Three linkers would make up a complete set, that is, you do not need an a linker because 

any product that only has a at one end automatically has one of the other three bases at the


other end. Together with the T-linkers using split NdeI and HindIII sites described here, a 

T-linker that introduces a split SacI site, for example, would complete a set. 

3. Potentially, other DNA sequences, such as a promoter for in vitro transcription, could be 

split so that a functional site is completed at only one end of the product. If the majority 

of the DNA sequence of such sites can be added by ligating a T-linker, this could provide 

significant cost savings compared to synthesizing target-specific primers containing such 

sequences. 

4. Blunt-ended ligation of linkers has been used to add primer sequences to DNA fragments 

(9,10), but the T-linker application presented here is novel as far as we can tell. The 

T-linkers are more suitable for use with DNA fragments generated by PCR than bluntended 

linkers, because of the nontemplate derived as added by the polymerase. Because 

the sequences at the ends of PCR products can be easily manipulated by incorporating 

changes in the primers, DNA sequences, such as restriction sites, can be split between 

the T-linker and the PCR product. In general, this sort of site splitting is not practical 

except with PCR-generated fragments. One exception is fragments tailed with a known 

homopolymer, such as the poly A tail on eukaryotic mRNAs (11); such a linker is commercially 

available (Novagen, Madison, WI). Because the T-linker is added as an inverted 

repeat at the ends of the fragment, a single primer (TL-A) is used to reamplify after 

ligation. Single-primer amplification systems (12) have an advantage in that a “primerdimer” 

cannot be formed from one primer, because this would produce an unamplifiable 

hairpin. 

5. Because each product being cloned is subjected to an extra amplification, the overall 

frequency of errors should be increased, although our experience shows that the increase 

is not dramatic. In many cases, the risk of PCR errors is quite acceptable. For example, if 

one is producing an enzyme or other protein with a measurable function, the clones can be 

screened for activity. Deleterious mutations will thus be weeded out, and nondeleterious 

mutations may not matter (the α3 subunit in our example will be used as a potential 

ligand-binding protein, and clones will be screened on this basis). Similarly, if a sequence 

is to be used as a hybridization probe, a low frequency of base substitutions is frequently 

acceptable. In situations where no mutations are acceptable, clones must be screened 

by careful sequencing. 

6. The pH and the magnesium concentration of the PCR are different from those of the 

ligation. Using a small ligation volume and a large PCR volume helps to correct the 

conditions for the PCR. Alternatively, the pH of the bottom mix can be increased, and 

the added magnesium reduced, so that the final pH and (Mg 2+ ) are correct after mixing. 

This allows use of smaller volumes. The ability to make a quick, automated one-tube 

ligation/reamplification reaction makes this setup intriguing. However, it is easier to 

repeat parts of the experiment (such as the reamplification) if you have leftovers from 

a separate ligation reaction. 


This work was supported by research grants from the Muscular Dystrophy Association 

of America and from the Council for Tobacco Research, by the NIH grant N52319, 

and the NIDA Program Project grant DA05695. R. M. H. was the recipient of the 

Robert G. Sampson Neuromuscular Disease Research Fellowship from the Muscular 

Dystrophy Association. 

References 

1. Clark, J. M. (1988) Novel nontemplated nucleotide addition reactions catalyzed by 

procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677–9686.


2. Mole, S. E., Iggo, R. D., and Lane, D. P. (1989) Using the polymerase chain reaction to 

modify expression plasmids for epitope mapping. Nucleic Acids Res. 17, 3319. 

3. Mead, D. A., Pey, N. K., Herrnstadt, C., Marcil, R. A., and Smith, L. M. (1991) A universal 

method for the direct cloning of PCR amplified nucleic acid. Bio/Technology 9, 657–663. 

4. Marchuk, D., Drumm, M., Saulino, A., and Collins, F. S. (1991) Construction of T-vectors, 

a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids 

Res. 19, 1154. 

5. Holton, T. A. and Graham, M. W. (1991) A simple and efficient method for direct cloning 

of PCR products using ddT-tailed vectors. Nucleic Acids Res. 19, 1156. 

6. Hoppe, B. L., Conti-Tronconi, B. M., and Horton, R. H. (1992) Gel loading dyes compatible 

with PCR. BioTechniques 12, 679–680. 

7. Horton, R. M., Hoppe, B. L., and Conti-Tronconi, B. M. (1994) AmpliGrease, “Hot Start” 

PCR using petroleum jelly. BioTechniques 16, 42– 43. 

8. Tabor, S. and Richardson, C. C. (1985) A bacteriophage T7 RNA polymerase/promoter 

system for controlled exclusive expression of specific genes. Proc. Natl. Acad. Sci. USA 

82, 1074–1078. 

9. Ko, M. S. H., Takahashi, N., Nishiguchi, K., and Abe, K. (1990) Unbiased amplification 

of a highly complex mixture of DNA fragments by ‘lone-linker’-tagged PCR. Nucleic 

Acids Res. 18, 4293. 

10. Bhat, G. J., Lodes, M. J., Myler, P. J., and Stuart, K. D. (1991) A simple method for cloning 

blunt ended DNA fragments. Nucleic Acids Res. 19, 398. 

11. Meissner, P. S. Sisk, W. P., and Berman, M. L. (1987) Bacteriophage lambda cloning 

system for the construction of directional cDNA libraries. Proc. Natl. Acad. Sci. USA 

84, 4171– 4175. 

12. Rich, J. J. and Willis, D. K. (1990) A single oligonucleotide can be used to rapidly isolate 

DNA sequences flanking a transposon Tn5 insertion by the polymerase chain reaction. 

Nucleic Acids Res. 18, 6673–6676.

484 Horton, Raju, and Conti-Fine

Cloning Gene Family Members 485 

67 

Cloning Gene Family Members Using PCR 

with Degenerate Oligonucleotide Primers 

Gregory M. Preston 


1.1. What Are Gene Families? 

As more and more genes are cloned and sequenced, it is apparent that nearly all genes 

are related to other genes. Similar genes are grouped into families, such as the collagen 

and globin gene families. There are also gene superfamilies. Gene superfamilies are 

composed of genes that have areas of high homology and areas of high divergence. 

Examples of gene superfamilies include the oncogenes, homeotic genes, and myosin 

genes. In most cases, the different members of a gene family carry out related functions. 

A detailed protocol for the cloning by degenerate oligonucleotide polymerase chain 

reaction (PCR) of members of the Aquaporin family of membrane water channels 

(1,2) is discussed here. 

1.2. Advantages of PCR Cloning of Gene Family Members 

There are several considerations that must be taken into account when determining 

the advantages of using PCR to identify members of a gene family over conventional 

cloning methods of screening a library with a related cDNA, a degenerate primer, or 

an antibody. It is recommended that after a clone is obtained by PCR, one uses this 

template to isolate the corresponding cDNA from a library because mutations can often 

be introduced in PCR cloning. Alternatively, sequencing two or more PCR clones from 

independent reactions will also meet this objective. The following is a list of some of 

the advantages of cloning gene family members by PCR. 

1. Either one or two degenerate primers can be used in PCR cloning. When only one of the 

primers is degenerate, the other primer must be homologous to sequences in the phage or 

bacteriophage cloning vector (3,4) or to a synthetic linker sequence, as with RACE PCR. 

The advantage to using only one degenerate primer is that the resulting clones contain 

all of the genetic sequence downstream from the primer (be it 5′ or 3′ sequence). The 

disadvantage to this anchor PCR approach is that one of the primers is recognized by every 

gene in the starting material, resulting in single-strand amplification of all sequences. 

This is particularly notable when attempting to clone genes that are not abundant in the 

starting material. This disadvantage can often be ameliorated in part by using a nested 



485

486 Preston 

amplification approach with two degenerate primers to preferentially amplify desired 

sequences. 

2. It is possible to perform a PCR on first-strand cDNAs made from a small amount of 

RNA and, in theory, from a single cell. Several single-stranded “minilibraries” can be 

rapidly prepared and analyzed by PCR from a number of tissues at different stages of 

development or cell cultures under different hormonal conditions. Therefore, PCR cloning 

can potentially provide information about the timing of expression of an extremely rare 

gene family member, or messenger RNA splicing variants, that may not be present in 

a recombinant library. 

3. Finally, the time and expense required to clone a gene should be considered. Relative 

to conventional cloning methods, PCR cloning can be more rapid, less expensive, and 

in some cases, the only feasible cloning strategy. It takes at least 4 d to screen 300,000 

plaques from a λgt10 library. With PCR, an entire library containing 10 8 independent 

recombinants (~5.4 ng DNA) can be screened in one reaction. Again, to ensure authenticity 

of your PCR clones, you should either use the initial PCR clone to isolate a cDNA clone 

from a library or sequence at least two clones from independent PCRs. 

1.3. Degenerate Oligonucleotide Theory and Codon Usage 

Because the genetic code is degenerate, primers targeted to particular amino acid 

sequences must also be degenerate to encode the possible permutations in that sequence. 

Thus, a primer to a six- amino acid sequence that has 64 possible permutations can 

potentially recognize 64 different nucleotide sequences, one of which is to the target 

gene. If two such primers are used in a PCR, then there are 64 × 64 or 4096 possible 

permutations. The target DNA will be recognized by a small fraction (1/64) of both 

primers, and the amplification product from that gene will increase exponentially. 

However, some of the other 4095 possible permutations may recognize other gene 

products. This disadvantage can be ameliorated by performing nested amplifications 

and by using “guessmer” primers. A guessmer primer is made by considering the 

preferential codon usage exhibited by many species and tissues (see Subheading 3.1.). 

For instance, the four codons for alanine begin with GC. In the third position of 

this codon, G is rarely used in humans (~10.3% of the time) or rats (~8.0%), but 

often used in Escherichia coli (~35%) (5). This characteristic of codon usage may be 

advantageously used when designing degenerate oligonucleotide primers. 

1.4. Strategy for Cloning Aquaporin Gene Family Members 

In a related methods chapter (3), I described the cloning by degenerate primer PCR 

of Aquaporin-1 (formerly CHIP28) from a human fetal liver λgt11 cDNA library 

starting with the first 35 amino acids from the N-terminus of the purified protein. A 

full-length cDNA was subsequently isolated from an adult human bone marrow cDNA 

library (4) and following expression in Xenopus shown to encode a water selective 

channel (6). We now know that the Aquaporin family of molecular water channels 

includes genes expressed in diverse species, including bacteria, yeast, plants, insects, 

amphibians, and mammals (1,2,7). We have used degenerate oligonucleotide primers 

designed to highly conserved amino acids between the different members of the 

Aquaporin family to clone novel Aquaporin gene family cDNAs from rat brain (AQP4) 

and salivary gland (AQP5) libraries (8,9). In Subheading 3., I will describe the creation 

of a new set of degenerate primers that we have used to clone, by degenerate primer 

PCR, Aquaporin homologs from a number of different tissues and species. Subheading 3.


Table 1 

The Degenerate Nucleotide Alphabet 

Letter 

Specification 

A 

Adenosine 

C 

Cytidine 

G 

Guanosine 

T 

Thymidine 

R puRine (A or G) 

Y pYrimidine (C or T) 

K Keto (G or T) 

M aMino (A or C) 

S Strong (G or C) 

W Weak (A or T) 

B Not A (G, C, or T) 

D Not C (A, G, or T) 

H Not G (A, C, or T) 

V Not T (A, C, or G) 

N aNy (A, G, C, or T) 

I 

Inosine a 

a Although inosine is not a true nucleotide, it is included 

in this degenerate nucleotide list because many researchers 

have employed inosine-containing oligonucleotide primers 

in cloning gene family members. 

has been broken up into three parts: Subheading 3.1. describes the designing of the 

degenerate primers; Subheading 3.2. describes the PCR amplification with degenerate 

primers; and 3. Subheading 3.3. describes the subcloning and DNA sequencing of the specific 

PCR-amplified products. 

2. Materials 

2.1. Design of Degenerate Oligonucleotide Primers 

No special materials are required here, except the amino acid sequence to which 

the degenerate primers will be designed and a codon usage table (5). If the degenerate 

primers are going to be designed according to a family of related amino acid sequences, 

these sequences should be aligned using a multiple sequence alignment program. A 

degenerate nucleotide alphabet (Table 1) provides a single-letter designation for any 

combination of nucleotides. Some investigators have successfully used mixed primers 

containing inosine where degeneracy was maximal, assuming inosine is neutral with 

respect to base pairing, to amplify rare cDNAs by PCR (10,11). 

2.2. PCR Amplification with Degenerate Primers 

For all buffers and reagents, distilled deionized water should be used. All buffers 

and reagents for PCR should be made up in distilled deionized 0.2-µ filtered water that 

has been autoclaved (PCR water) using sterile tubes and aerosol blocking pipet tips to 

prevent DNA contamination (see Note 1). All plastic supplies (microfuge tubes, pipet 

tips, and so on) should be sterilized by autoclaving or purchased sterile.

488 Preston 

1. 10× PCR buffer: 100 mM Tris-HCl, pH 8.3; at 25°C, 500 mM KCl, 15 mM MgCl 2 ; and 

0.1% w/v gelatin. Incubate at 50°C to melt the gelatin, filter sterilize, and store at –20°C 

(see Note 2). 

2. dNTP stock solution (1.25 mM each of dATP, dGTP, dCTP, and dTTP) made by diluting 

commercially available deoxynucleotides with PCR water. 

3. Thermostable DNA polymerase, such as Amplitaq DNA Polymerase (Perkin–Elmer Cetus, 

Norwalk, CT) supplied at 5 U/µL. 


5. A programmable thermal cycler machine, available from a number of manufacturers, 

including Perkin–Elmer Cetus, MJ Research, and Stratagene. 

6. Degenerate oligonucleotide primers should be purified by reverse-phase high-performance 

liquid chromatography or elution from acrylamide gels, dried down, resuspended at 

20 pmol/µL in PCR-water, and stored at –20°C, preferably in aliquots. 

7. The DNA template can be almost any DNA sample, including a single-stranded cDNA 

from a reverse transcription reaction, DNA from a phage library, and genomic DNA. The 

DNA is heat denatured at 99°C for 10 min and stored at 4 or –20°C. 

8. Chloroform (see Note 3). 

9. Tris-saturated phenol (see Note 3), prepared using ultra-pure redistilled crystalline phenol 

as recommended by the supplier (Gibco-BRL [product #5509], Gaithersburg, MD). Use 

polypropylene or glass tubes for preparation and storage. 

10. PC9 (see Note 3): Mix equal volumes of buffer-saturated phenol, pH >7.2, and chloroform, 

extract twice with an equal volume of 100 mM Tris-HCl, pH 9.0, separate phases by 

centrifugation at room temperature for 5 min at 2000g, and store at 4 to –20°C for up 

to 1 mo. 

11. AmAc (7.5 M) for precipitation of DNA. Ammonium acetate is preferred over sodium 

acetate because nucleotides and primers generally do not precipitate with it. Dissolve in 

water, filter through 0.2-µm membrane, and store at room temperature. 

12. 100% ethanol stored at –20°C. 

13. 70% ethanol stored at –20°C. 

14. TE: 10 mM Tris, 0.2 mM EDTA, pH 8.0. Dissolve in water, filter through 0.2-µm 

membrane, and store at room temperature. 

15. 50× TAE: 242 g of Tris-HCl base, 57.1 mL of acetic acid, 18.6 g of Na 2 (H 2 O) 2 EDTA. 

Dissolve in water, adjust volume to 1 L, and filter through 0.2-µm membrane. Store at 


16. HaeIII-digested φX174 DNA markers. Other DNA molecular weight markers can be used 

depending on availability and the size of the expected PCR-amplified products. 

17. 6× gel loading buffer (GLOB): 0.25% bromophenol blue, 0.25% xylene cyanol FF, 1 mM 

EDTA, and 30% glycerol in water. Store up to 4 mo at 4°C. 

18. Agarose gel electrophoresis apparatus and electrophoresis grade agarose. For the optimal 

resolution of DNA products >500 bp in length, NuSieve GTG agarose (FMC BioProducts) 

is recommended. 

