BioProcess Product Guide - GE Healthcare Life Sciences

<strong>GE</strong> <strong>Healthcare</strong><br />

<strong>Life</strong> <strong>Sciences</strong><br />

<strong>BioProcess</strong> <strong>Product</strong> <strong>Guide</strong><br />

2012/2013<br />

Scale-up<br />

Single-use<br />

Validation<br />

QbD<br />

Manufacturing<br />

IDEA<br />

Process<br />

development<br />

Time<br />

Purity<br />

Process<br />

economy<br />

Flexibility<br />

Security of supply

---

How to contact us<br />

www.gelifesciences.com/contact<br />

or by phone (T), fax (F), and Email<br />

Europe<br />

Austria T: +43 1 57 606 1613<br />

F: +43 1 57 606 1614<br />

Email: custservat@ge.com<br />

Italy T: +39 02 2600 1300<br />

F: +39 02 2600 1399<br />

Email: custservit@ge.com<br />

Belgium T: 0800 73890<br />

F: +32 (2) 416 8206<br />

Email: custservbnl@ge.com<br />

Netherlands T: 0800 82 82 82 1<br />

F: 0800 82 82 82 4<br />

Email: custservbnl@ge.com<br />

Czech Republic T: +420 220 518 399<br />

F: +420 220 518 743<br />

Email: apczech@apczech.cz<br />

Norway T: +47 815 65777<br />

F: +47 815 65666<br />

Email: custservno@ge.com<br />

Denmark T: +45 7025 2450<br />

F: +45 4516 2424<br />

Email: custservdk@ge.com<br />

Poland T: +48 22 5761893<br />

F: +48 22 5761894<br />

Email: office@lkb-biotech.pl<br />

Eire T: 1800 709 992<br />

F: +44 1494 542 010<br />

Email: custservuk@ge.com<br />

Portugal T: +351 21 4177036<br />

F: +351 21 4177037<br />

Email: cust.servpt@ge.com<br />

Finland and Baltics<br />

(Estonia, Latvia and<br />

Lithuania)<br />

T (Finland): 0800 94004<br />

T (Baltics): +358 (0) 95123940<br />

F. +358 (0) 951239439<br />

Email: custservfi@ge.com<br />

France T: +33 (0) 1 34 49 55 10<br />

F: +33 (0) 1 34 49 55 05<br />

Email: custservfr@ge.com<br />

Slovakia T: +43 664 913 07 35<br />

Email: orderexport@ge.com<br />

South East Europe T: +43 1 982 9527 20<br />

F: +43 1 984 3714<br />

Email: lkb@lkb.eu<br />

(Albania, Bosnia-Herzegovina, Bulgaria, Croatia, Kosovo,<br />

Macedonia, Montenegro, Romania, Serbia and Slovenia)<br />

Germany T: 0800 9080 711<br />

F: 0800 9080 712<br />

Email: custservde@ge.com<br />

Spain T: +34 935 944 950<br />

F: +34 935 944 965<br />

Email: cust.serves@ge.com<br />

Great Britain T: 0800 515 313<br />

F: 0800 616 927<br />

Email: custservuk@ge.com<br />

Sweden T: +46 (0) 771 400 600/01<br />

F: +46 (0) 18 612 19 10<br />

Email: custservse@ge.com<br />

Hungary T: +36 1 223 1034<br />

F: +36 1 223 1036<br />

Email: office@aphungary.hu<br />

Switzerland T: 0848 8028 10<br />

F: 0848 8028 11<br />

Email: custservch@ge.com

---

North America<br />

Canada T: 1-800-463-5800<br />

F: 1-800-567-1008<br />

Email: csdcanada@ge.com<br />

International<br />

USA T: 1-800-526-3593<br />

Press 1<br />

Press 2<br />

Press 3<br />

Press 0<br />

To reach an extension,<br />

sales or service representative<br />

Customer Service – to place an order or<br />

for pricing and product availability<br />

Hours: 8.30 am–7.30 pm Eastern Time<br />

For Technical Support or<br />

Instrument Repair<br />

Hours: 9.00 am–6.30 pm Eastern Time<br />

To reach an operator<br />

F: 1-877-295-8102<br />

Email: cs-us@ge.com<br />

Argentina T: +54 11 5556 2000<br />

Email: sales.ar@ge.com<br />

Australia T: 1800 150 522<br />

F: 1300 434 232<br />

Email: sales.au@ge.com<br />

Belarus<br />

See listing for Russian Federation<br />

Brazil T: +55 11 3933 7300<br />

F: +55 11 3933 7304<br />

Email: georgia.andrade@ge.com<br />

China<br />

(Beijing, Guangzhou,<br />

Hong Kong & Shanghai)<br />

T: 800-810-9118 or 400-810-9118<br />

Email: lifesciences@ge.com<br />

India (Bangalore) T: +91-80-4930 8000<br />

F: +91-80-4207 1422<br />

Email: supportdesk.india@ge.com<br />

India (Mumbai) T: +91-22-6573 6540/41/42/43<br />

F: +91-22-2838-1384<br />

Email: supportdesk.india@ge.com<br />

Israel T: +972 8 9366066<br />

F: +972 8 9366056<br />

Email: danyel@danyel.co.il<br />

Japan T: +81 3 5331 9336<br />

F: +81 3 5331 9370<br />

Email: Tech-JP@ge.com<br />

Kazakhstan<br />

See listing for Russian Federation<br />

Korea T: +82 2 6201 3800<br />

F: +82 2 6201 3804<br />

Email: lifesciencesKR@ge.com<br />

Malaysia T: +60 3 2267 1869<br />

F: +60 3 2273 6508<br />

Email: lifesciences.my@ge.com<br />

Mexico T: +52 55 9177 0300<br />

F: +52 55 9177 0388<br />

Email: Lorena.ruiz@ge.com<br />

Middle East T: +30 210 96 00 687<br />

F: +30 210 96 00 693<br />

Email: biotech@hvd.gr<br />

(Africa, Middle East, Greece, Malta, Cyprus, Pakistan,<br />

Afghanistan and Mongolia)<br />

Moldavia<br />

See listing for Russian Federation<br />

New Zealand T: 0800 733 893<br />

F: +64 (9) 638 7098<br />

Email: sales.nz@ge.com<br />

Russian Federation<br />

and other CIS/NIS<br />

T: +7 495 411 9805<br />

F: +7 495 769 6932<br />

Email: LSrus@ge.com<br />

Singapore T: + 65 6773 7303<br />

F: + 65 6773 7302<br />

Email: lifesciences.sg@ge.com<br />

South Africa T: +27 (0)11 794 4117<br />

F: +27 (0)11 794 2160<br />

Email: info@sepsci.co.za<br />

Taiwan T: +886-2-25165280<br />

F: +886-2-25165260<br />

Email: lifesciencestwn@ge.com<br />

Thailand T: +662 624 8444<br />

F: +662 624 8430<br />

Email: lifesciences.th@ge.com<br />

Ukraine<br />

See listing for Russian Federation

---

Sales branch offices<br />

Europe<br />

Austria<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Zweigniederlassung Österreich<br />

Europlaza, Gebäude E<br />

Wienerbergstrasse 41<br />

A-1120 Wien<br />

T: +43 1 57606 1613<br />

F: +43 1 57606 1614<br />

Email: custservat@ge.com<br />

Technical Support<br />

T: +43 1 57606 1619<br />

Belgium<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Branch office Benelux<br />

Kouterveldstraat 20<br />

B-1831 Diegem<br />

T: 0800 73 890<br />

F: 02 416 82 06<br />

Email: custservbnl@ge.com<br />

Czech Republic<br />

AP Czech s.r.o.<br />

Hostalkova 48<br />

CZ-169 00 Praha 6<br />

T: +420 220 518 399<br />

F: +420 220 518 743<br />

Email: apczech@apczech.cz<br />

Denmark<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Park Allé 295, 2. Sal<br />

Brondby<br />

DK- 2605<br />

DENMARK<br />

T: +45 45 16 24 00<br />

F: +45 45 16 24 24<br />

Email: custservdk@ge.com<br />

Labcrew<br />

T: +45 70 25 24 10<br />

Email: labcrewdk@ge.com<br />

Technical Support<br />

T: +45 70 25 24 60<br />

Email: productdk@ge.com<br />

Sales support to Iceland<br />

Finland and Baltics<br />

(Estonia, Latvia and Lithuania)<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Suomen sivuliike<br />

PL 3130<br />

FIN-00002 Helsinki<br />

FINLAND<br />

T: +358 9 512 3940<br />

F: +358 9 512 39439<br />

Email: custservfi@ge.com<br />

Labcrew<br />

T: +358 (9) 512 3940<br />

Email: labcrewfi@ge.com<br />

Technical Support<br />

T: +358 (9) 512 39 467<br />

Email: productfi@ge.com<br />

France<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Branch France<br />

24 Avenue de l'Europe CS 20529<br />

F-78457 Vélizy Villacoublay<br />

T: +33 (0) 1 34 49 55 10<br />

F: +33 (0) 1 34 49 55 10 55 05<br />

Email: custservfr@ge.com<br />

Germany<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Munzinger St. 5<br />

79111 Freiburg<br />

T: 0800 9080 711<br />

F: 0800 9080 712<br />

Email: custservde@ge.com<br />

Great Britain<br />

<strong>GE</strong> <strong>Healthcare</strong> UK Ltd<br />

Amersham Place<br />

Little Chalfont<br />

Bucks HP7 9NA<br />

T: +44 1494 544000<br />

F: +44 1494 542 010<br />

Email: custservuk@ge.com<br />

Hungary<br />

AP Hungary<br />

Etele út 59-61<br />

Budapest 1119<br />

T: +36 1 223 1034<br />

F: +36 1 223 1036<br />

Email: office@aphungary.hu<br />

Italy<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Filiale Italiana<br />

Via Galeno 36<br />

I-20126 Milano (MI)<br />

T: +39 02 2600 1300<br />

F: +39 02 2600 1399<br />

Email: custservit@ge.com<br />

Netherlands<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Branch office Benelux<br />

Kouterveldstraat 20<br />

B-1831 Diegem<br />

BELGIUM<br />

T: 0800 82 82 82 1<br />

F: 0800 82 82 82 4<br />

Email: custservbnl@ge.com<br />

Norway<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

P.O. Box 4665 Nydalen<br />

N-0450 Oslo<br />

T: +47 815 65 777<br />

F: +47 815 65 666<br />

Email: custservno@ge.com<br />

Labcrew<br />

T: +47 815 65 555<br />

Email: labcrew.no@ge.com<br />

Technical support<br />

T: +47 815 65 888<br />

F: +47 815 65 666<br />

Email: productno@ge.com<br />

Poland<br />

LKB Biotech<br />

al. Bohaterow Wrzesnia 9, lok. 115<br />

02-389 Warszawa<br />

T: +48 22 5761893<br />

F: +48 22 5761894<br />

Email: office@lkb-biotech.pl<br />

Portugal<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Sucursal em Portugal<br />

Av. Do Forte no. 6–6A<br />

Edifício Ramazzotti<br />

2790-072 Carnaxide<br />

T: + 351 21 417 70 36<br />

F: + 351 21 417 70 37<br />

Email: cust.servpt@ge.com<br />

South East Europe<br />

(Albania, Bosnia-Herzegovina,<br />

Bulgaria, Croatia, Kosovo,<br />

Macedonia, Montenegro,<br />

Romania, Serbia and Slovenia)<br />

LKB Vertriebs GmbH<br />

Wurzbachgasse 18<br />

P.O.Box 54<br />

A-1152 Wien<br />

AUSTRIA<br />

T: +43 1 982 9527 20<br />

F: +43 1 984 3714<br />

Email: lkb@lkb.eu<br />

Spain<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Sucursal en España<br />

Rosselló i Porcel, 21 Planta 14<br />

08106 Barcelona<br />

T: +34 935 944 950<br />

F: +34 935 944 965<br />

Email: cust.serves@ge.com

---

Sales branch offices<br />

Sweden<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Filial Sverige<br />

Björkgatan 30<br />

Box 605<br />

SE-751 25 UPPSALA<br />

T: +46 (0) 771 400 600/01<br />

F: +46 (0) 18 612 19 10<br />

Labcrew<br />

T:+46 (0) 771 400 602<br />

Email: labcrewse@ge.com<br />

Technical Support<br />

T: +46 (0) 18 612 19 00<br />

Email: productse@ge.com<br />

Switzerland<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Zweigniederlassung Schweiz<br />

Europastrasse 31<br />

CH-8152 Glattburg<br />

T: 0848 8028 10<br />

F: 0848 8028 11<br />

Email: custservch@ge.com<br />

North America<br />

Canada<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong>, Inc.<br />

500 Morgan Blvd.,<br />

Baie d’Urfé,<br />

Québec, H9X-3V1<br />

Customer Service<br />

T: 1-800-463-5800<br />

F: 1-800-567-1008<br />

Email: csdcanada@ge.com<br />

Technical Support<br />

Email: ts-usa@ge.com<br />

USA<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> Corp<br />

800 Centennial Avenue<br />

P.O. Box 1327<br />

Piscataway, NJ 08855-1327<br />

T: 1-800-526-3593<br />

Technical Support<br />

Email: ts-usa@ge.com<br />

Customer Service<br />

Email: cs-us@ge.com<br />

Instrument Service<br />

Email: labcrew-us@ge.com<br />

International<br />

Argentina<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong> Argentina SA<br />

Nicolas de Vedia 3616<br />

C1430DAH<br />

Ciudad Autonoma de Buenos Aires<br />

AR<strong>GE</strong>NTINA<br />

T: +54 11 5556 2000<br />

Email: sales.ar@ge.com<br />

Sales support to Argentina, Uruguay, Paraguay, Chile,<br />

and Bolivia<br />

Australia<br />

<strong>GE</strong> <strong>Healthcare</strong> Australia Pty. Ltd.<br />

Building 4B, Parklands Estate<br />

21 South Street<br />

Rydalmere NSW, 2116<br />

AUSTRALIA<br />

T: 1800 150 522<br />

F: 1300 434 232<br />

Email: sales.au@ge.com<br />

Postal address:<br />

PO Box 21<br />

Rydalmere, NSW 1701<br />

AUSTRALIA<br />

Sales support to New Zealand<br />

Brazil<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong> do Brasil Ltda.<br />

Rua Domingos Marchetti, 192<br />

Bairro do Limão<br />

SP 02712-150<br />

BRAZIL<br />

T: +55 11 3933 7300<br />

F: +55 11 3933 7304<br />

Email: georgia.andrade@ge.com<br />

Sales support to Brazil, Colombia, Costa Rica,<br />

Dominican Republic, Ecuador, Guatemala, Honduras,<br />

Panamá, Perú, Tobago, Trinidad and Venezulea<br />

China (Beijing)<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

Beijing Representative Office<br />

No. 1, Yongchong North Road<br />

Beijing Economic & Technological<br />

Development Area<br />

Beijing 100176<br />

T: +8610-5806-8888x 69689<br />

F: +8610-6787-1162<br />

Email: lifesciences@ge.com<br />

China (Guangzhou)<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

Guangzhou Representative Office 10/F,<br />

<strong>GE</strong> Tower, No.87 Hua Cheng Avenue,<br />

Pearl River New City, Tianhe District,<br />

Guangzhou 510623<br />

T: +86 20 3815 7777<br />

F: +86 20 3815 7800<br />

Email: lifesciences@ge.com

---

Sales branch offices<br />

China (Hong Kong)<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

L12 Office Tower, Langham Place<br />

8 Argyle Street, Mongkok<br />

Kowloon<br />

HONG KONG<br />

T: +852 2100 6314<br />

F: +852 2100 6338<br />

Email: lifesciences@ge.com<br />

China (Shanghai)<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

Shanghai Representative Office<br />

No 1 Hua Tuo Road,<br />

Zhang Jiang- High-Tech Park, Pudong,<br />

Shanghai 201203<br />

T: +86 21 3877 7888<br />

F: +86 21 3877 7488<br />

Email: lifesciences@ge.com<br />

India (Bangalore)<br />

Bangalore Regional Office<br />

Wipro <strong>GE</strong> <strong>Healthcare</strong> Pvt. Ltd.<br />

7th Floor, Summit Tower B,<br />

73/1, Brigade Metropolis,<br />

Mahadevapura,<br />

Bangalore -560048<br />

INDIA<br />

T: 91 80 49308000<br />

F: 91 80 4207 1422<br />

Email: supportdesk.india@ge.com<br />

Sales support to Bangladesh and Sri Lanka<br />

India (Mumbai)<br />

Mumbai Regional Office<br />

Wipro <strong>GE</strong> <strong>Healthcare</strong> Pvt Ltd.,<br />

No. 881, Solitaire Corporate Park,<br />

Andheri Ghatkopar Link Road,<br />

Andheri (E), Mumbai 400 093<br />

INDIA<br />

T: 91 22 6573 6540/41/42/43<br />

F: 91 22 2838 1384<br />

Email: supportdesk.india@ge.com<br />

Sales support to Bangladesh and Sri Lanka<br />

Israel<br />

Danyel Biotech Ltd.<br />

Hamada Street 1<br />

Science Park, P.O.B. 2417<br />

76124 Rehovot<br />

T: +972 8 9366066<br />

F: +972 8 9366056<br />

Email: danyel@danyel.co.il<br />

Japan<br />

<strong>GE</strong> <strong>Healthcare</strong> Japan Corporation<br />

Sanken Bldg.<br />

3-25-1, Hyakunincho Shinjuku-ku<br />

Tokyo 169-0073<br />

BioDirect Line<br />

T: +81 3 5331-9336<br />

F: +81 3 5331-9370<br />

Email: Tech-JP@ge.com<br />

Korea<br />

Address from May 2012:<br />

<strong>GE</strong> <strong>Healthcare</strong> Korea Ltd.<br />

Pharos Tower 7F, 119,<br />

Nonhyeon-dong, Gangnam-gu,<br />

Seoul 135-820<br />

T: +82 2 6201 3800<br />

F: +82 2 6201 3804<br />

Email: lifesciencesKR@ge.com<br />

Malaysia<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> Ltd.<br />

Level 6, 1 Sentral<br />

Jalan Travers, Kuala Lumpur Sentral<br />

50470 Kuala Lumpur<br />

T: +60 3 2267 1869<br />

F: +60 3 2273 6508<br />

Email: lifesciences.my@ge.com<br />

Mexico<br />

<strong>GE</strong> Sistemas Medicos S. A. de C. V.<br />

Antonio Dovali Jaime no. 70,<br />

Torre B, 4er. Piso 4.<br />

Col. Santa Fe Mexico<br />

D. F. CP 01200<br />

T: +52 55 9177 0300<br />

F: +52 55 9177 0388<br />

Email: Lorena.ruiz@ge.com<br />

Middle East<br />

(Africa, Middle East, Greece, Malta,<br />

Cyprus, Pakistan, Afghanistan and<br />

Mongolia)<br />

HVD Biotech Vertriebs GmbH<br />

Vouliagmenis Avenue 16<br />

P.O. Box 70051<br />

GR-16610 Glyfada<br />

GREECE<br />

T: +30 210 96 00 687<br />

F: +30 210 96 00 693<br />

Email: biotech@hvd.gr<br />

New Zealand<br />

<strong>GE</strong> <strong>Healthcare</strong> Ltd<br />

Level 1, 8 Tangihua Street<br />

Auckland 1010<br />

T: 0800 733 893<br />

F: +64 9 638 7098<br />

Email: sales.nz@ge.com<br />

Postal address:<br />

PO Box 106911<br />

Auckland City Post Shop<br />

Auckland 1143<br />

Russian Federation<br />

and other CIS/NIS<br />

CJSC <strong>GE</strong> <strong>Healthcare</strong> ZAO<br />

Presnenskaya nab., 10C, 12th floor<br />

RF-123 317, Moscow<br />

T: +7 (495) 411 98 05<br />

F: +7 (495) 769 69 32<br />

Email: LSrus@ge.com<br />

Contact Moscow office for Ukraine, Kazakhstan,<br />

Belarus, and other CIS countries (former Soviet Union<br />

excluding Baltic countries)<br />

Singapore<br />

<strong>GE</strong> <strong>Healthcare</strong> Pte. Ltd.<br />

1 Maritime Square #13-01<br />

Harbourfront Centre<br />

Singapore 099253<br />

SINGAPORE<br />

T: +65 6773 7303<br />

F: +65 6773 7302<br />

Email: lifesciences.sg@ge.com<br />

Sales support to South East Asia Region including<br />

Brunei, Philippines, Indonesia, and Vietnam<br />

South Africa<br />

Separation Scientific (SA) (Pty) Ltd<br />

Unit 29 Honeydew Shopping Centre<br />

Cnr Beyers Naude & Blueberry Street<br />

Honeydew, 2040<br />

T: +27 (0)11 794 4117<br />

F: +27 (0)11 794 2160<br />

Email: info@sepsci.co.za<br />

Taiwan<br />

<strong>GE</strong> Medical Systems Taiwan, Ltd.<br />

Taiwan Branch Office<br />

11F, No.68, Sec.3, Nanjing E. Rd.,<br />

Taipei 104<br />

T: +886 2 2888 3570<br />

F: +886 2 2888 3580<br />

Email: lifesciencestwn@ge.com<br />

Thailand<br />

<strong>GE</strong> Medical Systems (Thailand) Ltd.<br />

Thanapoom Tower, 32nd Floor<br />

1550 New Petchburi Road<br />

Makasan, Ratthewi<br />

Bangkok, 10400<br />

T: +662 624 8444<br />

F: +662 624 8430<br />

Email: lifesciences.th@ge.com

---

Main offices<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

Bio-<strong>Sciences</strong> AB<br />

Björkgatan 30<br />

SE-751 84 Uppsala<br />

SWEDEN<br />

T: +46 (0) 18 612 00 00<br />

F: +46 (0) 18 612 19 10<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

Europe GmbH<br />

Munzinger Strasse 5<br />

D-79111 Freiburg<br />

<strong>GE</strong>RMANY<br />

T: +0 800 9080 711<br />

F: +0 800 9080 712<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

UK Ltd.<br />

Amersham Place<br />

Little Chalfont<br />

Bucks HP7 9NA<br />

UK<br />

T: +44 (0) 1494 544000<br />

F: +44 (0) 1494 542266<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

Bio-<strong>Sciences</strong> Corp<br />

800 Centennial Avenue<br />

P.O. Box 1327<br />

Piscataway, NJ 08855-1327<br />

USA<br />

T: +1 732 457 8000<br />

F: +1 732 457 0557<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

Japan Corporation<br />

Sanken Bldg.<br />

3-25-1, Hyakunincho<br />

Shinjuku-ku<br />

Tokyo 169-0073<br />

JAPAN<br />

T: +81 3 5331 9336<br />

F: +81 3 5331 9370<br />

Fast Trak<br />

Regional Fast Trak Centers<br />

Europe<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Oskar-Schlemmer-Strasse 11<br />

80807 München<br />

<strong>GE</strong>RMANY<br />

T: +49 (0) 89 96 28 16 90<br />

F: +49 (0) 89 96 28 16 79<br />

Email: fasttrak.europe@ge.com<br />

North America<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> Corp.<br />

800 Centennial Avenue<br />

Piscataway, NJ 08855-1327<br />

USA<br />

T: +1 732 457 8064<br />

F: +1 732 457 8246<br />

Email: fasttrak.americas@ge.com<br />

China<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

<strong>GE</strong> (China) Research and Development<br />

Center Co.,Ltd<br />

1800 Cai Lun Road<br />

Zhangjiang High-Tech Park, Pudong<br />

Shanghai 210203<br />

T: +86 21 50504666-2600<br />

F: +86 21 50808591<br />

Email: fasttrak.china@ge.com<br />

India<br />

<strong>GE</strong> India Technology Centre Pvt. Ltd.<br />

John F. Welch Technology Center<br />

122, EPIP, Whitefield Road<br />

Bangalore - 560 066<br />

T: +91 80 4088 7394<br />

F: +91 80 2841 2111<br />

Email: fasttrak.india@ge.com<br />

Japan<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

Sanken Bldg, 3-25-1<br />

Hyakunincho 3-chome Shinjuku-ku<br />

169-0073 Tokyo<br />

T: +81 (0) 3 5331 9316<br />

F: +81 (0) 3 5331 9372<br />

Email: fasttrak.japan@ge.com<br />

Singapore<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

1 Maritime Square #13-01<br />

HarbourFront Centre<br />

Singapore 099253<br />

T: +65 6773 7303<br />

F: +65 6773 7302<br />

Email: lifesciences.sg@ge.com<br />

Administrative office<br />

Sweden<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> AB<br />

Björkgatan 30<br />

SE-751 84 Uppsala<br />

T: +46 (0) 18 612 1656<br />

Email: fasttrak.global@ge.com<br />

Website: www.gelifesciences.com/fasttrak

---

Contents<br />

1 2<br />

3<br />

<strong>Product</strong> highlights 16 Cell culture 26 ReadyToProcess 34<br />

Cell culture media,<br />

sera and reagents 28<br />

Microcarrier 31<br />

ReadyToProcess Platform 36<br />

WAVE Bioreactor systems 38<br />

Single-use fluid management<br />

and filtration 52<br />

ReadytoProcess connectivity 66<br />

ReadyToProcess<br />

chromatography 70<br />

7 8 9<br />

<strong>Product</strong>s for process<br />

development 150<br />

High-throughput<br />

process development 153<br />

PreDictor 96-well filter plates 154<br />

PreDictor RoboColumn 156<br />

HiScreen columns 157<br />

Examples of prepacked columns 158<br />

Selection kits 160<br />

Custom-packed columns 161<br />

Systems for method and<br />

process development 162<br />

Filtration products 164<br />

Cross flow filtration 170<br />

Normal flow filtration 189<br />

Filtration hardware 194<br />

Protein interaction and<br />

stability analysis 200<br />

Biacore systems 202<br />

MicroCal systems 206<br />

8 www.gelifesciences.com/bioprocess

---

4 5 6<br />

Chromatography<br />

media 74<br />

Ion exchange 77<br />

Affinity 82<br />

Hydrophobic interaction 87<br />

Multimodal 90<br />

Reversed phase 94<br />

Gel filtration 96<br />

Custom designed media 100<br />

Chromatography<br />

columns 102<br />

AxiChrom 106<br />

Chromaflow 110<br />

BPG 114<br />

INdEX 122<br />

FineLINE 126<br />

HiScale 132<br />

Custom-packed<br />

laboratory columns 134<br />

Manufacturing Solutions –<br />

column packing 136<br />

Chromatography<br />

systems 138<br />

ÄKTA avant 140<br />

ÄKTApilot 141<br />

ÄKTAprocess 142<br />

Inline conditioning 144<br />

Customized <strong>BioProcess</strong> Solutions 145<br />

UNICORN control 146<br />

10 11 12<br />

Oligonucleotide<br />

synthesis 208<br />

Synthesizers 211<br />

Columns 213<br />

Solid supports 214<br />

Service and<br />

support 216<br />

Service agreements 218<br />

Smart Asset Management<br />

Services 219<br />

Application services - Fast Trak 220<br />

Validation Services 224<br />

Online regulatory and<br />

technical support 226<br />

System and column support 228<br />

Security of supply 229<br />

Literature 230<br />

Index and legal 232<br />

A to Z of media and chemicals 234<br />

Terms and conditions of sale 268<br />

Trademarks 271<br />

Licensing information 271<br />

Alphabetical index 272<br />

www.gelifesciences.com/bioprocess 9

---

Inspiring science transforms<br />

your ideas into therapies<br />

Transforming ideas into innovative drug candidates brings multidisciplinary teams<br />

together with a vast array of complex equipment and processes. That, of course, is only<br />

the beginning. Taking those candidates and methods quickly and reliably from explorative<br />

discovery environments, through testing and clinical trials, and into highly regulated<br />

biopharmaceutical production environments, all with optimized processes, merely adds<br />

to a difficult equation.<br />

At <strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong>, we understand you want confidence in your decisionmaking<br />

as early as possible. Our aim is to help you and your bioprocessing teams, at<br />

every step, to bring drugs to market in a faster, simpler, more reliable and cost effective<br />

manner – according to your plan. Understanding your aspirations and challenges, and<br />

defining innovations that can support you in navigating the path to success, is a world<br />

we thrive in.<br />

Every day, we ask ourselves, how can we best support you? It could be in the form of<br />

modern media engineering to withstand repeated cleaning-in-place, or intelligent column<br />

packing that saves hours of precious time. Analysis technology that increases sensitivity<br />

and precision. Single-use systems that bring unprecedented flexibility to manufacturing.<br />

Validation support to lighten the regulatory load. Collaboration on critical projects or even<br />

acting as your partner in the design, construction and start-up of an entire plant. These<br />

are just a few examples of innovations, big and small, prompted by the demands of the<br />

industry, incubated at <strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong>.

---

Time to market is key<br />

Transforming ideas into innovative drug candidates, optimizing processes, and<br />

manufacturing biotherapeutics are multidisciplinary activities. The challenge is to take<br />

candidates and methods quickly and reliably from exploratory discovery environments,<br />

through testing and clinical trials, and into highly regulated biopharmaceutical<br />

production environments. In today’s competitive market, the focus is on improving<br />

efficiency and productivity, as well as ensuring process robustness and economy.<br />

<strong>GE</strong> <strong>Healthcare</strong> continues to develop products and services to support your needs from<br />

idea to biopharmaceutical.

---

Our technologies and products for efficient upstream and downstream processing,<br />

include the ReadyToProcess platform of single-use products, PreDictor formats for highthroughput<br />

process development, MabSelect media for monoclonal antibody purification,<br />

Capto media for ion exchange, hydrophobic interaction and multi-modal separations,<br />

AxiChrom columns, WAVE Bioreactor cell culture systems, ÄKTA chromatography and<br />

filtration systems, services and education.<br />

In 2011, <strong>GE</strong> <strong>Healthcare</strong> acquired PAA Laboratories, a developer and manufacturer of cell<br />

culture media for the biopharmaceutical and vaccine manufacturing industry. Adding<br />

upstream capabilities will enable us to provide an end-to-end, integrated service to<br />

our customers. We believe that an integrated approach, where we can help customers<br />

optimize every stage of their manufacturing process, has the potential to reduce cost of<br />

entry, deliver higher yields of finished product, and reduce time to market.<br />

Flexible solutions designed for your application needs<br />

<strong>GE</strong> <strong>Healthcare</strong> continues to develop quality products, services, and platform technologies<br />

that enable rapid process development and efficient production of biopharmaceuticals.<br />

Our solutions support the manufacture of biomolecules, including plasma proteins,<br />

recombinant proteins, antibodies, and recombinant viral vectors for biopharmaceutical<br />

therapy. We provide comprehensive solutions to support you at every step, from<br />

research to market.<br />

Antibodies – The capacity to manage high titers<br />

The successful production and application of therapeutic antibodies has increased<br />

the demand for more effective tools and solutions. Efficient tools to characterize<br />

the experimental design space are required, as well as optimization of upstream<br />

and downstream protocols in order to achieve robust and high-yield processes at<br />

manufacturing scale.<br />

Improvement in antibody processing has increased titer concentrations from a few<br />

milligrams to multiple grams per liter. High titers require chromatography media<br />

with high capacity, high rigidity and chemical stability. MabSelect, MabSelect Xtra,<br />

MabSelect SuRe, and MabSelect SuRe LX are examples of Protein A-based media<br />

that meet these criteria. High titers also reduce process volumes and thereby create<br />

new opportunities for flexible manufacturing. The ReadyToProcess platform has<br />

the flexibility to speed throughput and reduce up-front investment. The growing<br />

product portfolio includes WAVE Bioreactor and Cellbag culture chambers, as<br />

well as ReadyCircuit single-use assemblies and ReadyToProcess filtration and<br />

chromatography solutions.<br />

Recombinant proteins – Solutions to the most difficult production<br />

challenges<br />

Purification challenges with recombinant DNA technology vary depending upon the<br />

specific protein, the expression system and location of the product. <strong>GE</strong> <strong>Healthcare</strong><br />

can help you every step of the way with proven and well-integrated filtration and<br />

chromatography platforms with the Capto range, combined with AxiChrom process<br />

columns and ÄKTA chromatography systems as well as the ReadyToProcess platform.<br />

12 www.gelifesciences.com/bioprocess

---

Regardless of the expression system type, a downstream process normally follows the<br />

Capture - Intermediate Purification - Polishing approach. This often results in a process<br />

containing three to five purification steps. It is important to link different techniques and<br />

steps optimally for industrial robustness and scalability. When standard chromatography<br />

media cannot provide optimal purity and economy our Custom Designed Media (CDM)<br />

service can often be the swiftest way to a robust and economic process. The CDM service<br />

can help by tailoring a chromatography medium to specific processing needs.<br />

Vaccines – Technologies for safer, more efficacious and cost-effective<br />

vaccines<br />

Vaccine development has progressed from whole microorganisms to subunit vaccines<br />

that contain only antigenic proteins. Today, the vaccine field is very diverse and covers<br />

many molecule types, including conjugated polysaccharides, recombinant proteins,<br />

live-attenuated virus, inactivated viruses, virus-like particles and whole cells. Recent<br />

developments in immunology have also opened pathways for the development of<br />

therapeutic vaccines. A large part of therapeutic vaccine research is focused on the<br />

development of cancer vaccines.<br />

<strong>GE</strong> <strong>Healthcare</strong> offers a number of opportunities for manufacturers wanting to deliver<br />

safer, more efficacious and cost-effective vaccines. Our technologies and products<br />

include solutions for upstream manufacture, downstream purification and analytical<br />

assays.<br />

Comprehensive and reliable support<br />

We aspire to be a trusted, knowledgeable supplier and offer an array of specialized services<br />

and support for process development, validation, security of supply, and compliance.<br />

Our Fast Trak team provides education courses and process development assistance,<br />

while our Enterprise Solutions team can act as your partner in the design, construction<br />

and start-up of an entire plant. To support GMP compliance, Regulatory Support Files<br />

(RSFs) and Validation <strong>Guide</strong>s (VGs) are available for all <strong>BioProcess</strong> consumables, and<br />

similar documentation is available for <strong>BioProcess</strong> hardware.<br />

Secure supply<br />

Over the past decades <strong>GE</strong> <strong>Healthcare</strong> has supported the rapid growth in biopharmaceutical<br />

production – we currently deliver approximately 500 000 laboratory and pilot-scale<br />

columns per year, and over the years we have supplied more than 4 250 000 liters/kgs<br />

of chromatographic media, more than 12 000 process scale columns, 2000 <strong>BioProcess</strong><br />

systems, 200 000 membrane devices, and 1000 filtration skids.<br />

We have recently increased our production capacity and services to match demands.<br />

We believe security-of-supply is about quality as well as timely delivery of the right<br />

quantity, thus we have validated production processes and manufacture according to<br />

ISO 9001. Over the past years we have invested over US$100 million in business continuity<br />

systems, processes, training, and equipment. We have worked with a combination of<br />

market-leading safety and business continuity consulting firms. Customers and notified<br />

bodies/regulatory authorities closely scrutinize our production routines through on-site<br />

audits – an important catalyst in our continuous improvement program.<br />

www.gelifesciences.com/bioprocess 13

---

<strong>Product</strong>s and platforms across bioprocessing<br />

Through continuous development of innovative products and with the recent acquisition of<br />

PAA Laboratories, we are able to support bioprocessing from cell culture and fermentation<br />

through recovery and purification to formulation.<br />

Our products and platform solutions are designed to meet the key challenges posed at every<br />

stage in the process, delivering the desired product at the required purity and safety: all with<br />

fast development and integrated solutions in mind.<br />

14 www.gelifesciences.com/bioprocess

---

Key goals Technology Key products<br />

Downstream Upstream<br />

Cell Culture<br />

Recovery<br />

Capture<br />

Purification<br />

• High product titer<br />

• <strong>Product</strong> folding &<br />

post translational<br />

modifications correct<br />

• <strong>Product</strong> easily<br />

transferred to DSP<br />

• Isolate and prepare<br />

product for<br />

purification<br />

• Removal of cells and<br />

cells debris<br />

• Secure process<br />

robustness &<br />

economy<br />

• Initial purification<br />

of target molecule<br />

• Removal of process<br />

related impurities<br />

from clarified feed,<br />

including host cell<br />

protein, DNA, viruses<br />

and endotoxins<br />

• High producer cell<br />

grown in reactors and<br />

fermenters<br />

• Cell disruption<br />

methods<br />

• Cross flow filtration<br />

• Normal flow filtration<br />

• Affinity<br />

chromatography<br />

• Ion exchange<br />

• Multi-modal<br />

• Ion exchange<br />

chromatography<br />

• Multi-modal<br />

• Hydrophobic<br />

interaction<br />

• Ultrafiltration/<br />

diafiltration<br />

• WAVE Bioreactor<br />

• WAVE Mixer<br />

• Microcarriers<br />

• ReadyCircuit<br />

• PAA cell culture media<br />

• PAA supplements<br />

• ULTA filters<br />

• ReadyToProcess hollow fibers<br />

• ReadyToProcess chromatography<br />

• MabSelect, Capto media<br />

• PreDictor formats<br />

• Sepharose, Sephadex, CDM media<br />

• UniFlux, ÄKTA systems, UNICORN<br />

• AxiChrom columns<br />

• ReadyToProcess chromatography<br />

• ReadyToProcess hollow fiber<br />

• Capto, PlasmidSelect, CDM media<br />

• Sepharose, Sephadex, SOURCE<br />

• PreDictor, HiScreen, AxiChrom<br />

columns<br />

• Kvick cassettes, hollow fibers<br />

• ÄKTA systems, UNICORN, UniFlux<br />

Polishing<br />

• Removal of<br />

remaining traces<br />

of process- and<br />

product-related<br />

impurities<br />

• Ion exchange<br />

• Reversed phase<br />

• Hydrophobic<br />

interaction<br />

• Gel filtration<br />

• ReadyToProcess chromatography<br />

• Capto ImpRes, Superdex prep grade<br />

• Sephacryl, Sepharose, SOURCE<br />

• UniFlux, ÄKTA systems<br />

• AxiChrom columns<br />

Formulation<br />

• Long-term<br />

product stability<br />

• Ultrafiltration/<br />

diafiltration<br />

• Kvick cassettes, Hollow fiber filters<br />

• ReadyToProcess hollow fibers<br />

Analytics Manufacturing support<br />

Buffer<br />

preparation<br />

Cell culture<br />

media<br />

preparation<br />

QC/QA<br />

• Rapid, flexible<br />

preparation of buffer<br />

stock<br />

• Removal of bioburden<br />

and/or particulates<br />

• Consistent cell culture<br />

performance<br />

• Sterilization of heat<br />

labile components<br />

• Flexible preparation<br />

and storage systems<br />

• Rapid, selective<br />

measurement of target<br />

proteins or specific<br />

contaminants<br />

• Filtration<br />

• Mixing technology<br />

• Connectivity and<br />

storage solutions<br />

• Inline conditioning<br />

• Sterile filtration and<br />

mycoplasma removal<br />

• Mixing technology<br />

• Connectivity and<br />

storage solutions<br />

• Surface plasmon<br />

resonance<br />

• Ultrasensitive<br />

microcalorimetry<br />

• ULTA filters<br />

• WAVE Mixer<br />

• ReadyMate connectors<br />

• ReadyCircuit assemblies<br />

• ÄKTA Inline conditioning systems<br />

• ULTA filters<br />

• WAVE Mixer<br />

• ReadyMate connectors<br />

• ReadyCircuit assemblies<br />

• Biacore systems<br />

• MicroCal systems<br />

www.gelifesciences.com/bioprocess 15

---

1<strong>Product</strong> highlights<br />

ReadyCircuit assemblies<br />

and ReadyKart stations 18<br />

Capto media 21<br />

WAVEPOD II Integrated Controller 18<br />

MabSelect SuRe LX 22<br />

UNICORN DAQ 1.0 18<br />

ÄKTA avant system 22<br />

pH sensor for Cellbag bioreactor 19<br />

ActiCHO Media System 19<br />

Slurry tanks 23<br />

Inline conditioning for process<br />

chromatography systems 23<br />

PreDictor RoboColumn 20<br />

MicroCal DSC systems 24<br />

HiScale columns 20<br />

Smart Asset Management Services 24<br />

16 www.gelifesciences.com/bioprocess

---

1<br />

ReadyCircuit assemblies and ReadyKart stations<br />

<strong>Product</strong> highlights<br />

ReadyCircuit bags and tubing assemblies provide flexible solutions for<br />

fluid storage and transfer while eliminating cleaning and sterilization<br />

steps. They also reduce batch changeover time and improve facility<br />

throughput. ReadyCircuit assemblies are conveniently organized on<br />

ReadyKart mobile processing station - a configurable cart that provides<br />

ergonomic support and enhances the use of ReadyToProcess fluid<br />

processing products.<br />

ReadyCircuit assemblies and ReadyKart stations provide:<br />

• A sterile fluid path for storage and transfer of process fluids<br />

• Configurable process solutions for single-use fluid handling<br />

For more information see page 52.<br />

WAVEPOD II Integrated Controller<br />

The WAVEPOD II module integrates all the instrumentation associated<br />

with the WAVE Bioreactor 20/50 system, including dissolved oxygen,<br />

optical pH, and CO2/O2 gas mixing controls, to meet individual cell culture<br />

needs for insect cell, mammalian cell, and perfusion applications. The unit<br />

combines these four key instruments into a single compact device, which<br />

controls WAVE Bioreactor base via a digital link. A large color touchscreen<br />

allows easy access to all parameters, including data from the bioreactor.<br />

For further information, see page 48.<br />

UNICORN DAQ 1.0<br />

UNICORN DAQ 1.0 software provides data acquisition for the management<br />

and evaluation of results from cell cultures performed in WAVE Bioreactor<br />

systems. UNICORN DAQ software provides the following benefits:<br />

• Real time data acquisition allows you to monitor the run status<br />

of a connected WAVE Bioreactor 20/50 or 200 system<br />

• Simultaneous monitoring of up to four different instrument<br />

configurations enables efficient data acquisition<br />

• A common platform and user interface for all culture volumes<br />

simplifies scale up<br />

• Secure and unalterable result files<br />

For more information see page 47.<br />

18 www.gelifesciences.com/bioprocess

---

pH sensor for Cellbag bioreactor<br />

Cellbag bioreactor can be fitted with an optical pH sensor, a sterile,<br />

single-use “spot” sensor embedded into the bottom of the bioreactor.<br />

To measure pH using the sensor, a WAVEPOD II controller is required for<br />

WAVE Bioreactor 20/50 system.<br />

Cellbag bioreactor pH sensor provides:<br />

• High measurement accuracy with minimal drift over time<br />

• Single-use format<br />

• Optimized for minimum as well as maximum Cellbag working volumes<br />

1<br />

<strong>Product</strong> highlights<br />

For more information, see page 45.<br />

ActiCHO Media System<br />

Fed-batch culture improves the yield and the concentration of highly active recombinant proteins by<br />

continuous supplementation with essential nutrients. PAA has developed an innovative media system for<br />

fed-batch culture of Chinese hamster ovary (CHO) cells that significantly speeds up the entire process. After<br />

a short adaptation phase the optimal feeding strategy can be rapidly identified, allowing early transfer<br />

from shaker flask to protein production in larger scale in a bioreactor.<br />

The ActiCHO Media System is specially optimized to provide high performance and protein yield with<br />

recombinant CHO-DG44 cells in suspension culture. The ActiCHO Media System consists of the adaptation<br />

medium ActiCHO SM, the production medium ActiCHO P, and two matched feeding supplements ActiCHO<br />

Feed-A and ActiCHO Feed-B, and a separate, concentrated stock solution of glucose.<br />

Features of the ActiCHO Media System include:<br />

• Ready-to-use starter kit and scale-up kit<br />

• Chemically defined<br />

• Significant increase in productivity<br />

• <strong>Product</strong>ion of proteins with high potency<br />

• Speeds up time to market<br />

For more information, see page 30.<br />

www.gelifesciences.com/bioprocess 19

---

1<br />

PreDictor RoboColumn<br />

<strong>Product</strong> highlights<br />

PreDictor RoboColumn units are miniaturized columns prepacked with a<br />

wide range of <strong>BioProcess</strong> chromatography media for high-throughput<br />

process development (HTPD). Designed for robotic liquid handling, they<br />

offer workstation owners a fast and flexible means of generating valuable<br />

data. HTPD shortens time-to-clinic and increases understanding in early<br />

process development by allowing the parallel evaluation of large numbers<br />

of experimental parameters with less sample consumption. With screening<br />

results from PreDictor RoboColumn and/or PreDictor plates, process<br />

developers can move on to prepacked HiTrap or HiScreen columns for<br />

further optimization/finetuning and verification prior to scale-up.<br />

PreDictor RoboColumn units include the following benefits:<br />

• Supports HTPD by allowing parallel screening of chromatographic<br />

conditions<br />

• Facilitates screening of a wide range of parameters with small sample<br />

consumption<br />

• Prepacked with a range of <strong>GE</strong> <strong>Healthcare</strong> <strong>BioProcess</strong> chromatography<br />

media<br />

• High-throughput workflow allows investigation of enlarged experimental<br />

workspace for better process understanding<br />

For more information, see page 156.<br />

HiScale columns<br />

HiScale columns were developed to simplify and accelerate process<br />

development and preparative chromatography. Key design features<br />

enable precise column packing, easy handling, and increased method<br />

reproducibility. The column tubing material is PEEK, which allows for<br />

increased pressure specifications. The QuickLock mechanism of the<br />

adapter shaft facilitates rapid and easy movement of the adapter,<br />

simplifying adjustments as well as disassembly and cleaning.<br />

Primary benefits of HiScale columns are:<br />

• Pressure stability up to 20 bar<br />

• Wide range of packing protocols<br />

• Ergonomical design enabling precise packing<br />

• Simple column handling and cleaning<br />

For more information, see page 132.<br />

20 www.gelifesciences.com/bioprocess

---

Capto Q ImpRes and Capto SP ImpRes<br />

Capto SP ImpRes and Capto Q ImpRes are strong cation and strong anion<br />

exchange media, respectively, for high-throughput intermediate purification<br />

and polishing of a wide range of biomolecules. The combination of the high<br />

flow agarose and the small particle size of Capto ImpRes media results in<br />

good pressure-flow properties as well as outstanding resolution.<br />

• Strong anion exchangers with high resolution for late intermediate<br />

purification and polishing when high throughput is essential<br />

• High resolution for high purity and high yield<br />

• Flexible process design due to a large operational window of flow rates and<br />

bed heights<br />

• Traditional Q and SP ligands for robust and predictable separations, and<br />

easy optimization and scale-up.<br />

For more details on Capto Q ImpRes<br />

and Capto SP ImpRes, see page 80.<br />

1<br />

<strong>Product</strong> highlights<br />

Capto L<br />

Capto L is an affinity chromatography medium for the process-scale capture<br />

of a broad range of antibodies and antibody fragments. It combines a<br />

rigid, high-flow agarose matrix with the immunoglobulin-binding protein L<br />

ligand. Capto L is therefore suitable for capture of a wide range of antibody<br />

fragments such as Fabs, single-chain variable fragments (scFv), and domain<br />

antibodies (dAbs).<br />

Key performance features of Capto L include:<br />

• High specificity for kappa light chain allows efficient capture of a broad<br />

selection of antibodies and antibody fragments<br />

• High dynamic binding capacity reduces process time and amount of<br />

medium used<br />

• High-flow agarose matrix increases productivity, economy and process<br />

design flexibility<br />

For more details, see page 84.<br />

Capto Core 700<br />

Capto Core 700 is designed for flowthrough purification of large proteins or<br />

viruses in vaccine processes. The core bead design of this medium gives dualfunctional<br />

properties that make it possible to combine size separation with<br />

binding chromatography. The performance of the medium can be compared<br />

with gel filtration chromatography, but Capto Core 700 offers improved<br />

productivity and process economy. The multimodal property of the ligand in<br />

the core ensures strong binding with most impurities over a wide range of pH<br />

and salt concentration.<br />

Capto Core 700 enables:<br />

• Higher sample loads<br />

• Higher flow rates<br />

• Simple optimization and scale-up<br />

For more details, see page 91.<br />

www.gelifesciences.com/bioprocess 21

---

1<br />

MabSelect SuRe LX<br />

<strong>Product</strong> highlights<br />

MabSelect SuRe LX is an alkali-stabilized, Protein A-derived affinity medium<br />

with a binding capacity for monoclonal antibodies (MAbs) exceeding that<br />

of MabSelect SuRe at longer residence times. As an example, at 6 min<br />

residence time, the dynamic binding capacity of MabSelect SuRe LX for<br />

human IgG is approximately 60 g/L. This special combination of high<br />

binding capacity plus alkaline stability gives manufacturers of MAbs many<br />

opportunities to improve process economics and product quality.<br />

Benefits of MabSelect SuRe LX include:<br />

• Outstanding binding capacity<br />

• Quick, efficient processing of large volumes of high-titer bioreactor feeds<br />

• Higher density eluates increase operating flexibility and allow smaller<br />

unit operations<br />

• Alkali-tolerant Protein A-derived ligand allows the use of 0.1-0.5 M<br />

sodium hydroxide for Cleaning-In-Place (CIP)<br />

• Enhanced protease resistance of the Protein A ligand reduces leakage<br />

• Generic elution conditions for different monoclonal antibodies enable<br />

platform purifications<br />

For more information, see page 83.<br />

ÄKTA avant system<br />

Available in two versions, ÄKTA avant is a preparative chromatography<br />

system intended for method and process development. With flow rates up<br />

to 25 mL/min, ÄKTA avant 25 is designed for media screening and method<br />

optimization. ÄKTA avant 150, with flow rates up to 150 mL/min, is designed<br />

for scaling up to larger columns. ÄKTA avant is operated by UNICORN 6<br />

control software, which has been developed to increase productivity and<br />

efficiency. ÄKTA avant offers a complete solution for fast, high-quality<br />

protein separations while maintaining flexibility and reliability.<br />

Speed, scalability, and security:<br />

• Maximum information from minimum number of experiments with<br />

integrated Design of Experiments (DoE) support<br />

• Quick and predictable scale-up from screening and optimization on<br />

HiScreen columns to fine-tuning and robustness testing on AxiChrom<br />

columns<br />

• Built-in cooled fraction collector, column run data log book and<br />

FDA 21 CFR Part 11 compliant software<br />

For more information on ÄKTA avant,<br />

see page 140.<br />

22 www.gelifesciences.com/bioprocess

---

Slurry tanks<br />

1<br />

Slurry tanks help to generate a homogenous slurry and thus play a<br />

critical role in ensuring a well-packed column and a robust and efficient<br />

purification process. A well-packed column is characterized by high<br />

resolution (with positive impacts on purity and yield) and high bed stability,<br />

characteristics that help to avoid costly repacking due to poor HETP and<br />

asymmetry.<br />

Slurry tanks provide:<br />

• Homogenous slurry concentrations<br />

• More efficient column packing<br />

• Improved operator safety and process economics<br />

<strong>Product</strong> highlights<br />

For more information, see page 137.<br />

Inline conditioning for process chromatography systems<br />

Current trends in manufacturing biopharmaceuticals have put demands<br />

on securing increased buffer supplies delivered at precise times and at<br />

correct concentration and flow rates. To meet these demands, advanced<br />

technologies such as inline conditioning (IC) have gained increasing<br />

interest, not only because they reduce the need for large storage tanks,<br />

but also because IC can deliver correct solutions for a specific process need<br />

at a lowered total cost of ownership. <strong>GE</strong> <strong>Healthcare</strong> has delivered a wide<br />

range of IC systems, providing a reproducible, fully automated IC process.<br />

Advantages of inline conditioning include:<br />

• Timely buffer delivery<br />

• Automated IC process increases reproducibility<br />

• Allows for use of smaller tanks or disposable bags<br />

• Reduces or eliminates the need for CIP and WFI demands<br />

• Provides better process economics<br />

For more information, see page 144.<br />

www.gelifesciences.com/bioprocess 23

---

1<br />

MicroCal DSC systems<br />

<strong>Product</strong> highlights<br />

MicroCal Differential Scanning Calorimetry (DSC) systems help you to<br />

screen for changes in protein stability and provide critical guidance in<br />

protein engineering through pre-formulation, process development,<br />

to formulation of the final biopharmaceutical product. The technique<br />

measures heat absorbed by the sample as the protein unfolds during a<br />

controlled temperature increase and without the use of labels or artificial<br />

probes. The resulting measure of thermostability gives an indication of the<br />

protein’s long-term stability, without having to perform time-consuming<br />

accelerated stability studies.<br />

MicroCal DSC systems are designed to provide:<br />

• Selection of the most stable engineered antibody<br />

• Selection for the most stable protein storage conditions<br />

• Identification of the optimal elution conditions in antibody purification<br />

For more information, see page 206.<br />

Smart Asset Management Services<br />

Pharmaceutical and biotech companies face many challenges today,<br />

such as higher operational costs, regulatory pressures, and shrinking profit<br />

margins. For corporations, it is critical to reduce costs while improving<br />

scientific productivity. To help with these challenges, <strong>GE</strong> <strong>Healthcare</strong> offers<br />