19. Ethidium bromide (EtBr; see Note 3). Ethidium bromide (10 mg/mL stock) prepared in 

water and stored at 4°C in a brown or foil-wrapped bottle. Use at 0.5 to 2.0 µg/mL in water 

for staining nucleic acids in agarose or acrylamide gels. 

20. For the elution of specific PCR-amplified DNA products from agarose gels, several methods 

are available, including electroelution and electrophoresis onto DEAE-cellulose membranes 

(12,13). Several commercially available kits will also accomplish this task. I have had 

some success with GeneClean II (Bio 101, La Jolla, CA) for PCR products >500 bp 

in length, and with QIAEX (Qiagen, Chatsworth, CA) for products from 50 to 5000 bp. If 

you do not know the approximate size of the PCR-amplified products and wish to clone


all of them, the QIAquick-spin PCR purification kit is recommended (Qiagen) because 

this will remove all nucleotides and primers before attempting to clone. This kit is 

also recommended for purification of PCR products for secondary PCR-amplification 

reactions. 

2.3. Cloning and DNA Sequencing of PCR-Amplified Products 

1. From Subheading 2.2., items 8–14 and 20. 

2. pBluescript II phagemid vector (Stratagene). A number of comparable bacterial expression 

vectors are available from several companies. 

3. Restriction enzymes: EcoRV (for blunt-end ligation). 

4. Calf intestinal alkaline phosphatase (CIP; New England Biolabs, Beverly, MA). 

5. Klenow fragment of Escherichia coli DNA polymerase I (sequencing grade preferred) and 

10 mM dNTP solution (dilute PCR or sequencing grade dNTPs). 

6. T4 DNA ligase (1 or 5 U/µL) and 5× T4 DNA ligase buffer (Gibco-BRL). 

7. Competent DH5α bacteria. Can be prepared (12,13) or purchased. Other bacterial strains 

can be substituted. 

8. Ampicillin: 50 mg/mL stock in water, 0.2-µ filtered, and stored in aliquots at –20°C 

(see Note 4). 

9. LB media: 10 g of bacto-tryptone, 5 g of bacto-yeast extract, and 10 g of NaCl dissolved in 

1 L of water. Adjust pH to 7.0. Sterilize by autoclaving for 20 min on liquid cycle. 

10. LB-Amp plates: Add 15 g of bacto-agar to 1000 mL of LB media before autoclaving for 

20 min on the liquid cycle. Gently swirl the media on removing it from the autoclave to 

distribute the melted agar. Be careful: The fluid may be superheated and may boil over 

when swirled. Place the media in a 50°C water bath to cool. Add 1 mL of ampicillin, 

swirl to distribute, and pour 25 to 35 mL/90-mm plate. Carefully flame the surface of the 

media with a Bunsen burner to remove air bubbles before the agar hardens. Store inverted 

overnight at room temperature, then wrapped at 4°C for up to 6 mo. 

11. IPTG: Dissolve 1 g of isopropylthiogalactoside in 4 mL of water, filter through 0.2-µm 

membrane, and store in aliquots at –20°C. 

12. X-Gal: Dissolve 100 mg of 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside in 5 mL of 

dimethylformamide and stored at –20°C in a foil wrapped tube (light sensitive). 

13. Plasmid DNA isolation equipment and supplies (12,13) or plasmid DNA isolation kits, 

available from many manufacturers. 

14. Double-stranded DNA sequencing equipment and supplies (12,13) or access to a DNA 

sequencing core facility. 

3. Methods 

3.1. Design of Degenerate Oligonucleotide Primers 

1. The first step in designing a degenerate primer is to select a conserved amino acid sequence 

and then determine the potential nucleotide sequence (or the complement of this sequence 

for a downstream primer), considering all possible permutations. If the amino acid 

sequence is relatively long, you can potentially design two or more degenerate primers. 

If only one is made, make it to sequences with a high (50–65%) GC content because 

these primers can be annealed under more stringent conditions (e.g., higher temperatures). 

Figure 1 shows an alignment of the amino acid sequences for several members of the 

Aquaporin gene family in the two most highly conserved regions. Also shown is the 

consensus amino acid sequence, the degenerate nucleotide sequence, and the sequence 

of the primers we used to isolate Aquaporin gene family members. Interestingly, not 

only are these two regions highly conserved among the different members of this gene

490 Preston 

Fig. 1. Design of degenerate primers to amplify Aquaporin gene family members. Top, the 

amino acid sequences of 10 MIP family proteins, including the S. cerevisiae FPS1 (23), E. 

coli GlpF (24), α- and γ-tonoplast intrinsic proteins (TIP) of Arabidopsis thaliana (25), the 

vasopressin-responsive water channel of rat renal collecting tubules (AQP2) (26), the major 

intrinsic protein (MIP) of bovine lens fiber membranes (27), human Aquaporin-1 (4), turgor 

responsive gene (TUR) 7a from Pisum stivum (28), the Drosophila neurogenic big brain protein 

(29), and the Rhyzodium root Nodulin-26 peribacteroid membrane protein (30) were aligned 

by the PILEUP program of progressive alignments (31) using a gap weight of 3.0 and a gap 

length of 0.1 running on a VAX computer system. The two most highly conserved regions are 

shown, separated by the number of intervening amino acids. The most highly conserved amino 

acids are enclosed. Middle, below the aligned sequences, the consensus amino acid sequences 

are shown. Bottom, from part of the consensus amino acid sequences, the degenerate nucleotide 

sequences were determined (using the degenerate nucleotide alphabet from Table 1) followed 

by the sequences for the degenerate oligonucleotide primers. 

family, but they are also highly related to each other, with the conserved motif being 

(T/S)GxxxNPAxx(F/L)G, that has been speculated to have resulted from an ancient 

internal duplication in a primordial bacterial organism, because this repeat has persisted 

in Aquaporin homologs from bacteria through plants and mammals (1,6,14). These two 

regions are functionally related, both contributing to the formation of the water pore in 

Aquaporin-1 (15). 

2. The next step is to determine the number of permutations in the nucleotide sequence. There 

are 192 permutations ([2 × 4] × 3 × 4 × 2) in the sequence 5′-YTN-ATH-GGN-GAR-3′, 

which encodes the hypothetical amino acid sequence Leu-Ile-Gly-Glu. We can reduce the 

degeneracy by making educated guesses in the nucleotide sequence, that is, by making a 

guessmer. The 3′-end of a primer should contain all possible permutations in the amino 

acid sequence because Taq DNA polymerase will not extend a prime with a mismatch at the 

extending (3′) end. If the above primer was to a human gene, a potential guessmer would 

be 5′-CTB-ATY-GGN-GAR-3′, which only contains 64 permutations. This guessmer is 

proposed by taking into account the preferential codon usage for leucine and isoleucine 

in humans (5). 

3. The degeneracy of a primer can be reduced further by incorporating inosine residues in the 

place of N. The advantages of using inosine-containing primers is that they have a reduced 

number of permutations and that the inosine reportedly base pairs equally well with all


four nucleotides, creating a single bond in all cases (10). The disadvantage is that inosines 

reduce the annealing temperature of the primer. I have not used inosine-containing primers 

in my studies. 

4. It is often convenient to incorporate restriction endonuclease sites at the 5′-ends of a primer 

to facilitate cloning into plasmid vectors (4,8,9). Different restriction sites can be added 

to the 5′-ends of different primers so the products can be cloned directionally. However, 

not all restriction enzymes can recognize cognate sites at the ends of a double-stranded 

DNA molecule equally well. This difficulty can often be reduced by adding a two to four 

nucleotide 5′-overhang before the beginning of the restriction enzyme site (see Note 5). 

Some of the best restriction enzymes sites to use are EcoRI, BamHI, and XbaI. Catalogs 

from New England Biolabs have a list of the ability of different restriction enzymes to 

recognize short base-pair sequences. A potential pitfall of this approach would be the 

occurrence of the same restriction site within the amplified product as used on the end of 

one of the primers. Therefore, only part of the amplified product would be cloned. 

5. The final consideration you should make is the identity of the 3′ most nucleotide. The 

nucleotide on the 3′-end of a primer should preferably be G or C and not N, I, or T. 

The reason for this is that thymidine (and supposedly inosine) can nonspecifically prime 

on any sequence. Guanosines and cytidine are preferred since they form three H-bonds at 

the end of the primer, a degree stronger than an AT base pair. 

3.2. PCR Amplification and DNA Purification 

The template for these reactions can be the DNA in a phage library or the first-strand 

cDNA from a reverse transcription reaction on RNA. A phage library with a titer of 

5 × 10 9 pfu/mL would contain, in a 5-µL aliquot, 2.5 × 10 7 pfu (~1.5 ng of DNA). 

Before PCR amplification, the DNA is heat denatured at 99°C for 10 min. 

3.2.1. PCR (see Notes 1 and 6) 

In all cases, the DNA template should also be PCR amplified with the individual 

degenerate primers to determine whether any of the bands amplified are derived from 

one of the degenerate primer pools. A DNA-free control is required to assess if there is 

contaminating DNA in any of the other reagents. 

1. Pipet into 0.5-mL microcentrifuge tubes in the following order: 58.5 µL of PCR-water that 

has been autoclaved; 10 µL of 10× PCR buffer (see Note 2); 16 µL of 1.25 mM dNTP stock 

solution; 5.0 µL of primer up-1; 5.0 µL of primer down-1; and 5.0 µL of heat-denatured 

library or cDNA (1–100 ng). If several reactions are being set up concurrently, a master 

reaction mix can be made up consisting of all the reagents used in all of the reactions, such 

as the PCR water, reaction buffer, and dNTPs. 

2. Briefly vortex each sample and spin for 10 s in a microfuge. Overlay each sample with 

2 to 3 drops of mineral oil. 

3. Amplify by hot-start PCR using the following cycle parameters. Pause the thermocycler 

in step 4-cycle 1 and add 0.5 µL of Amplitaq DNA polymerase to each tube. Then, run for 

95°C, 5 min (initial denaturation); 94°C, 60 s (denaturation); 50°C, 90 s (annealing; see 

Note 7); 72°C, 60 s (extension); cycle 29 times to step 2; 72°C, 4 min; and 10°C hold. 

3.2.2. DNA Isolation and Gel Electrophoresis Analysis 

1. Remove the reaction tubes from the thermal cycler and add 200 µL of chloroform. Spin for 

10 s in a microfuge to separate the oil-chloroform layer from the aqueous layer. Carefully 

transfer the aqueous layer to a clean microfuge tube.

492 Preston 

2. Remove the AmpliTaq DNA polymerase by extracting the aqueous phase twice with 100 µL 

of PC9 (see Note 3). Spin for 2 min in a microfuge to separate the lower organic layer 

from the upper aqueous layer and transfer the aqueous layer to clean microfuge tube. This 

step is essential before digesting the DNA with restriction enzymes for directional cloning 

(see Subheading 3.3.) because the polymerase can precipitate, and in the presence of 

nucleotides, fill in recessed 3′ termini on DNA. 

3. AmAc-EtOH precipitation: To a 100 µL of DNA sample add 50 µL of 7.5 M AmAc (50% 

vol). Vortex briefly to mix. Precipitate the DNA with 350 µL of 100% ethanol (2–2.5 vol). 

Vortex the samples for 15 s and ice for 15 min. Spin down the DNA at 12,000g for 15 min 

at 4°C in a microfuge. Decant the aqueous waste. Add 250 µL of 70% ethanol. Vortex 

briefly and spin another 5 min at 4°C. Decant the ethanol and allow the pellets to dry 

inverted at room temperature, or dry in a Speed-Vac for 2 to 10 min. 

4. Resuspend in 20 µL of PCR water. 

5. The next step is to resolve an aliquot (2–10 µL) of the PCR fragments by gel electrophoresis. 

Small DNA products (>300 bp) can be resolved at high resolution on 5 to 10% polyacrylamide 

gels (12,13). Moderate-sized PCR products (150–1000 bp) should be resolved 

on 2 to 4% NuSieve agarose gels (in 1× TAE buffer). Larger PCR products (>500 bp) 

can be resolved on 0.8 to 2% agarose gels (1× TAE buffer). 

6. After the bromophenol blue dye has reached the end of the gel, soak the gel for 5 to 30 min 

in about 10 vol of water containing 1 µg/mL EtBr (see Note 3). Then view and photograph 

the gel under ultraviolet light. As shown in Fig. 1, there is little variability in the distance 

between the NPA motifs with the known members of the Aquaporin gene family. PCR 

amplification of the known Aquaporins cDNAs using the internal degenerate primers 

would generate products from 345 to 415 bp. A typical result is shown in Fig. 2. 

3.2.3. Secondary PCR Amplifications and DNA Purification 

Based on the results from gel electrophoresis of the PCR-amplified DNA products, a 

decision must be made on what to do next. The options are the following. 

1. Amplify by PCR from the initial DNA sample under different conditions. 

2. Amplify by PCR from a different DNA sample under the same conditions. (Different 

MgCl 2 concentration, annealing temperature, or primers, see Notes 2, 6, and 7). 

3. Gel purify a band(s) of DNA from the gel for cloning or to reamplify by PCR. 

4. Purify all PCR-amplified DNA fragments for cloning or to reamplify by PCR. 

5. Reamplify by PCR with the same or an internal pair of degenerate primers. 

Options 1 and 2 are self explanatory. If you want to gel purify a particular band or 

group of bands from an agarose gel, a number of procedures and kits are available (see 

Subheading 2.2.). If you plan on immediately cloning a PCR band(s), you may want 

to run the rest of the initial PCR on another gel to increase the recovery of DNA. It 

is also possible to recover specific DNA fragments from an acrylamide gel (3,12,13). 

To purify all PCR-amplified DNA fragments from the remaining sample, a number of 

methods are available, including the QIAquick-spin PCR purification kit, which can 

be used instead of steps 1–3 in Subheading 3.2.2. (Qiagen). Finally, aliquots of 

DNA purified from a gel or from the initial PCR (1–10%) can be reamplified by PCR 

with either the same or an internal pair of degenerate oligonucleotide primers (see 

Note 1). 

When attempting to identify a gene family homolog from a tissue that is known to 

express a homolog(s), a number of tricks can be tried to enrich the final PCR sample


Fig. 2. Gel electrophoresis analysis of PCR-amplified DNA. DNA isolated from a human 

kidney cDNA library in bacteriophage λgt10 was amplified with degenerate primers up-1 (lanes 

1, 5, and 6), up-2 (lanes 2, 7, and 8), down-1 (lanes 3, 5, and 7), and down-2 (lanes 4, 6, and 8). 

Reactions containing 5 × 10 6 pfu of heat-denatured phage DNA, 100 pmol of degenerate primers, 

and 1.5 mM MgCl 2 in a 100-µL volume were subject to 40 cycles of PCR amplification under 

the following parameters: 94°C for 60 s, 48°C for 90 s, and 72°C for 60 s. After chloroform 

extraction and ethanol precipitation, the DNA was resuspended in 20 µL of water, and 5 µL was 

electrophoresed into a 4% NuSieve agarose gel in 1× TAE. The gel was stained with ethidium 

bromide and photographed. The relative mobility of HaeIII digested φX174 DNA markers is 

shown on the right. The bracket shows the size range of known members of this gene family 

from the primers used. 

for new homologs. Because the degenerate oligonucleotide primers are designed from 

the sequence of the known gene family members, these primers will likely be biased 

for those homologs. Aquaporin-1 is abundant in the capillaries around the salivary 

glands and throughout the body, but absent in the salivary gland (16). To identify a 

salivary homology of the Aquaporin gene family, we used a rat salivary gland cDNA 

library that also contained Aquaporin-1 cDNAs, presumably from the surrounding 

capillaries. We first amplified the cDNA library with an external set of degenerate 

primers, digested the PCR-amplified DNAs with the restriction enzyme PstI (which 

cuts between the NPA motifs of rat AQP1), and reamplified with an internal pair of 

primers. We again digested with PstI to digest the rat AQP1 DNAs, then cloned and 

sequenced the DNA fragments between 350 and 450 bp (9). This strategy would not 

work if the resulting cDNA (AQP5) also contained a PstI site. By trying different 

restriction enzymes that cut DNA infrequently (6–8 bp-recognition sites), a number 

of new homologs will preferentially be identified. Alternatively, after cloning the 

DNA products into bacterial expression vectors, bacterial colony lift hybridization 

can be used to identify colonies containing inserts for known gene family members 

(3,12,13).