an array of services, including the Smart Asset Management Services<br />

program, Performance Solutions, LEAN Six-Sigma, Fast Trak process<br />

development and facility validation services.<br />

Smart Asset Management Services (SAMS) is helping leading companies<br />

around the world meet the challenges of controlling costs and improving<br />

productivity in a difficult business environment.<br />

For more information on how<br />

<strong>GE</strong> <strong>Healthcare</strong> Smart Asset<br />

Management Services<br />

can help your company, visit<br />

www.gelifesciences.com/service<br />

Our SAMS program can help companies:<br />

• Reduce operating costs by up to 20% through the implementation of<br />

an asset management program<br />

• Deploy on-site service engineers to improve instrument uptime and<br />

output<br />

• Apply LEAN Six-Sigma to operations to enhance productivity<br />

• Remove administrative tasks from your scientists to allow increased<br />

scientific productivity<br />

• Gain access to innovative financing solutions<br />

• Facilitate informed decision-making on capital purchases, improve<br />

asset productivity, and reduce maintenance costs through Asset<br />

Intelligence Solutions<br />

24 www.gelifesciences.com/bioprocess

---

www.gelifesciences.com/bioprocess 25

---

2Cell culture<br />

Cell culture media, sera and reagents 28<br />

Microcarrier 31<br />

26 www.gelifesciences.com/bioprocess

---

2<br />

Cell culture<br />

www.gelifesciences.com/bioprocess 27

---

2<br />

Cell culture media, sera<br />

and reagents<br />

Cell culture<br />

A suitable cell culture medium is<br />

a prerequisite for a successful cell<br />

cultivation process, irrespective<br />

of culture size or specific target<br />

application. The outcome of the<br />

cultivation will affect subsequent<br />

harvest and purification steps and<br />

consequently the yield and quality of<br />

the end-product.<br />

<strong>GE</strong> <strong>Healthcare</strong>'s PAA product offering<br />

includes animal and human sera, liquid<br />

and powder media, reagents and<br />

supplements. <strong>Product</strong>ion facilities in<br />

Austria, North America, and Australia,<br />

sales subsidiaries and a network of<br />

more than 50 distributors provide the<br />

highest service level to meet customer<br />

requirements. In 2009 PAA expanded<br />

its FDA registered and GMP licensed<br />

manufacturing site in Europe with a<br />

modern powder production facility. The<br />

entire powder facility is strictly free of<br />

animal components (ACF) and designed<br />

to facilitate the regulatory submission<br />

process for biopharmaceutical<br />

production. The latest technologies in<br />

both milling and blending (including<br />

Process Analytical Technology; PAT)<br />

provide customers with true inter- and<br />

intra-batch homogeneity of powder<br />

media up to 8000 kg batch sizes. In<br />

addition, PAA now offers a complete<br />

service from cell clone optimization<br />

and media adaptation to contract<br />

manufacturing.<br />

For more information about PAA’s<br />

products and offerings, please<br />

visit www.gelifesciences.com/paa<br />

or www.paa.com<br />

28 www.gelifesciences.com/bioprocess

---

<strong>Product</strong> portfolio<br />

More than 20 years of experience as a cell culture<br />

media manufacturer have made PAA a global expert. Its<br />

processes are set at pharmaceutical standards and GMP<br />

regulations defined by the European Union, the United<br />

States FDA, and the ICH. PAA Laboratories uses only<br />

carefully selected and screened raw materials and EP<br />

grade water in the manufacture of its liquid cell culture<br />

products. The high standard of the QA and QC procedures<br />

ensures that only highest quality products are supplied to<br />

customers.<br />

Liquid and powdered media<br />

The product range includes classical media (DMEM, RPMI<br />

1640, etc.), serum and protein free media, and cell type<br />

specific media for different applications such as stem cell,<br />

hybridoma and neuronal cultivation, as well as cytogenetic<br />

diagnosis. PAA offers a range of powdered basal media<br />

and buffer solutions. From raw material selection to the<br />

finished product, the whole process conforms to the FDA<br />

and EU‐GMP guidelines.<br />

Sera<br />

A core competence of PAA is the sourcing and<br />

manufacturing of a variety of sera products from a wide<br />

range of origins. PAA manufactures large ‘true pool’ batches<br />

ensuring high levels of batch-to-batch consistency. PAA´s<br />

sera portfolio comprises: Bovine sera (fetal bovine serum,<br />

newborn calf serum, calf serum, aldult bovine serum) and<br />

a variety of other animal sera and human sera. Special<br />

treatments such as gamma irradiation, heat inactivation, UV<br />

treatment, dialysis, and others are available. Special testing<br />

can be performed upon request.<br />

Reagents<br />

PAA offers a range of amino acid solutions, vitamins,<br />

antibiotics, selection antibiotics and cell detachment<br />

agents. In addition, they offer cell type specific growth<br />

supplements for hybridoma cloning, amniocyte cultivation<br />

and serum-free cell culture.<br />

Buffer solutions<br />

PAA supplies standard salt solution buffers (PBS, DPBS),<br />

balanced salt solutions (HBSS), and pH control buffers<br />

(sodium bicarbonate and HEPES). Cell culture grade water<br />

purified to EP standards is also available.<br />

Powder media for biopharmaceutical production<br />

PAA`s manufacturing plant in Austria houses a modern<br />

dry powder media production unit that meets the ongoing<br />

demands of the Biopharmaceutical Industry of the 21st<br />

century. PAA developed and implemented several new<br />

technologies, including Process Analytical Technology (PAT)<br />

for the manufacturing process of dry powder media. From<br />

raw material selection to the finished product, the whole<br />

process conforms to the FDA and EU-GMP guidelines.<br />

The latest technologies in both milling and blending provide<br />

customers with full homogeneity of powder media from<br />

1 to 8000 kg batch sizes. PAA utilizes air classification mills<br />

that consist of an impact mill and air classifier. The high<br />

air flow rates feature temperature controlled grinding to<br />

minimize the impact on temperature sensitive components.<br />

The particle size distribution of the end product is narrow<br />

and tightly controlled by the air classifier. For excellent<br />

media solubility, the cut off is precisely defined at 250 μm.<br />

Four different conical blenders guarantee a consistent<br />

blending process from small scale up to large volume<br />

batch sizes. The result is a high quality, free flowing, easy to<br />

dissolve, and fully homogenized powder.<br />

Modern technology:<br />

• GMP production processes<br />

• Strictly free of animal components (ACF)<br />

• Multi-channel FTIR measurement<br />

• Temperature and humidity control<br />

• CIP and DIP systems<br />

High flexibility:<br />

• Batch sizes from 1 to 8000 kg<br />

• Customized media production<br />

• Pure EP/USP grade chemicals upon request<br />

• Short lead time<br />

• Flexible packaging and delivery options<br />

2<br />

Cell culture<br />

www.gelifesciences.com/bioprocess 29

---

2<br />

Cell culture<br />

Network of competence speeds your time to<br />

market<br />

As one the world’s leading cell culture companies, PAA<br />

provides expertise in the design, development and<br />

production of culture media. Combining this in-depth<br />

knowledge with the expertise of two business partners,<br />

including cloning and vector design, cell line development,<br />

media optimization, and upstream processing, the expert<br />

team offers its customers individual process optimization<br />

for every aspect of their cell culture requirements.<br />

In addition, PAA can provide support and guidance on<br />

a range of technical issues to make sure its customers<br />

achieve their milestones.<br />

ActiCHO Media System – the all-inclusive<br />

CHO media kit for active cells<br />

PAA has developed a ready-to-use fed-batch and batch<br />

media system for recombinant CHO-DG44 cells. The<br />

ActiCHO Media System for easy feeding and easy scale-up<br />

provides high performance, high protein yield, and speeds<br />

up the process significantly.<br />

The ActiCHO Media System consists of the adaptation<br />

medium ActiCHO SM, the production medium ActiCHO P,<br />

and two matched feeding supplements ActiCHO Feed-A<br />

and ActiCHO Feed-B. The media and supplements do not<br />

contain hydrolysates or animal components, in compliance<br />

with regulatory demands related to virus safety.<br />

The special feature of the ActiCHO Media System is the<br />

fact that PAA offers the system as a ready-to-use starter<br />

kit. After a short adaptation phase, the defined and easy<br />

feeding strategy allows early transfer from shaker flasks<br />

to protein production on a larger scale in a bioreactor. PAA<br />

developed a level 1 starter kit for the initial testing on a<br />

25 mL scale. The next scale up option is a level 2 test kit<br />

with enough material to run a 5 L scale fed-batch. Both<br />

liquid kits are available with or without insulin. Additionally,<br />

PAA offers a 10 L media system starter powder kit. All<br />

kit components can be purchased individually, and<br />

customized production and filling is also available.<br />

Features:<br />

• Ready-to-use starter- and scale-up kit<br />

• Chemically defined<br />

• Significant increase in productivity<br />

• <strong>Product</strong>ion of proteins with high potency<br />

• Speeds up time to market<br />

Available ActiCHO Test Kits<br />

ActiCHO Test Kit, Level 1, with or without insulin<br />

<strong>Product</strong> Volume (mL) Units<br />

ActiCHO SM CD 500 1<br />

ActiCHO P CD 500 1<br />

ActiCHO Feed-A CD 100 2<br />

ActiCHO Feed-B CD 10 2<br />

ActiCHO Test Kit, Level 2, with or without insulin<br />

<strong>Product</strong> Volume (mL) Units<br />

ActiCHO SM CD 1000 2<br />

ActiCHO P CD 1000 5<br />

ActiCHO Feed-A CD 500 5<br />

ActiCHO Feed-B CD 50 5<br />

ActiCHO Powder Kit – without insulin<br />

<strong>Product</strong> Prepares for Units<br />

ActiCHO SM Powder Base CD 5 L 1<br />

ActiCHO P Powder Base CD 10 L 1<br />

ActiCHO Feed-A Powder Base CD 5 L 1<br />

ActiCHO Feed-B Powder Base CD 0.5 L 1<br />

For more information about PAA’s products and offerings,<br />

please visit www.gelifesciences.com/paa or www.paa.com<br />

30 www.gelifesciences.com/bioprocess

---

Microcarrier cell culture<br />

Microcarrier selection guide<br />

Industrial-scale cell culture using<br />

microcarriers has proven to be<br />

reliable and cost-effective for the<br />

manufacture of both human and<br />

animal healthcare products including<br />

viral vaccines, interferons, and animal<br />

and human growth hormones.<br />

Microcarrier technology can reduce<br />

culture medium and serum costs by<br />

over 50%, decrease labor and lessen<br />

the risk of contamination. Interest in<br />

microcarrier technology has grown<br />

today to include in vivo use in a<br />

number of therapeutic applications.<br />

<strong>GE</strong> <strong>Healthcare</strong> supplies microcarriers<br />

for a wide range of applications for<br />

cell immobilization, particularly in<br />

the area of eucaryotic cell culture.<br />

Microcarriers can be used to grow a<br />

variety of cell types, and with different<br />

hardware investments, or production<br />

technology.<br />

Our range of microcarrier products<br />

includes Cytodex, Cytopore, and<br />

Cytoline.<br />

Quality control<br />

The entire line of microcarriers from<br />

<strong>GE</strong> <strong>Healthcare</strong> is thoroughly quality<br />

controlled, including a function test on<br />

all batches with at least one cell type.<br />

Certificates of Analysis are available.<br />

Regulatory Support Files<br />

Regulatory Support Files have been<br />

prepared for Cytodex, Cytopore and<br />

Cytoline microcarriers. These files<br />

contain information to help industrial<br />

scale manufacturers validate their<br />

own production processes.<br />

For more information, please visit<br />

www.gelifesciences.com/cellcult<br />

2<br />

Cell culture<br />

Surface<br />

Macroporous<br />

High Density<br />

Macroporous<br />

Cytodex 1 & 3 Cytopore 1 & 2 Cytoline 1<br />

Stirred tank<br />

Batch culture<br />

Stirred tank<br />

Perfusion culture<br />

Fluidized bed<br />

Perfusion culture<br />

www.gelifesciences.com/bioprocess 31

---

2<br />

Cell culture<br />

Cytodex 1 and 3<br />

Cytodex microcarriers are based on cross-linked dextran<br />

beads. The microporous beads are transparent, spherical<br />

and hydrated, and are substituted with positively charged<br />

groups. The microcarriers have a mean diameter of 200 µm<br />

and a density of 1.04 g/mL. Their small size allows them to<br />

be easily transported through tubing. Cytodex has been<br />

derivatized form two types, 1 and 3. Cytodex 3 has been<br />

coated with gelatine of porcine skin origin.<br />

Cytodex microcarriers are designed for use in stirred tank<br />

cultures – homogeneous environments for cell growth<br />

in which culture parameters are easily monitored and<br />

controlled. Cells grow on the surface of Cytodex, which<br />

facilitates inspection, harvesting and infection of the cells.<br />

The microporosity of Cytodex enables nutrient supply to all<br />

sides of the cells. Cytodex microcarriers are autoclavable at<br />

121°C for 20 min.<br />

Application areas<br />

Cytodex is intended for the culture of truly anchoragedependent<br />

cells, a large proportion of which are used<br />

in the production of viral vaccines. Another major<br />

application for Cytodex is in the production of recombinant<br />

proteins. Epithelial and endothelial cells connect through<br />

tight junctions and form a cellular layer around the<br />

microcarriers.<br />

Cytodex microcarriers are used in batch and perfusion<br />

systems, in stirred cultures, and WAVE Bioreactors, as well<br />

as to increase the surface area of traditional stationary<br />

monolayers and roller cultures.<br />

Transmission electron micrograph of pig kidney<br />

cells growing on Cytodex 1.<br />

(Original photograph by B. Meignier and<br />

J. Tektoff, IFFA-Mérieux, Lyon, France,<br />

reproduced with kind permission.)<br />

Cytopore 1 and 2<br />

Cytopore microcarriers are hydrophilic DEAE exchangers<br />

with a mean diameter of 230 µm and a density of 1.03 g/mL.<br />

They are based on a cross-linked cotton cellulose matrix<br />

and have an average pore size of 30 µm. The microcarriers<br />

are both macroporous and microporous. Cells can enter the<br />

interior of the microcarrier where they are protected from<br />

shear forces generated by the stirrer, aeration, spin filter<br />

or bubbles created through sparging. The microporosity<br />

facilitates nutrient supply to all sides of the cells. Cytopore<br />

microcarriers are transparent before reaching higher cell<br />

densities and easily transported through tubing. They can<br />

be autoclaved at 121°C for 20 min.<br />

The macroporous<br />

structure of Cytopore<br />

is clearly seen on<br />

a cross-sectioned<br />

“empty” microcarrier.<br />

Application areas<br />

Cytopore 1 has a charge density of 1.0 meq/g and is<br />

designed primarily for the production of recombinant CHO<br />

cells in stirred tank cultures. Cytopore 2, with a charge<br />

density of 1.8 meq/g, is optimized for truly anchoragedependent<br />

cells which require a higher charge capacity<br />

for optimal cell growth. Cytopore functions well in the final<br />

stages of protein production when anchorage-dependent<br />

cells remain on the microcarriers for prolonged periods of<br />

time, protected from shear forces. Cytopore is suitable for<br />

the culture of other shear-sensitive cells including some<br />

hybridomas, insect cells and even some bacteria.<br />

Cytopore 1 cut in half,<br />

filled with CHO cells.<br />

32 www.gelifesciences.com/bioprocess

---

Cytoline 1<br />

Cytoline microcarriers are based on a matrix of polyethylene and silica.<br />

The polyethylene makes the microcarrier hydrophobic while the silica gives<br />

it a slightly negative charge. The silica also increases the density of the<br />

microcarriers, enabling them to be used in fluidized bed cultures. Cytoline 1<br />

has a density of 1.3 g/mL. Cytoline microcarriers are macroporous with a pore<br />

size between 10 and 400 µm. Cells gain easy access to the interior of Cytoline,<br />

where they are protected from shear forces. Since the microcarriers are not<br />

microporous, nutrients can only reach the cells through the macroporous<br />

structure.<br />

Cytoline microcarriers are lentil-shaped with a length of 2 to 2.5 mm. This size<br />

makes their transfer through tubing more difficult, but facilitates their retention<br />

in fluidized bed or perfusion cultures.<br />

Weighted Cytoline microcarriers are intended for use in fluidized bed reactors<br />

such as Cytopilot Mini, but can also be used in stirred tank, packed bed and<br />

suspension cultures. They are autoclavable at 121°C, but melt at higher<br />

temperatures.<br />

2<br />

Cell culture<br />

Application areas<br />

Cytoline 1 is intended for the culture of CHO cells. It can also be used for the<br />

culture of other cells that attach well, are less sensitive to shear forces, and<br />

require a high circulation rate in the reactor. Cytoline microcarriers can also be<br />

used to immobilize insect cells and bacteria.<br />

Cytoline 1 with<br />

recombinant CHO<br />

cells attached.<br />

www.gelifesciences.com/bioprocess 33

---

3ReadyToProcess<br />

ReadyToProcess Platform 36<br />

WAVE Bioreactor systems 38<br />

Single-use fluid management and filtration 52<br />

ReadytoProcess connectivity 66<br />

ReadyToProcess chromatography 70<br />

34 www.gelifesciences.com/bioprocess

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 35

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

ReadyToProcess platform<br />

A complete suite of systems and<br />

accessories for cell culture and<br />

fermentation, separation and<br />

purification, fluid management,<br />

and connectivity, <strong>GE</strong> <strong>Healthcare</strong>’s<br />

ReadyToProcess platform is designed<br />

to help you plug right into today’s<br />

challenges – simplifying and<br />

accelerating biopharmaceutical<br />

manufacturing, reducing timeconsuming<br />

routines, and ultimately<br />

increasing your manufacturing<br />

agility.<br />

ReadyToProcess brings seamless,<br />

scalable implementation to your<br />

biopharmaceutical operations both<br />

upstream and downstream. Flexibility,<br />

rapid response, and improved product<br />

safety are possible from start to<br />

finish. And of course our systems are<br />

manufactured to the high quality and<br />

regulatory standards you have come<br />

to expect from <strong>GE</strong> <strong>Healthcare</strong>.<br />

Easier setup and changeover, no<br />

need for cleaning and validation<br />

procedures, ReadyToProcess helps<br />

to turn downtime into uptime while<br />

also maintaining the integrity of your<br />

operations.<br />

Visit us on the web at<br />

www.gelifesciences.com/<br />

readytoprocess<br />

36 www.gelifesciences.com/bioprocess

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 37

---

1<br />

WAVE Bioreactor systems<br />

2<br />

3<br />

ReadyToProcess<br />

WAVE Bioreactor is an effective, cost<br />

efficient system for cell culture. Cells<br />

and culture medium reside within<br />

the presterilized Cellbag bioreactor.<br />

A rocking motion generates waves<br />

in the culture fluid, providing optimal<br />

mixing and gas transfer, resulting in an<br />

excellent environment for cell growth.<br />

The disposable Cellbag eliminates<br />

the need for cleaning, sterilization,<br />

and validation. Multiple instrument<br />

configurations are available for<br />

suspension, microcarrier, batch, fedbatch<br />

or perfusion culture.<br />

Visit us on the web at<br />

www.gelifesciences.com/wave<br />

Features/benefits of the WAVE Bioreactors<br />

include:<br />

• Convenience: Presterilized, single-use<br />

Cellbag bioreactors protect against the<br />

risk of cross-contamination, require no<br />

cleaning, involve minimal validation, and<br />

are supplied in a ready-to-use format<br />

• Reliability: Cellbag based bioreactors,<br />

including all fittings and filters, are<br />

supplied sterile and ready-to-use. They<br />

are suitable for cGMP commercial<br />

production and a biosafety cabinet is<br />

not required for inoculation or sampling.<br />

• Flexibility: Multiple instrument<br />

configurations for suspension,<br />

microcarrier, batch, fed-batch, or<br />

perfusion culture<br />

• Versatility: The systems are capable of<br />

handling culture volumes from 100 mL<br />

to 500 L<br />

38 www.gelifesciences.com/bioprocess

---

1<br />

Applications<br />

Monoclonal antibodies<br />

WAVE Bioreactor has been used extensively for monoclonal<br />

antibody production. Culture can be started at low volume<br />

and then fresh media added whenever the cell count is<br />

sufficiently high. This enables inoculum scale-up without<br />

transfers. Batches ranging from 100 mL to 500 L have<br />

been run with cell densities over 10 × 10 6 cells/mL and<br />

productivity and product quality comparable to stirred<br />

tank bioreactors. Dissolved oxygen concentrations are not<br />

limiting and remain above 50% saturation.<br />

Anchorage-dependent cells<br />

Agitation in the WAVE Bioreactor is powerful enough to mix<br />

and aerate the culture, yet it is gentle enough to cultivate<br />

anchorage-dependent cells on various microcarriers. The<br />

wave motion prevents settling and provides oxygenation<br />

without bubbles.<br />

Virus production<br />

WAVE Bioreactor provides a closed system that is suitable<br />

for virus production. In a gene therapy application, human<br />

293 cells have been grown in suspension and then infected<br />

with recombinant adenovirus. Cells grew to 4 × 10 6 cells/mL<br />

and virus production was 1 × 10 5 virus particles/cell. WAVE<br />

Bioreactor produces viruses under complete containment<br />

without the need for a biosafety cabinet.<br />

Selection guide – Systems<br />

Culture volume Cellbag WAVE Bioreactor system<br />

50 to 250 mL Cellbag 500 mL 2/10<br />

50 to 500 mL Cellbag 1 L 2/10<br />

100 to 1000 mL Cellbag 2 L 2/10<br />

20/50 + Kit 20<br />

500 mL to 5 L Cellbag 10 L 2/10<br />

20/50 + Kit 20<br />

1 to 10 L Cellbag 20 L 20/50 + Kit 20<br />

1 to 10 L Cellbag 22 L 20/50 + Kit 50<br />

5 to 25 L Cellbag 50 L 20/50 + Kit 50<br />

5 to 50 L Cellbag 100 L 200<br />

10 to 100 L Cellbag 200 L 200<br />

50 to 250 L Cellbag 500 L 500/1000 + Kit 500<br />

100 to 500 L Cellbag 1000 L 500/1000 + Kit 1000<br />

For information on using Cellbag with WAVE Bioreactor<br />

systems, see page 45.<br />

cGMP production<br />

WAVE Bioreactor is in use in cGMP applications producing<br />

inoculum for large conventional bioreactors, and also for<br />

clinical and commercial production of human therapeutics.<br />

Reduced cleaning and validation requirements make this<br />

an excellent system for cGMP applications.<br />

Insect cell/baculovirus<br />

The high oxygen supply capability of the WAVE Bioreactor<br />

makes it suitable for insect cell culture. Cell densities over<br />

9 × 10 6 cells/mL are routinely achieved. Baculovirus yields<br />

are higher than with conventional bioreactors. WAVE<br />

Bioreactor is extremely easy to operate and inoculum<br />

scale-up and infection can be done inside the bioreactor,<br />

reducing the need for transfers.<br />

Custom uses<br />

WAVE Bioreactor has many other uses, such as keeping<br />

in-process inoculum pools agitated and aerated prior to<br />

use; bead-to-bead transfer; thawing, and media mixing.<br />

Custom Cellbags can be provided for WAVE Bioreactor for<br />

any working volume between 100 mL and 500 L.<br />

Selection guide – Instrumentation options<br />

Module 1<br />

CO2 /Air Mix Controller •<br />

Dissolved Oxygen<br />

Optical Monitor<br />

O2 /Air Mix Controller •<br />

pH Controller<br />

Loadcell 2<br />

Perfusion Controller 3<br />

Description<br />

Infrared CO sensor and aeration system provides a<br />

2<br />

continuous supply of CO 2<br />

conditioned air to the Cellbag<br />

• Range: 0% to 12% CO 2<br />

• Monitor with miniature fiber-optic microprobes enabling<br />

real-time measurement of dissolved oxygen<br />

• High accuracy PMT optical detector with phase shift<br />

measurement<br />

• Range 0% to 50% O 2<br />

• Reusable DOOPT-PROBE purchased separately<br />

Provides continuous supply of O enriched gas to<br />

2<br />

the Cellbag for insect cell, virus, and high cell density<br />

applications.<br />

• Maintains low-oxygen environment for near-anaerobic<br />

applications<br />

• Range 0% to 50% O 2<br />

• Enables continuous pH measurement and control using<br />

CO 2<br />

or acid/base addition.<br />

• Embedded optical pH sensor is single use, and available<br />

pre-installed in Cellbags.<br />

• Enables online measurement of weight.<br />

• Used for automated fill/harvest and perfusion operations<br />

where precise volume control is critical.<br />

• Perfusion controller with Loadcell<br />

1<br />

Instrument Modules are available in WAVEPOD II for 2/10 and 20/50 system. Fully<br />

integrated modules are available for 200 and 500/1000 system.<br />

2<br />

Fully integrated in 20/50 system (option); 200 and 500/1000 system (standard).<br />

3<br />

For 2/10 system instrument only.<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 39

---

1<br />

2<br />

Overview – Systems<br />

Specifications 500/1000 system 2,3 200 system 2 20/50 system 1 2/10 system<br />

Working volume<br />

range<br />

Integral features<br />

50 to 500 L 5 to 100 L 0.1 to 25 L 0.05 to 5 L<br />

• Speed/angle control<br />

• Temperature control<br />

• Aeration<br />

• Loadcell<br />

• Speed/angle control<br />

• Temperature control<br />

• Aeration<br />

• Loadcell<br />

• Speed/angle control<br />

• Temperature control<br />

• Aeration<br />

• Speed/angle control<br />

• Temperature control<br />

• Aeration<br />

3<br />

ReadyToProcess<br />

Options<br />

• CO2MIX<br />

• O2MIX<br />

• DO<br />

• pH<br />

Weight with Kit 500:<br />

925 kg<br />

with Kit 1000:<br />

1020 kg<br />

Dimensions<br />

201 × 124 × 160 cm<br />

with Kit 500:<br />

226 × 124 × 160 cm<br />

with Kit 1000:<br />

226 × 231 × 160 cm<br />

• CO2MIX<br />

• O2MIX<br />

• DO<br />

• pH<br />

• Dual air/temperature<br />

• WAVEPOD II controller<br />

• CO2MIX<br />

• O2MIX<br />

• DO<br />

• pH<br />

• Loadcell<br />

• Dual air/temperature<br />

350 kg 16 kg 4.2 kg<br />

185 × 110 × 112 cm<br />

For installation,<br />

if required, unit<br />

can be tilted<br />

573 × 465 × 179 mm<br />

with Kit 20:<br />

711 × 575 × 254 mm<br />

with Kit 50:<br />

775 × 700 × 254 mm<br />

• CO2MIX<br />

• O2MIX<br />

• DO<br />

• pH<br />

• Perfusion controller<br />

489 × 330 × 200 mm<br />

Power<br />

• 200 to 240 VAC<br />

• 50/60 Hz, 30 A<br />

• 3-Phase<br />

• Phase-phase ± 5%<br />

• NEMA L2130 plug<br />

• 200 to 240 VAC<br />

• 50/60 Hz, 15 A<br />

• 3-phase<br />

• Phase-phase ± 5%<br />

• NEMA L2130 plug<br />

• 100/240 VAC<br />

• 50/60Hz, 6/3 A<br />

• 100/240 VAC<br />

• 50/60Hz, 4 A<br />

1<br />

20/50 system requires selection of Cellbag Holder Kit 20 or 50.<br />

2<br />

Unit provided with casters.<br />

3<br />

500/1000 system requires selection of Cellbag Holder Kit 500 or 1000.<br />

All BASE units are CE/CSA certified.<br />

40 www.gelifesciences.com/bioprocess

---

WAVE Bioreactor 500/1000 system<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

SYSTEM1000EH with DO 1 28-4115-46<br />

SYSTEM1000EH with CO2, O2, DO, PH, ANALOG 1 28-4115-59<br />

SYSTEM1000EH with O2, DO, ANALOG 1 28-4115-60<br />

SYSTEM1000EH with CO2, O2, DO, PH 1 28-4115-61<br />

SYSTEM1000EH with O2, DO 1 28-4115-62<br />

SYSTEM1000EH with CO2, PH 1 28-4115-63<br />

KIT500EH for Base 500/1000EH 1<br />

(includes HOLDER500 and HEATERPAD500) 1 28-4115-31<br />

KIT1000EH for Base 500/1000EH 2<br />

(includes HOLDER1000 and HEATERPAD1000) 1 28-4115-32<br />

1<br />

2<br />

3<br />

WAVE Bioreactor 500/1000 system comprises integral<br />

rocking, temperature, weight, and airflow controllers. The<br />

self-contained system is designed for use with working<br />

culture volumes of between 50 and 500 L in applications<br />

such as inoculum scale-up, R&D, process development,<br />

GMP production, vaccine production, and antibody<br />

manufacture. For additional flexibility, optional modules<br />

including DO, CO 2<br />

, O 2<br />

, weight/perfusion, and pH control can<br />

be added while built-in Ethernet and MODBUS data ports<br />

allow interfacing with Windows-based PC software for data<br />

logging and daisy chaining with other WAVE Bioreactor<br />

systems and instrument modules.<br />

Features of the system include:<br />

• Touch panel operator interface<br />

• Direct drive electronic linear motor<br />

• Adjustable rocking rate from 4 to 25 rocks/min with<br />

acceleration control<br />

• Adjustable rocking angle from 0.5° to 4° Integral<br />

temperature controller with heater Integral weight<br />

controller<br />

• Integral airflow controller<br />

• Integral PID controller for automatic temperature,<br />

O 2<br />

, CO 2<br />

, and pH adjustment<br />

• Real-time data monitoring<br />

• RS-485 MODBUS communications port<br />

• 10Base-T Ethernet communications port Remote alarm<br />

contact and printer interface Stainless-steel containment<br />

enclosure<br />

CO2 = CO 2<br />

-air gas mix controller, O2 = O 2<br />

-air gas mix controller, DO = Dissolved<br />

oxygen monitor (optical), PH = pH controller, ANALOG = Analog output card<br />

1<br />

Accomodates 1 × 500 L Cellbag only.<br />

2<br />

Accomodates 1 × 1000 L Cellbag only.<br />

Technical specifications<br />

Dimensions<br />

(L × W × H) Base unit: 201 × 124 × 160 cm (79 × 49 × 63 in)<br />

With KIT500EH: 226 × 124 × 160 cm (89 × 49 × 63 in)<br />

With KIT1000EH: 226 × 231 × 160 cm (89 × 91 in × 63 in)<br />

Weight<br />

Utilities<br />

Environmental<br />

Base unit: 700 kg (1500 lb)<br />

With KIT500EH: 925 kg (2000 lb)<br />

With KIT1000EH: 1020 kg (2250 lb)<br />

Voltage: 100-120/220-240 VAC<br />

Frequency: 50/60 Hz<br />

Maximum current: 15 A<br />

Power: 12 KVA<br />

This equipment is designed for use under the following<br />

conditions:<br />

• Indoor use<br />

• 5°C to 40°C<br />

• Up to 80% maximum relative humidity (rh) at 31°C decreasing<br />

linearly to 50% rh at 40°C<br />

For information on using Cellbag with<br />

WAVE Bioreactor systems, see page 45.<br />

Visit us on the web at<br />

www.gelifesciences.com/wave<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 41

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

WAVE Bioreactor 200 system<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

SYSTEM200EHDual with DualTemp, DualAir 1 28-9366-86<br />

SYSTEM200EHDual with CO2, ANALOG 1 28-4115-45<br />

SYSTEM200EHDual with CO2, O2, DO 1 28-4115-47<br />

SYSTEM200EHDual with CO2, O2, ANALOG 1 28-4115-44<br />

SYSTEM200EHDual with CO2, O2, DO, ANALOG 1 28-4115-43<br />

SYSTEM200EHDual with CO2, pHOPT, ANALOG 1 28-9849-53<br />

SYSTEM200EHDual with CO2, O2, DOOPT, pHOPT, ANALOG 1 28-9849-57<br />

SYSTEM200EH with CO2 1 28-4115-57<br />

SYSTEM200EH with CO2, O2 1 28-4115-55<br />

SYSTEM200EH with CO2, O2, ANALOG 1 28-4115-52<br />

SYSTEM200EH with CO2, O2, DO, ANALOG 1 28-4115-51<br />

SYSTEM200EH with O2, DO, ANALOG 1 28-4115-53<br />

SYSTEM200EH with CO2, pHOPT, ANALOG 1 28-9849-54<br />

SYSTEM200EH with CO2, O2, DOOPT, pHOPT, ANALOG 1 28-9847-43<br />

CO2 = CO 2<br />

-air gas mix controller, O2 = O 2<br />

-air gas mix controller, DO = Dissolved<br />

oxygen monitor (optical), PH = pH controller, ANALOG = Analog output card,<br />

pHOPT = pH controller, DOOPT = dissolved O 2<br />

controller<br />

WAVE Bioreactor 200 system comprises integral rocking,<br />

temperature, weight, and airflow controllers. The selfcontained<br />

system is designed for use with working culture<br />

volumes of between 10 and 100 L in applications such<br />

as inoculum scale-up, R&D, GMP production, vaccine<br />

production, and antibody manufacture. For additional<br />

flexibility, optional modules including DO, CO 2<br />

, O 2<br />

, weight/<br />

perfusion, and pH control can be added while builtin<br />

Ethernet and MODBUS data ports allow interfacing<br />

with Windows based PC software for data logging and<br />

daisy chaining with other WAVE Bioreactor systems and<br />

instrument modules.<br />

Features of the system include:<br />

• Touch panel operator interface<br />

• Direct drive electronic linear motor<br />

• Adjustable rocking rate from 4 to 25 rocks/min with<br />

acceleration control<br />

• Adjustable rocking angle from 2° to 9° Integral<br />

temperature controller with heater Integral weight<br />

controller<br />

• Integral airflow controller<br />

• Integral PID controller for automatic temperature, O 2<br />

, CO 2<br />

,<br />

and pH adjustment<br />

• Real-time data monitoring<br />

• RS-485 MODBUS communications port<br />

• 10Base-T Ethernet communications port Remote alarm<br />

contact and printer interface Stainless-steel containment<br />

enclosure<br />

Technical specifications<br />

Dimensions<br />

(L × W × H) 1852 × 1096 × 1120 mm (73 × 43 × 44 in)<br />

Weight<br />

Utilities<br />

Environmental<br />

350 kg (780 lb)<br />

Voltage: 100-120/220-240 VAC<br />

Frequency: 50/60 Hz<br />

Maximum current: 15 A<br />

Power: 12 KVA<br />

This equipment is designed for use under the following<br />

conditions:<br />

• Indoor use<br />

• 5°C to 40°C<br />

• Up to 80% maximum relative humidity (rh) at 31°C decreasing<br />

linearly to 50% rh at 40°C<br />

For information on using Cellbag with<br />

WAVE Bioreactor systems, see page 45.<br />

Visit us on the web at<br />

www.gelifesciences.com/wave<br />

42 www.gelifesciences.com/bioprocess

---

WAVE Bioreactor 20/50 system<br />

WAVE Bioreactor 20/50 system is a versatile, modular<br />

system designed for R&D and production use. It consists<br />

of a base unit with various options suitable for culture of<br />

multiple cell lines.<br />

WAVE Bioreactor 20/50 system has an extensive line of<br />

instrumentation, including weight controllers for perfusion<br />

culture, dissolved oxygen amplifiers, and pH controllers for<br />

use with working culture volumes between 100 mL and<br />

25 L. WAVE Bioreactor 20/50 system can be used with the<br />

WAVEPOD II controller, which provides simplified control of<br />

all culture parameters including oxygen, pH, and CO 2<br />

/O 2<br />

gas<br />

mixing in a single module. For benchtop operation, covering<br />

the Cellbag with a lid is recommended. A filter heater for<br />

the exhaust filter is strongly recommended otherwise<br />

water will condense in the filter and may lead to clogging<br />

and overpressure in the bag.<br />

Features of the system include:<br />

• Adjustable rock rate 2 to 40 rocks/min<br />

• Adjustable rock angle from 2° to 12°<br />

• Integral temperature control<br />

• Integral aeration control<br />

• Simplified system control when used with WAVEPOD II<br />

controller (see page 48)<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

BASE20/50EHT 100-120V 1 28-9413-41<br />

BASE20/50EHT 220-240V 1 28-9413-42<br />

BASE20/50EHT 100-120V with Loadcell 1 28-9413-43<br />

BASE20/50EHT 220-240V with Loadcell 1 28-9413-44<br />

BASE20/50EHT Dual 100-120V 1 28-9413-45<br />

BASE20/50EHT Dual 220-240V 1 28-9413-46<br />

BASE20/50EHT Dual 100-120V with Loadcell 1 28-9413-47<br />

BASE20/50EHT Dual 220-240V with Loadcell 1 28-9413-48<br />

BASE20/50EHT 100-120V with CO2 1 28-9413-49<br />

BASE20/50EHT 220-240V with CO2 1 28-9413-50<br />

BASE20/50EHT 100-120V with CO2, Loadcell 1 28-9413-51<br />

BASE20/50EHT 220-240V with CO2, Loadcell 1 28-9413-52<br />

BASE20/50EHT 100-120V with O2 1 28-9413-53<br />

BASE20/50EHT 220-240V with O2 1 28-9413-54<br />

BASE20/50EHT 100-120V with O2, Loadcell 1 28-9413-55<br />

BASE20/50EHT 220-240V with O2, Loadcell 1 28-9413-56<br />

KIT20EHT 110-120V 1 28-4115-26<br />

KIT20EHT 220-240V 1 28-9416-44<br />

KIT20EHT Dual 110-120V 1 28-4115-27<br />

KIT20EHT Dual 220-240V 1 28-9416-45<br />

KIT50EHT 110-120V 1 28-4115-28<br />

KIT50EHT 220-240V 1 28-9416-46<br />

KIT50EHT Dual 110-120V 1 28-4115-30<br />

KIT50EHT Dual 220-240V 1 28-9416-47<br />

LID20 - Clear 1 28-4115-34<br />

LID20W - White 1 28-4115-35<br />

LID50 - Clear 1 28-4115-37<br />

LID50W - White 1 28-4115-38<br />

CO2 = CO 2<br />

-air gas mix controller, O2 = O 2<br />

-air gas mix controller, Dual = independent<br />

control of two individual Cellbag bioreactors, Loadcell = measure Cellbag bioreactor<br />

weight during rocking.<br />

Technical specifications<br />

Dimensions<br />

(L × W × H)<br />

Weight<br />

Utilities<br />

Environmental<br />

Base unit: 573 × 465 × 179 mm (22.6 × 18.3 × 7.1 in)<br />

With KIT20EHT: 711 × 575 × 254 mm (28 × 22.6 × 10 in)<br />

With KIT50EHT: 775 × 700 × 254 mm (30.5 × 27.6 × 10 in)<br />

(for Loadcell models, add 32 mm to height dimension)<br />

Base unit: 16 kg (35 lb)<br />

Voltage: 100-120/220-240 VAC<br />

Frequency: 50/60 Hz<br />

Power: 630 VA<br />

This equipment is designed for use under the following<br />

conditions:<br />

• Indoor use<br />

• 4°C to 40°C<br />

• < 95% rh, non-condensing<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

For information on using Cellbag with<br />

WAVE Bioreactor systems, see page 45.<br />

Visit us on the web at<br />

www.gelifesciences.com/wave<br />

www.gelifesciences.com/bioprocess 43

---

1<br />

2<br />

WAVE Bioreactor 2/10 system<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

BASE2/10EH 1 28-4115-00<br />

2/10 system Perfusion Controller 1 28-9875-84<br />

LID2/10W - Opaque 1 28-4115-33<br />

Technical specifications<br />

3<br />

Dimensions<br />

(L × W × H)<br />

Weight<br />

230 × 330 × 160 mm (9 × 13.1 × 6 in)<br />

4.2 kg (9 lb)<br />

ReadyToProcess<br />

WAVE Bioreactor 2/10 system is a compact unit fitted with<br />

integral features such as an air pump with a mass flow<br />

meter and a temperature control with a heater and sensor.<br />

Options include weight controllers for perfusion culture and<br />

dissolved oxygen amplifiers. Multifunction control enables<br />

adjustment of rocking angle, speed, and aeration rate. The<br />

system is for use with working culture volumes between<br />

100 mL and 5 L.<br />

Utilities<br />

Environmental<br />

Voltage: 100-120/220-240 VAC<br />

Frequency: 50/60 Hz<br />

Maximum Current: 4 A<br />

Power: 145/210 VA<br />

This equipment is designed for use under the following<br />

conditions:<br />

• Indoor use<br />

• 5°C to 30°C with lid, 15°C to 30°C without lid<br />

• < 95% rh, non-condensing<br />

For information on using Cellbag with<br />

WAVE Bioreactor systems, see page 45.<br />

Visit us on the web at<br />

www.gelifesciences.com/wave<br />

Features of the system include:<br />

• Adjustable rock rate 3 to 40 rocks/min<br />

• Adjustable angle from 2° to 9°<br />

• Integral air pump with mass flow meter<br />

• RS-485 communications port<br />

• LCD display and control interface<br />

• Temperature control with heater and sensor<br />

44 www.gelifesciences.com/bioprocess

---

Cellbag bioreactors<br />

Reproduced with kind permission of Pacifi cGMP, USA.<br />

Designed for use with the WAVE Bioreactor system,<br />

Cellbag bioreactors are presterilized, single-use bags<br />

for the non-invasive mixing of culture medium and cells<br />

during cultivation in research, development, and cGMP<br />

manufacturing operations. As part of the ReadyToProcess<br />

platform of single use products, Cellbag bioreactors require<br />

no sterilization or cleaning steps and provide a suitable<br />

environment for cell growth while minimizing the risk of<br />

cross-contamination. They are manufactured from multilayered,<br />

laminated, clear USP Class VI plastics and are easily<br />

coupled to the full suite of ReadyToProcess cell culture,<br />

purification, and fluid handling products.<br />

Cellbag bioreactors deliver:<br />

• Ease-of-use: Cellbag bioreactors are presterilized and<br />

disposable, requiring neither cleaning nor validation and<br />

thus eliminating the risk of cross-contamination<br />

• Robustness: The bags are manufactured from multilayer<br />

laminated, clear plastic films designed to provide<br />

mechanical strength and bio-inert fluid contact<br />

• Biocompatibility: Fluid contact layer is an ethylene vinyl<br />

acetate (EVA)/low density polyethylene copolymer and<br />

the outer non-contact layer is made of low density<br />

polyethylene<br />

• Customization: Cellbag bioreactors can be readily<br />

customized for user-specified connectors, tube sets, and<br />

special components<br />

All Cellbags have air inlet and outlet filters, a needleless<br />

sampling port, an Oxywell2 dissolved oxygen probe<br />

insertion port, and a fill/harvest port. However, Cellbags<br />

can be customized with optional fittings such as pH probes,<br />

dip tubes, screw cap ports, temperature ports, perfusion<br />

filters, and special tubing ports.<br />

The Cellbag size you need depends on the culture volume<br />

to be cultivated.<br />

Selection guide – Cellbag<br />

Cellbag<br />

Outlet air filter<br />

Inoculation/harvest lines<br />

Cellbag rod<br />

Culture<br />

volume<br />

2/10<br />

system<br />

20/50<br />

system<br />

200<br />

system<br />

Visit us on the web at www.gelifesciences.com/wave<br />

500/1000<br />

system<br />

Kit 20 Kit 50 Kit 500 Kit 1000<br />

Cellbag 500 mL 50 to 250 mL ●<br />

Cellbag 1 L 50 to 500 mL ●<br />

Cellbag 2 L 100 to 1000 mL ● ●<br />

Cellbag 10 L 500 mL to 5 L ● ●<br />

Cellbag 20 L 1 to 10 L ●<br />

Cellbag 22 L 1 to 10 L ●<br />

Cellbag 50 L 5 to 25 L ●<br />

Cellbag 100 L 5 to 50 L ●<br />

Cellbag 200 L 10 to 100 L ●<br />

Cellbag 500 L 50 to 250 L ●<br />

Cellbag 1000 L 100 to 500 L ●<br />

Inlet air filter<br />

Oxywell2<br />

Needleless<br />

sampling port<br />

Spare Luer port/<br />

optional pH probe<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 45

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

Cellbag 500 mL 1 CB500ML10-01<br />

Cellbag 1 L 1 CB0001L10-01<br />

Cellbag 2 L 1 CB0002L10-01<br />

Cellbag 2 L (Oxywell2 version) 1 CB0002L10-02<br />

Cellbag 2 L (screwcap version) 1 CB0002L10-03<br />

Cellbag 2 L (perfusion version) 1 CB0002L10-04<br />

Cellbag 2 L (Fibra-Cel version) 1 CB0002L10-07<br />

Cellbag 2 L (pHOPT version) 1 CB0002L10-11<br />

Cellbag 2 L (pHOPT and screwcap version) 1 CB0002L10-13<br />

Cellbag 2 L (pHOPT and perfusion version) 1 CB0002L10-14<br />

Cellbag 2 L (ReadyMate version) 1 CB0002L10-21<br />

Cellbag 10 L 1 CB0010L10-01<br />

Cellbag 10 L (Oxywell2 version) 1 CB0010L10-02<br />

Cellbag 10 L (screwcap version) 1 CB0010L10-03<br />

Cellbag 10 L (perfusion version) 1 CB0010L10-04<br />

Cellbag 10 L (Fibra-Cel version) 1 CB0010L10-07<br />

Cellbag 10 L (pHOPT version) 1 CB0010L10-11<br />

Cellbag 10 L (pHOPT and screwcap version) 1 CB0010L10-13<br />

Cellbag 10 L (pHOPT and perfusion version) 1 CB0010L10-14<br />

Cellbag 10 L (ReadyMate version) 1 CB0010L10-21<br />

Cellbag 20 L 1 CB0020L10-01<br />

Cellbag 20 L (Oxywell2 version) 1 CB0020L10-02<br />

Cellbag 20 L (screwcap version) 1 CB0020L10-03<br />

Cellbag 20 L (perfusion version) 1 CB0020L10-04<br />

Cellbag 20 L (Fibra-Cel version) 1 CB0020L10-07<br />

Cellbag 20 L (pHOPT version) 1 CB0020L10-11<br />

Cellbag 20 L (pHOPT and screwcap version) 1 CB0020L10-13<br />

Cellbag 20 L (pHOPT and perfusion version) 1 CB0020L10-14<br />

Cellbag 20 L (ReadyMate version) 1 CB0020L10-21<br />

Cellbag 22 L (Oxywell2 version) 1 CB0022L10-02<br />

Cellbag 22 L (Fibra-Cel version) 1 CB0022L10-07<br />

Cellbag 22 L (pHOPT version) 1 CB0022L10-11<br />

Cellbag 22 L (ReadyMate version) 1 CB0022L10-21<br />

Cellbag 50 L 1 CB0050L10-01<br />

Cellbag 50 L (Oxywell2 version) 1 CB0050L10-02<br />

Cellbag 50 L (perfusion version) 1 CB0050L10-04<br />

Cellbag 50 L (Fibra-Cel version) 1 CB0050L10-07<br />

Cellbag 50 L (pHOPT version) 1 CB0050L10-11<br />

Cellbag 50 L (pHOPT and perfusion version) 1 CB0050L10-14<br />

Cellbag 50 L (ReadyMate version) 1 CB0050L10-21<br />

Cellbag 100 L (Oxywell2 version) 1 CB0100L10-02<br />

Cellbag 100 L (pHOPT version) 1 CB0100L10-11<br />

Cellbag 200 L (Oxywell2 version) 1 CB0200L10-02<br />

Cellbag 200L (pHOPT version) 1 CB0200L10-11<br />

Cellbag 500 L (pH version) 1 CB0500L10-05<br />

Cellbag 1000 L (pH version) 1 CB1000L10-05<br />

Clave sampling valve on 6.4 mm O.D. C-Flex tubing 1 TK001<br />

PVC tubing with press-in plug 1 TK002<br />

Tube Kit, PVC and silicone tubing with T-connectors 1 TK003<br />

Check valve, 250 L (pack of 25) 1 WV050087<br />

Check valve, 100/200 L (pack of 50) 1 WV050088<br />

Technical specifications<br />

Typical connectors • Air inlet: 0.2 µm gas filter<br />

• Air outlet: 0.2 µm gas filter with check valve<br />

• Sampling: Needleless self-sealing syringe port.<br />

No laminar hood required<br />

• Fill/harvest: C-Flex tubing suitable for sterile fusing<br />

terminated with Luer, MPC couplings or ReadyMate<br />

connectors<br />

• Multiuse: Luer port with cap<br />

• Oxywell2: Silicone sheath for DO probe<br />

• pH: pH probe port and pHOPT patch<br />

Biocompatability • Testing is performed on irradiated film (50 kGy):<br />

• USP XXII plastic class VI and ISO 10993:<br />

• ISO 10993-4 Hemolysis study in vivo extraction method<br />

• ISO 10993-5 Cytotoxicity study using ISO elution method<br />

• ISO 10993-6 Muscle implantation study in rabbit<br />

• ISO 10993-10 Acute intracutaneous reactivity study in<br />

rabbit<br />

• ISO 10993-11 Acute systemic toxicity in mouse<br />

Sterility and<br />

endotoxin<br />

• Sterilized by gamma radiation at 25 to 40 kGy<br />

• Lot release requires < 0.125 EU/mL endotoxin<br />

Temperature rating • Cellbags may be used from 0°C to 50°C<br />

Pressure rating • Maximum operating pressure 1.5 psig (0.1 bar)<br />

Mechanical strength • Film seal strength > 67 N/cm<br />

46 www.gelifesciences.com/bioprocess

---

UNICORN DAQ 1.0<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

UNICORN DAQ 1.0 1 28-9848-23<br />

Converter 100 1 28-9770-48<br />

Computer and networking specifications<br />

Hardware<br />

Recommendations<br />

1<br />

2<br />

PC<br />

Memory<br />

2.5 GHz processor<br />

For Windows XP: 512 MB RAM<br />

For Windows 7: 2 GB RAM<br />

3<br />

Hard disk<br />

Monitor<br />

Converter 100<br />

Drives<br />

Peripherals<br />

For Windows XP: 1 GB available hard disk space<br />

For Windows 7: 2 GB available hard disk space<br />

Double hard disk and RAID controller recommended<br />

Color monitor: 1024 × 768 pixels, small fonts, 64 k colors<br />

Requires 10 Mbps network card (not supplied)<br />

CD ROM<br />

Mouse<br />

ReadyToProcess<br />

UNICORN DAQ software facilitates online data acquisition<br />

for the management and evaluation of results from cell<br />

cultures performed in WAVE Bioreactor systems, part of<br />

the ReadyToProcess platform. Up to four different WAVE<br />

Bioreactor systems can be simultaneously connected<br />

to a single PC or networked to the software providing a<br />

common platform for acquiring, monitoring, and storing<br />

result data. A dynamic graphical user interface informs the<br />

user about the real time status of the run being monitored<br />

while data are automatically saved to a local hard drive<br />

or server in a secure and unalterable result file for added<br />

security. A common platform and user interface for all<br />

culture volumes simplifies scale up.<br />

Modular format for easier navigation<br />

UNICORN DAQ software comprises three program modules<br />

that automatically open at logon. Data acquisition is set<br />

up and started in UNICORN Manager and monitored in the<br />

System Control module while result data are managed<br />

using the Evaluation module.<br />

Software requirements<br />

Item<br />

Operating system<br />

Recommendation<br />

Windows XP Professional x32 or<br />

Windows 7 Professional x32<br />

Opened result files are displayed in the Evaluation module window.<br />

Visit us on the web at www.gelifesciences.com/wave<br />

www.gelifesciences.com/bioprocess 47

---

1<br />

WAVEPOD II Integrated Controller for WAVE Bioreactor 20/50 system<br />

2<br />

3<br />

ReadyToProcess<br />

WAVEPOD II Integrated Controller integrates<br />

instrumentation associated with the WAVE Bioreactor<br />

20/50 system for the setup, control, and monitoring of<br />

cell culture parameters in Cellbag bioreactors. Multiple<br />

configurations of the WAVEPOD II controller are available<br />

to meet individual cell culture needs and a large color<br />

touchscreen provides easy access to all operations, data,<br />

and alarm conditions from the integrated control modules.<br />

WAVEPOD II is available with a choice of control modules to<br />

meet your specific cell culture needs. By coordinating the<br />

functions of individual control modules, you can develop<br />

complex schemes for the precise measurement and control<br />

of culture conditions.<br />

Detailed features include:<br />

pH: The pH controller enables online measurement and<br />

control of pH using an optical pH sensor preinstalled in<br />

Cellbag bioreactors. The pH controller incorporates a<br />

set point controller to power PUMP20 units or to switch<br />

user-supplied base and acid pumps on and off to maintain<br />

and control pH. Alternatively, pH can be maintained by<br />

controlling CO 2<br />

concentration.<br />

DOOPT: The dissolved oxygen (DO) monitor controller<br />

provides amplification, display, and data transmission<br />

of DO concentration allowing real-time measurement of<br />

DO concentration inside the Cellbag bioreactor. The DO<br />

monitor controller was designed for use with miniature<br />

fiber-optic dissolved oxygen probes (DOOPTPROBE), and<br />

it can increase the rocking rate automatically to maintain<br />

online control of DO.<br />

O2MIX: The O 2<br />

/air mix controller connects to a supply of<br />

oxygen (and low pressure N 2<br />

supply if required) to provide<br />

O 2<br />

/air concentrations between 0% and 50% O 2<br />

. The<br />

instrument controls enriched oxygen levels for insect cell/<br />

baculovirus and high culture density applications and it is<br />

also useful for maintaining low-oxygen environments for<br />

near-anaerobic applications.<br />

CO2MIX: The CO 2<br />

/air mix controller connects to a supply<br />

of 100% CO 2<br />

to provide CO 2<br />

/air concentrations between<br />

0% and 15% CO 2<br />

. The instrument is useful for pH control of<br />

bicarbonate buffered cell culture media.<br />

Airflow: The Airflow controller can be used as a standalone<br />

module for Cellbag bioreactor aeration or as a conditioned<br />

gas supply to a WAVE Bioreactor 20/50EHT system. The<br />

flow of ambient or processed air is measured by a thermal<br />

mass flow sensor and regulated by a flow control valve<br />

operated by an internal controller.<br />

Air flow measurement and control<br />

When running WAVEPOD II in “LOCAL” mode<br />

Air flow<br />

measurement range 0 to 1 L/min<br />

Air flow control range<br />

Operating pressure, system<br />

air inlet<br />

Process gas<br />

Bag pressure<br />

0.05 to 1.00 L/min<br />

Ambient air, no over pressure<br />

10 to 20 kPa (1 to 3 psi)<br />

CO 2 measurement and control<br />

CO 2<br />

mix, measurement<br />

range 0% to 20%<br />

CO 2<br />

mix, measurement<br />

accuracy<br />

controlled by pressure relief valve at bag<br />

± 0.5% CO 2<br />

for 0% to 5% CO 2<br />

± 10% of reading for 5% to 12% CO 2<br />

(0.5% to 1.2% CO 2<br />

)<br />

Ambient temperature variation dependency: ± 0.05%<br />

CO 2<br />

/°C temp deviation<br />

CO 2<br />

mix,<br />

control range 0% to 15%<br />

± 0.5% CO 2<br />

for 0% to 5% CO 2<br />

± 10% of reading for 5% to 12% CO 2<br />

(0.5% to 1.2% CO 2<br />

)<br />

Ambient temperature variation dependency: ± 0.05%<br />

CO 2<br />

/°C temp deviation<br />

CO 2<br />

inlet specifications<br />

100% CO 2<br />

Inlet pressure to system: 0.7 to 1.0 bar<br />

Min flow rate: 0.2 L/min for full CO 2<br />

specification<br />

48 www.gelifesciences.com/bioprocess

---

O 2 measurement and control<br />

O 2<br />

mix, measurement range 0% to 50%<br />

Default 21% to 50%<br />

Note: N 2<br />

is required for delivery of O 2<br />

< 20.9%<br />

O 2<br />

mix, displayed<br />

measurement resolution 0.1%<br />

O 2<br />

mix, measurement accuracy ± 1.0% O 2<br />

for 21% to 50% O 2<br />

O 2<br />

mix, control range 0% to 50%<br />

O 2<br />

mix, control accuracy ± 1.0% O 2<br />

for 21% to 50% O 2<br />

Inlet pressure to system<br />

0.7 to 1.0 bar<br />

Min flow rate<br />

Temperature measurement and control<br />

Liquid temperature<br />

control range<br />

Accuracy at equilibrium conditions<br />

Precision at equilibrium conditions<br />

Readout of process value (PV) from BASE 20/50 unit<br />

pH measurement and control<br />

pH measurement range pH 4.5 to 8.5<br />

pH control range pH 6 to 8<br />

pH accuracy within<br />

control range<br />

* Offset calibration to be done at the setpoint pH<br />

0.6 L/min for full O 2<br />

specification.<br />

Min: Ambient temperature 5°C<br />

Max: 40°C<br />

≤ ± 0.1°C (exclusive of measurement accuracy)<br />

≤ ± 0.2°C (exclusive of measurement accuracy)<br />

± 0.05 pH within 0.25 pH from offset<br />

calibration pH*, ± 0.10 pH within 0.25 to 0.5 pH<br />

from offset calibration pH*<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

WAVEPOD II with CO2, O2, pHOPT, DOOPT 1 28-9847-40<br />

WAVEPOD II with CO2, pHOPT 1 28-9847-41<br />

WAVEPOD II with O2, DOOPT 1 28-9847-42<br />

DOOPT-Probe 1 28-4116-72<br />

RTD Probe 1 28-4116-67<br />

CO2 = CO 2<br />

-air gas mix controller, O2 = O 2<br />

-air gas mix controller,<br />

pHOPT = pH controller, DOOPT = dissolved O 2<br />

controller<br />

Technical specifications<br />

Dimensions<br />

Weight<br />

395 × 280 × 405 mm<br />

13.6 kg<br />

Communications RJ12-6 for connecting WAVE bioreactor base<br />

RJ12 Converter 100<br />

RJ45 AUX jack<br />

Two DB9 jacks for connecting acid/base pumps<br />

DB15 alarm jack<br />

Utilities<br />

Voltage: 110-120/220-240 VAC, (auto switching)<br />

Frequency: 50/60 Hz<br />

Power: 200 VA<br />

Environmental Operating conditions: 5°C to 40°C<br />

Operating humidity: 10% to 90% noncondensing<br />

Storage conditions: -20°C to 60°C<br />

Pollution degree rating: 1<br />

Ingress protection (IP) rating: 32<br />

Indoor use only<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

Visit us on the web at www.gelifesciences.com/wave<br />

www.gelifesciences.com/bioprocess 49

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

WAVE Mixer<br />

WAVE Mixer makes it possible to mix materials contained in<br />

bags under sterile conditions. The rocking platform induces<br />

a wave motion in the liquid without an impeller or other<br />

invasive mixer. WAVE Mixer has been optimized for efficient<br />

mixing and dispersion of up to 35 L of liquid, in a choice<br />

of 20 or 50 L M*Bags, and 10 L of liquid can be mixed to<br />

homogeneity in less than 7 s.<br />

WAVE Mixer performs a number of functions including:<br />

• Thawing<br />

• Pooling<br />

• Mixing<br />

• Media and buffer preparation<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

MIXER 20/50EHT 110-120V 1 28-9515-84<br />

MIXER 20/50EHT 220-240V 1 28-9515-12<br />

MIXER 20/50EHT 110-120V with Loadcell 1 28-9515-85<br />

MIXER 20/50EHT 220-240V with Loadcell 1 28-9515-32<br />

MIXKIT20 1 28-4115-73<br />

MIXKIT20EH 110-120V 1 28-9514-79<br />

MIXKIT20EH 220-240V 1 28-9526-27<br />

MIXKIT50 1 28-4115-76<br />

MIXKIT50EH 110-120V 1 28-9514-80<br />

MIXKIT50EH 220-240V 1 28-9526-28<br />

MIXHOLDER20 1 28-4115-72<br />

MIXHOLDER50 1 28-4115-75<br />

MIXLID20 1 28-4115-71<br />

Technical specifications<br />

WAVE Mixer<br />

Dimensions<br />

(L × W × H)<br />

Weight<br />

Utilities<br />

Environmental<br />

172 × 502 × 381 mm (6.8 x 19.8 x 15 in)<br />

with MIXKIT50EHT:<br />

355 (incl. M*Bag) × 635 × 740 mm (14 x 25 x 29.1 in)<br />

with MIXKIT20EHT:<br />

295 (incl. M*Bag) × 450 × 654 mm (11.6 x 17.7 x 25.7 in)<br />

18 kg (36 lb)<br />

Storage conditions -40°C to 80°C<br />

Voltage: 100-120/220-240 VAC<br />

Frequency: 50/60 Hz<br />

Power: 630 VA<br />

This equipment is designed for use under the following<br />

conditions:<br />

• Indoor use<br />

• 15°C to 35°C<br />

• < 90% rh, non-condensing<br />

WAVE Mixer features include:<br />

• Disposable, single-use system for mixing liquids without<br />

the need for a mixing tank or conventional mixer<br />

• No equipment cleaning, sterilization, validation, or crosscontamination<br />

• Mixes liquid volumes from 1 to 35 L in 20 and 50 L mixing<br />

bags. Larger bag sizes are available on request.<br />

• All M*Bag Mixing Chambers are provided with a large<br />

screw cap port for the easy addition of powders and solids<br />

M*Bag<br />

Film<br />

Biocompatability<br />

Fluid contact layer: medical grade low density polyethylene<br />

(LDPE)<br />

Non-contact outer layer: LPDE + EVA or nylon/EVOH<br />

copolymer<br />

Testing is performed on irradiated film at 50 kGy<br />

USP XXII plastic class VI test and ISO 10993<br />

Acute intracutaneous reactivity study in rabbit ISO10993-10<br />

Acute systemic toxicity in mouse ISO 10993-11<br />

Muscle implantation study in rabbit ISO 10993-6<br />

Cytotoxicity study using ISO elution method ISO 10993-5<br />

Hemolysis study in vitro, extraction method ISO 10993-4<br />

M*Bag allows ingredients to be mixed and dissolved using<br />

the WAVE Mixer. Made of a multilayer, laminated clear<br />

plastic, the outer layer provides high mechanical strength<br />

and a gas-impermeable barrier while the fluid contact layer<br />

is typically a medical grade, low-density polyethylene.<br />

A large screw cap port allows powders or other solids<br />

to be easily poured into the bag, and also a probe (to<br />

measure pH) to be inserted. A large outlet port allows the<br />

M*Bag to be drained completely.<br />

Maximum<br />

operating pressure<br />

0.1 bar<br />

Temperature rating M*Bags may be used from 0°C to 50°C<br />

Endotoxin<br />

Lot release requires < 0.125 EU/mL endotoxin<br />

50 www.gelifesciences.com/bioprocess

---

Application guide – WAVE Mixer<br />

Mixer 20/50ET<br />

In-process blending<br />

In-process intermediates can be mixed and various ingredients can be added.<br />

In-process pooling<br />

In-process samples collected during chromatography or other operations can be pooled together in a<br />

single bag and mixed to form a homogeneous intermediate for sampling and further processing.<br />

Blending for sampling<br />

Mixing stored materials in bags in order to obtain a representative sample for stability and process<br />

optimization studies.<br />

Mixing prior to fill<br />

Mixing stored or collected product prior to dispensing in to final vials, bags, or other containers. Mixing<br />

the bag ensures each aliquot is identical. Using the bag as the mixing container ensures sterility and GMP<br />

operation.<br />

Reconstitution and dissolution<br />

Preparation of media from powdered and concentrated components and preparation of sterile buffers.<br />

In process reactions<br />

Reactions can be carried out in the bag. This may involve adding oxidants or reductants. The headspace in<br />

the bag can be controlled to maintain the desired oxygen level.<br />

Mixer 20/50EHT<br />

Thawing of frozen materials.<br />

Warming blood and other biological fluids.<br />

Maintaining temperature during pooling operations.<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

Visit us on the web at www.gelifesciences.com/wave<br />

www.gelifesciences.com/bioprocess 51

---

1<br />

2<br />

Single-use fluid management and<br />

filtration<br />

3<br />

ReadyToProcess<br />

ReadyCircuit assemblies simplify<br />

and speed up bioprocessing. For<br />

biopharmaceutical companies, CMOs,<br />

and startups, this enables accelerated<br />

development and reduced up-front<br />

investment – manufacturing agility<br />

increases, opening doors to new business<br />

opportunities.<br />

Benefits of ReadyCircuit bags and tubing<br />

assemblies:<br />

• Quickly configure and assemble a wide<br />

range of sterile, fluid-processing circuits<br />

• Dispose of entire circuit after<br />

processing, thereby eliminating<br />

cleaning and cleaning validation costs<br />

• Enables development of products<br />

without a large capital investment in<br />

manufacturing systems<br />

Available in a wide range of capacities and<br />

pore selections, ReadyToProcess filters<br />

include single-use cartridges for both<br />

cross flow filtration (CFF) and normal flow<br />

filtration (NFF) operations. Preconditioned,<br />

sterile, and ready for immediate use,<br />

they cut unnecessary downtime as they<br />

minimize preparation steps as well as<br />

eliminate associated cleaning protocols<br />

and cleaning validation.<br />

Applications include aseptic processing;<br />

clarification, ultrafiltration, and<br />

diafiltration in vaccine and MAb<br />

production; media filtration; and NFF<br />

prefiltration for bioreactors and columns.<br />

ReadyCircuit assembly components and<br />

associated equipment are conveniently<br />

organized on ReadyKart mobile processing<br />

station - a configurable cart that<br />

mechanically supports and enhances the<br />

use of ReadyToProcess fluid processing<br />

products. ReadyKart stations offer<br />

versatility, simplification, and efficiency<br />

by ergonomically placing ReadyCircuit<br />

assemblies and associated equipment<br />

within easy reach of the user.<br />

Visit us on the web at<br />

www.gelifesciences.com/readytoprocess<br />

52 www.gelifesciences.com/bioprocess

---

1<br />

ReadyCircuit assemblies<br />

ReadyCircuit assemblies simplify<br />

system assembly and reduce cleaning<br />

and cleaning validation costs. They also<br />

reduce the time span between finishing<br />

one batch and starting the next.<br />

Versatility<br />

Versatility is the hallmark of the<br />

ReadyCircuit family, enabling you<br />

to design and build almost any<br />

fluid processing circuit you can<br />

imagine. For example, you can<br />

easily assemble fully functional<br />

CFF or NFF biofiltration systems<br />

including pressure, temperature and<br />

conductivity sensors. You can select<br />

from over 250 standard bag, tubing,<br />

sensor, and filter components:<br />

• Bag assemblies from 250 mL to 200 L<br />

• Manifold/tube assemblies<br />

• Sensor assemblies<br />

• Cross flow filtration assemblies<br />

• Normal flow filtration assemblies<br />

Advantages for your<br />

application<br />

ReadyCircuit assemblies offer distinct<br />

advantages in many applications:<br />

• Aseptic clarification and purification<br />

of vaccines and monoclonals<br />

• Antibodies, recombinant proteins,<br />

and plasmids<br />

• Aseptic cell processing<br />

• Environments where terminal<br />

sterilization is not feasible<br />

• Preclinical through Phase II clinical<br />

trials<br />

• Areas where the risk of cross<br />

contamination is high<br />

• Fast-track drug development<br />

processes<br />

• Small to midsize CMOs, biotech,<br />

and biopharmas seeking lean<br />

solutions or having concerns about<br />

crosscontamination in preclinical,<br />

Phase I and Phase II trials<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 53

---

1<br />

ReadyCircuit bags<br />

Tube assemblies<br />

2<br />

3<br />

ReadyToProcess<br />

ReadyCircuit bags offer scale-up capability that simplifies<br />

development continuity.<br />

Bag types include:<br />

• Sample bags for small volume applications<br />

• 50 L horizontal pillow bag<br />

• 1 to 20 L pillow bags for vertical or horizontal use on<br />

mobile carts<br />

• 100 to 200 L 3D bags for large-scale production<br />

ReadyCircuit bags have inlet and outlet ports and are<br />

supplied sterile with ReadyMate disposable aseptic<br />

connectors. Port configuration varies by bag type.<br />

Basic tubing assemblies consist of lengths of tubing with<br />

ReadyMate disposable aseptic connectors at each end.<br />

Other ReadyCircuit tubing assemblies include tubing or<br />

aseptic connectors integrated with components such as<br />

tees, pressure sensors, reducers, and so on.<br />

A combination of ReadyCircuit tubing assemblies can be<br />

ordered to meet specific processing needs. Preconfigured<br />

kits consisting of tubing assemblies, bags, and sensors<br />

are also available to meet many standard fluid processing<br />

objectives.<br />

Some circuits and assemblies include TC and Steam-Thru<br />

adapters commonly used to connect disposable fluid paths<br />

to stainless steel process equipment.<br />

Technical specifications<br />

Storage of unfilled products:<br />

Temperature = -20°C to 45°C<br />

Storage of 2D bags filled with process fluids:<br />

Temperature = -80°C to 45°C<br />

Shelf-life at 1°C to 45°C = 30 d<br />

Shelf-life at -80°C to 0°C = 3 y<br />

Storage of 3D bags filled with process fluids:<br />

Temperature = 2°C to 45°C<br />

Shelf-life at 2°C to 45°C = 30 d<br />

Technical specifications<br />

Pressures—tubing in tubing assemblies<br />

Maximum working pressures for the three types of tubing found in ReadyCircuit<br />

components:<br />

C-Flex = 1 bar (15 psi) at 20°C<br />

Reinforced (AdvantaPure) = 4 bar (60 psi) at 20°C<br />

Pump tubing (PumpSil) 6.3 to 9.1 mm (1/4 to 3/8 in) = 1.7 barg (25 psig) at 20°C<br />

Pump tubing (PumpSil) 12.7 to 19 mm (1/2 to 3/4 in) = 1 barg (15 psig) at 20°C<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong><br />

sales representative<br />

54 www.gelifesciences.com/bioprocess

---

Sensor assemblies<br />

ReadyCircuit sensors are tubing assemblies integrated<br />

with temperature, pressure, and conductivity sensors.<br />

The sensor assemblies use ReadyMate disposable<br />

aseptic connectors. Sensors are compatible with SciLog<br />

<strong>BioProcess</strong>ing Systems SciTemp, SciPres, and SciCon<br />

monitors.<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong><br />

sales representative<br />

Technical specifications<br />

SciTemp Flow-Thru temperature sensor specifications<br />

Material, Fluid Contact: medical grade polysulfone meets USP Class VI and<br />

FDA 21CFR177.1520. All Wetted Materials are made of animal-free compounds.<br />

Compatible with most sanitizing agents such as NaOH or hypochlorite. Sensors can<br />

be repeatedly autoclaved.<br />

Sensor type: Thermistor, Epoxy-Coated, 2252 Ω<br />

Temperature range: -10°C to 125°C<br />

Temperature accuracy: ± 0.10°C in the 4°C to 70°C range<br />

Temperature display resolution: two decimal places (0.01°C)<br />

Sensor connectors: lockable and waterproof<br />

Sensor microchip: EPROM-stored sensor ID and calibration factor<br />

SciPres Flow-Thru pressure sensor specifications<br />

Material, Fluid Contact: medical grade polysulfone meets USP Class VI and<br />

FDA 21CFR177.1520. All wetted materials are made of animal-free compounds.<br />

Compatible with most sanitizing agents such as NaOH and hypochlorite, for flow cell<br />

sanitization. Can be sterilized. Autoclavable and gamma stable.<br />

Sensor type: medical grade, silicone piezo-resistive sensing element with on-chip<br />

temperature compensation<br />

Sensor isolation: insoluble silicone dielectric gel isolates sensing element from<br />

process solution. The gel is a non-toxic, non-allergenic elastomer system that meets<br />

all USP Biological Safety, Class VI plastics requirements.<br />

Pressure range: 0.34 to 4.1 barg (-5 to 60 psig)<br />

Pressure accuracy: ± 0.02 barg (± 0.30 psig)<br />

Pressure resolution: 0.0007 barg (0.01 psig)<br />

Temperature range: 0°C to 60°C<br />

Sensor microchip: EPROM-stored sensor ID and calibration factor<br />

Sensor connector and cables: lockable and waterproof<br />

SciCon Flow-thru conductivity sensor specifications<br />

Material, Fluid Contact: natural polypropylene (PP) or polysulfone (PS) w/gold<br />

electrodes; medical grade meets USP Class VI and FDA 21 CFR 177.1520.<br />

All wetted materials are made of animalfree compounds. Compatible with most<br />

sanitizing agents such as NaOH and hypochlorite, for flow cell sanitization. Can be<br />

sterilized: autoclavable and Gamma stable.<br />

Sensor type: 4-electrode conductivity cell, factory calibrated, readyto use<br />