494 Preston 

3.3. Cloning and DNA Sequencing of PCR-Amplified Products 

3.3.1. Preparation of Vector for Ligation 

1. For blunt-end ligations, digest 1 µg of pBluescript II KS phagemid DNA (Stratagene) with 

10 U EcoRV in a 50-µL vol. Incubate at 37°C for 2 h. For cohesive-end ligations, similarly 

digest the vector with the appropriate restriction enzyme(s). 

2. For both blunt-end ligations and cohesive-end ligations where the vector has been digested 

with only one restriction enzyme, it is necessary to remove the 5′-phosphate from the 

vector to inhibit the vector from self ligating. This is accomplished by treating the vector 

with CIP according to the manufacturer’s recommendations. Note that 1 µg of a 3-kbp 

linear DNA molecule contains 1 pmol of 5′ overhangs (BamHI), blunt-ends (EcoRV), or 

3′-overhangs (PstI), depending on the enzyme that digested it. Afterward, add EDTA to 

5 mM and heat-kill the enzyme at 65°C for 1 h. Adjust the volume to 50 to 100 µL with TE 

and extract once with Tris-saturated phenol, twice with PC9, and twice with chloroform. 

Back extract each organic layer with 50 µL of TE and pool with the final sample. 

AmAc-EtOH precipitate (see Subheading 3.2.2.) and resuspend in 10 µL of water. 

3. If the insert is going to be directionally cloned into the vector, just extract once with 

50 µL of PC9, AmAc-EtOH precipitate (see Subheading 3.2.2.) and resuspend in 10 µL 

of water. 

3.3.2. Preparation of Inserts for Ligation 

AmpliTaq and other thermostable DNA polymerases often fail to completely fill in 

the ends of the double-stranded DNA products, thus leaving recessed 3′ termini that 

can be filled in with the Klenow fragment of E. coli DNA polymerase I. This should be 

done whether or not the DNA is going to be digested with restriction enzymes added to 

the ends of the primers for directional cloning (see Subheading 3.1.). 

1. AmAc-EtOH precipitate the DNA (see Subheading 3.2.2.) and resuspend in 15 µL of 

water. 

2. Add 2 µL of 10× restriction enzyme reaction buffer. Klenow DNA polymerase works 

well in most restriction enzyme digestion buffers (10× REact 2 or 3 from Gibco-BRL). 

If the DNA is going to be subsequently digested with a restriction enzyme(s), use the 

buffer for that enzyme. 

3. Add 2 µL of 10 mM dNTP solution. Then, add Klenow DNA polymerase (1 U/µg DNA) 

and incubate at room temperature for 15 min. 

4. Heat-inactivate the enzyme at 75°C for 10 min. If the DNA is going to be directly used in 

ligation reactions, it is not necessary to purify the DNA from the unincorporated dNTPs 

because they will not inhibit T4 DNA ligase. To concentrate the DNA sample, proceed 

with step 6. 

5. PCR products containing restriction sites on their ends should now be digested with the 

restriction enzymes. Incubate in the appropriate buffer, using 20 U of enzyme/µg of DNA 

and incubating for 2 to 4 h at the proper temperature. 

6. Extract the DNA once or twice with PC9 and precipitate with AmAc-EtOH as described 

above (see Subheading 3.2.2.). Resuspend the final pellet in 5 to 10 µL of water. 

3.3.3. DNA Ligation and Bacterial Transformation 

1. At this point, it is often advantageous to run a small aliquot of the different DNA fragments 

on a gel to assess their approximate concentrations and purity. Ideally, you want at least a 

21 molar ratio of insert to vector in the ligation reactions. If necessary return to the above 

procedures to isolate more DNA for the ligation reaction.


2. Set up the ligation reactions with the vector and insert similar to the following: 

a. Reaction 1: 1 µL of vector (10 ng; vector control); 

b. Reaction 2: 1 µL of vector + 1 µL of insert (~10 ng insert); 

c. Reaction 3: 1 µL of vector + 4 µL of insert. 

Then add 2 µL of 5× T4 DNA ligase buffer (Gibco-BRL) and water to 9.5 µL. If the 

buffer is more than 4-mo-old, the ATP may be depleted. Therefore, add fresh ATP to a 

final concentration of 1 mM. 

3. For cohesive-end ligations add 0.5 µL of T4 DNA ligase (1 U/µL), gently mix, spin 5 s 

in a microfuge, and incubate at 15°C for 10 to 20 h. For blunt-end ligations add 1 µL 

of T4 DNA ligase (5 U/µL), gently mix, spin 5 s in a microfuge, and incubate at 25°C 

(or room temperature) for 1 to 12 h. Stop the reaction by heating at 75°C for 10 min and 

store the samples at –20°C. 

4. Set up a bacterial transformation with competent DH5α bacteria or a comparable strain 

of bacteria. Be sure to include a positive control (10 ng of undigested vector DNA) and a 

negative control (water). To 1.5-mL microfuge tubes, add half of the ligation mix (5 µL) 

or 5 µL of control DNA or water and 50 µL of competent bacteria (thawed slowly on ice); 

incubate on ice for 30 min. Heat-shock at 42°C for 2 min. Return to ice for 1 min. Add 

200 µL of LB media containing 10% glycerol. Mix gently and allow bacteria to recover 

and express the ampicillin resistance gene by incubating at 37°C for 1 h. 

5. Prewarm LB-Amp plates at 37°C for 45 min. About 30 min before plating the bacteria on 

the plates, add 40 µL of X-Gal and 4 µL of IPTG and quickly spread over the entire surface 

of the plate using a sterile glass spreader. Spread 20 to 200 µL of the transformation 

reactions on these plates. Allow the inoculum to absorb into the agar and incubate the 

plates inverted at 37°C for 12 to 24 h (see Note 4). Afterward, placing the plates at 4°C 

for 2 to 4 h will help enhance the blue color development. 

3.3.4. Plasmid DNA Minipreps and DNA Sequencing 

1. Colonies that contain active β-galactosidase will appear blue, whereas those containing 

a disrupted LacZ gene will be white. Set up minicultures by inoculating individual white 

colonies into 2 mL of LB media containing ampicillin. After growing at 37°C overnight, 

isolate the plasmid DNA. Resuspend the DNA in 20 to 50 µL of water or TE. 

2. Digest 5 to 20 µL of the DNA with the appropriate restriction enzymes and analyze by 

agarose gel electrophoresis (see Subheading 3.2.3.). 

3. Perform double-stranded DNA sequencing on recombinants containing inserts in the 

expected size range. 

4. Notes 

1. All PCRs should be set up in sterile laminar flow hoods using pipet tips containing filters 

(aerosol-resistant tips) to prevent the contamination of samples, primers, nucleotides, 

and reaction buffers by DNA. If the PCR is going to be reamplified by PCR, all possible 

intervening steps should also be performed in a sterile hood with the same precautions to 

prevent DNA contamination. These precautions should also be extended to all extractions 

and reactions on the nucleic acid (RNA or DNA) through the last PCR. Likewise, all 

primers, nucleotides, and reaction buffers for PCR should be made up and aliquoted using 

similar precautions. All buffers for PCR should be made with great care using sterile 

disposable plastic or baked glass, and restricted for use with aerosol-resistant pipet tips. 

2. Standard PCR buffers contain 15 mM MgCl 2 (1.5 mM final concentration). In many 

cases, changes in the MgCl 2 concentration will have significant consequences on the 

amplification of specific bands. In PCR-amplifying the four exons of the AQP1 gene,

496 Preston 

MgCl 2 concentrations between 0.7 and 1.0 mM gave the best results (17,18); however, 

MgCl 2 concentrations between 0.5 and 5.0 mM have been reported. 

3. Organic solvents and ethidium bromide are hazardous materials. Always handle with 

tremendous caution, wearing gloves and eye protection. Contact your hazardous waste 

department for proper disposal procedures in your area. 

4. Ampicillin-resistant bacteria secrete β-lactamase into the media, which rapidly inactivates 

the antibiotic in regions surrounding the growing bacterial colony. Thus, when bacteria are 

growing at a high density or for long periods (>16 h), ampicillin-sensitive satellite colonies 

will appear around the primary colonies (which are white in blue-white selections). 

This problem can be ameliorated (but not eliminated) by substitution of carbenicillin for 

ampicillin on agar plates. 

5. When designing primers with restriction enzyme sites and 5′-overhangs, note that the 

5′-overhang should not contain sequences complementary to the sequence just 3′ of the 

restriction site because this would facilitate the production of primer-dimers. Consider 

the primer 5′-ggg.agatct.CCCAGCTAGCTAGCT-3′, which has a XbaI site proceeded by 

a 5′-ggg and followed by a CCC-3′. These 12 nucleotides on the 5′-end are palindromic 

and can therefore easily dimerize with another like primer. A better 5′-overhang would 

be 5′-cac. 

6. When cloning a gene from a recombinant library by PCR, remember that not all genes are 

created equally. Genes with high GC contents have proven more difficult to clone than 

most. Several researchers have made contributions in a search for factors to enhance the 

specificity of PCRs. Nonionic detergents, such a Nonident P-40, can be incorporated in 

rapid sample preparations for PCR analysis without significantly affecting Taq polymerase 

activity (19). In some cases, such detergents are absolutely required to reproducibly detect 

a specific product (20) presumably because of inter- and intrastrand secondary structure. 

Tetramethylammonium chloride has been shown to enhance the specificity of PCRs by 

reducing nonspecific priming events (21). Commercially available PCR enhancers are 

also available. 

7. A critical parameter when attempting to clone by PCR is the selection of a primer annealing 

temperature. This is especially true when using degenerate primers. The primer melting 

temperature (T m ) is calculated by adding 2° for AT base pairs, 3° for GC base pairs; 2° 

for NN base pairs, and 1° for IN base pairs. Most PCR chapters suggest you calculate the 

T m and set the primer annealing temperature to 5 to 10°C below the lowest T m . Distantly 

related gene superfamily members have been cloned using this rationale (22). However, I 

have found that higher annealing temperatures are helpful in reducing nonspecific priming, 

which can significantly affect reactions containing degenerate primers. 


I thank my colleagues, especially Peter Agre and William B. Guggino, for their 

support and helpful discussions. This work was supported in part by NIH grants 

HL33991 and HL48268 to Peter Agre. 

References 

1. Reizer, J., Reizer, A., and Saier, M. H., Jr. (1993) The MIP family of integral membrane 

channel proteins: sequence comparisons, evolutionary relationships, reconstructed pathways 

of evolution, and proposed functional differentiation of the two repeated halves of the 

proteins. Crit. Rev. Biochem. Mol. Biol. 28, 235–257. 

2. Knepper, M. A. (1994) The aquaporin family of molecular water channels. Proc. Natl. 

Acad. Sci. USA 91, 6255–6258.


3. Preston, G. M. (1993) Use of degenerate oligonucleotide primers and the polymerase 

chain reaction to clone gene family members, in Methods in Molecular Biology, vol. 15: 

PCR Protocols: Current Methods and Applications. (White, B. A., ed.) Humana, Totowa, 

NJ, pp. 317–337. 

4. Preston, G. M. and Agre, P. (1991) Isolation of the cDNA for erythrocyte integral membrane 

protein of 28 kilodaltons: Member of an ancient channel family. Proc. Natl. Acad. Sci. 

USA 88, 11,110–11,114. 

5. Wada, K.-N., Aota, S.-I., Tsuchiya, R., Ishibashi, F., Gojobori, T., and Ikemura, T. (1990) 

Codon usage tabulated from the GenBank genetic sequence data. Nucleic Acids Res. 18, 

2367–2411. 

6. Preston, G. M., Carroll, T. P., Guggino, W. B., and Agre, P. (1992) Appearance of water 

channels in Xenopus oocytes expressing red cell CHIP28 protein. Science 256, 385–387. 

7. Chrispeels, M. J. and Agre, P. (1994) Aquaporins: Water channel proteins of plant and 

animal cells. TIBS 19, 421– 425. 

8. Jung, J. S., Bhat, B. V., Preston, G. M., Guggino, W. B., Baraban, J. M., and Agre P. (1994) 

Molecular characterization of an aquaporin cDNA from brain: candidate osmoreceptor and 

regulator of water balance. Proc. Natl. Acad. Sci. USA 91, 13,052–13,056. 

9. Raina, S., Preston, G. M., Guggino, W. B., and Agre, P. (1995) Molecular cloning and 

characterization of an aquaporin cDNA from salivary, lacrimal and respiratory tissues. 

J. Biol. Chem. 270, 1908–1912. 

10. Knoth, K., Roberds, S., Poteet, C., and Tamkun, M. (1988) Highly degenerate, inosinecontaining 

primers specifically amplify rare cDNA using the polymerase chain reaction. 

Nucleic Acids Res. 16, 10,932. 

11. Chérif-Zahar, B., Bloy, C., Kim, C. L. V., Blanchard, D., Bailly, P., Hermand, P., et al. 

(1990) Molecular cloning and protein structure of a human blood group Rh polypeptide. 


12. Sambrook, J., Fritsch, E. F., and Maniatis, T., eds. (1989) Molecular Cloning: A Laboratory 

Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 

13. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., et al., 

eds. (1994) Current Protocols in Molecular Biology. Greene Publishing/Wiley-Interscience, 

New York. 

14. Wistow, G. J., Pisano, M. M., and Chepelinsky, A. B. (1991) Tandem sequence repeats in 

transmembrane channel proteins. TIBS 16, 170–171. 

15. Jung, J. S., Preston, G. M., Smith, B. L., Guggino, W. B., and Agre, P. (1994) Molecular 

structure of the water channel through aquaporin CHIP: The hourglass model. J. Biol. 

Chem. 269, 14,648–14,654. 

16. Nielsen, S., Smith, B. L., Christensen, E. I., and Agre, P. (1993) Distribution of the 

aquaporin CHIP in secretory and resorptive epithelia and capillary endothelia. Proc. Natl. 

Acad. Sci. USA 90, 7275–7279. 

17. Smith, B. L., Preston, G. M., Spring, F. A., Anstee, D. J., and Agre, P. (1994) Human 

red cell Aquaporin CHIP, I. molecular characterization of ABH and Colton blood group 

antigens. J. Clin. Invest. 94, 1043–1049. 

18. Preston, G. M., Smith, B. L., Zeidel, M. L., Moulds, J. J., and Agre, P. (1994) Mutations 

in aquaporin-1 in phenotypically normal humans without functional CHIP water channels. 

Science 265, 1585–1587. 

19. Weyant, R. S., Edmonds, P., and Swaminathan, B. (1990) Effects of ionic and nonionic 

detergents on the Taq polymerase. Biotechnology 9, 308–309. 

20. Bookstein, R., Lai, C.-C., To, H., and Lee, W.-H. (1990) PCR-based detection of a 

polymorphic BamHI site in intron 1 of the human retinoblastoma (RB) gene. Nucleic 

Acids Res. 18, 1666.

498 Preston 

21. Hung, T., Mak, K., and Fong, K. (1990) A specificity enhancer for polymerase chain 

reaction. Nucleic Acids Res. 18, 4953. 

22. Zhao, Z.-Y. and Joho, R. H. (1990) Isolation of distantly related members in a multigene 

family using the polymerase chain reaction technique. Biochem. Biophys. Res. Commun. 

167, 174–182. 

23. Aelst, L. V., Hohmann, S., Zimmermann, F. K., Jans, A. W. H., and Thevelein, J. M. (1991) 

A yeast homologue of the bovine lens fiber MIP gene family complements the growth 

defect of a Saccharomyces cerevisiae mutant on fermentable sugars but not its defect in 

glucose-induced RAS-mediated cAMP signalling. EMBO J. 10, 2095–2104. 

25. Muramatsu, S. and Mizuno, T. (1989) Nucleotide sequence of the region encompassing 

the glpKF operon and its upstream region containing a bent DNA sequence of Escherichia 

coli. Nucleic Acids Res. 17, 4378. 

25. Höfte, H., Hubbard, L., Reizer, J., Ludevid, D., Herman, E. M., and Chrispeels, M. J. 

(1992) Vegetative and seed-specific forms of Tonoplast Intrinsic Protein in the vacuolar 

membrane of Arabidopsis thaliana. Plant Physiol. 99, 561–570. 

26. Fushimi, K., Uchida, S., Hara, Y., Hirata, Y., Marumo, F., and Sasaki, S. (1993) Cloning 

and expression of apical membrane water channel of rat kidney collecting tubule. Nature 

361, 549–552. 

27. Gorin, M. B., Yancey, S. B., Cline, J., Revel, J.-R., and Horwitz, J. (1984) The major 

intrinsic protein (MIP) of the bovine lens fiber membrane: characterization and structure 

based on cDNA cloning. Cell 39, 49–59. 

28. Guerrero, F. D., Jones, J. T., and Mullet, J. E. (1990) Turgor-responsive gene transcription 

and RNA levels increase rapidly when pea shoots are wilted: sequence and expression of 

three induced genes. Plant Mol. Biol. 15, 11–26. 

29. Rao, Y., Jan, L. Y., and Jan, Y. N. (1990) Similarity of the product of the Drosophila 

neurogenic gene big brain to transmembrane channel proteins. Nature 345, 163–167. 

30. Fortin, M. G., Morrison, N. A., and Verma, D. P. S. (1987) Nodulin-26, a peribacteroid 

membrane nodulin is expressed independently of the development of the peribacteroid 

compartment. Nucleic Acids Res. 15, 813–824. 

31. Feng, D.-F. and Doolittle, R. F. (1990) Progressive alignment and phylogenetic tree 

construction of protein sequences, in Methods in Enzymology, vol. 183: Molecular Evolution: 

Computer Analysis of Protein and Nucleic Acid Sequences (Doolittle, R. F., ed.), 

Academic, New York, pp. 375–387.

cDNA Libraries from Few Cells 499 

68 

cDNA Libraries from a Low Amount of Cells 

Philippe Ravassard, Christine Icard-Liepkalns, Jacques Mallet, 

and Jean Baptiste Dumas Milne Edwards 


1.1. Application of the SLIC Strategy to cDNA Libraries: 

General Considerations 

Conventional cDNA library construction often requires a minimum available amount 

of material (typically 1 or 2 µg of polyA + RNA). For complex organs, such as brain, or 

certain species, such as humans, as well as subsets of cell types, this condition is often 

difficult to fulfill. Amplification by polymerase chain reaction (PCR) can be used to 

circumvent this limitation because it is a powerful method to obtain working quantities 

of low-abundance DNAs. To effectively apply this method, known sequences need to 

be attached to the ends of the single-stranded cDNA (ss-cDNA). One at the 5′ end of 

the ss-cDNA is added during the priming of the synthesis; the other, at the 3′ end, is 

covalently attached by ligation using the SLIC strategy. With known DNA sequences 

attached to both ends of the synthetized cDNA, minute quantities can be amplified with 

sequence-specific primers to provide sufficient material to successfully generate and 

screen cDNA libraries. The overall scheme is illustrated in Fig. 1. 

Obviously, the goal in constructing such a library is to maintain the representation 

of every mRNA in the total RNA population, even low-abundant ones. Because the 

reverse transcription and the single-strand ligation do not modify the overall proportion 

of each molecule, only the PCR step may introduce an important bias in cDNA 

representation. Thus, for cDNA library construction using this methodology, it is 

important to optimize the synthesis of the sequence-tagged cDNA and to take steps 

to limit any amplification bias. 

1.2. Simultaneous PCR Amplification of a Complex DNA Mixture 

Generates an Important Size Bias 

The sequence-tagged cDNAs correspond to a large population of molecules with 

indentical ends. The only difference between these molecules is their relative size and 

sequence. Therefore, keeping the representativity of the cDNAs after PCR requires a 

constant amplification yield regardless of the size and sequence of the original cDNA 

population. This, unfortunately cannot be achieved by PCR. In fact, coamplification of 



499

500 Ravassard et al. 

Fig. 1. Constructing cDNA libraries using the SLIC strategy. Reverse transcription is 

performed with a random primer RA3′ NV. RNAs are digested and primer is removed to avoid 

its ligation to the A5′ NV oligonucleotide. A5’ NV bears a phosphate group at its 5′ extremity 

to allow ligation to the 3′ end of the ss-cDNA. To avoid formation of concatemers A5′ NV 

bears an amino group at its 3′ end. Two rounds of nested PCR are performed to generate a 

ready-to-use cDNA library. 

short and long molecules with the same primers always leads to a selective amplification 

of the shorter ones, even though the longer ones were originally more abundant (1). 

Attempts to enlarge the average size of the PCR products have been made with the 

help of long-range PCR procedures, such as Pfu dilutions (2), Taq extender (Stratagene, 

La Jolla, CA), and Expand PCR system (Boehringer, Indianapolis, IN). The results 

were not significantly different if compared with the classic PCR techniques (data 

not shown). 

In conclusion, the size bias represents the major limitation in constructing PCR 

cDNA libraries. Thus, to avoid bias during the amplification step the average size of 

the cDNA library must be between 0.8 and 1 kbp, which is far below the usual average 

length of a ss-cDNA.


Fig. 2. Oligonucleotides used for 3′ anchored PCR. The three oligonucleotides A3′_1,2,3 

are designed from A3′ NV and RA3′ NV to be used in PCR experiments. Note that these three 

primers have to be used with A5′_1,2,3. 

1.3. ss-cDNA Synthesis 

The constraint caused by the size limitation of the ss-cDNA forbids the use of 

oligo-dT to prime the reverse transcription. If such a priming strategy is chosen, this 

will lead to a 3′-UTR-cDNA library. To obtain a cDNA library representative of the 

sequences of all messenger RNA, priming with random primer RA3′ NV must be 

performed. 

Experimentally, the ss-cDNA is synthesized with a random primer RA3′ NV (Fig. 2) 

and a radiolabled nucleotide. The average size is determined by alkaline gel electrophoresis 

and autoradiography. The incubation time with the reverse transcriptase 

is calibrated in order to generate an ss-cDNA whose average length is between 0.8 

and 1 kbp. With those conditions the representation of any mRNA will be optimal 

in the library. 

1.4. Amplification of the cDNA Library Based on the SLIC Strategy 

We have used this strategy to generate a cDNA library from newborn rat cervical 

superior ganglia (CSG). Total RNA was prepared from one single CSG, and polyA + 

RNA was prepared with oligo dT-coated magnetic beads (Dynabeads mRNA purification 

kit). Half of the material, which corresponds to polyA + RNA of about 5000 cells, 

was used to synthesize ss-cDNA primed with RA3′ NV. An incubation time of 30 min 

was optimum to generate an average size of 1 kbp. After removal of the primer, the 

ss-cDNA was ligated to A5′ NV (note that after each step the different primers are 

removed). These ss-cDNA were amplified by two rounds of nested PCR. To increase 

the specificity of the PCR reaction, we have used the touchdown PCR protocol (3). The 

primers used for the nested PCR were A5′_1 ∞ A3′_1 and A5′_2 ∞ A3′_2, respectively. 

One-twentieth of the reaction was cloned in a blunt-end vector, yielding 2 ∞ 10 5 

colonies. Analysis by direct PCR on colonies of 96 randomly chosen clones indicated 

that the average size of the library was about 900 bases. The striking result is that the


size dispersion around the mean is extremely low when compared with a conventional 

library. Finally, 5000 primary clones were screened with a TH oligonucleotide, yielding 

two positive TH clones (0.04%). Thus, no major distortion had been introduced in the 

abundance of TH clones, since TH represents 0.05% of CSG mRNA. 

1.5. Direct Screening of the PCR Library 

with Biotinylated Oligonucleotides 

One of the major difficulties in making a cDNA library is the cloning of the 

double-stranded cDNA (ds-cDNA). We tested a direct screening protocol of uncloned 

ds-cDNA. After the second nested PCR, the amount of ds-cDNA was about 2 to 5 µg. 

We directly hybridized the denatured ds-cDNA with a biotinylated TH specific primer. 

After the hybridization reaction, probe-cDNA hybrids were separated from unhybridized 

DNA using streptavidin-coated magnetic beads (Dynabeads M-280). After various 

washing steps, the captured cDNA was amplified using the third nested PCR primers 

(A5′3 and A3′3) directly onto the beads. The PCR product was cloned, and more than 

85% of them were TH clones as analyzed by partial sequencing. Biotinylated cDNA 

probes, instead of oligonucleotides, can also be used to screen a PCR library (4). 

1.6. Application of the SLIC Method to Subtractive Libraries 

Subtraction cloning strategies could be modified and certainly improved taking 

advantage of the generation of cDNA molecules exhibiting two defined extremities. 

Basically, tracer cDNA synthesized on mRNA from source A is hybridized to sequences 

of driver mRNA, which is isolated from a different but usually related source B. The 

tracer cDNAs that do not become hybridized with driver mRNA represent an enriched 

population of sequences expressed only in A cells. These are used for constructing an 

A-cell specific cDNA library. 

The SLIC strategy provides DNA molecules with two defined ends. This offers the 

opportunity to work on cDNA from populations A and B with two different sets of 

SLIC primers, A (A5′ NV and RA3′ NV) and B (B5′ NV and RB3′ NV; Fig. 3). During 

the PCR amplification of the tracer population B, a pair of biotinylated primers is used. 

Thus, this population can be captured and pure single-stranded molecules immobilized 

on magnetic beads. Then, after hybridization with the amplified A population, the 

unhybridized population corresponds to the A-cell specific sequences and can be used 

easily to generate substracted libraries or probes. This strategy gives for the first 

time the opportunity to realize such subtractive libraries with a very small amount 

of input material. 

1.7. Conclusion 

The SLIC method is a powerful and unique tool to synthesize cDNA and substractive 

libraries from a limited number of cells. It is unfortunately extremely difficult to 

generate full-length libraries. Nevertheless, cloning 5′ or 3′ ends of a cDNA is no 

longer a limiting step because anchored PCR can be easily performed. In this case, the 

same ss-cDNA that was used to generate the library can also be used as a matrix to 

isolate both ends of the incomplete clone.


Fig. 3. Alternative oligonucleotides used for subtractive cDNA library construction. For 

the B oligonucleotides the same modifications (5′ phosphate and 3′ amino) as the A primers 

have to be used. 

2. Materials 

2.1. Oligonucleotides 

1. PCR library primers: For the 5′ end of the ss-cDNA, use RA3′ NV and the related 

oligonucleotides (A3_1,2,3). For the 3′ end use A5′NV, A5′_1,2,3. All oligonucleotides 

must bear 5′ and 3′ hydroxyl group. Only A5′NV must have a phosphate group to its 

5′ end to allow ligation to the 3′ end of the ss-cDNA. To avoid selfligation of A5′ NV, its 

3′ end must be protected with an amino group. Those modifications are performed by any 

oligonucleotide suppliers. Apply the same rules when using B5′ NV and RB3′ NV. Note 

that only two related oligonucleotides are available for both ends. 

2. Biotinylated screening primers: Ask your oligonucleotide supplier for 5′ biotinylated 

primers with a seven carbon spacer. Do not use an 11 carbon spacer because this will 

dramatically decrease the capture yield. If this primer is designed to hybridize in the middle 

of a molecule, add 4 to 6 random nucleotides at the 5′ end to facilitate the interaction with 

the streptavidin magnetic beads. 

2.2. RNA Extraction (see Note 1) 

1. Starting material: Fresh pelleted cells, store at –80°C on collection. Fresh pieces of organs, 

or tissue frozen in liquid nitrogen and stored at –80°C. 

2. PolytronR TP1200 (if organs are used). 

3. RNAZol reagent (BIOPROBE). 

4. DT40 (Pharmacia, [Piscataway, NJ]; #17-0270-01) Prepare a 5 mg/mL stock solution in 

ddH 2 O. Aliquot and store at –20°C. 

5. CHCl 3 . 



8. 70% Ethanol.


9. ddH 2 O. 

10. Dynabeads mRNA purification kit (Dynal, Lake Success, NY). 

2.3. Synthesis of the ss-cDNA 

1. Water bath at 70 and 42°C. 

2. Dry-ice powder and ice. 

3. 10× FSB buffer: 1 M Tris-HCl, pH 8.4 (at 42°C), 1.2 M KCl, 100 mM MgCl 2 . Aliquot 

and store at –20°C. 

4. DTT (100 mM ). 

5. Acetylated bovine serum albumin, 5 mg/mL (RNase-free; Life Technologies/BRL, 

Gaithersburg, MD). 

6. RNasin, 36 U/µL (Promega Biotech, Madison, WI). 

7. dNTPs, 10 mM each (Use lithium-free dNTPs). 

8. Sodium pyrophosphate (20 mM; PPi). 

9. [α 32 P] dATP, 3000 Ci/mmol (Amersham, Arlington Heights, IL). 

10. AMV reverse transcriptase, 10 U/µL (Promega Biotech, Madison, WI). 

11. RA3′ NV (50 ng/µL). 

2.4. Synthesis Yield Determination 

1. DE81 Whatman paper. 

2. Na 2 HPO 4 (0.5 M ). 


4. Aqueous scintillation cocktail. 

2.5. Removal of Primers 

1. Prep-A-Gene DNA purification Kit (Bio-Rad [Richmond, CA]; #732-6010). The silica 

matrix used in this kit does not bind RNA or small DNA molecules (cut off around 100 

nucleotides) under oxidizing conditions. 

2. Water baths at 90 and 65°C. 

2.6. Ligation of the ss-cDNA to the Modified Oligonucleotide 

Modified oligonucleotide: 5′ phosphate and 3′ NH 2 A5′NV (or B5′NV). 

2.7. PCR Amplification 

PCR reagents, including primers. 

2.8. Direct Screening of the PCR Library 


1. Biotinylated primer (see Subheading 2.1.2.). 

2. Streptavidin Dynabeads (10 mg/mL Dynabeads M-280 Streptavidin, DYNAL, Lake 

Success, NY). 

3. Magnetic concentrator (Dynal MPC). 

4. Rotating wheel. 

5. 20× SSPE solution: 200 mM NaH 2 PO 4 , pH 7.4, 3.6 M NaCl, 20 mM EDTA (5). 

6. 20× SSC: 300 mM sodium citrate, pH 7.0, 3 M NaCl (5). 

7. 50× Denhardt’s solution: 1% each of BSA, Ficoll 400, and PVP (5). 

8. 20% SDS. 

9. Sonicated salmon sperm DNA.


10. 10× PCR buffer (see Chapter 1). 

11. 42°C incubator. 

2.9. Blunt-End Cloning of PCR Products 

1. Unpurified PCR products. 

2. T4 DNA polymerase (4 U/µL, Amersham). 

3. Agarose gel (choose agarose concentration according to the PCR product length). 

4. QIAEX II purification kit (Qiagen, Inc., Chatsworth, CA). 

5. ATP (3 and 8 mM ). 

6. T4 polynucleotide kinase 5 U/µL (Amersham). 

7. 10× T4 polynucleotide kinase buffer (Amersham). 

8. Dephosphorylated SmaI pUC19 vector (Appligene). 

9. T4 DNA ligase, 4 U/µL. 

10. Electrocompetent XLI blue cells. 

11. Escherichia coli electroporation equipment. 

2.10. Direct PCR on Colonies 

1. Inoculating needles. 

2. PCR reagent, including primers. With pUC vectors, use M13 universal sequencing primer 

and M13 reverse sequence primer. 