Conductivity range: 1 to 200 mS/cm. Resolution: 0.1 S/cm.<br />

Accuracy: high range: ± 0.25 mS in the 10 to 200 mS range. Low range: ± 3 μS in the<br />

0 to 100 μS range.<br />

Temperature range: 4°C to 50°C<br />

Temperature probe: thermistor, factory calibrated<br />

Temperature accuracy: ± 0.5°C<br />

Sensor microchip: EPROM-stores device ID, cell constant, temp offset and factory<br />

calibration data<br />

Precalibration: 47 μS at 25°C using standard traceable to NIST<br />

Sensor connector and cables: lockable and waterproof<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 55

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

Custom ReadyCircuit assemblies<br />

<strong>GE</strong> <strong>Healthcare</strong>’s ReadyToProcess standard product<br />

platform consists of over 240 bag, tubing, filter, and<br />

sensor assemblies. Complementing this, <strong>GE</strong> <strong>Healthcare</strong><br />

ReadyToProcess specialists can assemble these<br />

components, or components of your choosing, into a<br />

customized, presterilized, single-use fluid management<br />

solution. Customized assemblies can also be configured<br />

using our online configurator tool.<br />

Custom ReadyCircuit assemblies incorporate all of the<br />

design control and quality management systems as<br />

incorporated in our standard products. The flexibility of<br />

single use products and the flexibility of the <strong>GE</strong> <strong>Healthcare</strong><br />

team, allow for an optimized fluid management solution for<br />

specific requirements.<br />

Custom ReadyCircuit assembly components<br />

Custom ReadyCircuit assemblies can be configured from<br />

standard components.<br />

Bags: sizes available from 250 mL to 1000 L<br />

Tubing: C-Flex, Pumpsil and reinforced Silicone. Virtually<br />

any tubing length or dimensions can be specified, as well<br />

as alternative tubing types.<br />

Connectors, disconnects and tubing accessories:<br />

ReadyMate genderless DAC is available in six different<br />

configurations for maximum tubing flexibility. Aseptic<br />

disconnectors are available to meet tubing size<br />

requirements of 1/8 to 3/4 in. A full variety of tubing<br />

reducers, Ts and Ys are available<br />

Sensors: Flowthrough temperature, pressure, and<br />

conductivity sensors compatible with SciLog <strong>BioProcess</strong>ing<br />

Systems can be configured into ReadyCircuit systems.<br />

Filters: A wide variety of normal flow and cross flow hollow<br />

fiber filters can be used to configure a custom ReadyCircuit<br />

solution.<br />

Additional components such as pumps and valves can<br />

be designed into a system. The fully assembled custom<br />

ReadyCircuit solution can be designed to fit onto ReadyKart<br />

for full mobile processing and ease of use.<br />

Applications for custom ReadyCircuit assemblies<br />

• Cell harvest<br />

• Ultrafiltration/ diafiltration<br />

• Media preparation and storage<br />

• Buffer preparation and storage<br />

• Transfer systems for cell culture inoculation, media<br />

addition, pH adjust, or any transfer requiring assurance<br />

of aseptic delivery<br />

• Chromatography buffer supply<br />

• Bulk drug filling and storage<br />

• Sampling<br />

• Protein concentration<br />

• Virus concentration<br />

• Bulk drug substance formulation<br />

Speed, robustness, reliability<br />

Custom ReadyCircuit assemblies are reviewed by our<br />

product specialists to meet our design specifications. All<br />

custom ReadyCircuit assemblies are manufactured in<br />

an ISO Class 7 environment and with an ISO 9001:2008<br />

compliant certified quality management system.<br />

Assemblies can normally be constructed and delivered<br />

within 4–6 weeks.<br />

Ordering information<br />

Code number<br />

Description<br />

28-9876-79 Sensor Assembly, Pendo Tech, 1/2 in<br />

28-9903-20 PendoTech RM to RM Jumper 3/4 in<br />

28-9983-80 Pendo Tech RM to RM Jumper 1/4 in<br />

29-0013-91 10 L Cell Harvest Assembly<br />

29-0015-82 20 L Cell Harvest Assembly<br />

29-0015-84 50 L Cell Harvest Assembly<br />

29-0015-91 1/4 in Y Adapter, MPC and RM<br />

29-0015-92 1/4 in Y RM Adapter<br />

Visit us on the web at<br />

www.gelifesciences.com/<br />

readytoprocess<br />

56 www.gelifesciences.com/bioprocess

---

ReadyToProcess hollow fiber cartridges<br />

Typical applications of ReadyToProcess hollow fiber<br />

cartridges include:<br />

• Aseptic clarification and purification of vaccines,<br />

monoclonal antibodies, recombinant proteins, and<br />

plasmids<br />

• Aseptic cell processing<br />

• Environments where terminal sterilization is not feasible<br />

• Preclinical through Phase II clinical trials<br />

• Areas where the risk of cross-contamination is high<br />

• Fast-Trak drug development processes<br />

1<br />

2<br />

3<br />

ReadyToProcess hollow fiber cartridges enable simpler,<br />

safer, and faster drug development by minimizing device<br />

preparations steps such as wetting and sterilizing. The<br />

cartridges are designed to wet the membrane, lower total<br />

organic carbon (TOC) and conductivity, and minimize<br />

endotoxin and bioburden levels. The single-use nature of<br />

the columns eliminates the need for cleaning protocols<br />

and cleaning validation, as well as eliminating crosscontamination<br />

between runs. ReadyToProcess hollow fiber<br />

cartridges are packaged in high-purity water and sterilized<br />

via exposure to gamma radiation.<br />

Operating specifications<br />

Ultrafiltration<br />

Microfiltration<br />

Temperature range Up to 80°C 0.1 and 0.2 μm: up to 80°C<br />

0.45 and 0.65 μm: up to 50°C<br />

Maximum feed < 10°C: 5.2 barg (75 psig) At 25°C:<br />

pressure<br />

10°C–25°C: 4.5 barg (65 psig) 0.1 μm: 2.1 barg (30 psig)<br />

25°C–80°C: 3.4 barg (50 psig) 0.2 μm: 1.7 barg (25 psig)<br />

0.45 μm: 1 barg (15 psig)<br />

0.65 μm: 1 barg (15 psig)<br />

Maximum<br />

transmembrane<br />

pressure<br />

10–30 kD:<br />

< 10°C: 4.1 barg (60 psig)<br />

10°C–25°C: 3.4 barg (50 psig)<br />

25°C–50°C: 3.1 barg (45 psig)<br />

50°C–80°C: 2.4 barg (35 psig)<br />

50–750 kD:<br />

< 10°C: 3.4 barg (50 psig)<br />

10°C–25°C: 3.1 barg (45 psig)<br />

25°C–50°C: 2.4 barg (35 psig)<br />

50°C–80°C: 1.7 barg (25 psig)<br />

At 25°C:<br />

0.1 μm: 1.4 barg (20 psig)<br />

0.2 μm: 1 barg (15 psig)<br />

0.45 μm: 0.7 barg (10 psig)<br />

0.65 μm: 0.7 barg (10 psig)<br />

ReadyToProcess hollow fiber cartridges are available in a<br />

wide variety of ultrafiltration molecular weight cut-offs and<br />

microfiltration pore sizes, from lab to pilot scale.<br />

Technical specifications<br />

Model<br />

Cartridge diameter<br />

3M, 3X2M 0.9 cm (0.375 in)<br />

4M, 4X2M 1.9 cm (0.75 in)<br />

5, 6 3.2 cm (1.25 in)<br />

8, 9 5.1 cm (2 in)<br />

35, 55 7.6 cm (3 in)<br />

Model<br />

3M<br />

3X2M<br />

4M<br />

4X2M<br />

Cartridge length<br />

41.7 cm (16.4 in)<br />

73.5 cm (28.9 in)<br />

44.5 cm (17.5 cm)<br />

76 cm (29.9 in)<br />

5 41.8 cm (16.5 in)<br />

6 73.5 cm (28.9 in)<br />

8 44.9 cm (17.7 in)<br />

9 73.5 cm (28.9 in)<br />

35 45.6 cm (18 in)<br />

55 77.3 cm (30.4 in)<br />

Model<br />

Path length<br />

3M, 4M, 5, 8, 35 30 cm (12 in)<br />

3X2M, 4X2M, 6, 9, 55<br />

Fluid connections<br />

Feed/retentate<br />

Permeate<br />

Materials of construction<br />

Cartridge housing, fittings, fiber<br />

Cartridge sleeve<br />

Fiber net<br />

Fiber potting<br />

Permeate tubing<br />

ReadyMate<br />

Gaskets<br />

Regulatory conformance<br />

EMEA/410/01<br />

Biological Reactivity Test,<br />

In Vivo per USP Class VI<br />

21CFR177 Indirect Food Additives<br />

L929 MEM Elution Test –<br />

ISO 10993-5 (Cytotoxicity)<br />

60 cm (24 in)<br />

ReadyMate connectors<br />

ReadyMate connectors<br />

Polysulfone<br />

Polypropylene<br />

Polyethylene<br />

Epoxy<br />

C-Flex (3M, 3X2M)<br />

AdvantaPure (4M, 4X2M, 5, 6, 8, 9, 35, 55)<br />

Polycarbonate, silicone<br />

Silicone<br />

Compliant<br />

Compliant<br />

Compliant (except Size 3M and 3X2M)<br />

Compliant<br />

Hemolysis –<br />

Rabbit Blood (direct contact) – ISO 10993-4 Compliant<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 57

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

Ordering information<br />

ReadyToProcess hollow fiber cartridges - Ultrafiltration<br />

Code number Model number Pore size Fiber ID Membrane surface area Nominal flowpath<br />

(NMWC) (mm) (m 2 ) (ft 2 ) length (cm)<br />

39-0000-04 RTPUFP-10-C-3X2MS 10 000 0.5 0.029 0.31 60<br />

39-0000-05 RTPUFP-30-C-3X2MS 30 000 0.5 0.029 0.31 60<br />

39-0000-06 RTPUFP-50-C-3X2MS 50 000 0.5 0.029 0.31 60<br />

39-0000-07 RTPUFP-100-C-3X2MS 100 000 0.5 0.029 0.31 60<br />

39-0000-08 RTPUFP-300-C-3X2MS 300 000 0.5 0.029 0.31 60<br />

39-0000-09 RTPUFP-500-C-3X2MS 500 000 0.5 0.029 0.31 60<br />

39-0000-10 RTPUFP-750-E-3X2MS 750 000 1 0.023 0.24 60<br />

39-0000-67 RTPUFP-10-C-4MS 10 000 0.5 0.065 0.7 30<br />

39-0000-68 RTPUFP-30-C-4MS 30 000 0.5 0.065 0.7 30<br />

39-0000-69 RTPUFP-50-C-4MS 50 000 0.5 0.065 0.7 30<br />

39-0000-70 RTPUFP-100-C-4MS 100 000 0.5 0.065 0.7 30<br />

39-0000-71 RTPUFP-300-C-4MS 300 000 0.5 0.065 0.7 30<br />

39-0000-72 RTPUFP-500-C-4MS 500 000 0.5 0.065 0.7 30<br />

39-0000-73 RTPUFP-750-E-4MS 750 000 1 0.042 0.45 30<br />

39-0000-19 RTPUFP-10-C-4X2MS 10 000 0.5 0.14 1.5 60<br />

39-0000-20 RTPUFP-30-C-4X2MS 30 000 0.5 0.14 1.5 60<br />

39-0000-21 RTPUFP-50-C-4X2MS 50 000 0.5 0.14 1.5 60<br />

39-0000-22 RTPUFP-100-C-4X2MS 100 000 0.5 0.14 1.5 60<br />

39-0000-23 RTPUFP-300-C-4X2MS 300 000 0.5 0.14 1.5 60<br />

39-0000-24 RTPUFP-500-C-4X2MS 500 000 0.5 0.14 1.5 60<br />

39-0000-25 RTPUFP-750-E-4X2MS 750 000 1 0.085 0.9 60<br />

39-0000-74 RTPUFP-10-C-5S 10 000 0.5 0.2 2.1 30<br />

39-0000-75 RTPUFP-30-C-5S 30 000 0.5 0.2 2.1 30<br />

39-0000-76 RTPUFP-50-C-5S 50 000 0.5 0.2 2.1 30<br />

39-0000-77 RTPUFP-100-C-5S 100 000 0.5 0.2 2.1 30<br />

39-0000-78 RTPUFP-300-C-5S 300 000 0.5 0.2 2.1 30<br />

39-0000-79 RTPUFP-500-C-5S 500 000 0.5 0.2 2.1 30<br />

39-0000-80 RTPUFP-750-E-5S 750 000 1 0.12 1.3 30<br />

39-0000-34 RTPUFP-10-C-6S 10 000 0.5 0.48 5.2 60<br />

39-0000-35 RTPUFP-30-C-6S 30 000 0.5 0.48 5.2 60<br />

39-0000-36 RTPUFP-50-C-6S 50 000 0.5 0.48 5.2 60<br />

39-0000-37 RTPUFP-100-C-6S 100 000 0.5 0.48 5.2 60<br />

39-0000-38 RTPUFP-300-C-6S 300 000 0.5 0.48 5.2 60<br />

39-0000-39 RTPUFP-500-C-6S 500 000 0.5 0.48 5.2 60<br />

39-0000-40 RTPUFP-750-E-6S 750 000 1 0.28 3 60<br />

39-0000-81 RTPUFP-10-C-8S 10 000 0.5 0.53 5.7 30<br />

39-0000-82 RTPUFP-30-C-8S 30 000 0.5 0.53 5.7 30<br />

39-0000-83 RTPUFP-50-C-8S 50 000 0.5 0.53 5.7 30<br />

39-0000-84 RTPUFP-100-C-8S 100 000 0.5 0.53 5.7 30<br />

39-0000-85 RTPUFP-300-C-8S 300 000 0.5 0.53 5.7 30<br />

39-0000-86 RTPUFP-500-C-8S 500 000 0.5 0.53 5.7 30<br />

39-0000-87 RTPUFP-750-E-8S 750 000 1 0.36 3.9 30<br />

39-0000-49 RTPUFP-10-C-9S 10 000 0.5 1.15 12.5 60<br />

39-0000-50 RTPUFP-30-C-9S 30 000 0.5 1.15 12.5 60<br />

39-0000-51 RTPUFP-50-C-9S 50 000 0.5 1.15 12.5 60<br />

39-0000-52 RTPUFP-100-C-9S 100 000 0.5 1.15 12.5 60<br />

39-0000-53 RTPUFP-300-C-9S 300 000 0.5 1.15 12.5 60<br />

39-0000-54 RTPUFP-500-C-9S 500 000 0.5 1.15 12.5 60<br />

39-0000-55 RTPUFP-750-E-9S 750 000 1 0.84 9 60<br />

39-0000-89 RTPUFP-500-C-35S 500 000 0.5 1.35 14.5 30<br />

39-0000-91 RTPUFP-500-C-55S 500 000 0.5 3.25 35 60<br />

58 www.gelifesciences.com/bioprocess

---

Ordering information<br />

ReadyToProcess hollow fiber cartridges – Microfiltration<br />

Code number Model number Pore size Fiber ID Membrane surface area Nominal flowpath<br />

(NMWC) (mm) (m 2 ) (ft 2 ) length (cm)<br />

39-0000-00 RTPCFP-1-E-3MS 0.1 1 0.011 0.12 30<br />

39-0000-01 RTPCFP-2-E-3MS 0.2 1 0.011 0.12 30<br />

39-0000-02 RTPCFP-4-E-3MS 0.45 1 0.011 0.12 30<br />

39-0000-03 RTPCFP-6-D-3MS 0.65 0.75 0.012 0.13 30<br />

39-0000-11 RTPCFP-1-E-3X2MS 0.1 1 0.023 0.24 60<br />

39-0000-12 RTPCFP-2-E-3X2MS 0.2 1 0.023 0.24 60<br />

39-0000-13 RTPCFP-4-E-3X2MS 0.45 1 0.023 0.24 60<br />

39-0000-14 RTPCFP-6-D-3X2MS 0.65 0.75 0.027 0.29 60<br />

39-0000-15 RTPCFP-1-E-4MS 0.1 1 0.042 0.45 30<br />

39-0000-16 RTPCFP-2-E-4MS 0.2 1 0.042 0.45 30<br />

39-0000-17 RTPCFP-4-E-4MS 0.45 1 0.042 0.45 30<br />

39-0000-18 RTPCFP-6-D-4MS 0.65 0.75 0.046 0.5 30<br />

39-0000-26 RTPCFP-1-E-4X2MS 0.1 1 0.085 0.91 60<br />

39-0000-27 RTPCFP-2-E-4X2MS 0.2 1 0.085 0.91 60<br />

39-0000-28 RTPCFP-4-E-4X2MS 0.45 1 0.085 0.91 60<br />

39-0000-29 RTPCFP-6-D-4X2MS 0.65 0.75 0.095 1.02 60<br />

39-0000-30 RTPCFP-1-E-5S 0.1 1 0.12 1.3 30<br />

39-0000-31 RTPCFP-2-E-5S 0.2 1 0.12 1.3 30<br />

39-0000-32 RTPCFP-4-E-5S 0.45 1 0.12 1.3 30<br />

39-0000-33 RTPCFP-6-D-5S 0.65 0.75 0.16 1.7 30<br />

39-0000-41 RTPCFP-1-E-6S 0.1 1 0.28 3 60<br />

39-0000-42 RTPCFP-2-E-6S 0.2 1 0.28 3 60<br />

39-0000-43 RTPCFP-4-E-6S 0.45 1 0.28 3 60<br />

39-0000-44 RTPCFP-6-D-6S 0.65 0.75 0.37 4 60<br />

39-0000-45 RTPCFP-1-E-8S 0.1 1 0.36 3.9 30<br />

39-0000-46 RTPCFP-2-E-8S 0.2 1 0.36 3.9 30<br />

39-0000-47 RTPCFP-4-E-8S 0.45 1 0.36 3.9 30<br />

39-0000-48 RTPCFP-6-D-8S 0.65 0.75 0.41 4.4 30<br />

39-0000-56 RTPCFP-1-E-9S 0.1 1 0.84 9 60<br />

39-0000-57 RTPCFP-2-E-9S 0.2 1 0.84 9 60<br />

39-0000-58 RTPCFP-4-E-9S 0.45 1 0.84 9 60<br />

39-0000-59 RTPCFP-6-D-9S 0.65 0.75 0.93 10 60<br />

39-0000-88 RTPCFP-6-D-35S 0.65 0.75 1 10.8 30<br />

39-0000-90 RTPCFP-6-D-55S 0.65 0.75 2.5 27 60<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 59

---

1<br />

ReadyToProcess ULTA normal flow filter capsules<br />

2<br />

3<br />

ReadyToProcess<br />

ReadyToProcess ULTA normal flow filter capsules are<br />

single-use filters designed for laboratory through process<br />

scale applications. Volumes range from a few milliliters<br />

to thousands of liters of solution. The filters provide<br />

prefiltration and sterilizing grade filtration for a wide range<br />

of biopharmaceutical solutions.<br />

ULTA normal flow filter capsules are available in four<br />

assemblies:<br />

• ReadyCircuit ULTA SG capsule assembly: for sterile<br />

filtration of biopharmaceutical solutions<br />

• ReadyCircuit ULTA HC capsule assembly: for effective<br />

sterile filtration of difficult-to-filter biopharmaceutical and<br />

diagnostic solutions<br />

• ReadyCircuit ULTA CG capsule assembly: for controlling<br />

bioburden and particle retention in a wide variety of pH<br />

ranges and feed streams<br />

• ReadyCircuit ULTA GF capsule assembly: for effective<br />

prefiltration/clarification of biopharmaceutical solutions<br />

Maximum recommended operating conditions<br />

Large capsule assemblies with<br />

Readymate (5 in, 10 in, 20 in, 30 in capsules)<br />

Small capsule assemblies with C-Flex tubing<br />

and ReadyMate (2 in, 4 in, 6 in capsules)<br />

5.5 barg (79 psi) at 25˚C (77˚F)<br />

1 barg (14.5psi) at 25˚C (77˚F)<br />

ULTA filters - Integrity test parameters for sterile filters and bioburden reduction filters<br />

Pore size IT ΔP Diffusional Flow Specification (sccm) Bubble Point<br />

(microns) (barg) 2 in 4 in 6 in 5 in 10 in 20 in 30 in (barg)<br />

ULTA Prime CG 0.6/0.2 1.70 1.2 2.9 6.0 7.4 16.0 32.0 48.0 2.48<br />

ULTA Pure SG 0.22 2.80 1.2 2.9 6.0 7.4 16.0 32.0 48.0 3.38<br />

ULTA Pure HC 0.6/0.22 2.80 1.4 3.2 6.7 8.4 18.0 36.0 54.0 3.38<br />

Area specifications/Integrity specifications. ULTA filters - effective filtration area. All values are in square meters (m 2 ).<br />

Pore size<br />

Mean Surface Area<br />

(microns) 2 in 4 in 6 in 5 in 10 in 20 in 30 in<br />

ULTA Prime GF 0.6 0.045 0.095 0.19 0.27 0.56 1.12 1.68<br />

1.0 0.045 0.095 0.19 0.24 0.51 1.01 1.52<br />

2.0 0.045 0.095 0.19 0.24 0.51 1.01 1.52<br />

5.0 0.045 0.095 0.19 0.26 0.53 1.07 1.60<br />

7.0 0.036 0.076 0.15 0.20 0.42 0.83 1.25<br />

10.0 0.036 0.076 0.15 0.20 0.42 0.83 1.25<br />

ULTA Prime CG 0.6/0.2 0.047 0.10 0.21 0.26 0.55 1.10 1.65<br />

ULTA Pure SG 0.2 0.047 0.10 0.21 0.26 0.55 1.10 1.65<br />

ULTA Pure HC 0.6/0.2 0.047 0.10 0.21 0.26 0.55 1.10 1.65<br />

60 www.gelifesciences.com/bioprocess

---

Ordering information<br />

ULTA normal flow filter capsule assemblies<br />

Code number Description Expanded description<br />

1<br />

12-4100-58 1XCG9202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-59 1XCG9204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

2<br />

12-4100-60 1XCG92H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 5 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-61 1XCG9206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-62 1XCG9210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-63 1XCG9220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

3<br />

12-4100-64 1xCG9230 2x RM A ReadyCircuit assembly comprised of an ULTA Prime CG 0.2 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-65 1XGF9602 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-66 1XGF9604 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-67 1XGF96H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 5 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-68 1XGF9606 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

ReadyToProcess<br />

12-4100-69 1XGF9610 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-70 1XGF9620 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-71 1XGF9630 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 0.6 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-72 1XGF0102 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-73 1XGF0104 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-74 1XGF0106 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 5 in capsule filter and of tubing terminating with ReadyMate<br />

connectors.<br />

12-4100-75 1XGF01H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 6 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-76 1XGF0110 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-77 1XGF0120 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-78 1XGF0130 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 1 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-79 1XGF0202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-80 1XGF0204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-81 1XGF0206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 5 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-82 1XGF02H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 6 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-83 1XGF0210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-84 1XGF0220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-85 1xGF0230 2x RM A ReadyCircuit assembly comprised of an ULTA Prime GF 2 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-86 1XGF0502 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-87 1XGF0504 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

www.gelifesciences.com/bioprocess 61

---

1<br />

Ordering information<br />

ULTA normal flow filter capsule assemblies<br />

Code number Description Expanded description<br />

12-4100-88 1XGF05H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 5 in capsule filter terminating with ReadyMate connectors.<br />

2<br />

12-4100-89 1XGF0506 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-90 1XGF0510 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-91 1XGF0520 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

3<br />

12-4100-92 1XGF0530 2X RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-93 1XHC9202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-94 1XHC9204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

ReadyToProcess<br />

12-4100-95 1XHC92H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 5 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-96 1XHC9206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4100-97 1XHC9210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-98 1XHC9220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

12-4100-99 1XHC9230 2X RM A ReadyCircuit assembly comprised of an ULTA Prime HC 0.6 / 0.2 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

12-4101-00 1XSG9202 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 2 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4101-01 1XSG9204 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 4 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4101-02 1SG92H1 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 5 in capsule filter terminating with ReadyMate connectors.<br />

12-4101-03 1XSG9206 2X0.5 FT CF RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 6 in capsule filter and 6 in (152 mm) of C-Flex 374 tubing<br />

terminating with ReadyMate connectors.<br />

12-4101-04 1XSG9210 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 10 in capsule filter terminating with ReadyMate connectors.<br />

12-4101-05 1XSG9220 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 20 in capsule filter terminating with ReadyMate connectors.<br />

12-4101-06 1XSG9230 2X RM A ReadyCircuit assembly comprised of an ULTA Prime SG 0.2 µm 30 in capsule filter terminating with ReadyMate connectors.<br />

Ordering information<br />

ULTA normal flow filter capsule assemblies - cell harvest filter trains<br />

Code number Description Expanded description<br />

12-4102-45 1xGF0502 1xCG9202 2x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 2 in capsule filter and ULTA Prime CG 0.2 µm 2 in capsule<br />

filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors.<br />

12-4102-46 1xGF05H1 1xCG9206 1x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 5 in capsule filter and ULTA Prime CG 0.2 µm 6 in capsule<br />

filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors.<br />

12-4102-47 1xGF0510 1xCG92H1 2xRM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 10 in capsule filter and ULTA Prime CG 0.2 µm 5 in capsule<br />

filter terminating with ReadyMate connectors.<br />

12-4102-48 1xGF0520 1xCG9210 2xRM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 20 in capsule filter and ULTA Prime CG 0.2 µm 10 in<br />

capsule filter terminating with ReadyMate connectors.<br />

12-4102-51 1xGF0502 1xHC9202 2x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 2 in capsule filter and ULTA Prime HC 0.6 / 0.2 µm 2 in<br />

capsule filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors.<br />

12-4102-52 1xGF05H1 1xHC9206 1x0.5ft C RM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 5 in capsule filter and ULTA Prime HC 0.6 / 0.2 µm 6 in<br />

capsule filter with 6 in (152 mm) of C-Flex 374 tubing terminating with ReadyMate connectors.<br />

12-4102-53 1xGF0510 1xHC92H1 2xRM A ReadyCircuit assembly comprised of an ULTA Prime GF 5 µm 10 in capsule filter and ULTA Prime HC 0.6 / 0.2 µm 5 in<br />

capsule filter terminating with ReadyMate connectors.<br />

62 www.gelifesciences.com/bioprocess

---

ReadyKart mobile processing station<br />

1<br />

ReadyKart mobile processing station delivers:<br />

• Quick and convenient setup of fluid processing equipment<br />

saves time and allows users to do their best work<br />

• Nesting capabilities with hose/tubing routing enables<br />

integration of multi-step processes<br />

• A wide range of fluid processing setups<br />

ReadyKart Mobile Processing Station is a configurable<br />

cart that mechanically supports and enhances the use of<br />

<strong>GE</strong> <strong>Healthcare</strong> ReadyToProcess fluid processing products.<br />

2<br />

3<br />

ReadyKart mobile processing stations fit well with the<br />

goals of scientists, process engineers, and laboratory<br />

technicians who must configure fluid processing<br />

systems for product and process development or pilot<br />

manufacturing. When used with <strong>GE</strong> <strong>Healthcare</strong>’s family of<br />

ReadyToProcess components, users can quickly configure<br />

a wide range of sterile and disposable fluid processing<br />

systems. Since ReadyKart enables the ergonomic<br />

placement of equipment, users perform their tasks faster<br />

and better.<br />

Versatile approach to fluid processing<br />

Similar to other ReadyToProcess equipment, ReadyKart<br />

offers versatility, simplification, and efficiency. ReadyKart<br />

accommodates and organizes the following fluid<br />

processing components:<br />

• Configurable and stackable shelves—support pumps,<br />

process sensor monitors, and trays and bins that hold<br />

processing bags<br />

• Trays and bins—tilting trays hold and tilt pillow bags<br />

horizontally, while bins hold large 3-D bags. Both allow<br />

convenient routing of inlet and outlet port tubing.<br />

• Holders for bags and filters—adjustable-height bag<br />

holders hold pillow bag vertically. Filter holders support<br />

normal- and cross-flow filters attached with laboratory<br />

clamps. Bags and filters are held at convenient heights<br />

for easy setup and monitoring.<br />

ReadyToProcess<br />

Ordering information<br />

ReadyKart full size accessories and replacement parts<br />

Code number Description Usage guide<br />

28-9778-94 ReadyKart with 3 shelves Basic full size cart pre-configured with a bottom stainless steel shelf and 2 solid shelves, 2 arm clamp assemblies to<br />

hang bags, 2 hanging bag protectors and 1 filter holder rod and clamp assembly and 1 end panel<br />

28-9778-96 ReadyKart frame for 3 shelves Basic full size cart frame with a stainless steel bottom shelf will accept up to 2 removable shelves to be accessorized<br />

as required<br />

28-9779-08 ReadyKart shelf no tank hole Replacement part—Accessory for full cart frame, up to 2 required depending on desired configuration<br />

28-9779-09 ReadyKart t-shelf with tank hole Accessory, 2 required if using 200 L tank, 1 required if using 100 L tank<br />

28-9778-99 ReadyKart top shelf assembly Accessory for full size cart added 2-shelf capability (transport to freezing, storage, cascading process train). When<br />

installed, unable to use filter holder rods.<br />

Ordering information<br />

ReadyKart mini accessories and replacement parts<br />

Code number Description Usage guide<br />

28-9778-97 ReadyKart mini with 3 shelves Basic half size cart pre-configured with a bottom stainless steel shelf and 2 solid shelves, 1 arm clamp assemblies to<br />

hang bags, 1 hanging bag protectors and 1 filter holder rod and clamp assembly<br />

28-9778-98 ReadyKart mini frame for 3 shelves Basic half size cart frame with a stainless steel bottom shelf will accept up to 2 removable shelves to be accessorized<br />

as required<br />

28-9779-10 ReadyKart mini shelf no tank hole Replacement par—Accessory for minicart frame, up to 2 required depending on desiredconfiguration<br />

28-9779-13 ReadyKart mini shelf with tank hole Accessory, 2 required if using 200 L tank, 1 required if using 100 L tank<br />