3. Methods 


All manipulations must be performed in an RNase-free environment and with PCR 

anticontamination material. In our hands, the best extraction yield for low amount of 

material is obtained with the RNAZol kit. When working with tissues, use a polytronR 

TP1200 to homogenize in the RNAzol solution. 

Follow the supplier’s instructions with two important modifications. 

1. Add 1 µL of DT40 (5 mg/mL) in the RNAZol solution prior to the homogenization step. 

This will increase the extraction yield. 

2. At the end, resuspend the pellet in 20 µL of ddH 2 O and store at –80°C. 

If the extraction of polyA + RNA is required, use the Dynabeads mRNA purification 

kit (Dynal); do not use the Dynabeads mRNA DIRECT kit. Elute from the magnetic 

beads with 20 µL of ddH 2 O instead of elution buffer and store at –80°C. 

3.2. Synthesis of the ss-cDNA (see Note 2) 

The final volume for the reverse transcription is 50 µL. 

3.2.1. AMV RTase Preincubation Mix 

1. Add, on ice, in a sequential manner the following reagents: 1.5 µL of H 2 O, 3 µL of 10× FSB, 

2.5 µL of 0.1 M DTT, 3 µL of 10 mM each dNTP (lithium free), 1 µL of 5 mg/mL BSA, 

5 µL [α 32 P] dATP (100 U/µL) (3000 Ci/mmol), 1 µL of RNasin (36 U/µL), 10 µL of 

20 mM PPi, and 1 µL of AMV RTase. 

2. Preincubate on ice for 30 min.


3.2.2. RNA Mix Preparation 

Prepare this mix during the preincubation of the AMV reverse transcriptase. 

1. Dilute the RNA in 17 µL of ddH 2 O (see Note 3). 

2. Add 1 µL of 50 ng/µL RA3′NV (or any anchored random primer). 

3. Add 2 µL of 10× FSB. 

4. Heat the tubes at 70°C for 15 min. 

5. Spin and freeze in dry-ice powder. 

6. Let it thaw on ice. 

3.2.3. Reverse Transcription 

1. Assemble the preincubation mix and the RNA mix and incubate at 42°C for 20 min 

to 1 h. 

2. To stop the reaction, add 1 µL of 0.5 M EDTA. To determine the optimal incubation time, 

perform five cDNA synthesis in 10 µL final reaction volume and stop the incubation every 

10 min after 20 min initial reaction time. Load 5 to 10 µL on an alkaline agarose gel (5) 

and measure the average length. The optimal reaction time will be the one that gives an 

average size of 0.8 to 1 kbp. 

3.3. Synthesis Yield Determination 

1. Take 1 µL of the cDNA and dilute it to 10 µL in ddH 2 O. 

2. Spot 5 µL of the dilution on two pieces of DE81 Whatman filter. 

3. Wash one filter only in 0.5 M Na 2 HPO 4 for 10 min. 

4. Repeat step 3 two more times and dry this filter in 100% ethanol. 

5. Dry both filters in air for 15 min. 

6. Add 10 mL of aqueous scintillation cocktail to the washed and unwashed filters. 

7. Count the 32 P activity. The washed filter activity corresponds to the incorporated activity 

(I), whereas the unwashed one corresponds to the total activity (T). 

8. The synthesized ss-cDNA mass (M) is given by the formula: 

M = (I / T) × (total dATP mass during reaction) × 4 (1) 

In the conditions used, M(ng) = (I / T) × 792. The overall yield should be between 

25 and 30% of the starting mass of RNAs. 

3.4. Removal of Primers 

Use Prep-A-Gene DNA purification kit. Follow the supplier’s instructions with the 

following important modifications. 

1. To remove primer after the ss-cDNA synthesis, heat for 5 min at 90 to 95°C to denature 

the RNADNA heteroduplexes. Add 150 µL of binding buffer, mix, then add 5 µL of 

resuspended matrix. Mix well. Incubate for 10 min at room temperature. 

2. To remove primer after ligation or PCR, do not perform this denaturation step. 

3. For purification do not use a starting volume smaller than 50 µL. 

4. Carefully remove all the wash buffer after the last wash. Traces of ethanol can be removed 

by drying the tubes for 3 min in a SpeedVac or equivalent rotary vacuum desiccator. 

5. Elute with 5 to 10 µL of ddH 2 O for 5 min at 65°C, then spin for 30 s and collect 

supernatant. 

6. Alternative procedures can be followed.


3.5. Ligation of the ss-cDNAs to the Modified Oligonucleotide 

(see Note 4) 

1. Remove primer before the PCR amplification step. 

3.6. PCR Amplification (see Notes 5 and 6) 

The general conditions used for both PCR amplifications are: 50 µL of reaction 

volume, hot start, and touchdown PCR. 

1. First PCR: Use A5′_1 and A3′_1 and half of the purified ligation mixture. 

2. Second PCR: Use A5′_2 and A3′_2 and one tenth of the purified first PCR. 

3. For both PCRs: 

a. Use as final concentration 200 µM of dNTPs, 0.8 µM of each primer, and 1.5 mM 

of MgCl 2 . 

b. Hot start: Add 0.5 µL of Taq DNA polymerase (5 U/µL) below the mineral oil when 

the reaction mixture reaches 80°C. 

c. Perform the following touch down PCR cycles: denaturation 93°C for 3 min; two cycles 

of 94°C, 30 s/70°C, 45 s/72°C, 1.5 min; two cycles of 94°C, 30 s/69°C, 45 s/72°C, 

1.5 min; two cycles of 94°C, 30 s/68°C, 45 s/72°C, 1.5 min; two cycles of 94°C, 

30 s/67°C, 45 s/72°C, 1.5 min; two cycles of 94°C, 30 s/66°C, 45 s/72°C, 1.5 min; 

25 cycles of 94°C, 30 s/65°C, 45 s/72°C, 1.5 min; and cool down to 4°C. 

d. Remove primer after each PCR. 

After the second nested PCR the amount of ds-cDNA is about 2 to 5 µg. 

3.7. Direct Sceening of the PCR Library 


3.7.1. Hybridization with the Biotinylated Oligonucleotide (see Note 7) 

1. Use 500 ng of purified ds-cDNA. The volume should not exceed 8 µL. 

2. Add 2 µL of the 100 ng/µL biotinylated oligonucleotide. 

3. Adjust volume to 10 µL. 

4. Heat denature for 5 min at 95°C. 

5. Immediately add 100 µL of hybridization buffer: 5× SSPE, 5× Denhardt’s solution, 

1% SDS. 

6. Incubate overnight at 42°C. 

3.7.2. Separation of Probe-cDNA Hybrids 

After the hybridization reaction, probe-cDNA hybrids are separated from unhybridized 

DNA using Streptavidin-coated magnetic beads. 

1. Prehybridize Dynabeads with salmon sperm DNA by washing 20 µL of 10 mg/mL 

Dynabeads twice with 50 µL of hybridization buffer containing 250 µg/mL salmon sperm 

DNA. Incubate for 2 h at room temperature on a rotating wheel. 

2. Mix the Dynabeads with the probe-cDNA solution. Incubate 15 to 30 min at room 

temperature on a rotating wheel. 

3. The hybrids captured by the beads are washed twice with 1× SSC, 1% SDS, then twice 

with 0.1× SSC, 1% SDS. Washes are performed at 42°C for 20 min each.


4. Wash twice with 1× PCR buffer, 5% SDS, for 5 min at room temperature. 

5. Wash with 1× PCR buffer until SDS is completely removed. To do this, change the 

microtube after every wash. 

3.7.3. PCR Amplification of the Captured cDNA 

1. Transfer one fourth of the beads with the captured cDNA into a PCR tube. Make sure 

that all traces of SDS are removed. 

2. Perform PCR amplification with A5′_3 and A3′_3. Use the same protocol as described 

in Subheading 3.6. 

3.8. Blunt-End Cloning of PCR Products 

For blunt-end cloning, the 3′ overhanging extremities of the PCR product are 

removed with T4 DNA Polymerase (3′–5′ exonuclease activity). Oligonucleotides 

usually have 5′ hydroxyl ends. To allow ligation of the PCR product those extremities 

have to be phosphorylated by T4 Polynucleotide kinase (T4 PNK). 

1. At the end of the amplification reaction, add to the PCR mixture 1 µL of T4 DNA 

polymerase (4 U/µL). Incubate for 20 min at 16°C. Do not allow the temperature to 

rise above 16°C. 

2. Load the PCR product on a preparative agarose gel. 

3. Cut the desired bands and purify the DNA with the QIAEX II purification kit. Follow 

the supplier’s recommendations. 

4. Elute DNA from the silica matrix with 10 µL of ddH 2 O. 

5. Add 1.5 µL of 10× T4 PNK buffer, 1 µL of 3 mM ATP, 1.5 µL of ddH 2 O, and 1 µL of 

T4 PNK (5 U/µL). 


7. Heat inactivate the enzyme at 75°C for 20 min. 

8. The PCR product is ready for ligation. Use the same buffer as the phosphorylation reaction, 

a dephosphorylated blunt-end vector (e.g., pUC19 SmaI), and a final concentration of 

ATP of 0.8 mM. 

9. Transform by electroporation and plate on the appropriate selection medium. 

3.9. Direct PCR on Colonies (see Note 8) 

1. Pick a colony with an inoculating needle. 

2. Touch the bottom of a 0.5-mL microtube (or a well in a microtiter plate) with the needle. 

3. Inoculate with the same needle, 3 mL of liquid bacterial growth medium in a 15-mL tube, 

and incubate at 37°C for 18 h. 

4. Repeat steps 1 to 3 for all the colonies to be analyzed. 

5. Prepare the PCR mixture on ice as follows. The volumes given are sufficient for one 

reaction: 2.5 µL of 10× PCR buffer, 2 µL of 2.5 mM dNTP, 2 µL of 50 mM MgCl 2 , 2 µL 

of primer 1 (50 ng/µL), 1 µL of primer 2 (50 ng/µL), 0.1 U of Taq DNA polymerase, 

and ddH 2 O to 25 µL. 

6. Distribute the PCR mixture into every tube on ice and add 100 µL of mineral oil. 

7. Place the tubes or the microtiter plate in the thermal cycler and run the following program: 

3 min denaturation at 93°C; 35 cycles of 94°C for 30 s, 55°C for 45 s, and 72°C for 

1 min/kb. 

8. Analyze the PCR products on an agarose gel. 

9. Prepare plasmid DNA of the positive clones from the cultures (prepared in step 3). Use 

this plasmid DNA for sequencing.


4. Notes 

1. All the material used in this manipulation must be very clean and at least sterilized. Wear 

gloves throughout the manipulation to avoid RNase contamination. The same precautions 

should be followed in the synthesis of the ss-cDNA. These precautions represent the lower 

level of protection against RNase and it is advisable to read ref. 6 carefully. Because 

PCR has to be performed later on this material, use anticontamination tips and aliquot 

every solution. 

2. During this manipulation, prepare controls that will be used in the ligation and PCR 

experiments. Prepare samples without AMV RTase and samples without RNA. This will 

lead to three different controls. 

3. We have successfully used as little as 10 ng of polyA + RNA. Do not exceed 1 µg of 

total RNA. 

4. Prepare nonligated samples composed of the same mixture as described in Subheading 3.5. 

without the T4 RNA ligase. Include each control of the cDNA synthesis. 

5. After removal of the primers, perform PCR amplification. Do not forget to include a PCR 

control without DNA for both amplifications. 

6. To analyze each PCR amplification, load 5 µL of (one tenth) of the PCR product on an 

agarose gel. After ethidium bromide staining, a signal could be observed after the first 

PCR but it is generally obtained after the second nested PCR. 

7. We have used degenerated primers to screen the PCR library. The amount of primer and 

Dynabeads should be at least five times above the amount described in Subheading 3.7. 

8. We have developped a direct PCR analysis to determine the sizes of inserted fragments 

and to rule out false positive recombinant clones. 

References 

1. Boularand, S., Darmon, M. C., and Mallet, J. (1995) The human tryptophan hydroxylase 

gene: An unusual complexity in the 5′ untranslated region. J. Biol. Chem. 270, 3748–3756. 


yield from λ bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220. 

3. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., and Mattick, J. S. (1991) “Touch 

down” PCR to circumvent spurious priming during gene amplification. Nucleic Acids 

Res. 19, 4008. 

4. Abe, K. (1992) Rapid isolation of desired sequences from lone linker PCR amplified cDNA 

mixtures: Application to identification and recovery of expressed sequences in cloned 

genomic DNA. Mammalian Genome 2, 252–259. 


Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY [SSPE, p. B.13, 

SSC, p. B.13, Denhart’s solution, p. B.15, Alkaline gel electrophoresis, p. B.23]. 

6. Blumberg, D. D. (1987) Creating a ribonuclease free environment. Methods Enzymol. 

152, 20–24.

510 Ravassard et al.

Chimieric Junctions, Deletions, and Insertions 511 

69 

Creation of Chimeric Junctions, Deletions, 

and Insertions by PCR 

Genevieve Pont-Kingdon 


Recombinant polymerase chain reaction (PCR) (1) is the method of choice if one 

wants to modify a cloned DNA. It is a versatile technique that allows operations as 

different as creation of deletions, addition of small insertions, site-directed mutagenesis, 

and construction of chimeric molecules at any chosen location in the molecule of 

interest (see Note 1). This chapter describes in detail a simplification of the original 

recombinant PCR method. This fast and efficient method has been successful in fusing 

two different sequences with precision (2–4). It can also be used to create deletions 

or insert small fragments of DNA. 

The method (see Fig. 1) relies on a “chimeric primer” (C) and two outside primers 

(A and B). The final product can be obtained in one or two rounds of PCR. The figure 

illustrates the construction of a chimeric molecule in which two different templates 

are joined. The creation of a deletion, or the introduction of a small insertion within 

a given template, would follow the same pathway (see Note 1). In all cases, the new 

junction is designed in the chimeric primer; the 3′ half of the chimeric primer pairs 

with one of the templates (or one side of the deletion/insertion point), and its 5′ half has 

homology with the other template (or the other side of the deletion/insertion point). 

Both templates and the three primers (A–C) are placed in a reaction tube (step 

1) and one PCR is performed. During the first cycles, only the primers A and C can 

prime exponential amplification (step 2). This amplification reaction gives rise to an 

“intermediate fragment” (step 3), that can itself act as a primer. One of its 3′-ending 

strands anneals to the second template and is extended (step 4). This extension provides 

a template (step 5) for exponential amplification of the final product using the primers 

A and B (step 6). To limit the amplification of the intermediate fragment to the first 

cycles of PCR, the chimeric primer is used at a lower concentration than the two 

outside primers (3,4). 

2. Materials 

1. Primers (see Subheading 3.1.). 

2. DNA templates, linearized at a site outside the region to be amplified. 



511

512 Pont-Kingdon 

Fig. 1. Construction of a chimeric product. See text for explanation of steps 1–6. The dsDNA 

templates are the plain and dotted double lines. The outside primers are short, plain (A), or 

dotted (B) single lines. The drawing of the chimeric primer (half plain, half dotted) reflects 

its homologies to the templates. Half arrowheads indicate 3′ ends. Closed arrows indicate 

amplification steps (2 and 6). 

3. GeneAmp PCR Core Reagent Kit (Perkin–Elmer, Foster City, CA) containing: AmpliTaq 

DNA polymerase (5 U/µL), Gene Amp dNTPs (10 mM solutions of dATP, dGTP, dTTP, 

and dCTP), GeneAMP 10× PCR buffer II (100 mM Tris-HCl, pH 8.3; 500 mM KCl), 

and 25 mM MgCl 2 solution. 


5. Restriction endonucleases and buffers. 

6. Agarose gel electrophoresis reagents and equipment. 

7. Phenol:CHCl 3 isoamyl alcohol (25241, vvv). 

8. Ammonium acetate (7.5 M ). 



3. Methods 

3.1. Design of Chimeric Primer 

The chimeric primer is crucial because it contains the new junction and because 

sequences on each side of the junction serve as primers in different steps (i.e., 2 and 4 

in Fig. 1) of the reaction. To allow priming by the nucleotides found on each side of 

the junction, the new junction should be placed in the middle of an oligonucleotide 

of sufficient length. Otherwise, the design of a chimeric primer should follow the 

classical rules of primer-design (5). Our chimeric primer was a 34-mer, with 17 bases 

homologous to one template and 17 bases homologous to the other. Some slightly 

longer chimeric primers (36- and 40-mer) have been used (3,4). See Note 2 for more 

information on the design of the chimeric primer.


3.2. Design of Outside Primers 

Fewer constraints apply to the design of the two outside primers, and therefore 

following the general rules of primer design should be adequate. In principle, the 

outside primers can be kilobase pairs away (within the limit of PCR feasibility) from 

the new junction. However, because their location determines the size of the product 

that will be cloned, the choice of their position is important. For several reasons, it 

is advantageous to plan the cloning of a fragment of few hundred nucleotides instead 

of a longer one: First, the smaller the fragment is, the less chance there is to find 

PCR-induced mutations in the final clone. Second, a smaller piece of DNA has to be 

sequenced to verify the integrity of the newly cloned DNA. This can be achieved by 

using primers that anneal close to the junction and have “built in” restriction sites 

at their 5′ ends. Another approach is to choose primers that anneal further from the 

junction and clone with restriction sites that closely surround the chimeric junction in 

the final product. The choice between these two possibilities depends on the cloning 

strategy and the availability of cloning sites in the amplification product. If the chimeric 

fragment has to be cloned into a new vector, restriction sites unique in both vector and 

chimeric fragment can be engineered at the 5′ ends of the two outside primers. If the 

chimeric junction has to be replaced by cloning in one of the original templates, restriction 

sites that exist in this template and in the chimeric junction have to be used. 

The size of the outside primers can be different than the size of the chimeric primer. 

We have been successful with a 34-mer chimeric primer, and two outside primers of 23 

and 20 nucleotides, respectively. If the size of the two outside primers is very different 

than half the size of the chimeric primer, series of cycles with different annealing 

temperatures can be performed (see Note 3). 

3.3. Procedure 

1. Assemble the components in one 50-µL reaction containing: both templates (10 fmol 

each), both outside primers (25 pmol each), chimeric primer (1 pmol), 50 µM each dNTP 

(see Note 4), 1× AmpliTaq DNA polymerase buffer, 1.5 mM MgCl 2 (see Note 5), and 2.5 

U of AmpliTaq DNA polymerase. 

2. Top PCR mix with 50 µL of mineral oil. 

3. Perform PCR as follows (see Note 3): 

a. Three to five initial cycles to allow initiation and amplification (steps 2–4 in Fig. 1) 

using the chimeric primer: 95°C for 30 s, T1 (see Note 3) for 30 s, and 72°C for 1 min 

for each kilobase of intermediate fragment. 

b. Twenty to thirty cycles to amplify the final chimeric product: 95°C for 30 s, T2 (see 

Note 3) for 30 s and 72°C for 1 min for each kilobase of chimeric product. 

4. Directly analyze 10 µL of the amplified DNA by standard procedures (restriction enzyme 

digests and electrophoresis, see Note 6). 

5. To clone the new junction, clean the PCR product by extraction with an equal volume of 

phenolchloroformisoamyl alcohol (25241). 

6. Transfer the aqueous phase to a sterile microcentrifuge tube. Remove the excess dNTP (it 

can inhibit T4 ligase) by ethanol precipitation. Add 1/2 vol of 7.5 M ammonium acetate 

and 2.5 vol of 100% ethanol. 

7. Mix well and incubate at room temperature for 10 min. 

8. Spin in a microfuge at maximum speed for 5 min.

514 Pont-Kingdon 

9. Invert tube and allow to drain. 

10. Wash pellet with 70% ethanol. 

11. Resuspend the DNA in 20–50 µL of TE. Quantify the DNA by UV spectrophotometry 

and use for cloning. 

4. Notes 

1. The applications of this method are diverse; it allows the creation of: 

a. Chimeric molecules: This method is well suited to cases in which the two molecules 

to be joined are unrelated. In the case where the two templates are fused in a region of 

homology, another PCR technique (6) might be preferred. 

b. Deletions: A set of different deletions can be easily obtained from the same template by 

using a set of different chimeric primers and only one set of outside primers. 

c. Insertions: The size of potential insertion using this technique is limited to the size of 

the chimeric primer. A restriction site sequence, sandwiched into a chimeric primer, 

could be introduced at will into any DNA. 

2. As in the Megaprimer method (7), the technique described here uses a PCR product as 

a primer. It has been mentioned for the Megaprimer method (8) that mutations can be 

found in the final product because of the tendency of Taq polymerase to add nontemplated 

nucleotides at the 3′ end of newly synthesized DNA strands. The frequency of these 

mutations should be low since 3′-ending DNA strands carrying nontemplated nucleotides 

should not prime well for the synthesis of the final product. Although we did not observe 

such mutations in the two final clones that we obtained and sequenced, this phenomenon 

could apply here, and we encourage the reader to refer to Note 1 in ref. 8 for a complete 

discussion. 

3. In this technique, each half of the chimeric primer must anneal with its target. We have 

limited the size of our chimeric primer to 34 nucleotides, giving us 17 nucleotides for 

each half. Because our outside primers are 20 and 23 nucleotides in length, we felt that it 

was necessary to plan a first set of cycles with a lower annealing temperature to allow the 

stable annealing of each half of the chimeric primer in the steps 2 and 4. This precaution is 

not necessary if all the sequences with a “priming” role (each half of the chimeric primer 

and both outside primers) are close in length and in G+C content. 

The temperature T1 is the approximate “annealing temperature” ([number of G + C × 

4°C] + [number of A + T × 2°C] – 10°C) of the less stable half of the chimeric primer. 

The temperature T2 is the approximate annealing temperature of the less stable of the 

two outside primers. 

4. To limit the number of PCR-induced mutations in the final chimeric product, a low 

concentration of each dNTP (50 µM) is used. 

5. The optimal MgCl 2 concentration can vary among different pairs of primers. It is wise to 

define the best MgCl 2 concentration in a test experiment (9). In fact, it is possible that the 

two consecutive PCRs that occur in the tube have incompatible requirements for MgCl 2 . 

If this is the case, the chimeric product can be obtained by a two-step method (2). In this 

alternative, the intermediate fragment obtained during the first reaction is extracted with 

phenol:chloroform:isoamyl alcohol and purified from excess primers by precipitation with 

isopropanol from 2 M NH 4 OAc. The purified DNA is then used as a primer in a second 

reaction that contains the second template and the two outside primers. 

6. It is often stated that the oil that tops the PCR has to be removed to properly load the 

DNA into the well of an electrophoresis gel. We found that this step is not needed if the 

pipet tip is cleaned with tissue paper (Kimwipe) just after it has been filled with a DNA 

sample. In fact we found that the oil left in the tube allows for longer conservation of 

the sample at 4°C.


Acknowledgment 

I want to thank Janet E. Lindsley and Dana Carroll for helpful comments. 

References 

1. Higuchi, R. (1989) Using PCR to engineer DNA, in PCR Technology: Principles and 

Applications for DNA Amplification, Stockton, New York, pp. 61–70. 

2. Pont-Kingdon, G. (1994) Construction of chimeric molecules by a two-step recombinant 

PCR method. BioTechniques 16, 1010–1011. 

3. Cao, Y. (1990) Direct cloning of a chimeric gene fused by the polymerase chain reaction. 

Technique 2, 109–111. 

4. Yon, J. and Fried, M. (1989) Precise gene fusion by PCR. Nucleic Acids Res. 17, 4895. 

5. Sharrocks, A. D. (1994) The design of primers for PCR, in PCR Technology: Current 

Innovations (Griffin, G. G. and Griffin, A. M., eds.), CRC, Boca Raton, FL, pp. 5–11. 

6. Klug, J., Wolf, M., and Beato, M. (1991) Creating chimeric molecules by PCR directed 

homologous DNA recombination. Nucleic Acids Res. 19, 2793. 

7. Sarkar, G. and Sommer, S. S. (1990) The “megaprimer” method of site-directed mutagenesis. 

Biotechniques 8, 404– 407. 

8. Barik, S. (1993) Site-directed mutagenesis by double polymerase chain reaction, in Methods 

in Molecular Biology, vol. 15: PCR Protocols: Current Methods and Applications (White, 

B. A., ed.), Humana, Totowa, NJ, pp. 277–286. 

9. Saiki, R. K. (1989) The design and optimization of the PCR, in PCR Technology: Principles 

and Applications for DNA Amplification (Erlich, H. A., ed.), Stockton, New York, 

pp. 7–16.

516 Pont-Kingdon

Recombinant PCR 517 

70 

Recombination and Site-Directed Mutagenesis 

Using Recombination PCR 

Douglas H. Jones and Stanley C. Winistorfer 


The polymerase chain reaction (PCR) (1) provides a rapid means for the recombination 

and site-directed mutagenesis of DNA (2). DNA modification can occur during 

PCR because the primers are incorporated into the ends of the PCR product. The 

simplest PCR-based method for site-directed mutagenesis and DNA recombination 

is recombination PCR. 

Recombination PCR uses in vivo recombination in Escherichia coli to generate sitedirected 

mutants and recombinant constructs (3,4). In the recombination PCR method, 

PCR adds homologous ends to DNA. These homologous ends mediate recombination 

between these linear PCR products in E. coli, resulting in the formation of DNA joints 

in vivo. If two PCR products have homologous ends that can recombine to form a circle, 

and if this circle constitutes a selectable plasmid, E. coli can be readily transformed 

by the linear PCR products. Recombination PCR has almost no steps apart from PCR 

amplification and transformation of E. coli, and this method works well in Rec A minus 

E. coli strains used routinely in cloning. Since the introduction of this method in 1991, 

it has been used by numerous investigators (5–9). One example of DNA recombination 

using recombination PCR is illustrated in Fig. 1, which shows a protocol for amplifying 

a portion of a donor plasmid and inserting it in a recipient plasmid at a defined position 

and orientation. The donor plasmid is shown on the left side and the recipient plasmid is 

on the right side. The steps corresponding to this figure are briefly outlined below: 

1. The DNA segment that is to be inserted into the recipient plasmid is amplified from 

the donor plasmid using primers 1 and 2. In a separate PCR amplification, the recipient 

plasmid is amplified with primers 3 and 4. The 5′ regions of primers 1 and 2 that do not 

anneal to the donor plasmid are complementary to primers 4 and 3, respectively (or 3 

and 4, depending on the orientation of the insert desired in the recombinant construct). 

Frequently, a plasmid template can be linearized outside the region to be amplified by 

restriction endonuclease digestion before PCR amplification. When this can be done, 

the PCR product does not need to be purified, because linearized plasmids transform E. coli 

inefficiently. If a plasmid template cannot be linearized by restriction endonuclease digestion 

outside the region to be amplified prior to PCR amplification, the PCR product must 



517

518 Jones and Winistorfer 

Fig. 1. Diagram illustrating DNA recombination using recombination PCR. The primers are 

numbered hemiarrows. The insert is the cross-hatched region. Smooth circles represent the DNA 

strands of the donor plasmid. Circles with wavy and jagged portions represent DNA strands of 

the recipient plasmid. Reprinted by permission from Biotechniques 10, 62–66. 

be removed from the plasmid before transformation to prevent background transformants 

arising from the supercoiled plasmid template. PCR product purification is accomplished 

either by agarose gel purification followed by glass bead extraction or by adding the 

restriction endonuclease DpnI to the PCR mixture. DpnI is a restriction endonuclease that 

digests methylated GATC sites. These sites are methylated in the plasmid by strains of 

E. coli used routinely in cloning (by dam methylase), but are not methylated in the PCR 

products, permitting DpnI to digest the plasmid without cutting the PCR product (10). 

2. The two PCR products are combined and used to transform MAX efficiency competent 

E. coli (BRL, Life Technologies, Gaithersburg, MD). If each plasmid template is restriction 

endonuclease digested outside the region to be amplified prior to PCR amplification, 

the two crude PCR products can simply be combined, and the resulting mixture used 

to transform E. coli. 

In a simple variation of this recombination PCR strategy, the inserted segment can be an 

unmodified PCR product. In that case, primers 3 and 4 have 5′ ends that are homologous 

to the ends of the PCR fragment to be inserted, and the recipient plasmid is linearized 

by restriction endonuclease digestion prior to PCR amplification. We routinely use this 

approach to clone any PCR product (4).


In recombination PCR, the sum goal of the two amplifications is to yield two PCR 

products where each end of one product is homologous to a distinct end of the other 

PCR product. Because the amplifying primer sequences are incorporated into the ends of 

a PCR product, so long as primers 1 and 2 contain regions that are complementary to 

regions of primers 3 and 4 (or 4 and 3), the PCR products will contain ends that are 

homologous to each other, and these primer-determined DNA ends do not need to be 

determined by the original donor or recipient templates. The only requirement of this 

recombination PCR strategy is that primers 1 and 2 must have regions of complementarity 

to primers 3 and 4. Therefore, recombination PCR can be used not only to generate 

recombinant constructs, such as gene chimeras, but also for the site-directed mutagenesis 

of two distal sites concurrently (Fig. 2) or for the rapid site-directed mutagenesis of single 

sites (Fig. 3) (11). In the point mutagenesis protocol illustrated in Fig. 3, the plasmid is 

linearized by restriction endonuclease digestion before each PCR amplification. In each 

of the two amplifications, the mutating primers (primers 1 and 3) mutate the identical 

base pair so that the mutated ends of each product are homologous to each other and 

the nonmutating primers (primers 2 and 4) are also designed to produce ends that are 

homologous to each other. Both unpurified PCR products are combined to transform 

E. coli, generating clones with the mutation of interest. 

2. Materials 

1. Taq DNA polymerase (AmpliTaq 5 U/mL; Perkin–Elmer, Norwalk CT) (see Note1). 

2. 10× PCR buffer II: 500 mM KCl, 100 mM Tris-HCl, pH 8.3. 

3. MgCl 2 solution (25 mM). 

4. Stocks (10 mM ) of each dATP, dCTP, dTTP, and dGTP, neutralized to pH 7.0 with NaOH. 

5. Restriction endonucleases (New England BioLabs, Beverly, MA). 

6. PCR primers. In Fig. 1, PCR amplification with primers 1 and 2 results in a product with 

24 to 30 bp of homology with the products of primers 3 and 4. For PCR primers that 

introduce mutations, see Note 2. 

7. Agarose. 

8. Ethidium bromide. 

9. TAE buffer: 40 mM Tris-acetate, 2 mM EDTA, pH 8.5 (12). 

10. Geneclean (Bio 101, La Jolla, CA). 

11. TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 

12. MAX Efficiency DH5α Competent E. coli (BRL, Life Technologies). Once a tube is 

thawed it should not be reused (see Note 3). 

13. SOC Media (13). 

14. LB plates with 100 µg/mL ampicillin (14). 

15. Luria-Bertani medium (LB broth) (15). 

3. Methods 

1. Linearize the plasmid template by restriction endonuclease digestion outside the region to 

be amplified, if possible. The plasmid digest does not need to be purified prior to its use 

as a PCR template (see Notes 4 and 5). 

2. Assemble a PCR in a total volume of 50 µL containing the following: 2 ng of plasmid 

template, 25 pmol of each primer, 200 µM each dNTP, 1X PCR buffer, 2.5 mM MgCl 2 , 

and 1.25 U DNA Taq DNA polymerase. (see Note 6). 

3. Perform PCR amplification using the following parameters (see Note 6): 94°C for 1 min 

(initial denaturation), 94°C for 30 s (denaturation), 50°C for 30 s (anneal), 72°C for 

1 min/kb of PCR product (extension), 14–20 amplification cycles, and 72°C for 7 min 

(final extension step).


Fig. 2. Diagram illustrating site-directed mutagenesis of two distal sites using recombination 

PCR. The primers are numbered hemiarrows. Asterisks designate the mutagenesis sites. There 

is no purification of the PCR products. Notches designate point mismatches in the primers and 

resulting mutations in the PCR products. Reprinted by permission from Technique 2, 273–278. 