28-9779-00 ReadyKart mini top shelf assembly Accessory for “half” size cart added 2-shelf capability (transport to freezing, storage, cascading process train). When<br />

installed, unable to use filter holder rods.<br />

www.gelifesciences.com/bioprocess 63

---

1<br />

Ordering information<br />

ReadyKart accessories that fit the full and mini sizes<br />

Code number Description Usage guide<br />

28-9779-03 ReadyKart 200 L tank Requires 2 shelves with tank holes. Catalog number 28977909 on full size cart or catalog number 28977913<br />

on the mini cart<br />

2<br />

3<br />

ReadyToProcess<br />

28-9779-04 ReadyKart 100 L tank Requires 1 shelf with tank hole in the upper shelf of the cart. Catalog number 28977909 on full size cart or catalog<br />

number 28977913 on the mini cart<br />

28-9779-05 ReadyKart 1 and 5L tray Accessory support, recommended for pillow bags and hanging bags used as pillow bags<br />

28-9779-06 ReadyKart 10, and 20 L tray Accessory support, recommended for pillow bags and hanging bags used as pillow bags, can be mounted<br />

across width of carts<br />

28-9779-07 ReadyKart 50 L tray Accessory support, recommended for 50 L pillow bags.<br />

28-9779-02 ReadyKart filter holder rod Accessory required to hold filters vertical at cart corners, requires filter holder clamp or customer supplied equal.<br />

Cannot use if top shelf assembly in place.<br />

28-9779-26 ReadyKart filter holder clamp Accessory required to hold filters vertical at cart corners, requires filter holder rod (should this be part of an assembly<br />

with the rod and also as a replacement part<br />

28-9779-01 ReadyKart arm clamp assembly Accessory required to hold hanging boat fitment bags, recommend hanging bag plate for added bag protection<br />

28-9779-17 ReadyKart hanging bag plate Accessory recommended for protection of hanging bag that would rest against the arm clamp assembly<br />

Ordering information<br />

ReadyKart replacement parts<br />

Code number Description Usage guide<br />

28-9779-22 ReadyKart tray lift assembly Replacement part<br />

28-9779-23 ReadyKart arm clamp Replacement part<br />

28-9779-24 ReadyKart arm glide insert Replacement part<br />

28-9779-18 ReadyKart arm gas spring Replacement part<br />

28-9779-25 ReadyKart arm glide locator Replacement part<br />

28-9779-20 ReadyKart swivel lock caster Replacement part<br />

28-9779-19 ReadyKart fixed caster Replacement part<br />

28-9779-21 ReadyKart end panel Replacement part<br />

Visit us on the web at<br />

www.gelifesciences.com/<br />

readytoprocess<br />

64 www.gelifesciences.com/bioprocess

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 65

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

ReadyToProcess connectivity<br />

<strong>GE</strong> <strong>Healthcare</strong>’s line of<br />

ReadyToProcess systems and<br />

accessories are supported by<br />

integrated devices that help maintain<br />

secure connectivity throughout the<br />

manufacturing process. Simple,<br />

sterile connections between media<br />

bags, as well as leak proof seals of<br />

thermoplastic tubing are examples<br />

of ReadyToProcess connectivity<br />

solutions. ReadyToProcess<br />

connectivity products provide the<br />

links between our systems and<br />

components, allowing rapid, secure<br />

workflows and maintaining sterile<br />

integrity.<br />

Visit us on the web at<br />

www.gelifesciences.com/<br />

readytoprocess<br />

66 www.gelifesciences.com/bioprocess

---

ReadyMate Disposable Aseptic Connectors<br />

1<br />

1/4 in<br />

3/8 in<br />

TC<br />

1/2 in<br />

3/4 in<br />

Mini TC<br />

The ReadyMate Disposable Aseptic Connector (DAC)<br />

provides secure connections for high-fluid throughput and<br />

offers a simple and economical connection for upstream<br />

and downstream applications. ReadyMate DAC is autoclave<br />

and gamma compatible, and can be part of a sterile<br />

circuit. It can be used to connect unit operations and<br />

assemblies, upstream and downstream. ReadyMate DAC<br />

is manufactured in compliance with the current Good<br />

Manufacturing Practices of the FDA and ISO 9000-2000.<br />

Strap clamps are disposable and easy to use clamps<br />

ensuring leak-proof, traceable connections and meet ISO<br />

standard 2852.<br />

ReadyMate connectors provide:<br />

• Secure, single-use connections made quickly and easily<br />

in any environment<br />

• Genderless design with cross-size connectivity reduces<br />

inventory and increases flexibility<br />

• Large inner diameter for high throughput<br />

• TC, Mini-TC, and standard hose barb sizes<br />

• Secure closure mechanism using standard sanitary<br />

clamps (ISO 2852) or a disposable clamp to make a<br />

tamper-proof, lightweight connection<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

ReadyMate DAC 250 with 1/4 in barb 50* 28-9366-91<br />

ReadyMate DAC 250 with 1/4 in barb 10 † 28-9366-12<br />

ReadyMate DAC 375 with 3/8 in barb 50* 28-9366-92<br />

ReadyMate DAC 375 with 3/8 in barb 10 † 28-9366-87<br />

ReadyMate DAC 500 with 1/2 in barb 50* 28-9366-93<br />

ReadyMate DAC 500 with 1/2 in barb 10 † 28-9366-88<br />

ReadyMate DAC 750 with 3/4 in barb 50* 28-9366-94<br />

ReadyMate DAC 750 with 3/4 in barb 10 † 28-9366-89<br />

ReadyMate DAC 750 Mini TC 50* 28-9367-07<br />

ReadyMate DAC 750 Mini TC 10 † 28-9366-95<br />

ReadyMate DAC 1500 TC 50* 28-9568-90<br />

ReadyMate DAC 1500 TC 10 † 28-9568-89<br />

ReadyClamp 25 28-9366-90<br />

* five bags of 10<br />

†<br />

one bag of 10<br />

Technical specifications<br />

Sizes<br />

1/4 in (6.4 mm OD)<br />

3/8 in (9.5 mm OD)<br />

1/2 in (12.7 mm OD)<br />

3/4 in (19.1 mm OD)<br />

Standard Mini-TC (ID 15.7 mm)<br />

Standard TC 1½ in (ID 19.7 mm)<br />

Outside clamp profile 50 mm (1½ in) ISO standard 2852<br />

Wetted materials<br />

Polycarbonate<br />

Silicone rubber<br />

Material compliance<br />

USP Class VI<br />

21 CFR 177<br />

Animal-free origin or compliance to EMEA/410/01<br />

Maximum Pressure*<br />

5 bar (4°C to 40°C)<br />

Sterilization method<br />

Gamma irradiation (25–50 kGy)<br />

Autoclaving (125°C, 15–30 min)<br />

One sterilization cycle<br />

Not intented for Steam-in-Place (SIP)<br />

Shelf life<br />

3 yrs<br />

Storage temperature 4°C to 30°C<br />

* Depends on strapping and assembly components.<br />

Visit us on the web at<br />

www.gelifesciences.com/readytoprocess<br />

2<br />

3<br />

ReadyToProcess<br />

Standard clamp<br />

ReadyClamp<br />

www.gelifesciences.com/bioprocess 67

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

Sterile Tube Fuser<br />

The Sterile Tube Fuser is a fully automated device for<br />

welding together dry or fluid-filled thermoplastic tubing<br />

in a sterile operation without the need for a laminar flow<br />

cabinet or similar environmental control device. The<br />

instrument is useful for connecting tubing between sterile<br />

containers, bioreactor bags, and process equipment. The<br />

unit can connect large diameter (up to 22.2 mm OD; dry<br />

only) tubing for the rapid and secure transfer of large<br />

volumes of inoculum, media buffers, process intermediates,<br />

and other products.<br />

Applications include:<br />

• Sterile media transfer<br />

• Vaccine manufacture<br />

• Filling and formulation<br />

• Bioreactors feed and harvest<br />

• Pharmaceutical process fluid transfer<br />

• High containment operations<br />

• In-process pooling<br />

• Transferring buffers<br />

Sterile Tube Fuser features include:<br />

• Tubing diameters from 6.4–22.2 mm (1/4–7/8 in) using<br />

interchangeable tubing holders<br />

• Typical welding cycle takes 2–3 min<br />

• Secure and rapid fluid transfer<br />

• Infrared blade temperature sensor<br />

• PC interface for data printing and parameter download<br />

• PTFE-coated blades for strong welds<br />

• Can be used to weld most thermoplastic tubing<br />

Ordering information<br />

<strong>Product</strong><br />

Quantity Code number<br />

Sterile Tube Fuser – Dry 1 28-9996-02<br />

Tube Holder Set for 15.5 mm (5/8 in) OD tubing 1 28-4116-81<br />

Tube Holder Set for 15.5 mm (5/8 in) OD tubing(clamped<br />

tube holder set for wet welding;for use with STF-IRcWW) 1 28-4116-92<br />

Tube Holder Set for 19.1 mm (3/4 in) OD tubing 1 28-4116-82<br />

Tube Holder Set for 11.2 mm (7/16 in) OD tubing 1 28-4116-83<br />

Tube Holder Set for 11.2 mm (7/16 in) OD tubing (clamped<br />

tube holder set for wet welding; for use with STF-IRcWW) 1 28-4116-93<br />

Tube Pinch Holder Set for 6.4 mm (1/4 in) OD tubing 1 29-0026-29<br />

Tube Holder Set for 6.4 mm (1/4 in) OD tubing (clamped<br />

tube holder set for wet welding; for use with STF-IRcWW) 1 28-4116-94<br />

Tube Holder Set for 8.0 mm (5/16 in) OD tubing 1 28-4116-85<br />

Tube Holder Set for 9.6 mm (3/8 in) OD tubing 1 28-4116-86<br />

Tube Holder Set for 12.5 mm (1/2 in) OD tubing 1 28-4116-87<br />

Tube Holder Set for 12.5 mm (1/2 in) OD tubing (clamped<br />

tube holder set for wet welding; for use with STF-IRcWW) 1 28-4116-95<br />

Tube Holder Set for 22.2 mm (7/8 in) OD tubing 1 28-4116-88<br />

Tube Holder Set for 14.3 mm (9/16 in) OD tubing 1 28-4128-99<br />

Single-use stainless steel cutting blades with PTFE coating.<br />

Non-sterile (50 blades/package) 1 28-4117-01<br />

Blade removal tool 1 28-9543-27<br />

STF Tube Data Management Tool (GUI) 1 29-0026-52<br />

Temperature Verification Kit 1 28-4116-98<br />

Programming Lock Key 1 WV-0019-84<br />

Technical specifications<br />

Cutting Blades (BLADES-IR/50)<br />

Dimensions (L × W × H)<br />

Weight<br />

Utilities<br />

Environmental<br />

Tube types vs. tube sizes<br />

1/8 × 1/4 in<br />

3/16 × 5/16 in<br />

3/16 × 3/8 in<br />

1/4 × 3/8 in<br />

Single-use, 50 per pack<br />

395 × 355 × 265 mm (15.5 × 14 × 10.4 in)<br />

16 kg (35 lb)<br />

Voltage: 100–120/220–240 VAC<br />

Frequency: 50/60 Hz<br />

This equipment is designed for use under the<br />

following conditions:<br />

• Indoor use<br />

• 0°C to 30°C<br />

• 2% to 80% rh, non-condensing<br />

Bioprene<br />

C-Flex 082*<br />

C-Flex 374* ● ● ● ●<br />

PHARMED BPT*<br />

SANIPURE 60<br />

SANIPURE BDF*<br />

TYGON/PVC<br />

Visit us on the web at www.gelifesciences.com/wave<br />

1/4 × 7/16 in<br />

* Denotes the factory loaded tubing types<br />

All compatible tube sizes<br />

• ReadyToProcess tube sizes<br />

5/16 × 7/16 in<br />

1/4 × 1/2 in<br />

3/8 × 1/2 in<br />

7/16 × 9/16 in<br />

3/8 × 5/8 in<br />

1/2 × 3/4 in<br />

5/8 × 7/8 in<br />

68 www.gelifesciences.com/bioprocess

---

Tube Sealer<br />

Ordering information<br />

<strong>Product</strong><br />

Quantity Code number<br />

Tube Sealer (preprogrammed to thermally seal C-Flex,<br />

Sanipure, PVC, Tygon, and PharMed thermoplastic tubing<br />

from 6.4 to 31.8 mm OD) 1 28-4117-04<br />

Tube Data Management Tool (GUI) 1 29-0027-82<br />

Functional Verification Gauge 1 28-4117-09<br />

Quick Change Tube Restrictor Kit 1 WV-0032-61<br />

Programming Lock Key 1 WV-0019-84<br />

Technical specifications<br />

Dimensions (L × W × H)<br />

Weight<br />

Utilities<br />

Environmental<br />

165 × 356 × 203 mm (6.5 × 14 × 8 in)<br />

8 kg (18 lb)<br />

Voltage: 100–120/220–240 VAC<br />

Frequency: 50/60 Hz<br />

Power: 350 VA<br />

This equipment is designed for use under the<br />

following conditions:<br />

• Indoor use<br />

• 2°C to 32°C<br />

• 2% to 80% rh, non-condensing<br />

1<br />

2<br />

3<br />

ReadyToProcess<br />

Tube Sealer is a portable device that can heat-seal<br />

thermoplastic tubing from 6.4 to 31.8 mm OD. The seal<br />

forms a tamperproof and leakproof closure for securing<br />

tubes from bags, bottles, and other vessels. Tube Sealer<br />

is preprogrammed for many brands of tubing, is fully<br />

automated for validatable operation, and prevents fluids<br />

such as inoculum, products, media, and buffers from<br />

leaking through tubing, clamps, and plugs.<br />

Tube types vs. tube sizes<br />

1/8 × 1/4 in<br />

3/16 × 5/16 in<br />

3/16 × 3/8 in<br />

1/4 × 3/8 in<br />

1/4 × 7/16 in<br />

5/16 × 7/16 in<br />

1/4 × 1/2 in<br />

3/8 × 1/2 in<br />

3/8 × 5/8 in<br />

1/2 × 3/4 in<br />

Bioprene<br />

C-Flex 082<br />

C-Flex 374 ● ● ● ●<br />

5/8 × 7/8 in<br />

3/4 × 1 1/8 in<br />

3/4 × 1 1/4 in<br />

Tube Sealer has a range of applications including:<br />

• Sealing tubing attached to bags<br />

• Tamperproof sealing<br />

• Sampling<br />

• Shipping/storage<br />

PHARMED BPT<br />

SANIPURE 60<br />

SANIPURE BDF<br />

TYGON/PVC<br />

All compatible tube sizes<br />

• ReadyToProcess tube sizes<br />

• Sealing transfer/sampling lines<br />

Key features of Tube Sealer include:<br />

• Keypad-selectable programs for virtually all types and<br />

sizes of thermoplastic tubing up to 31.8 mm OD<br />

• Typical sealing cycle takes 2–3 min<br />

• No adapters required over the entire size range<br />

• Lightweight unit can be used anywhere in the plant or<br />

laboratory<br />

• Microprocessor controlled motor ensures reproducible<br />

and validatable performance<br />

• No accessories, compressed air or cooling water needed<br />

• Factory settings for sealing most thermoplastic tubing<br />

Visit us on the web at www.gelifesciences.com/wave<br />

www.gelifesciences.com/bioprocess 69

---

1<br />

ReadyToProcess chromatography<br />

2<br />

3<br />

ReadyToProcess<br />

ÄKTA ready and ReadyToProcess columns<br />

are part of the ReadyToProcess platform,<br />

consisting of plug-and-play, ready-touse<br />

solutions for entire chromatography<br />

processes.<br />

ÄKTA ready is a fully automated liquid<br />

chromatography system for process<br />

scale-up and production of materials<br />

for clinical trials. The system operates<br />

with ready to-use, disposable flow paths<br />

that are available in High and Low Flow<br />

Kits. The need for cleaning between<br />

products/batches is eliminated and no<br />

development or validation of cleaning<br />

procedures is required.<br />

Highlights of ÄKTA ready systems include:<br />

• Simple exchange of the complete flow<br />

path removes the need for system<br />

cleaning<br />

• Improved economy and productivity<br />

due to simpler procedures<br />

• Single-use eliminates risk of crosscontamination<br />

between products/<br />

batches<br />

• Scalable processes using UNICORN<br />

ReadyToProcess columns are designed<br />

for seamless scalability, delivering the<br />

same performance level as available in<br />

conventional processing columns such<br />

as AxiChrom and BPG. ReadyToProcess<br />

columns are designed for purification of<br />

biopharmaceuticals for clinical phase I<br />

and II studies. Depending on the scale<br />

of operations, they can also be used for<br />

full-scale manufacturing, as well as for<br />

preclinical studies.<br />

ReadyToProcess columns provide a range<br />

of benefits including:<br />

• Time savings – by eliminating several<br />

time-consuming steps<br />

• Cost savings – by lowering buffer<br />

consumption and reducing cleaning<br />

validation demands<br />

• Process security – robust column<br />

construction and performance<br />

• Scalability – by facilitating conventional<br />

approaches in larger scales<br />

• Reduced cross-contamination<br />

Visit us on the web at<br />

www.gelifesciences.com/readytoprocess<br />

70 www.gelifesciences.com/bioprocess

---

ÄKTA ready system<br />

Ordering information<br />

<strong>Product</strong><br />

Code number<br />

ÄKTA ready system including column trolley and UNICORN 28-9062-61<br />

Accessories<br />

High Flow Kit, ÄKTA ready 28-9301-83<br />

Low Flow Kit, ÄKTA ready 28-9301-82<br />

Low flow test kit ÄKTA ready 28-9336-80<br />

UV Cond test tools ÄKTA ready 28-9336-88<br />

Pressure calib tool ÄKTA ready 28-9329-42<br />

ReadyToProcess columns see page 72<br />

1<br />

2<br />

3<br />

ÄKTA ready is a fully automated liquid chromatography<br />

system for process scale-up and production of materials for<br />

clinical trials. After the completion of a purification task, the<br />

columns and the flow path (i.e., the Flow Kits) can be either<br />

disposed of or exchanged for reuse. The ReadyToProcess<br />

concept can speed up processes considerably due to<br />

fewer operations: there is no need to establish and validate<br />

cleaning procedures, and no complex setup. The flow path<br />

can be changed quickly, with a downtime of less than 1 h.<br />

This saves time, capital investment, start-up cost, and costs<br />

of labor and consumables.<br />

Technical specifications<br />

General specifications<br />

Dimensions (W × D × H) 1000 × 800 × 1650 mm<br />

Weight<br />

230 kg<br />

Control system<br />

UNICORN v5.20 or higher<br />

Instrument input voltage AC Voltage, 1 × 100/120/200–208/220–230/240 V, ±<br />

10%, 50/60 Hz<br />

Max. power consumption 1 kVA<br />

Ingress protection<br />

IP45<br />

Compressed air interface 5.5–7 bar, 50 Nl/min, oil- and particle-free<br />

Operating conditions<br />

Surrounding temperature 2°C to 30°C<br />

Fluid temperature 2°C to 40°C<br />

Fluid density 950–1050 kg/m 3<br />

Fluid viscosity<br />

1.0–1.3 × water viscosity at actual temperature, max.<br />

2.5 cP<br />

System capacity<br />

Volumetric flow rates 7.5–510 L/h High Flow Kit<br />

3–175 L/h Low Flow Kit<br />

Pump speed<br />

340 rpm (100%) High Flow Kit<br />

225 rpm (100%) Low Flow Kit<br />

Max. pressure,<br />

peristaltic pump<br />

4.0 bar<br />

System pressure rating 5.0 bar (high-pressure flow path, upstream column)<br />

2.0 bar (high-pressure flow path, downstream column)<br />

0.95 bar (low-pressure outlet manifold)<br />

0.6 bar (low-pressure inlet manifold)<br />

ReadyToProcess<br />

Validation with UNICORN software<br />

UNICORN software has an installation wizard that checks<br />

the setup and the installation and functionality of the<br />

Flow Kit and sensors. A report is generated with completed<br />

installation procedures including instructions from the<br />

wizard, traceability to Flow Kit, process information,<br />

and results from the component test. The installation<br />

wizard also contains instructions and reports for column<br />

installation. UNICORN has undergone an independent audit<br />

and is designed as a control package in FDA 21 CFR part 11<br />

and GMP compliant environments. The record system uses<br />

a document locking scheme and traceable audit log. For<br />

integration purposes, UNICORN communicates with control<br />

systems within the plant via OLE for Process Control (OPC).<br />

OPC supports application areas such as data access for<br />

real time values and security control to protect sensitive<br />

information.<br />

Sensor specifications<br />

Sensor Acceptance range Measurement error 1<br />

Pressure 0–5 bar g ± 0.20 bar g<br />

Flow (high flow kit) 2 7.5–510 L/h ± 5% actual value at flow 3 40 L/h 3<br />

± 10% actual value at flow < 40 L/h 3<br />

Flow (low flow kit) 2 3–175 L/h ± 5% actual value at flow3 20 L/h 3<br />

Conductivity 4 0–150 mS/cm ± 5% full scale 5<br />

± 10% actual value at flow < 20 L/h 3<br />

pH 6 pH 2–12 ± 0.2 pH at calibration temperature<br />

Drift: ± 0.025 pH units/h (20°C, pH 4)<br />

Flow rate sensitivity: ± 0.1 pH unit<br />

UV 0.01–1.0 AU Deviation from linearity ± 5% 3, 7<br />

Temperature 2°C–40°C ± 3°C 3<br />

1 max. error, valid within acceptance range under operation conditions<br />

2<br />

flow meter cells for high flow and low flow kits are designed with different flow path geometries<br />

3<br />

valid for liquid with density of water and 1.0–1.3× the viscosity of water at the actual liquid<br />

temperature; and max. temperature difference of 10°C between liquid and ambient temperature<br />

4<br />

temperature compensation optional<br />

5<br />

valid at actual temperature (no temperature compensation)<br />

6<br />

temperature compensation not available<br />

7<br />

cell length 1.8 mm ± 0.2 mm<br />

www.gelifesciences.com/bioprocess 71

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

ReadyToProcess columns<br />

ReadyToProcess columns are prepacked, prequalified, and<br />

presanitized process chromatography columns available<br />

with a range of <strong>BioProcess</strong> media in four different sizes:<br />

1, 2.5, 10, and 20 L. The columns can be used in a wide<br />

range of chromatographic applications for separation of<br />

various compounds such as proteins, endotoxins, DNA,<br />

plasmids, vaccines, and viruses.<br />

ReadyToProcess chromatography columns offer the<br />

possibility to work in a fully flexible mode in early clinical<br />

phases while keeping a conventional re-use option for<br />

large-scale manufacturing open. The chromatography<br />

media used in ReadyToProcess columns have a long<br />

track-record of use in full-scale manufacturing using<br />

conventional, large-scale chromatography, where columns<br />

can be used for tens or hundreds of cycles. The transition<br />

from ReadyToProcess format to full-scale manufacturing is<br />

therefore straightforward.<br />

Custom ReadyToProcess columns<br />

<strong>GE</strong> <strong>Healthcare</strong> can provide custom-built ReadyToProcess<br />

columns built to user specifications and including<br />

a wide range of prepacked <strong>BioProcess</strong> media. For<br />

further information, contact your <strong>GE</strong> <strong>Healthcare</strong> sales<br />

representative.<br />

Technical specifications<br />

Ordering information<br />

1 L 2.5 L 10 L 20 L<br />

Inner diameter (mm) 80 126 251 359<br />

Inner cross section (cm 2 ) 50 124 495 1012<br />

Column volume (L) 1.0 2.5 9.9 20.2<br />

Packed bed height (mm) 200 200 200 200<br />

Net mesh (μm) 23 23 23 23<br />

Mechanical compression factor (%)* ≤ 15 ≤ 15 ≤ 15 ≤ 15<br />

Outer height (mm) 382 378 388 407<br />

Outer diameter incl. lid (mm) 155 195 342 484<br />

Weight (kg) ~ 3 ~ 6 ~ 25 ~ 55<br />

Inlet TC25 connectors, tubing i.d.<br />

Outlet TC25 connectors, tubing i.d.<br />

4.8 mm<br />

(0.19 in)<br />

4.8 mm<br />

(0.19 in)<br />

6.3 mm<br />

(0.25 in)<br />

6.3 mm<br />

(0.25 in)<br />

9.5 mm<br />

(0.375 in)<br />

9.5 mm<br />

(0.375 in)<br />

12.7 mm<br />

(0.5 in)<br />

12.7 mm<br />

(0.5 in)<br />

Ambient temperature † (°C) 4–30 4–30 4–30 4–30<br />

Liquid temperature † (°C) 4–40 4–40 4–40 4–40<br />

Maximum liquid pressure, bar ‡ 4 4 4 4<br />

Estimated shelf life (months) 18 18 18 18<br />

* The mechanical compression factor varies depending on the medium.<br />

† The temperature difference between the fluid running through the column and the ambient<br />

temperature in the room should never be greater than 20°C.<br />

‡ While the maximum liquid pressure stated depends on the pressure rating of the column,<br />

restrictions for the maximum pressure drop over the column depend on the packed<br />

chromatography medium, in order to ensure bed stability. See User Manual for details.<br />

<strong>Product</strong> Column size Code number<br />

ReadyToProcess Capto Q 1 1 L 28-9510-90<br />

ReadyToProcess Capto Q 2.5 2.5 L 28-9017-23<br />

ReadyToProcess Capto Q 10 10 L 28-9017-24<br />

ReadyToProcess Capto Q 20 20 L 28-9017-25<br />

ReadyToProcess Capto S 1 1 L 28-9510-93<br />

ReadyToProcess Capto S 2.5 2.5 L 28-9017-29<br />

ReadyToProcess Capto S 10 10 L 28-9017-30<br />

ReadyToProcess Capto S 20 20 L 28-9017-31<br />

ReadyToProcess Capto adhere 1 1 L 28-9511-09<br />

ReadyToProcess Capto adhere 2.5 2.5 L 28-9017-14<br />

ReadyToProcess Capto adhere 10 10 L 28-9017-15<br />

ReadyToProcess Capto adhere 20 20 L 28-9017-16<br />

ReadyToProcess MabSelect SuRe 1 1 L 28-9511-10<br />

ReadyToProcess MabSelect SuRe 2.5 2.5 L 28-9017-17<br />

ReadyToProcess MabSelect SuRe 10 10 L 28-9017-18<br />

ReadyToProcess MabSelect SuRe 20 20 L 28-9017-19<br />

ReadyToProcess Phenyl Sepharose 6 FF (low sub) 1 1 L 28-9511-11<br />

ReadyToProcess Phenyl Sepharose 6 FF (low sub) 2.5 2.5 L 28-9017-35<br />

ReadyToProcess Phenyl Sepharose 6 FF (low sub) 10 10 L 28-9017-36<br />

ReadyToProcess Phenyl Sepharose 6 FF (low sub) 20 20 L 28-9017-37<br />

ReadyToProcess Capto MMC 1 1 L 28-9511-18<br />

ReadyToProcess Capto MMC 2.5 2.5 L 28-9291-20<br />

ReadyToProcess Capto MMC 10 10 L 28-9291-21<br />

ReadyToProcess Capto MMC 20 20 L 28-9291-22<br />

ReadyToProcess Q Sepharose FF 1 1 L 28-9511-25<br />

ReadyToProcess Q Sepharose FF 2.5 2.5 L 28-9290-76<br />

ReadyToProcess Q Sepharose FF 10 10 L 28-9290-79<br />

ReadyToProcess Q Sepharose FF 20 20 L 28-9290-82<br />

ReadyToProcess SP Sepharose FF 1 1 L 28-9510-97<br />

ReadyToProcess SP Sepharose FF 2.5 2.5 L 28-9291-05<br />

ReadyToProcess SP Sepharose FF 10 10 L 28-9291-06<br />

ReadyToProcess SP Sepharose FF 20 20 L 28-9291-07<br />

ReadyToProcess DEAE Sepharose FF 1 1 L 28-9511-26<br />

ReadyToProcess DEAE Sepharose FF 2.5 2.5 L 28-9291-14<br />

ReadyToProcess DEAE Sepharose FF 10 10 L 28-9291-15<br />

ReadyToProcess DEAE Sepharose FF 20 20 L 28-9291-16<br />

72 www.gelifesciences.com/bioprocess

---

1<br />

2<br />

3<br />

ReadyToProcess<br />

www.gelifesciences.com/bioprocess 73

---

4<br />

Chromatography media<br />

Ion exchange 77<br />

Affinity 82<br />

Hydrophobic interaction 87<br />

Multimodal 90<br />

Reversed phase 94<br />

Gel filtration 96<br />

Custom Designed Media 100<br />

74 www.gelifesciences.com/bioprocess

---

Media selection –<br />

our strategy<br />

At <strong>GE</strong> <strong>Healthcare</strong> we are committed to supplying you with media that pass the rigorous<br />

selection requirements demanded for the downstream processing of biopharmaceuticals.<br />

Consider three issues:<br />

4<br />

Chromatography media<br />

Performance – The different stages in<br />

downstream processing from Capture to<br />

Polishing demand media with different<br />

characteristics.<br />

Scalability – Is the medium produced at a<br />

large enough scale? Can it be packed into<br />

large production columns with retained<br />

performance?<br />

Security of supply – How is quality<br />

assurance? Is the producer geared up to<br />

long-term industrial supply issues?<br />

B<br />

A<br />

Sanitization<br />

CIP<br />

C<br />

Media /<br />

Systems /<br />

Columns<br />

<strong>BioProcess</strong> media – made for bioprocessing<br />

Media selection filter<br />

D<br />

Regulatory<br />

Support<br />

E<br />

F<br />

V endor<br />

Certification<br />

T echnical<br />

Support<br />

Secure<br />

Supply<br />

G<br />

H<br />

Capture<br />

I<br />

J<br />

Intermediate<br />

Purification<br />

K<br />

Scalability<br />

L<br />

Polishing<br />

Compatibility with production and regulatory requirements.<br />

Use only media that pass through this filter.<br />

This label designates our media that have been specifically designed to meet the demands<br />

of industrial biotechnology:<br />

• Secure supply Large capacity production integrated with clear ordering and delivery<br />

routines mean <strong>BioProcess</strong> media are available in the right quantity, at the right place, at<br />

the right time. Future supplies of <strong>BioProcess</strong> media are assured, making them a secure<br />

investment for your long-term production.<br />

• Safety stock Our media safety stock agreements offer the right quantity of media,<br />

manufactured to specified quality levels, and delivered at the right time. For more<br />

information on Safety Stock agreements contact your local <strong>GE</strong> <strong>Healthcare</strong> office.<br />

• Validated manufacture Produced following validated methods and tested under strict<br />

quality control, <strong>BioProcess</strong> media fulfill performance specifications. A certificate of<br />

analysis is available with each order.<br />

• Regulatory support Regulatory Support Files contain details of performance, stability,<br />

extractable compounds and analytical methods available. The essential information in<br />

these files is an invaluable starting point for process validation, as well as support for<br />

clinical and marketing applications submitted to regulatory authorities.<br />

• From capture to polishing Specific <strong>BioProcess</strong> media have been designed for each<br />

chromatographic stage in a process from capture to polishing. Using <strong>BioProcess</strong> media<br />

for every stage results in a systematic approach to method development.<br />

• High productivity High flow rates, high capacity and high recovery contribute to the<br />

overall economy of an industrial process.<br />

• Sanitization/CIP All <strong>BioProcess</strong> media can be cleaned- and sanitized-in-place.<br />