4. Visualize the PCR product on an agarose minigel. If 5 µL of the PCR product can be clearly 

seen following ethidium bromide staining (>15 ng/5 µL), there is enough product. 

5. Withdraw 2.5 µL from each PCR tube (typically 10–60 ng/2.5 µL) and then combine the 

two samples. If the PCR template is linearized by restriction endonuclease digestion outside 

the region to be amplified, no purification of PCR products is necessary (see Note 5). 

6. Transform MAX efficiency competent E. coli (BRL) with the 5-µL sample containing the two 

PCR products. Maintaining an even molar ratio of one product to another is not necessary. 

Transformation is carried out following the manufacturer’s instructions with the following 

modifications:


Fig. 3. Diagram illustrating site-directed mutagenesis of a single site using recombination 

PCR with 4 primers. The primers are numbered hemiarrows. The asterisk designates the 

mutagenesis site. Primer 2 is complementary to primer 4. Restriction endonuclease sites A and 

B bracket the insert. Notches designate point mismatches in the primers and resulting mutations 

in the PCR products. There is no purification of the PCR products. For each additional single 

site-directed mutagenesis reaction, only a new primer 1 and 3 need to be synthesized, and the 

same cut templates can be used. Reprinted by permission from Technique 2, 273–278. 

a. Use 50 µL of E. coli for each sample transformed, because this is effective and less 

expensive than the 100 µL recommended. 

b. After incubation at 37°C in a shaker for 1 h, plate the entire sample onto an LB plate 

containing 100 µg/mL ampicillin. 

c. Once an aliquot of bacteria is thawed, do not use it again. 

Then, set up the following transformations: Plate A: 2.5 µL of PCR 1 + 2.5 µL of PCR 2; 

Plate B: 2.5 µL of PCR 1 + 2.5 µL of TE; Plate C: 2.5 µL of PCR 2 + 2.5 µL of TE; Plate 

D: 0.5 ng of a supercoiled template in 5 µL of TE; and Plate E: 5 µL of TE.


The yield of colonies from plate A is >2 times that from plate B + C, confirming a high 

percentage of recombinants in plate A. Plate D is a transformation control, and should 

yield a thick lawn of colonies. Plate E is an antibiotic control, and should yield no colonies 

since the bacteria that have not been transformed are sensitive to ampicillin. Only 25 µL 

of cells are used for the control plates D and plate E, so that only one BRL tube, which 

contains 200 µL of bacteria, needs to be used. 

7. Screen plasmids by placing individual colonies in 2 mL of LB broth containing 100 µg/mL 

of ampicillin. Grow the colonies at 37°C for 6–24 h. 

8. Screen the plasmids by removing 2 µL of the LB broth, place it directly in a PCR tube, 

and amplify for 25 cycles (see steps 2–4) using primers that flank the mutated site or 

insert (e.g., M13 primers) (16). 

9. In a mutagenesis protocol, a base pair can be mutated to either create or remove a restriction 

endonuclease site. In particular, the degenerate amino acid code allows one to create 

or eliminate a restriction endonuclease recognition site without altering the amino acid 

encoded at that site. Screen for the mutation by adding 3 U of the restriction endonuclease 

and 1 µL of the appropriate 10× restriction buffer directly to 5 µL of the unpurified PCR 

product in a total volume of 10 µL. 

10. Assess cutting by minigel analysis. Typically, 50 to 100% of the clones contain the 

recombinant of interest. Then, purify the plasmid and sequence the mutated region (see 

Note 7). 

4. Notes 

1. Other investigators have used Pfu DNA polymerase instead of Taq DNA polymerase 

in recombination PCR (6). Pfu DNA polymerase has better fidelity than Taq DNA 

polymerase (17). 

2. The primers that introduce point mutations (primers 1–4 in Fig. 2 and primers 1 and 3 in 

Fig. 3) are designed to generate 15to 45 bp of homology between each end of one PCR 

product relative to the other PCR product. In all recombination PCR protocols, 24 bp of 

homology works very well, and alterations that generate long regions of homology do 

not work noticeably better. Decreasing the length of homology from 25 to 12 bp in an 

early protocol did decrease the transformation efficiency four- to five-fold. Single point 

mismatches lie no closer than six nucleotides from the 3′ end of a primer and are frequently 

placed toward the middle. Placing point mutations near the 5′ end of each mutating primer 

will generate two PCR products whose mutated ends have >24-bp of homology. Multiple 

point mismatches should be placed in the middle or toward the 5′ end of a primer, with 

primer lengths long enough to create 24-bp of homology between the mutated ends of the 

two PCR products. Primers that are nonmutating are generally 24 to 30 nucleotides long. 

These nonmutating primers can be designed to anneal to the β-lactamase gene so that they 

can be used with a variety of different plasmids. Frequently, the mutating and nonmutating 

primers are designed to be perfect complements to each other. 

For site-directed mutagenesis, since unique restriction endonuclease recognition sites 

almost always bracket the insert, the same linearized templates can be used for the 

mutagenesis of any single site in the insert. Primers 2 and 4 are nonmutating (see Fig. 3), 

and are conserved for each new site targeted for mutagenesis, so that only two new 

primers need to be generated for each site targeted for mutagenesis (via primers 1 and 3). 

Furthermore, only approx one half of the length of the entire template needs to be amplified 

in each of the two PCR amplifications, facilitating the mutagenesis of large constructs and 

permitting considerable flexibility in the primer design and sequence. Recombination PCR 

has been used to mutate constructs up to 7.1 kb (18).


3. Because the transformation efficiency is low, highly competent bacteria (transfection 

efficiency >1 × 10 9 /µg of monomer pUC19) should be used. Using restriction endonuclease 

digested templates, the transformation efficiency is about 10 colonies with the mutation/ng 

total DNA used to transform E. coli. 

4. After 14 amplification cycles, the PCR product yield is much higher when using a linear 

template than when using a supercoiled template. 

5. If a plasmid template cannot be linearized outside the region to be amplified before PCR 

amplification, the PCR product must be removed from the supercoiled plasmid template. 

This can be accomplished either by agarose gel electrophoresis and extraction using 

GeneClean or by digestion with the restriction endonuclease DpnI. When agarose gel 

resolution and GeneClean extraction are used, the entire PCR product should be gel 

purified and reconstituted in 25 to 30 µL of TE, and 2.5 µL is combined with the 

2.5 µL of the other PCR product before transformation. If DpnI is used, add 20 U of DpnI 

directly to 25 µL of the PCR sample using the recommended 10× DpnI buffer in a final 

total volume of 30 µL, and incubate the mixture at 37°C for 1 h. No further purification 

of the PCR product is necessary. 

6. The exact buffer components and conditions for PCR vary with different primers and 

template. 

7. There is always the possibility of a sequence error in a single clone after PCR amplification. 

The altered region should be sequenced, and one may choose to clone a restriction fragment 

containing the mutated or recombined region of interest into a construct that has not 

undergone PCR amplification. 


This work was supported by the Roy J. Carver Charitable Trust, the University of 

Iowa through funds generated by the Childrens Miracle Network Telethon, and by 

National Institutes of Health grant R01 HG00569. We thank Jim Hartley for suggesting 

use of the restriction endonuclease DpnI to remove supercoiled template from the 

PCR mixture. 

References 

1. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986) Specific 

enzymatic amplification of DNA in vitro: the polymerase chain reaction, in Cold Spring 

Harbor Symposia on Quantitative Biology, vol. LI, Cold Spring Harbor Laboratory, Cold 

Spring Harbor, NY, pp. 263–273. 

2. White, B. (1993) Methods in Molecular Biology, vol. 15, PCR Protocols: Current Methods 

and Applications, Humana, Totowa, NJ. 

3. Jones, D. H. and Howard, B. H. (1991) A rapid method for recombination and site-specific 

mutagenesis by placing homologous ends on DNA using polymerase chain reaction. 

Biotechniques 10, 62–66. 

4. Jones, D. H. (1994) PCR mutagenesis and recombination in vivo. PCR Methods Appl. 

3, S141–S148. 

5. Coco, W. M., Rothmel, R. K., Henikoff, S., and Chakrabarty, A. M. (1993) Nucleotide 

sequence and initial functional characterization of the clcR gene encoding a LysR family 

activator of the clcABD chlorocatechol operon in Pseudomonas putida. J. Bacteriol. 175, 

417– 427. 

6. Fridovich-Keil, J. L. and Jinks-Robertson, S. (1993) A yeast expression system for human 

galactose-1-phosphate uridylyltransferase. Proc. Natl. Acad. Sci. USA 90, 398– 402.


7. Goulden, M. G., Kohm, B. A., Santa Cruz, S., Kavanagh, T. A., and Baulcombe, D. C. 

(1993) A feature of the coat protein of potato virus X affects both induced virus resistance 

in potato and viral fitness. Virology 197, 293–302. 

8. Gibbs, J. S., Regier, D. A., and Desrosiers, R. C. (1994) Construction and in vitro properties 

of HIV-1 mutants with deletions in “nonessential” genes. AIDS Res. Hum. Retrovir. 10, 

343–350. 

9. Singh, K. K., Small, G. M., and Lewin, A. S. (1992) Alternative topogenic signals in peroxisomal 

citrate synthase of Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 5593–5599. 

10. Weiner, M. P., Costa, G. L., Schoettlin, W., Cline, J., Mathur, E., and Bauer, J. C. (1994) 

Site-directed mutagenesis of double-stranded DNA by the polymerase chain reaction. 

Gene 151, 119–123. 

11. Jones, D. H. and Winistorfer, S. C. (1992) Recombinant circle PCR and recombination 

PCR for site-specific mutagenesis without PCR product purification. Biotechniques 12, 

528–534. 


Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. B23. 


Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. A2. 





16. Liang, W. and Johnson, J. P. (1988) Rapid plasmid insert amplification with polymerase 

chain reaction. Nucleic Acids Res. 16, 3579. 

17. Lundberg, K. S., Shoemaker, D. D., Adams, M. W. W., Short, J. M., Sorge, J. A., and 

Mathur, E. J. (1991) High-fidelity amplification using a thermostable DNA polymerase 

isolated from Pyrococcus furiosus. Gene 108, 1–6. 

18. Yao, Z., Jones, D. H., and Grose, C. (1992) Site-directed mutagenesis of herpesvirus 

glycoprotein phosphorylation sites by recombination polymerase chain reaction. PCR 

Methods Appl. 1, 205–207.

Mutagenesis by Megaprimer PCR 525 

71 

Megaprimer PCR 

Application in Mutagenesis and Gene Fusion 

Emily Burke and Sailen Barik 


Since the advent of the polymerase chain reaction (PCR), a variety of PCR-based 

procedures of mutagenesis have been developed through the use of synthetic primers 

encoding the mutation. Among these, the megaprimer method and related ones (1–5) 

remain some of the simplest and most versatile. Variations and improvements of 

the basic technique have been suggested over the past few years; these include a 

combination of magapriming and overlap extension, improvement of yield, use of 

single-stranded DNA, avoidance of unwanted mutations arising from nontemplated 

insertions by Taq polymerase, and the inclusion of various kinds of mutations, 

including multiple, nonadjacent ones (2–11). The basic method (Fig. 1) requires three 

oligonucleotide primers and two PCRs (termed PCR-1 and -2 here) using the wild-type 

DNA as template (1,2,8,10). The “mutant” primer is represented by M and the two 

“outside” primers by A and B. The M primer may encode a substitution, a deletion, an 

insertion, or a combination of these mutations, thus providing versatility while using 

the same basic strategy (10). The first PCR (PCR-1) is performed using the mutant 

primer M and one of the outside primers, such as A (Fig. 1). The double-stranded 

product A-M is purified and used as a primer (hence the name megaprimer; ref. 1) 

in the second PCR (PCR-2) together with the other outside primer, B. Although both 

strands of the megaprimer may prime on the respective complementary strands of the 

template, the fundamental principles of PCR amplification ensure that only the one that 

extends to the other primer, that is, B in Fig. 1, will be exponentially amplified into 

the double stranded product in PCR-2. As mentioned, the wild-type DNA is used as 

template in both PCRs. This article describes the most optimized megaprimer method 

in our experience and has drawn freely on the improvements described by various 

authors (3–28). 

1.1. Improving the Yield of PCR-2 

Poor yields from PCR-2 have sometimes been reported even when proper primer 

design (see above) was followed, especially when the megaprimer is large (0.8 kb 

and above). Although the exact reasons remain unclear, the most likely reasons are 



525

526 Burke and Barik 

Fig. 1. The basic megaprimer method. Primers A, B, M, and the priming strand of the 

megaprimer AM are indicated by thinner lines with arrowhead, while the thicker double lines 

represent the wild type template (usually part of a plasmid clone, not shown). Primers A and B 

contain restriction sites (e.g., NdeI and BamHI) indicated as thicker regions, and extra “clamp” 

sequence at the 5′ end indicated by double lines. The sequence to be inserted is shown as the 

dotted region in primer M and the subsequent PCR products. The final product containing the 

insertion is restricted and cloned. 

the unique features of the megaprimer, viz., its double-stranded nature and large size. 

Strand separation of the double-stranded megaprimer is essentially achieved in the 

denaturation steps of the PCR cycle. Under some conditions, however, self-annealing 

of the megaprimer apparently tends to reduce the yield of the product (4). 

Various solutions to this problem have been suggested. In one approach, a biotin tag 

is added to the 5′ end of primer A, which would generate a biotin-labeled megaprimer 

in PCR-1. After denaturation, the biotinylated strand of the megaprimer is purified on 

avidin attached to magnetic beads (26). In another method (27), the use of two 

parallel templates allowed the inclusion of two outside primers as well as the 

megaprimer in PCR-2, resulting in a direct amplification of the final product. Use of a 

“one-tube” method (described above), when properly optimized, should eliminate loss 

of megaprimer during the purification step. Other strategies for increasing the yield 

of PCR-2 involve optimizing the concentrations of both template and megaprimer. In


some instances, the use of higher amounts of template (in the microgram range, as 

opposed to nanogram quantities used in standard PCR) in PCR-2 has been shown 

to dramatically increase the product yield (4). Unfortunately, higher concentrations 

of template also tend to increase mispriming by a megaprimer with a mismatched 

3′ end (our unpublished results). Thus, a more effective strategy may be to increase the 

amount of the megaprimer. A method that we have found useful is to perform the first 

several cycles of PCR-2 with the megaprimer only. After this initial asymmetric PCR, 

the small primer is added (11). In an optimization of this strategy (28), the starting 

concentration of megaprimer is increased to 6 µg (from 25 ng) per 100 µL of PCR-2. 

We have adopted a combination of the last two approaches in this article. 

2. Materials 

2.1. Template 

About 100 ng of DNA template to be mutated (e.g., a gene cloned in a plasmid). 

2.2. Primers 

100 pg of oligonucleotide primers A and B, and 50 ng of mutant primer M; one 

primer, say A, in the opposite sense, and other primer, B, in the same sense as the 

mutant primer M (Fig. 1). Include restriction sites, preferably unique, in these primers 

so that the final product can be efficiently digested with restriction enzymes and 

cloned. The mutant primer may be designed to contain a point mutation, or insertion, 

or deletion, as desired (see Notes 1 and 2). 

2.3. PCR Buffer 

10× PCR buffer for Pfu polymerase (Stratagene Cloning Systems, La Jolla, CA) 

is: 200 mM Tris-HCl (pH 8.0–8.3); 100 mM KCl; 20 mM MgCl 2 ; 60 mM ammonium 

sulfate; 1% Triton X-100 100 µg/mL nuclease-free BSA; the buffer is usually supplied 

with the enzyme by most manufacturers. 

2.4. Deoxyribonucleotides 

The final dNTP concentration is generally 200 µM for each nucleotide. Make a stock 

dNTP mix containing 2 mM of each dNTP (dATP, dCTP, dGTP, dTTP); we make it by 

adding 50 µL of 10 mM stock solutions of each nucleotide, available commercially, 

into 50 µL H 2 O, to produce 250 µL of the mix. 

2.5. Analysis and Purification of DNA 

A system for purifying the PCR products, such as gel electrophoresis, followed by 

recovery of the appropriate DNA band in the excised agarose fragment (8). 

Wherever needed in this procedure, use deionized (e.g., Millipore) autoclaved 

water. 

3. Method 

3.1. PCR-1: Synthesis of the Megaprimer 

1. It is assumed that the reader is familiar with standard PCR protocols. Use the following 

recipe for the first PCR. Make the following 100-µL reaction mix in an appropriate 

microcentrifuge tube (0.5 or 1.7 mL, dictated by the heating block of your thermal 

cycler): H 2 O (75 µL); 10× PCR buffer (10 µL); 2 mM each of dNTP mix (10 UL; the final


concentration of each nucleotide is 200 µM ); Primer A (50 pmol); Primer M (50 pmol) 

(Note 3); DNA template (10–100 ng); and 2.5 U Pfu polymerase (0.5 µL);or 2.5 U Taq 

plus 0.1 U Pfu polymerase) for a total of 100 µL. 

2. Vortex well to mix, then spin briefly in a microfuge. If the thermal cycler has a heated lid, 

then proceed to do PCR; otherwise, reopen the tube, overlay the reaction mixture with 

enough mineral oil to cover the reaction (~100 µL for a 0.5-mL microfuge tube), then 

close cap. The tube is now ready for thermal cycling. 

3. Perform PCR-1 using the following cycle profiles. Initial denaturation: 94°C, 3 min; 

30 to 35 main cycles: 94°C, 1 min (denaturation): T° (depending on the T m of the primers), 

2 min (annealing); 72°C, appropriate time, depending on product length (extension); and 

final extension 72°C, 1.5 × N min. 

After synthesis, the samples are maintained at 4°C (called “soak” file in older Perkin– 

Elmer programs) for a specified time. Some instruments lack an active cooling mechanism 

and keep samples at an ambient temperature of about 20°C by circulating tap water around 

the heat block, which appears to be adequate for overnight runs; others just shut off at 

the end of the final extension. 

4. After PCR, proceed directly to the next step if there is no oil overlay. Otherwise, first 

remove the oil as follows. (If oil is not removed completely, the sample will float up when 

loaded in horizontal agarose gels!). Add 200 µL of chloroform to each tube. The mineral 

oil and chloroform will mix to form a single phase and sink to the bottom of the tube. 

Spin for 30 s in a microfuge. Carefully collect ~80 µL of top aqueous layer and transfer 

to a fresh Eppendorf tube. 

5. Purify the megaprimer using any standard procedures such as gel purification (see 

Chapter 18) and use it in PCR-2 below. 

3.2. PCR-2: Synthesis of the Mutant Using the Megaprimer 

1. Reconstitute 100-µL PCR as follows: 10× PCR buffer (10 µL); 2 mM each of dNTP mix 

(10 µL; final concentration of each nucleotide is 200 µM ); All of the recovered megaprimer 

(A-M) from the previous step (20–50 µL); DNA template (0.2 µg); Make up volume to 

100 µL with H 2 O; and mix well. 

2. Start reaction essentially as described for PCR-1, except that a “hot-start” is preferred (see 

Note 4) and is performed as follows. When the reaction is in the annealing step of the first 

cycle, open the cap briefly, quickly add 0.5 µL of Pfu polymerase (2.5 U, or 2.5 U Taq plus 

0.1 U Pfu polymerase), and mix by pipetting. Close the cap and let PCR continue. 

3. After five cycles, when the reaction is again at an annealing step, promptly add 50 pmol 

of primer B, mix well, and let PCR continue another 30 cycles. (The small amounts of 

primer B and Pfu polymerase do not contribute significantly to the total reaction volume 

and, therefore, have been ignored in the volume calculations). 

4. Do another PCR in parallel, using primers A and B (but no megaprimer) and the same 

wild-type template; use an aliquot (5 µL) of this PCR as a size marker when analyzing 

PCR-2 by gel electrophoresis. This will also help in identifying the real product (in PCR-2) 

among the wrong ones that sometimes result from mispriming. 

5. Gel purify the final mutant PCR product essentially as described earlier for the purification 

of the megaprimer (see Notes 5 and 6). 

4. Notes 

1. Design of the mutant primer. Perhaps the most unique feature of the megaprimer method 

is that the product of one PCR becomes a primer in the next, which creates the following 

potential problem. Taq polymerase, as a result of its lack of proofreading activity, tends


to extend the product DNA beyond the template by adding one or two non-templated 

residues, predominantly As (12). When the product is used as a primer in the next 

round of PCR (PCR-2), these nontemplated A residues may not match with the template 

and, therefore, will either abrogate amplification (13–15) or produce an undesired 

A-substitution. A variety of solutions to this problem have been recommended (5,8,10,16). 

The first is to design the mutant primer such that there is at least one T residue beyond 

the 5′ end of the primer sequence in the template. Thus, when the complementary strand 

incorporates a non-templated A at the 3′ end, it will still be complementary to the other 

strand. If the template sequence does not permit this, a second solution is to use a mixture 

of Taq and Pfu DNA polymerases in 20:1 ratio in PCR-2 (3) or to use Pfu exclusively. This 

is what we have recommended in this chapter. The 3′ exonuclease activity of Pfu should 

remove any mismatch at the 3′ end of the megaprimer; however, this proofreading ability 

also necessitates the addition of at least 10 perfectly matched bases on both the 5′ and 3′ 

ends of the mutagenic primer (8,10,13,17). Finally, one can use enzymes, such as mung 

bean nuclease, that will remove nontemplated nucleotides from the megaprimer (16). 

In addition to these unique considerations, the general rules of primer design described 

below, should be followed. 

2. Length of the megaprimer. Try to avoid making megaprimers (A-M) that approach the size 

of the final, full-length product (gene) A-B (see Fig. 1). Briefly, if M is too close to B, it 

will make separation of AB and AM (unincorporated, left-over megaprimer) difficult after 

PCR-2. When the mutation is to be created near B, one should make an M primer of the 

opposite polarity, and synthesize BM megaprimer (rather than AM), and then do PCR-2 

with BM megaprimer and A primer. When the mutation is at or very near the 5′ or 3′ end of 

the gene (within 1–50 nucleotides), there is no need to use the megaprimer method; one can 

simply incorporate the mutation in either A or B primer and do a straightforward PCR using 

A and B primers! For borderline situations, such as when the mutation is, for example, 

120 nucleotides away from the 5′ end of the gene, incorporation of the mutation in primer 

A may make the primer too big to synthesize; or else, it will make the megaprimer AM 

too short to purify away from primer B. In such a case, simply back up primer A to a few 

hundred bases further upstream to make the AM megaprimer longer. In general, realize 

that primers A and B can be located virtually anywhere on either side of the mutant 

primer M, and therefore, try to utilize this flexibility as an advantage when designing 

these primers. 

3. Molar amount of megaprimer. Because the megaprimer is large, one needs to use a greater 

quantity of it to achieve the same number of moles as a smaller primer. Example: 50 pmol 

of a 20 nt-long single-stranded primer will equal 0.3 µg; however, 50 pmol of a 500 nt-long 

double-stranded megaprimer will equal 6 µg. A good yield and recovery of megaprimer 

is, therefore, important. If needed, do 2× 100 µL PCRs to generate the megaprimer. There 

is no need to remove the template DNA after PCR-1 because the same DNA will be used 

as template in PCR-2. 

4. “Hot start” PCR-2. The hot-start technique used in PCR-2 works just as well as the more 

expensive commercial methods. Hot start tends to reduce false and nonspecific priming 

in PCR in general (29) and is particularly useful in PCR-2 of the megaprimer method 

(our unpublished observation). 

5. Poor yield of mutant. If the final yield is poor, the surest strategy is to amplify a portion 

of the gel-purified mutant product in a third PCR (PCR-3) using primers A and B and 

hot start. This may also be necessary if PCR-2 produces nonspecific products in addition 

to the specific one. Before PCR-3 is conducted, however, it is very important to ensure 

that the mutant product of PCR-2 is well separated from the wild type template in the 

gel purification; otherwise, PCR-3 will amplify the wild-type DNA as well. The final gel-


purified mutant DNA (from either PCR-2 or PCR-3) is ready for a variety of applications, 

such as sequencing (30–36) or cloning (33,34). 

6. Single-tube methods. Recently, various investigators have reported successful modifications 

of the megaprimer method in which the purification step is not required. One involves 

cleavage of the template, coupled with enzymatic removal of PCR-1 primers, to ensure 

amplification of the correct product in PCR-2 (24). A second possibility is to exploit the 

unusually high T m of the megaprimer by designing a short, low Tm flanking primer for 

PCR-1, and a long flanking primer for PCR-2. This enables the use of a higher Tm for 

PCR-2 such that it will only allow annealing of the appropriate flanking primer (25). 

A third method uses a limiting amount of the first flanking primer, such that when the 

second flanking primer is added, the principle product will be the mutant DNA (17). 

Since we have not tested any of these modifications, the interested reader is advised to 

consult the original papers. 


Research in the author’s laboratory was supported in part by NIH Grant AI45803. 

S. B. is also a recipient of a Burroughs Wellcome New Initiatives in Malaria Research 

Award. 

References 

1. Sarkar, G. and Sommer, S. S. (1990) The “megaprimer” method of site-directed mutagenesis. 

Biotechniques 8, 404– 407. 

2. Landt, O., Grunart, H.-P., and Hahn, U. (1990) A general method for rapid mutagenesis 

using the polymerase chain reaction. Gene 96, 125–128. 

3. Perrin, S. and Gilliland, G. (1990) Site-specific mutagenesis using asymmetric polymerase 

chain reaction and a single mutant primer. Nucleic Acids Res. 18, 7433–7438. 

4. Barik, S. and Galinski, M. (1991) “Megaprimer” method of PCR: Increased template 

concentration improves yield. Biotechniques 10, 489– 490. 

5. Kuipers, O. P., Boot, H. J., and de Vos, W. M. (1991) Improved site-directed mutagenesis 

method using PCR. Nucleic Acids Res. 19, 4558. 

6. Merino, E., Osuna, J., Bolivat, F., and Soberon, X. (1992) A general PCR-based method 

for single or combinatorial oligonucleotide-directed mutagenesis on pUC/M13 vectors. 


7. Aiyar, A. and Leis, J. (1993) Modification of the megaprimer method of PCR mutagenesis: 

Improved amplification of the final product. Biotechniques 14, 366–369. 

8. Barik, S. (1993) Site-directed mutagenesis by double polymerase chain reaction. Methods 

Mol. Biol. 15, 277–286. 

9. Pont-Kingdon, G. (1994) Construction of chimeric molecules by a two-step recombinant 

PCR method. BioTechniques 16, 1010–1011. 

10. Barik, S. (1995) Site-directed mutagenesis by PCR: Substitution, insertion, deletion, and 

gene fusion. Methods Neurosci. 26, 309–323. 

11. Datta, A. K. (1995) Efficient amplificaton using ‘megaprimer’ by asymmetric polymerase 

chain reaction. Nucleic Acids Res. 23, 4530– 4531. 

12. Clark, J. M. (1988) Novel non-templated nucleotide addition reactions catalyzed by 

procaryotic and eucaryotic DNA polymerases. Nucleic Acids Res. 16, 9677–9686. 


yield from lambda bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216–2220 

14. Sarkar, G., Cassady, J., Bottema, C. D. K., and Sommer, S. S. (1990) Characterization of 

polymerase chain reaction amplification of specific alleles. Anal. Biochem. 186, 64–68.


15. Kwok, S., Kellogg, D. E., McKinney, N., Spasic, D., Goda, L., Levenson, C., et al. 

(1990) Effects of primer-template mismatches on the polymerase chain reaction: Human 

immunodeficiency virus type I model studies. Nucleic Acids Res. 18, 999–1005. 

16. Chattopadhyay D. and Raha, T. (1997) PCR mutagenesis: treatment of the megaprimer with 

mung bean nuclease improves yield. Biotechniques 6, 1054–1056. 

17. Picard, V., Ersdal-Badju, E., Lu, A., and Bock, S. C. (1994) A rapid and efficient one-tube 

PCR-based mutagenesis technique using Pfu DNA polymerase. Nucleic Acids Res. 22, 

2587–2591. 

18. Rychlik, W. (1995) Selection of primers for polymerase chain reaction. Mol. Biotechnol. 

3, 129–134. 

19. New England Biolabs Catalog (1995) pp. 208–209. 

20. Innis, M. A., Myambo, K. B., Gelfand, D. H., and Brow, M. A. D. (1988) DNA sequencing 


reaction-amplified DNA. Proc. Natl. Acad. Sci. USA 85, 9436–9440. 

21. Suggs, S. V., Hirose, T., Miyake, E. H., Kawashima, M. J., Johnson, K. I., and Wallace, R. B. 

(1981) Use of synthetic oligodeoxyribonucleotides for the isolation of specific cloned DNA 

sequences, in ICN-UCLA Symposium on Developmental Biology Using Purified Genes, 

Vol. 23 (Brown, D. D., ed.),. Academic Press, New York, pp. 683–693. 

22. Tautz, D. and Renz, M. (1983) An optimized freeze-squeeze method for recovering long 

DNA from agarose gels. Anal. Biochem. 132, 14–19. 

23. Zintz, C. B. and Beebe, D. C. (1991) Rapid re-amplification of PCR products purified in 

low melting point agarose gels. Biotechniques 11, 158–162. 

24. Seraphin, B. and Kandels-Lewis, S. 1996. An efficient PCR mutagenesis strategy without 

gel purification step that is amenable to automation. Nucleic Acids Res. 24, 3276–3277. 

25. Ke, S. H. and Madison, E. L. (1997) Rapid and efficient site-directed mutagenesis by 

single-tube ‘megaprimer’ PCR method. Nucleic Acids Res. 25, 3371–3372. 

26. Fieschi, J., Niccoli, P., Camilla, C., Chames, P., Chartier, M., and Baty, D. (1996) 

Polymerase chain reaction-based site-directed mutagenesis using magnetic beads. Anal. 

Biochem. 234, 210–214. 

27. Upender, M., Raj, L., and Weir, M. (1995) Megaprimer method for in vitro mutagenesis 

using parallel templates. Biotechniques 18, 29–32. 

28. Smith, A. M. and Klugman, K. P. (1997) “Megaprimer” method of PCR-based mutagenesis: 

the concentration of megaprimer is a critical factor. Biotechniques 22, 438– 442. 

29. Mullis, K. B. (1991) The polymerase chain reaction in an anemic mode: how to avoid cold 

oligodeoxyribonuclear fusion. PCR Methods Appl. 1, 1– 4. 

30. Meltzer, S. J. (1993) Direct sequencing of polymerase chain reaction products. Methods 

Mol. Biol. 15, 137–142. 

31. Sarkar, G. and Bolander, M. E. (1995) Semi exponential cycle sequencing. Nucleic Acids 

Res. 23, 1269–1270. 

32. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory 

Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 113–119. 

33. Barik, S. (1993) Expression and biochemical properties of a protein Ser/Thr phosphatase 

encoded by bacteriophage λ. Proc. Natl. Acad. Sci. USA 15, 10,633–10,637. 

34. Mazumder, B., Adhikary, G., and Barik, S. (1994) Bacterial expression of human respiratory 

syncytial viral phosphoprotein P and identification of Ser237 as the site of phosphorylation 

by cellular casein kinase II. Virology 205, 93–103. 

35. Krowczynska, A. M. and Henderson, M. B. (1992) Efficient purification of PCR products 

using ultrafiltration. Biotechniques 13, 286–289. 

36. Stoflet, E. S., Koeberl, D. D., Sarkar, G., and Sommer, S. S. (1988) Genomic amplification 

with transcript sequencing. Science 239, 491– 494.

532 Burke and Barik

John M. S. Bartlett.pdf - Bio-Nica.info

You also want an ePaper? Increase the reach of your titles

Delete template?

Save as template?