• Scalability Packing methods are established for a wide range of scales. You can use the<br />

same <strong>BioProcess</strong> media for development work, pilot studies, and routine production.<br />

76 www.gelifesciences.com/bioprocess

---

Ion exchange<br />

chromatography<br />

Technique description<br />

Separation in ion exchange<br />

chromatography (IEX) is based upon<br />

the selective, reversible adsorption of<br />

charged molecules to an immobilized<br />

ion exchange group of opposite<br />

charge. An ion exchanger consists of<br />

an insoluble porous matrix to which<br />

charged groups have been covalently<br />

bound.<br />

IEX is the most frequently used<br />

method for the purification of<br />

biological substances. Biomolecules<br />

with even small differences in surface<br />

charge can be separated using IEX.<br />

Both high binding capacities and very<br />

high resolution can be obtained by<br />

choosing the optimal ion exchanger<br />

and the optimal separation conditions.<br />

Anion exchanger groups<br />

ANX: -CH 2<br />

CHOHCH 2<br />

NH + (CH 2<br />

CH 3<br />

) 2<br />

C 2<br />

H 5<br />

DEAE: Diethylaminoethyl – O–C 2<br />

H 4<br />

–N + –H<br />

C 2<br />

H 5<br />

C 2<br />

H 5<br />

QAE: Quatenary aminoethyl – O–C 2<br />

H 4<br />

–N + –CH 2<br />

CH(OH)CH 3<br />

C 2<br />

H 5<br />

CH 3<br />

Q: Quatenary ammonium – O-CH 2<br />

CHOHCH 2<br />

OCH 2<br />

CHOHCH 2<br />

– N + –CH 3<br />

CH 3<br />

Cation exchanger groups<br />

CM: Carboxymethyl –O–CH 2<br />

COO –<br />

S: Sulphoethyl –O–CH 2<br />

–CH 2<br />

–SO 3<br />

–<br />

SP: Sulphopropyl –O–CH 2<br />

CHOHCH 2<br />

OCH 2<br />

CH 2<br />

CH 2<br />

SO 3<br />

–<br />

4<br />

Chromatography media<br />

Q, S and SP are strong ion exchange groups<br />

that maintain charge capacity over a very<br />

wide pH range. The other groups are weak<br />

ion exchangers, and their charge capacity<br />

varies with pH.<br />

www.gelifesciences.com/bioprocess 77

---

4<br />

Chromatography media<br />

New and established media<br />

<strong>GE</strong> <strong>Healthcare</strong> ion exchangers are<br />

well-established in industry. A wide<br />

range of base matrices has been<br />

developed to address most customer<br />

requirements.<br />

Capto is a product line, based on<br />

high flow agarose, designed to meet<br />

large-scale biopharma manufacturers'<br />

demands for fast, efficient and costeffective<br />

capture and intermediate<br />

purification. The rigidity of Capto<br />

media allows for longer bed heights<br />

in smaller diameter columns, thereby<br />

simplifying column handling as well<br />

as reducing investment in largescale<br />

equipment. Capto ImpRes is<br />

an extension of the Capto line and is<br />

designed for intermediate purification<br />

and polishing steps. The Capto ion<br />

exchanger line is composed of strong<br />

anion exchangers Capto Q and Capto<br />

Q ImpRes, strong cation exchangers<br />

Capto S and Capto SP ImpRes, and<br />

Capto DEAE, a weak anion exchanger.<br />

The flexibility and high flow rates<br />

offered by Capto media open new<br />

possibilities in large-scale protein<br />

purification.<br />

MacroCap SP and MacroCap Q are<br />

macroporous ion exchangers designed<br />

for the purification of PEGylated and<br />

other large biomolecules. They allow<br />

separation of mono- from oligo- and<br />

non-PEGylated proteins with high<br />

selectivity, even under high load<br />

conditions.<br />

Sepharose Big Beads, Sepharose Fast<br />

Flow, Sepharose XL and Sepharose<br />

High Performance are other products<br />

based on cross-linked agarose. These<br />

media are designed for robust, high<br />

capacity, high resolution ion exchange<br />

chromatography at various stages<br />

of process-scale purification. For<br />

many years, they have been the<br />

industry standard for ion exchange of<br />

biomolecules.<br />

Sephadex: Other key products include<br />

Sephadex ion exchangers, based<br />

on cross-linked dextran beads and<br />

offering high capacities for batch or<br />

column mode.<br />

SOURCE media for late-intermediate<br />

purification and polishing also<br />

belong to a long line of ion<br />

exchangers specifically designed to<br />

meet the processing needs of the<br />

biopharmaceutical manufacturer.<br />

The handbook Ion Exchange<br />

Chromatography and<br />

Chromatofocusing – Principles<br />

and Methods can be obtained<br />

through your local <strong>GE</strong> <strong>Healthcare</strong><br />

office or downloaded from our<br />

website.<br />

Code number 11-0004-21.<br />

78 www.gelifesciences.com/bioprocess

---

Selection guide<br />

Capture<br />

Polishing<br />

Sephadex<br />

Capto<br />

Sepharose High Performance<br />

Capto ImpRes<br />

Sepharose Fast Flow / Sepharose XL<br />

Sepharose Big Beads<br />

SOURCE<br />

4<br />

Getting started<br />

Intermediate<br />

purification<br />

Testing the performance of<br />

chromatography media at the laboratory<br />

bench helps you select the most<br />

appropriate one for process-scale use.<br />

PreDictor 96-well filter plates (prefilled with<br />

IEX media) and PreDictor RoboColumn<br />

units (mini columns prepacked with<br />

IEX media) support high-throughput<br />

process development (HTPD) workflows<br />

by allowing for parallel screening of<br />

media and process conditions. Another<br />

advantage of PreDictor plates and<br />

RoboColumn units is that screening<br />

can be carried out with minimal sample<br />

consumption.<br />

HiTrap prepacked columns (1 and 5 mL)<br />

are a particularly fast, simple, and<br />

reproducible way of testing different ion<br />

exchange media. They can be operated<br />

with a syringe, a peristaltic pump or a<br />

chromatography system. HiTrap Capto<br />

IEX Selection Kit provides three different<br />

ion exchange ligands and two different<br />

multimodal ligands based on Capto. The<br />

HiTrap IEX Selection Kit contains seven ion<br />

exchangers based on Sepharose Fast Flow<br />

and Sepharose XL.<br />

Capto Q, Capto S, Capto DEAE, Capto SP<br />

ImpRes, Capto Q ImpRes, as well as Q<br />

and SP Sepharose High Performance,<br />

Sepharose Fast Flow and XL are also<br />

available in prepacked HiTrap 1 mL and<br />

5 mL columns.<br />

For method development, the HiScreen<br />

prepacked column range is recommended<br />

due to the 10 cm bed length and small bed<br />

volume. They are convenient to use and<br />

give reproducible results. If a 20 cm bed<br />

length is preferred, two HiScreen columns<br />

can easily be connected in series.<br />

HiScreen columns are 0.77 × 10 cm<br />

(4.6 mL) prepacked columns with Capto Q,<br />

Capto S, Capto DEAE, Capto SP ImpRes,<br />

and Capto Q ImpRes designed for process<br />

development.<br />

A convenient way of assessing<br />

SOURCE 15Q and SOURCE 15S media is<br />

to use an ÄKTA system and RESOURCE or<br />

4.6/100 PE prepacked columns.<br />

In addition to prepacked columns, many<br />

of the media described in this section can<br />

be ordered as laboratory-sized packs.<br />

See A–Z of media and chemicals.<br />

Chromatography media<br />

www.gelifesciences.com/bioprocess 79

---

4<br />

Chromatography media<br />

Capto<br />

For high productivity capture and intermediate purification<br />

Capto is a product line designed to meet large-scale biopharma manufacturers’<br />

demands for fast, efficient and cost-effective capture and intermediate<br />

purification. It is based on a highly-rigid agarose matrix produced with a<br />

manufacturing process that gives significantly improved pressure/flow<br />

properties with maintained control over pore structure. The rigid matrix enables<br />

high bed heights and purification of viscous samples at high flow rates. Capto Q<br />

and Capto S are strong anion and cation exchangers, and Capto DEAE is a weak<br />

anion exchanger – all maximize productivity due to fast mass transfer plus high<br />

dynamic binding capacity. Typical flow velocities are over 700 cm/h.<br />

Capto ImpRes<br />

For high productivity intermediate purification and polishing<br />

Capto SP ImpRes and Capto Q ImpRes are strong cation and strong anion<br />

exchange media, respectively, for high-throughput intermediate purification<br />

and polishing of a wide range of biomolecules. The combination of the high flow<br />

agarose technique used for all Capto products and the small particle size of<br />

Capto ImpRes results in good pressure-flow properties as well as high resolution.<br />

Flow velocities are over 220 cm/h.<br />

MacroCap<br />

For purification of large biomolecules<br />

MacroCap is a product line designed to purify PEGylated and other large<br />

biomolecules. MacroCap SP and MacroCap Q are cation and anion exchangers<br />

that deliver high product purity and yield at high sample loads. Mono-PEGylated<br />

proteins are separable from oligo-PEGylated and native protein in a single<br />

run. The MacroCap base matrix is hydrophilic and chemically stable, thereby<br />

increasing media lifetime.<br />

PEGylation is typically performed after purification of the target protein.<br />

Sephadex<br />

High binding capacities for column or batch modes<br />

Sephadex ion exchangers are very well established and have been used in<br />

industry for many years. Their binding capacities and reliability make them<br />

both simple and economical to use. Due to their stability and ease of packing,<br />

Sephadex A-25 and C-25 are popular choices for column techniques. Sephadex<br />

A-50 and C-50 are also widely used for batch applications, especially processing<br />

crude feedstocks, and in plasma fractionation.<br />

Sepharose Big Beads<br />

For capture steps handling very large volumes of feed or viscous feedstocks<br />

Sepharose Big Beads is the natural choice for the capture step in a process<br />

where high throughput and capacity are essential in packed column mode.<br />

Typical flow velocities for dilute samples are > 1000 cm/h. The large particle<br />

size combined with high physical stability ensures rapid processing of viscous<br />

samples. These media should be chosen for clarified feedstocks when high<br />

throughput is required and resolution is of less importance.<br />

• Capto DEAE<br />

• Capto Q<br />

• Capto S<br />

• Capto SP ImpRes<br />

• Capto Q ImpRes<br />

• MacroCap SP<br />

CDM MacroCap Q<br />

• DEAE Sephadex A-25<br />

• QAE Sephadex A-25<br />

• CM Sephadex C-25<br />

• DEAE Sephadex A-50<br />

• QAE Sephadex A-50<br />

• CM Sephadex C-50<br />

• SP Sepharose Big Beads<br />

• Q Sepharose Big Beads<br />

• = <strong>BioProcess</strong> media<br />

CDM = Custom Designed Media<br />

produced on receipt of order.<br />

80 www.gelifesciences.com/bioprocess

---

Sepharose XL<br />

High loading capacities for more productive capture from clarified feedstocks<br />

Q Sepharose XL and SP Sepharose XL have high loading capacities compared<br />

with Sepharose Fast Flow ion exchangers. Combined with high throughput,<br />

this helps improve the production economy of manufacturing processes. Both<br />

adsorbents are based on the well-established Sepharose Fast Flow media.<br />

Sepharose Fast Flow<br />

Well-established in large-scale production of biopharmaceuticals<br />

These media are well-suited for separating crude mixtures early in purification<br />

schemes, where a combination of good resolution and high flow rate is essential.<br />

Typical flow velocities for these media are 100 to 400 cm/h.<br />

Sepharose High Performance<br />

Where high resolution is essential for intermediate purification and polishing<br />

These media are well-suited for intermediate purification and polishing. Use them<br />

when resolution and capacity have priority. Typical flow velocities are 100 cm/h.<br />

• Q Sepharose XL<br />

• SP Sepharose XL<br />

• DEAE Sepharose Fast Flow<br />

• CM Sepharose Fast Flow<br />

• Q Sepharose Fast Flow<br />

• SP Sepharose Fast Flow<br />

• ANX Sepharose 4 Fast Flow (high sub)<br />

• SP Sepharose High Performance<br />

• Q Sepharose High Performance<br />

• CM Sepharose High Performance<br />

4<br />

SOURCE<br />

For rapid, high-resolution, preparative separations at low or high pressure<br />

SOURCE ion exchangers are monosized, rigid, polystyrene/divinyl benzene<br />

matrices for chromatography of proteins, peptides and oligonucleotides.<br />

SOURCE 15Q and 15S media are well-suited for complex separations during<br />

polishing. SOURCE 30Q and 30S are for intermediate purification and large-scale<br />

polishing. Typical flow velocities are up to 1000 cm/h at large-scale, and even<br />

higher on the laboratory bench.<br />

• SOURCE 15S<br />

• SOURCE 15Q<br />

• SOURCE 30S<br />

• SOURCE 30Q<br />

Chromatography media<br />

HiTrap Capto IEX Selection Kit (Code number 28-9343-88)<br />

This kit provides three different ion exchange ligands and two different<br />

multimodal ligands based on Capto, enabling convenient and easy screening.<br />

Contains five 1 mL HiTrap columns prepacked with Capto Q, Capto S,<br />

Capto DEAE, Capto MMC, Capto adhere, as well as connectors and detailed<br />

instructions.<br />

HiTrap IEX Selection Kit (Code number 17-6002-33)<br />

This kit allows fast and easy screening of seven different ion exchange ligands<br />

based on Sepharose Fast Flow and Sepharose XL, which is excellent for<br />

laboratory studies with small sample quantities before scaling up. Contains SP, Q,<br />

CM, ANX (high sub) and DEAE Sepharose Fast Flow and Q and SP Sepharose XL in<br />

1 mL HiTrap columns. The kit contains connectors and detailed instructions.<br />

For further information, please contact your local <strong>GE</strong> <strong>Healthcare</strong> office.<br />

www.gelifesciences.com/bioprocess 81

---

Affinity<br />

chromatography<br />

4<br />

Chromatography media<br />

Technique description<br />

The inherent high specificity of ligand – target interactions<br />

makes affinity chromatography particularly suitable for<br />

the capture stage of downstream processing. One of the<br />

typical advantages of using affinity techniques is that<br />

the capacity of the media is usually not affected by the<br />

presence of contaminants since they have no affinity<br />

for the coupled ligand. The result is reliable product<br />

purity, often with purification factors well over 1000, and<br />

effective concentration, achieved in a single step. Affinity<br />

chromatography may also be suitable for the Intermediate<br />

or polishing stages, to remove small amounts of specific<br />

contaminants. In affinity chromatography, the product to<br />

be purified adsorbs to an affinity ligand that is coupled to<br />

a matrix. The ligand is specific for a single type of protein/<br />

peptide molecule, or group of such molecules. The targeted<br />

product often binds to the ligand under specific conditions<br />

of ionic strength and pH. After unbound impurities are<br />

washed away, the product can be eluted by using a step<br />

gradient of increasing or decreasing ionic strength and/<br />

or by changing the pH, or by a more selective elution<br />

technique.<br />

Affinity chromatography<br />

The most widely used affinity chromatography purification<br />

step in industry today is the capture of antibodies using the<br />

Protein A ligand. As an alternative to tradtional Protein A<br />

purification methods, Capto L utilizes the kappa light chain<br />

to purify a broad range of antibodies.<br />

Protein A media<br />

The MabSelect family for the capture of monoclonal<br />

antibodies (MAbs) has been developed with industrial needs<br />

in mind. The expanded product range focuses on improved<br />

overall process economy and reduced time for optimization.<br />

Capto L<br />

Capto L captures antibody fragments of different sizes<br />

and species. Due to the binding of protein L to the variable<br />

region of the kappa light chain, Capto L is particularly<br />

suitable for capturing a wide range of different-sized<br />

antibody fragments such as Fabs (fragment antibodies),<br />

single-chain variable fragments (scFv) and domain<br />

antibodies (dAbs).<br />

Group-specific media<br />

Heparin Sepharose 6 Fast Flow, Capto Blue, and Blue<br />

Sepharose 6 Fast Flow are examples of media with affinity<br />

for a group of related molecules.<br />

IMAC media<br />

Immobilized Metal Ion Chromatography (IMAC) is a versatile<br />

purification technique for proteins, including histidinetagged<br />

proteins, with an affinity for metal ions. Examples<br />

of IMAC media include Ni Sepharose 6 Fast Flow, IMAC<br />

Sepharose 6 Fast Flow and Chelating Sepharose Fast Flow.<br />

Pre-activated media<br />

Pre-activated media allow you to couple a ligand<br />

appropriate to your application. The choice of medium<br />

depends on several factors, for example the groups in<br />

the ligand molecule that are suitable for coupling and<br />

the chemical stability demands on the resulting affinity<br />

medium. CNBr-activated Sepharose 4 Fast Flow and NHSactivated<br />

Sepharose 4 Fast Flow are examples of modern<br />

pre-activated media suitable for attaching various ligands.<br />

82 www.gelifesciences.com/bioprocess

---

MabSelect media<br />

The successful production and application of new<br />

therapeutic antibodies has accelerated the demand<br />

to develop the next generation of MAbs. Satisfying this<br />

demand requires excellence in both process development<br />

and full-scale production<br />

The high titers of modern expression systems require<br />

chromatography media with high capacity, high rigidity<br />

and chemical stability to obtain high yields, and ensure<br />

long media lifetime. Protein A chromatography media are<br />

considered the most efficient and robust tool for the capture<br />

of a variety of antibodies. Improvements to the chemical<br />

stability and binding capacity of Protein A have resulted in<br />

greater durability, increased throughput, and a reduction in<br />

the costs for large-scale production.<br />

Benefits of Protein A-based chromatography media<br />

• High selectivity reduces the number and size of subsequent<br />

unit operations through high purities and yields<br />

• Insensitivity to variations in additives, pH and<br />

conductivity facilitates the use of generic protocols<br />

• Usually validated for both viral clearance and subsequent<br />

inactivation<br />

MabSelect family overview<br />

MabSelect is the common name for a range of process<br />

development to production-scale chromatography media<br />

for monoclonal antibody purification. All MabSelect media<br />

feature:<br />

• A base matrix of high-flow agarose<br />

• High chemical stability: compatible with all aqueous<br />

buffers commonly used in Protein A chromatography<br />

• Mammalian product-free: no animal-derived components<br />

involved in the fermentation or purification of the<br />

recombinant Protein A ligand<br />

• Epoxy as coupling chemistry<br />

• Recommended storage reagents: 20% ethanol,<br />

2% benzyl alcohol<br />

• Temperature stability: 2°C to 40°C<br />

• Regulatory Support File<br />

• Shelf life: 5 yr<br />

• Simple scale-up to production-sized columns<br />

• Available in HiTrap and HiScreen formats for convenient<br />

media screening<br />

Like all our <strong>BioProcess</strong> media, MabSelect meets every<br />

requirement for process design and scale-up. Prepacked<br />

columns and bulk quantities are available. For largescale<br />

packing, we recommend AxiChrom, Chromaflow or<br />

BPG columns.<br />

MabSelect SuRe<br />

Withstands rigorous and cost-effective CIP protocols,<br />

(e.g., 0.1 to 0.5 M NaOH)<br />

• Alkali-stabilized rProtein A ligand<br />

• Generic and economic CIP/sanitization<br />

• <strong>Product</strong> safety and process robustness<br />

MabSelect SuRe LX<br />

For high binding capacity at long residence time<br />

• Efficient processing of large volumes of high-titer<br />

bioreactor feeds<br />

• Higher density eluates increase operating flexibility<br />

• Effective CIP improves process economy<br />

MabSelect<br />

For high purity and throughput at production scale<br />

• Prioritized volume throughput<br />

• Optimized matrix and ligand coupling<br />

• The antibody purification standard<br />

MabSelect Xtra<br />

For capturing high-titer antibody feedstocks and reducing<br />

processing costs<br />

• Outstanding dynamic binding capacity<br />

• Improved process economics and reduced raw material<br />

costs<br />

• High-purity capture due to minimal non-specific binding<br />

The handbooks Affinity<br />

Chromatography – Principles<br />

and Methods (18-1022-29)<br />

and Antibody Purification<br />

Handbook (18-1037-46)<br />

can be obtained through your<br />

local <strong>GE</strong> <strong>Healthcare</strong> office<br />

or downloaded from our<br />

website.<br />

4<br />

Chromatography media<br />

www.gelifesciences.com/bioprocess 83

---

Capto L<br />

4<br />

Chromatography media<br />

Capto L is an affinity chromatography<br />

medium designed to capture a broad<br />

range of antibodies and antibody<br />

fragments. It combines a rigid,<br />

high-flow agarose matrix with the<br />

immunoglobulin-binding protein<br />

L ligand. In addition to binding all<br />

classes of Ig (IgG, IgM, IgA, IgE and<br />

IgD), protein L also binds differentsized<br />

antibody fragments such as<br />

Fabs, single-chain variable fragments<br />

(scFv) and domain antibodies, as long<br />

as they have the kappa light chain.<br />

Key performance characteristics of<br />

Capto L include:<br />

• High selectivity for kappa light chain<br />

allows efficient capture of a broad<br />

selection of antibodies and antibody<br />

fragments<br />

• High dynamic binding capacity<br />

reduces process time and amount<br />

of chromatography medium used<br />

• Allows platform approach to the<br />

purification of antibody fragments<br />

containing the kappa light chain<br />

• High-flow agarose matrix increases<br />

productivity, economy, and process<br />

design flexibility<br />

• Low ligand leakage increases<br />

antibody fragment purity and<br />

productivity<br />

• Flexible formats (e.g., PreDictor<br />

plates and prepacked columns)<br />

speed the screening and<br />

optimization of binding/elution<br />

conditions.<br />

Purification conditions are broadly<br />

similar for many antibody fragments<br />

containing the kappa light chain, and<br />

can easily be modified to match the<br />

specific properties of individual target<br />

molecules. This will result in significant<br />

savings in costs, effort and time during<br />

process development. Gains can also<br />

be won in manufacturing since the<br />

high selectivity of affinity capture will<br />

help reduce number of subsequent<br />

polishing steps as compared to other,<br />

less selective purification media.<br />

Protein L binding affinities<br />

Species Antibody class Affinity*<br />

General<br />

Kappa light chain<br />

(subtypes 1,3,4)<br />

Lambda light chain<br />

Heavy chain<br />

Strong<br />

No binding<br />

No binding<br />

Human IgG1 Strong<br />

IgG2<br />

Strong<br />

IgG3<br />

Strong<br />

IgG4<br />

Strong<br />

IgA<br />

Strong<br />

IgD<br />

Strong<br />

IgE<br />

Strong<br />

IgM<br />

Strong<br />

Fab<br />

Strong<br />

ScFv<br />

Strong<br />

Dabs<br />

Strong<br />

Mouse IgG1 Strong<br />

IgG2a<br />

Strong<br />

IgG2b<br />

Strong<br />

IgG3<br />

Strong<br />

IgM<br />

Strong<br />

Rat IgG1 Strong<br />

IgG2a<br />

Strong<br />

IgG2b<br />

Strong<br />

IgG2c<br />

Strong<br />

Pig Total IgG Strong<br />

Dog Total IgG Weak<br />

Binding sites for Capto L<br />

Cow IgG1 No Binding<br />

IgG2<br />

No Binding<br />

Goat IgG1 No Binding<br />

Kappa or<br />

Lambda<br />

IgG2<br />

No Binding<br />

Sheep IgG1 No Binding<br />

IgG2<br />

No Binding<br />

Chicken Total IgG No Binding<br />

Fv<br />

Light chain<br />

Heavy chain<br />

Capto L<br />

* Binding to protein L occurs only if the immunoglobulin<br />

has the appropriate kappa light chains. Stated binding<br />

affinity refers only to species and subtypes with<br />

appropriate kappa light chains. Lambda light chains<br />

and some kappa light chains will not bind.<br />

Variable region<br />

Constant region<br />

Fab Fab<br />

scFv<br />

V L<br />

domain<br />

Fc<br />

Fab<br />

IgG<br />

84 www.gelifesciences.com/bioprocess

---

Capture toolkit for antibody fragments<br />

Antibody fragments are set to<br />

become the next important class of<br />

protein-based biotherapeutics after<br />

monoclonal antibodies (MAbs). One of<br />

the advantages that MAbs offer is the<br />

possibility to use a platform approach<br />

to purification, where capture by<br />

Protein A affinity chromatography<br />

has become the industry standard.<br />

Affinity capture allows very robust<br />

and generic processes and requires<br />

minimal optimization and high purity<br />

in one separation step.<br />

A similar approach for antibody<br />

fragments is now taking shape.<br />

Antibody fragments pose a different<br />

challenge due to their diversity and<br />

lack of common binding site (such as<br />

the Fc region in full length antibodies).<br />

In humans approximately 60% of<br />

antibodies consist of the kappa light<br />

chain and approximately 40% of the<br />

lambda light chain. Furthermore,<br />

approximately 10% of the antibodies<br />

have the V H3<br />

heavy chain for which<br />

MabSelect has an affinity. These<br />

approximations may differ for<br />

recombinant antibody fragments.<br />

With the introduction of Capto L,<br />

with its protein L ligand, a platform<br />

purification approach to capture<br />

for this class of biomolecules is now<br />

emerging. Complementing Capto L in<br />

the toolbox are other chromatography<br />

media with affinity for the different<br />

antibody fragment sizes and light/<br />

heavy chain subtypes. These affinity<br />

media have complementing binding<br />

specificities and will capture the<br />

majority of antibody fragments.<br />

Details of the different media can<br />

be found in their respective data<br />

files (see page 234 for the A-Z media<br />

section).<br />

4<br />

Chromatography media<br />

<strong>Guide</strong> to capture of antibody fragments<br />

Fab<br />

ScFv<br />

Domain antibody<br />

Kappa<br />

light chain<br />

Lambda<br />

light chain<br />

Kappa<br />

light chain<br />

Kappa<br />

light chain<br />

VH 3<br />

Heavy chain<br />

Capto L<br />

Lambda<br />

FabSelect<br />

Capto L<br />

Capto L<br />

MabSelect<br />

KappaSelect<br />

www.gelifesciences.com/bioprocess 85

---

<strong>Product</strong> application guide<br />

4<br />

Chromatography media<br />

Getting started<br />

Testing the performance of<br />

chromatography media at the<br />

laboratory bench will help you select<br />

the most appropriate one for process<br />

scale use. All of the media described<br />

in this section can be ordered as<br />

laboratory-sized packs and many<br />

are also available in small, prepacked<br />

HiTrap and HiScreen columns.<br />

Turn to page 234 for the A–Z of<br />

media and chemicals.<br />

This table is only a brief guide to<br />

application areas for our affinity<br />

media. For further information on<br />

these applications, please contact<br />

your local <strong>GE</strong> <strong>Healthcare</strong> office.<br />

• = <strong>BioProcess</strong> media<br />

CDM = Custom Designed Media<br />

produced on receipt of order.<br />

Target molecules Affinity media Applications<br />

-NH 2<br />

• NHS-activated Sepharose 4 Fast Flow Ligand immobilization<br />

-NH 2<br />

• CNBr-activated Sepharose 4 Fast Flow Ligand immobilization<br />

-NH 2 CDM 6-AKS Sepharose 4 Fast Flow Ligand immobilization<br />

-NH 2<br />

-OH, -SH Epoxy-activated Sepharose 6B Ligand immobilization<br />

-COOH, -CHO CDM Amino Sepharose 6 Fast Flow Ligand immobilization<br />

Immunoglobulins • Capto L IgG, IgM, IgA, IgE, IgD and antibody<br />

fragments<br />

CDM IgSelect Human IgG all subclasses<br />

• MabSelect SuRe<br />

IgG, some IgM and IgA<br />

• MabSelect SuRe LX<br />

IgG, some IgM and IgA<br />

• MabSelect<br />

IgG, some IgM and IgA<br />

• MabSelect Xtra<br />

IgG, some IgM and IgA<br />

• rmp Protein A Sepharose Fast Flow IgG, some IgM and IgA<br />

• rProtein A Sepharose 4 Fast Flow IgG, some IgM and IgA<br />

• nProtein A Sepharose 4 Fast Flow IgG, some IgM and IgA<br />

• Protein G Sepharose 4 Fast Flow IgG<br />

Histidine-tagged<br />

• Ni Sepharose 6 Fast Flow<br />

Polyhistidine tagged proteins<br />

proteins<br />

• IMAC Sepharose 6 Fast Flow<br />

Polyhistidine tagged proteins<br />

GST-tagged proteins Glutathione Sepharose 4 Fast Flow Glutathione S-transferase (GST),<br />

tagged proteins, other glutathione<br />

S-transferases and glutathione-binding<br />

proteins<br />

Growth factors • Heparin Sepharose 6 Fast Flow Fibroblast growth factor (FGF),<br />

• Blue Sepharose 6 Fast Flow<br />

• Capto Blue<br />

endothelial cell growth factor (ECGF)<br />

Protein synthesis<br />

factors<br />

• Heparin Sepharose 6 Fast Flow Initiation factors, elongation factors<br />

(EF-1)<br />

Hormones and<br />

Con A Sepharose 4B<br />

Follicle-stimulating<br />

hormone receptors • Heparin Sepharose 6 Fast Flow Oestrogen and androgen receptors<br />

Coagulation proteins • Heparin Sepharose 6 Fast Flow Antithrombin III,<br />

• Heparin Sepharose 6 Fast Flow Factors IX, X, XI, XII, XIIa, prothrombin,<br />

thrombin<br />

• Chelating Sepharose Fast Flow Factor IX<br />

Nucleic acids • ECH-Lysine Sepharose 4 Fast Flow Ribosomal RNA, double stranded DNA<br />

Polysaccharides and Con A Sepharose 4B<br />

a-D-Glucosyl, a-D-mannosyl<br />

glycoproteins<br />

Lentil Lectin Sepharose 4B<br />

a-D-Glucosyl, a-D-mannosyl<br />

Membrane proteins Lentil Lectin Sepharose 4B a-D-Glucosyl, a-D-mannosyl<br />

Con A Sepharose 4B<br />

a-D-Glucosyl, a-D-mannosyl<br />

Lipoproteins • Heparin Sepharose 6 Fast Flow a-lipoprotein<br />

Con A Sepharose 4B<br />

Low density lipoprotein<br />

Enzymes • Heparin Sepharose 6 Fast Flow Restriction endonucleases, DNA ligase,<br />

DNA and RNA polymerases, nucleic acid<br />

binding<br />

• Blue Sepharose 6 Fast Flow<br />

Broad range of nucleotide-requiring<br />

• Capto Blue<br />

enzymes<br />

Protease binding<br />

• Benzamidine Sepharose 4 Fast Flow Trypsin, urokinase, prekallikrein, kallikrein<br />

(high sub)<br />

Other Con A Sepharose 4B a 1<br />

-antitrypsin<br />

• Capto Blue<br />

a 2<br />

-macroglobulin<br />

• Blue Sepharose 6 Fast Flow<br />

a 2<br />

-macroglobulin<br />

• Chelating Sepharose Fast Flow a 2<br />

-macroglobulin<br />

• Gelatin Sepharose 4 Fast Flow<br />

Fibronectin<br />

• Heparin Sepharose 6 Fast Flow Fibronectin<br />

• ECH-Lysine Sepharose 4 Fast Flow Plasminogen and plasminogen activator<br />

• Capto Blue<br />

Albumin<br />

• Blue Sepharose 6 Fast Flow<br />

Albumin<br />

• Capto Blue<br />

Interferon<br />

• Blue Sepharose 6 Fast Flow<br />

Interferon<br />

• Heparin Sepharose 6 Fast Flow Interferon<br />

• Chelating Sepharose Fast Flow Interferon<br />

• AVB Sepharose High Performance Adeno-associated viruses<br />

CDM Procainamide Sepharose 4 Fast Flow Butyrylcholinesterase<br />

CDM VIIISelect Beta-domain depleted FVIII<br />

CDM Plasminogen Removal Gel Plasminogen<br />

86 www.gelifesciences.com/bioprocess

---

Hydrophobic<br />

interaction<br />

chromatography<br />

Technique description<br />

Proteins and peptides differ from one<br />

another in their surface hydrophobicity<br />

and this difference forms the basis of a<br />

HIC separation. Salt solutions are used to<br />

mediate the binding of sample molecules<br />

to a hydrophilic matrix substituted with a<br />

hydrophobic ligand.<br />

Widespread application<br />

Hydrophobic interaction chromatography<br />

(HIC) is well-established within protein<br />

purification today and has evolved into<br />

one of the most powerful methods in<br />

preparative biochemistry. By combining<br />

versatility with high selectivity, it is<br />

employed in capture, intermediate,<br />

or final purification stages of a wide<br />

variety of substances. The speed and<br />

resolution of HIC rival ion exchange<br />

chromatography; its selectivity is<br />

complementary to ion exchange and size<br />

exclusion chromatography; and its ability<br />

to clear endotoxins, nucleic acids, and<br />

viruses makes it an indispensable tool for<br />

the purification of therapeutic proteins.<br />

Choice of adsorbent<br />

Developing an efficient HIC method<br />

involves steps similar to these of other<br />

techniques – scouting for potentially<br />

suitable adsorbents, optimization and<br />

scale-up. Adsorbents differ in the type<br />

of ligand, degree of substitution and<br />

base matrix. The correct choice is made<br />

after experiments to determine the<br />

best selectivity and strength of binding.<br />

Choice also depends upon the scale of<br />

operation and position in the purification<br />

scheme. PreDictor 96-well filter plates,<br />

prefilled with HIC media, and PreDictor<br />

RoboColumn units, minicolumns<br />

prepacked with HIC media, support<br />

high-throughput process development<br />

(HTPD) workflows by allowing for parallel<br />

screening of media and conditions, with<br />

minimal sample consumption.<br />

Capto Phenyl (high sub), Capto Butyl,<br />

and Capto Octyl are HIC media used in<br />

the capture and intermediate stages of<br />

protein purification. Their combination of<br />

high capacity, narrow specification range,<br />

high flow rate and low backpressure<br />

consistently reduces process cycle times<br />

and increases productivity.<br />

4<br />

Chromatography media<br />

Help with experimental design<br />

The theory of HIC, experimental design and<br />

process considerations are comprehensively<br />

described and discussed in the HIC/<br />

RPC handbook. Please contact your local<br />

<strong>GE</strong> <strong>Healthcare</strong> office to obtain your copy or<br />

downloaded from our website.<br />

Code number 11-0012-69.<br />

www.gelifesciences.com/bioprocess 87

---

Selection guide<br />

Capture<br />

Polishing<br />

Sepharose Fast Flow<br />

Capto<br />

4<br />

Sepharose High Performance<br />

Chromatography media<br />

Getting started<br />

Unlike other chromatographic techniques where standard<br />

proteins may provide useful guidelines for predicting<br />

performance, HIC-based purifications require the<br />

experimental determination and optimization of a number<br />

of parameters.<br />

Many of the media described in this section can be ordered<br />

as laboratory-sized packs, as easy-to-use prepacked<br />

columns, or as PreDictor HIC screening plates. The small<br />

HiTrap columns, operated with a syringe, a peristaltic pump<br />

or a chromatography system, allow a particularly fast and<br />

simple way of screening key HIC media. They are available<br />

as a Selection kit.<br />

HiScreen (4.7 mL) prepacked columns are convenient and<br />

give reproducible results, making them well-suited for<br />

method development. In addition, 20 mL HiPrep columns<br />

are easy to use for initial scaling up. PreDictor plates<br />

can be used to rapidly determine optimal conditions and<br />

Intermediate<br />

purification<br />

to compare media performance. The method wizard in<br />

UNICORN controlled ÄKTA systems supports the most<br />

common scouting procedures, such as automatic media<br />

screening.<br />

A tool for screening different HIC media<br />

The HiTrap HIC Selection Kit consists of seven ready to use<br />

1 mL prepacked columns for screening different types of<br />

ligands and for method development work at small scale.<br />

• Phenyl Sepharose High Performance<br />

• Phenyl Sepharose 6 Fast Flow (low sub)<br />

• Phenyl Sepharose 6 Fast Flow (high sub)<br />

• Butyl-S Sepharose 6 Fast Flow<br />

• Butyl Sepharose 4 Fast Flow<br />

• Butyl Sepharose High Performance<br />

• Octyl Sepharose 4 Fast Flow<br />

88 www.gelifesciences.com/bioprocess

---

Hydrophobicity map of HIC media<br />

Butyl-S Sepharose 6 Fast Flow<br />

Octyl Sepharose 4 Fast Flow<br />

Butyl Sepharose 4 Fast Flow<br />

Phenyl Sepharose 6 Fast Flow (low sub)<br />

Butyl Sepharose High Performance<br />

Capto Octyl<br />

Capto Butyl<br />

Phenyl Sepharose High Performance<br />

Phenyl Sepharose 6 Fast Flow (high sub)<br />

Capto Phenyl (high sub)<br />

Increasing<br />

hydrophobicity<br />

4<br />

Sepharose Fast Flow<br />

Media for capture and intermediate purification in largescale<br />

production of biopharmaceuticals.<br />

These media are designed for robust, high capacity, high<br />

resolution, hydrophobic interaction chromatography at<br />

various stages of process-scale purification. The range<br />

of Fast Flow HIC media covers different selectivities. The<br />

appropriate choice for each application is difficult to predict<br />

and therefore several different media need to be tested.<br />

• Butyl Sepharose 4 Fast Flow<br />

HIC medium with aliphatic ligand. The ligand gives<br />

different selectivity compared with phenyl media.<br />

• Butyl-S Sepharose 6 Fast Flow<br />

A low-hydrohobicity HIC medium for capturing<br />

recombinant HBsAg and removing hydrophobic<br />

contaminants.<br />

• Octyl Sepharose 4 Fast Flow<br />

Gives different and complementary selectivity<br />

compared with phenyl and butyl media.<br />

• Phenyl Sepharose 6 Fast Flow (high sub)<br />

A high capacity HIC medium with a binding capacity<br />

for IgG and HSA up to 30 mg/mL at flow velocities of<br />

100 cm/h. Has proven to be a very efficient capture<br />

medium.<br />

• Phenyl Sepharose 6 Fast Flow (low sub)<br />

HIC medium with aromatic phenyl ligand.<br />

Sepharose High Performance<br />

Media for intermediate purification and polishing when<br />

high resolution is needed.<br />

• Butyl Sepharose High Performance and<br />

Phenyl Sepharose High Performance<br />

Robust media for difficult purification problems when<br />

high resolution is the main objective. Is also very<br />

efficient for polishing monoclonal antibodies.<br />

Capto HIC media<br />

Capto Phenyl (high sub), Capto Butyl, and Capto Octyl<br />

are hydrophobic interaction chromatography (HIC) media<br />

used in the capture and intermediate stages of protein<br />

purification.<br />

These media are based on a highly-rigid agarose matrix<br />

that gives significantly improved pressure/flow properties<br />

to ensure high productivity.<br />

• Capto Phenyl (high sub) and Capto Butyl<br />

Capto Phenyl (high sub) and Capto Butyl combine high<br />

capacity, narrow specification range, high flow rate,<br />

and low backpressure consistently reducing process<br />

cycle times and increasing productivity.<br />

• Capto Octyl<br />

Capto Octyl is a high capacity medium available via<br />

the Custom Designed Media line in 25 mL, 1 L, and 5 L<br />

packs, as well as in PreDictor 96-well plate formats.<br />

Chromatography media<br />

• = <strong>BioProcess</strong> media<br />

CDM = Custom Designed Media<br />

produced on receipt of order.<br />

www.gelifesciences.com/bioprocess 89

---

Multimodal<br />

chromatography<br />

4<br />

Chromatography media<br />

Technique description<br />

Multimodal separation is based<br />

on different types of interaction,<br />

depending on the nature of the<br />

multimodal ligand and overall process<br />

conditions. The most common<br />

interaction for <strong>GE</strong> <strong>Healthcare</strong>’s line<br />

of multimodal ion exchangers is<br />

based upon the selective reversible<br />

adsorption of charged molecules<br />

to an immobilized multimodal ion<br />

exchange group of opposite charge<br />

with hydrophobic character. For<br />

other multimodal media, such as<br />

PlasmidSelect Xtra, the predominate<br />

interactions are of aromatic and<br />

thiophilic nature. Both types of media<br />

consist of an insoluble porous matrix<br />

to which the multimodal ligands have<br />

been covalently bound. In multimodal<br />

chromatography it is important to<br />

screen the overall process conditions<br />

(e.g. pH and conductivity) in order to<br />

evaluate the full potential of the media<br />

both for binding and elution mode.<br />

In many cases, the specific interaction<br />

between the multimodal ligand and<br />

the target molecules is a complex<br />

mixture of different interactions which<br />

is also very dependant of the overall<br />

process conditions. Media containing<br />

multimodal ligands are characterized<br />

by interactions that are different from<br />

those of “traditional” ligands and have<br />

in many cases been designed for a<br />

specific purpose. <strong>GE</strong> <strong>Healthcare</strong>’s<br />

multimodal ligands also offers new<br />

selectivities that may be beneficial in<br />

other types of purification challenges<br />

where more traditional ligands do not<br />

offer the required selectivity.<br />

A range of Data files covering our Multimodal<br />

Chromatography media is available.<br />

Please contact your local <strong>GE</strong> <strong>Healthcare</strong> office<br />

to obtain your copy.<br />

Capto Core 700, Code number 28-9983-07<br />

Capto MMC, Code number 11-0035-45<br />

Capto adhere, 28-9078-88<br />

PlasmidSelect Xtra, 28-4094-87<br />

90 www.gelifesciences.com/bioprocess

---

Capto Core 700<br />

OH<br />

OH<br />

OH<br />

OH<br />

The multimodal ligand of Capto Core 700,<br />

designed for robust binding of proteins and<br />

cell-debris -to be used with the layered beads<br />

technology for purification of large proteins or<br />

viruses.<br />

Capto MMC<br />

O O S NH<br />

The multimodal ligand of Capto MMC, designed<br />

for protein binding at high feed conductivities.<br />

O<br />

O<br />

O –<br />

Capto Core 700 is a multimodal<br />

chromatography medium designed for<br />

purification of large proteins or viruses<br />

in vaccine processes. Capto Core 700<br />

provides a multimodal alternative<br />

to size-exclusion chromatography<br />

and centrifugation that are typically<br />

employed in the polishing steps of such<br />

targets.<br />

Capto Core 700 beads consist of a<br />

ligand-activated core and inert shell.<br />

The pore size of the beads gives<br />

a restricted access to the ligandactivated<br />

core and provides a cut-off<br />

for molecules larger than M r<br />

700 000.<br />

Relative to size-exclusion<br />

chromatography, Capto Core 700<br />

provides the advantages of high<br />

Capto MMC is a weak, multimodal<br />

cation exchanger belonging to the<br />

Capto family of <strong>BioProcess</strong> media<br />

for fast and cost efficient protein<br />

purification. Capto MMC allows for<br />

increased productivity and reduced<br />

cost with:<br />

• High capacity at high conductivity<br />

• High productivity<br />

• New selectivity<br />

Capto MMC combines recent base<br />

matrix developments with an<br />

innovative ligand chemistry. Capto<br />

MMC is “salt tolerant” meaning that<br />

binding of proteins can be performed<br />

at the conductivity of the feed<br />

material, thus avoiding costly and<br />

time consuming dilutions of large<br />

volumes of water for injection in<br />

order to lower the conductivity prior<br />

to binding the protein to the column.<br />

Capto MMC has a multimodal ligand<br />

that may interact with the target<br />

molecule in multiple ways. It contains<br />

a carboxylic group and thus has<br />

purity, improved process economy,<br />

and increased productivity by:<br />

• Enabling significantly higher sample<br />

load<br />

• Enabling higher flow rates<br />

• Ensuring straightforward<br />

optimization and scale-up<br />

The core of each bead is functionalized<br />

with ligands that are both hydrophobic<br />

and positively charged, resulting in<br />

a highly efficient multimodal binding<br />

of the various contaminants small<br />

enough to enter into the core. The<br />

multimodal property of the ligands in<br />

the core ensures strong binding with<br />

most impurities over a wide range of<br />

pH and salt concentrations.<br />

features that resemble those of a<br />

weak cation exchanger. However,<br />

in addition to the ionic interactions<br />

several other types of interactions<br />

are involved including hydrophobic<br />

bonding and aromatic interactions.<br />

High salt tolerance and new<br />

selectivity<br />

Capto MMC has the ability to bind<br />

proteins at high conductivities, as<br />

demonstrated by dynamic binding<br />

capacities of three different proteins<br />

under different conductivities.<br />

Dynamic binding capacity (mg/ml)<br />

60<br />

50<br />

40<br />

30<br />

20<br />

10<br />

Lysozyme<br />

ß-Lactoglobulin<br />

BSA<br />

0 10 20 30 40 50<br />

Conductivity (mS/cm)<br />

Dynamic binding capacities of Capto MMC<br />

at 1 minute residence time for three different<br />

proteins ranging from low to high conductivities.<br />

4<br />

Chromatography media<br />

O O N + 0<br />

www.gelifesciences.com/bioprocess 91

---

4<br />

Chromatography media<br />

Capto adhere<br />

O<br />

OH<br />

O<br />

OH<br />

Capto SP ImpRes or Capto S<br />

Capto adhere<br />

N +<br />

OH<br />

The multimodal ligand of Capto adhere<br />

designed for selective removal of contaminants<br />

after a Protein A capture step.<br />

Cell culture<br />

Cell removal<br />

MabSelect SuRe or<br />

MabSelect SuRe LX<br />

Virus inactivation and filtration<br />

Capto adhere<br />

Final UF/DF and sterile filtration<br />

Capto adhere is a strong multimodal<br />

anion exchanger belonging to the<br />

Capto family of <strong>BioProcess</strong> media.<br />

Capto adhere allows for increased<br />

productivity and reduced cost with:<br />

• High capacity and productivity<br />

• Removal of contaminants after a<br />

Protein A capture step<br />

• Allowing for a two-step purification<br />

process of monoclonal antibodies<br />

• New selectivity<br />

Capto adhere combines recent<br />

base matrix developments with<br />

an innovative ligand chemistry.<br />

Capto ahere is designed as a<br />

scavenger medium with the ability<br />

to selectively remove contaminants<br />

such as dimer/aggregates, host<br />

Capto Q<br />

Capto adhere<br />

Toolbox concept in the downstream purification of monoclonal antibodies using Capto adhere to<br />

reduce the total number of unit operations.<br />

cell proteins, and leaked protein A<br />

after a Protein A capture step of<br />

monoclonal antibodies. Capto adhere<br />

has a multimodal ligand that may<br />

interact with the target molecule in<br />

many different ways. It contains a<br />

quaternary ammonium group and<br />

thus has features similar to those of<br />

a strong anion exchanger. However,<br />

in addition to the ionic interactions,<br />

several other types of interactions<br />

are involved including hydrophobic<br />

bonding and aromatic interactions.<br />

Two-step process for MAb purification<br />

The multimodal functionality of Capto<br />

adhere offers features different from<br />

more traditional ion exchangers<br />

in terms of both the ability to<br />

selectively remove contaminants<br />

such as host cell proteins, leaked<br />

Protein A, aggregates and viruses<br />

after a Protein A capture step of<br />

monoclonal antibodies. In addition,<br />

the ligand of Capto adhere may also<br />

offer new selectivities for other types<br />

of purification challenges where<br />

more traditional ligands have not<br />

been successful. The downstream<br />

purification of monoclonal antibodies<br />

has traditionally been performed<br />

in three-step processes comprising<br />

Protein A as a capture step<br />

followed by anion exchange, cation<br />

exchange, and HIC steps in different<br />

combinations. Capto adhere offers<br />

the option to reduce the overall<br />

number of chromatographic steps<br />

in the purification of monoclonal<br />

antibodies by combining a highly<br />

efficient Protein A step based on<br />

MabSelect SuRe with a second step<br />

based on Capto adhere.<br />

92 www.gelifesciences.com/bioprocess

---

PlasmidSelect Xtra<br />

S<br />

N<br />

The multimodal ligand of PlasmidSelect Xtra<br />

showing a high selectivity between supercoiled<br />

and open circular plasmid DNA.<br />

Purified plasmid DNA is required<br />

in increasingly larger quantities to<br />

meet the emerging requirements for<br />

gene therapy and DNA vaccination.<br />

As both human and veterinary<br />

applications are in focus, plasmid DNA<br />

purity, quantity, and cost-per-dose<br />

requirements vary greatly. Process<br />

development to purify plasmid DNA at<br />

large scale must thus be:<br />

• Flexible<br />

• Easily scalable<br />

• Robust<br />

• Cost efficient<br />

PlasmidSelect Xtra combines agarose<br />

base matrix technology allowing<br />

for low, non-specific interactions<br />

with a multimodal ligand designed<br />

for selective separation between<br />

supercoiled plasmid DNA and open<br />

circular plasmid DNA. PlasmidSelect<br />

Xtra has a ligand that may interact<br />

with the target molecule in many<br />

different ways. It contains both a<br />

thioether and a pyridyl functional<br />

group and its features partly<br />

resemble those of a phenyl-based<br />

HIC medium. However, in addition<br />

to the hydrophobic interactions,<br />

several other types of interactions are<br />

involved including thiophilic bonding<br />

and aromatic interactions.<br />

PlasmidSelect Xtra platform<br />

• Generic process for purification of<br />

supercoiled plasmid DNA.<br />

• Screening Kit: Quick and easy<br />

analysis with an ÄKTA system.<br />

Code number 28-4052-69.<br />

• Starter Kit: Prepacked columns for<br />

convenient process development.<br />

Code number 28-4052-68.<br />

• Bulk media: PlasmidSelect Xtra,<br />

Sepharose 6 Fast Flow, and SOURCE<br />

30Q are <strong>BioProcess</strong> media available<br />

in large quantities for scale-up and<br />

manufacturing. See A-Z of media<br />

and chemicals section of this<br />

catalog.<br />

4<br />

Chromatography media<br />

Fermentation<br />

Cell harvesting Lysis Clarification<br />

Concentration<br />

SOURCE 30Q<br />

Sepharose 6 Fast Flow<br />

Formulation<br />

Concentration<br />

Polishing<br />

Supercoiled plasmid<br />

DNA capture<br />

RNA removal<br />

The PlasmidSelect Xtra process, designed for the purification of high-quality, supercoiled plasmid DNA.<br />

www.gelifesciences.com/bioprocess 93

---

Reversed<br />

phase<br />

chromatography<br />

4<br />

Chromatography media<br />

Technique description<br />

Reversed phase chromatography<br />

(RPC) is in theory closely related<br />

to hydrophobic interaction<br />

chromatography. Both techniques<br />

are based on the interaction between<br />

hydrophobic patches on the surface<br />

of biomolecules and the hydrophobic<br />

groups covalently attached to the<br />

surface of the matrix. In practice,<br />

however, they are different. Media for<br />

RPC are typically highly substituted<br />

with hydrophobic ligands and the<br />

binding of substances to RPC media<br />

is usually stronger. Organic solvents<br />

are often required for elution. The<br />

technique is mainly applicable for<br />

peptides, proteins up to M r<br />

2.5 × 10 4<br />

and other low molecular weight<br />

biomolecules that are stable in<br />

aqueous-organic solvents.<br />

Required for polishing<br />

RPC is a widely-used analytical<br />

technique but it is also employed in<br />

preparative applications, up to process<br />

scale, for more demanding polishing<br />

problems, such as separating<br />

microheterogeneities from the native<br />

molecule of recombinant peptides.<br />

RPC is also a standard technique<br />

for purifying synthetic peptides and<br />

oligonucleotides. The technique often<br />

requires medium to high-pressure<br />

columns and systems and explosionproof<br />

equipment for handling high<br />

concentrations of flammable, volatile<br />

organic solvents.<br />

RPC media from <strong>GE</strong> <strong>Healthcare</strong> are<br />

designed for difficult preparative<br />

separations at all scales.<br />

94 www.gelifesciences.com/bioprocess

---

<strong>Product</strong>s<br />

SOURCE 15RPC and SOURCE 30RPC,<br />

both <strong>BioProcess</strong> media, are designed<br />

for fast, high performance preparative<br />

separations of biomolecules<br />

such as proteins, peptides and<br />

oligonucleotides. The media have<br />

matrices based on rigid, highly crosslinked,<br />

polystyrene/divinyl benzene,<br />

with monosized beads of diameters<br />

15 µm and 30 µm respectively.<br />

Pore size distribution is controlled<br />

and reproducible. Emphasis during<br />

development has been on quality,<br />

reproducibility and scalability,<br />

features that are particularly<br />

important for industrial applications.<br />

Their wide pH stability (pH 1 to 14)<br />

and high capacity make SOURCE<br />

RPC media an interesting alternative<br />

400-fold scale up on SOURCE 30RPC<br />

to silica-based media. The high<br />

chemical stability of the matrix offers<br />

exceptional flexibility when choosing<br />

running and cleaning conditions.<br />

SOURCE 15RPC is intended for<br />

polishing where fast, preparative<br />

separations with the highest<br />

resolution are required. SOURCE<br />

15RPC is also available in prepacked<br />

columns – RESOURCE RPC columns<br />

and ST 4.6/100 ÄKTA columns –<br />

which are well-suited for selectivity<br />

screening experiments.<br />

SOURCE 30RPC is well-suited for the<br />

polishing stage of industrial processes<br />

where high flow velocities and low<br />

back-pressures are needed.<br />

4<br />

Chromatography media<br />

Column:<br />

Sample:<br />

Sample load:<br />

Solution A:<br />

Solution B:<br />

Flow velocity:<br />

Gradient:<br />

SOURCE 30RPC, 10 mm i.d. × 300 mm column (24 mL)<br />

200 mm i.d. × 300 mm column (10 L)<br />

Mixture of Angiotensin II, Ribonuclease A and Insulin<br />

0.064 mg/mL media, total load<br />

0.1% TFA/0.05 M NaCl<br />

0.1% TFA/60% n-Propanol<br />

150 cm/h<br />

20% to 70% B, 5 column volumes (cv)<br />

2.0<br />

A 280 nm<br />

24 ml column<br />

2.0<br />

A 280 nm<br />

FineLINE 200L column<br />

1.0<br />

1.0<br />

0<br />

0 1 2 3 4 5 6 7 8 9 (cv)<br />

0<br />

0 1 2 3 4 5 6 7 8 9 (cv)<br />

A 400-fold scale up of a model sample mix on SOURCE 30 RPC. Going from a 24 mL laboratory-scale<br />

column to a 9.4 liter production-scale column in one step gives what is essentially identical results at<br />

both scales.<br />

www.gelifesciences.com/bioprocess 95

---

Gel filtration<br />

4<br />

Chromatography media<br />

Technique description<br />

Gel filtration separates biomolecules<br />

according to size. Large molecules<br />

elute either in the void volume or early<br />

in a chromatographic separation.<br />

Smaller molecules, depending on their<br />

degree of penetration of the pores of<br />

the matrix, elute later. Gel filtration is a<br />

simple technique which complements<br />

ion exchange, hydrophobic interaction,<br />

reversed phase, and affinity.<br />

In process chromatography, gel<br />

filtration is used principally for<br />

desalting the product, for buffer<br />

exchange, or for specific removal of<br />

contaminants with molecular weights<br />

above or below the desired product’s<br />

molecular weight. Typically, molecules<br />

must differ in size by two-fold to yield<br />

a good separation, although other<br />

adsorptive effects can augment some<br />

separations where molecules are<br />

similar in size.<br />

Excellent range<br />

Gel filtration is useful at polishing<br />

or final purification stages where<br />

volumes are much lower than at the<br />

capture or intermediate stages and<br />

there is a need to remove dimers or<br />

aggregates.<br />

<strong>GE</strong> <strong>Healthcare</strong> has an excellent range<br />

of gel filtration media ranging from<br />

Sephadex G-types and different<br />

Sephacryl selectivities, to the<br />

Superdex family.<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

The handbook Gel Filtration – Principles and<br />

Methods can be obtained through your local<br />

<strong>GE</strong> <strong>Healthcare</strong> office or downloaded from our<br />

website.<br />

Code number 18-1022-18<br />

Gel Filtration<br />

Principles and Methods<br />

96 www.gelifesciences.com/bioprocess

---

Selection guide<br />

Capture<br />

Polishing<br />

Sephacryl<br />

Sepharose Fast Flow<br />

Superdex<br />

4<br />

Sephadex G-25<br />

Intermediate<br />

purification<br />

Chromatography media<br />

Important characteristics of media for<br />

gel filtration include particle size, pore<br />

volume, adsorptive properties and<br />

matrix rigidity. The Sephacryl range<br />

of gel filtration products is available<br />

in five different selectivities covering<br />

a wide molecular weight range. All<br />

Sephacryl High Resolution media are<br />

available in convenient prepacked<br />

HiPrep 120 mL and 320 mL columns.<br />

Sepharose Fast Flow and Sephadex<br />

G-25 are chromatography media<br />

suitable for group separation such<br />

as desalting and buffer exchange.<br />

Sephadex G-25 media are available<br />

in prepacked HiPrep (53 mL) and<br />

HiTrap (5 mL) columns. The Superdex<br />

range of gel filtration media has<br />

been specifically designed to solve<br />

particular purification problems.<br />

The fractionation ranges are narrow<br />

and selectivity curves are steep<br />

compared with other gel filtration<br />

media. Additionally, Superdex media<br />

are available in prepacked HiLoad<br />

120 mL and 320 mL columns, which<br />

are a convenient way of obtaining<br />

reproducible results at lab-scale.<br />

www.gelifesciences.com/bioprocess 97

---

4<br />

Superdex prep grade<br />

High productivity gel filtration for Polishing<br />

Superdex prep grade is a high resolving gel filtration medium with average<br />

particle size of 34 µm. It is a composite of cross-linked agarose and dextran.<br />

Superdex 30 prep grade is well-suited for the Polishing and formulation<br />

of peptides with molecular weights of less than 1 × 10 4 , Superdex 75 prep<br />

grade is designed for the separation of recombinant DNA products, and<br />

Superdex 200 prep grade is particularly useful for the separation of monoclonal<br />

antibodies from dimers and low molecular weight contaminants (e.g., albumin<br />

and transferrin). Typical flow velocity is up to 50 cm/h and back pressure is<br />

typically below 3 bar with a 60 cm bed height. All of the Superdex prep grade<br />

media are available in prepacked high performance HiLoad 120 mL (16/60) and<br />

320 mL (26/60) columns.<br />

• Superdex 30 prep grade<br />

• Superdex 75 prep grade<br />

• Superdex 200 prep grade<br />

Chromatography media<br />

Sephacryl High Resolution<br />

Well established high resolution gel filtration for production<br />

Sephacryl High Resolution media give high resolution and are very well<br />

established in production process and industrial scale applications. They are<br />

a cost effective alternative to Superdex prep grade media. All Sephacryl High<br />

Resolution media are available in convenient, prepacked HiPrep 120 mL (16/60)<br />

and 320 mL (26/60) columns.<br />

Sepharose Fast Flow<br />

Industrial scale separations of very large molecules and virus particles<br />

The properties of Sepharose 4 and 6 Fast Flow media make them suitable for<br />

industrial scale gel filtration and are often used for group separations. Sepharose<br />

6 Fast Flow is part of the Plasmid Select Xtra process used for RNA removal.<br />

• Sephacryl S-100 High Resolution<br />

• Sephacryl S-200 High Resolution<br />

• Sephacryl S-300 High Resolution<br />

• Sephacryl S-400 High Resolution<br />

• Sephacryl S-500 High Resolution<br />

• Sepharose 4 Fast Flow<br />

• Sepharose 6 Fast Flow<br />

Sephadex G-25<br />

Well established for desalting and buffer exchange<br />

Sephadex G-25 media are well established for desalting and buffer exchange<br />

in industrial applications. These media have a low exclusion limit and separate<br />

macromolecules from salts and buffer substances with a minimum of sample<br />

dilution. Prepacked HiPrep 26/10 Desalting columns (53 mL) and HiTrap<br />

Desalting 1 mL and 5 mL columns are available for fast and convenient<br />

desalting. Note that several columns can be coupled in series to increase sample<br />

volume to be buffer exchanged (desalted).<br />

Sephadex LH-20<br />

Gel filtration in organic solvents<br />

This medium is for use with organic solvents when separating small molecules,<br />

lipids, steroids, fatty acids, hormones, etc.<br />

• Sephadex G-25 Coarse<br />

• Sephadex G-25 Medium<br />

• Sephadex G-25 Fine<br />

• Sephadex G-25 Superfine<br />

• Sephadex LH-20<br />

• = <strong>BioProcess</strong> media<br />

98 www.gelifesciences.com/bioprocess

---

Application guide<br />

For very small<br />

molecules<br />

For peptides and globular<br />

proteins<br />

Superdex 30 prep grade<br />

Superdex 75 prep grade<br />

Superdex 200 prep grade<br />

For larger molecules<br />

or particles<br />

10 2 10 3 10 4 10 5 10 6 10 7 10 8<br />

Sephacryl S-100 High Resolution<br />

Sephacryl S-200 High Resolution<br />

Sephacryl S-300 High Resolution<br />

Sephacryl S-400 High Resolution<br />

Sephacryl S-500 High Resolution<br />

Sepharose 6 Fast Flow<br />

Sepharose 4 Fast Flow<br />

Sepharose CL-2B<br />

4<br />

Sephadex G-25 C<br />

Sephadex G-25 M<br />

Sephadex G-25 F<br />

Sephadex G-25 SF<br />

C=Coarse<br />

M=Medium<br />

F=Fine<br />

SF=Superfine<br />

Chromatography media<br />

Getting started<br />

Testing the performance of<br />

chromatography media at the<br />

laboratory bench will help you select<br />

the most appropriate for processscale<br />

use. Prepacked HiLoad, HiPrep,<br />

and HiTrap columns are convenient<br />

and give reproducible results.<br />

www.gelifesciences.com/bioprocess 99

---

Custom Designed<br />

Media<br />

4<br />

Chromatography media<br />

The Custom Design Media (CDM) group<br />

provides large scale operators with<br />

chromatography media designed for<br />

their specific purification tasks. By<br />

tailoring a chromatography medium for<br />

your specific problem a CDM project aims<br />

to give you a more robust process and<br />

improved process economy. The Custom<br />

Designed Media can be made on an<br />

exclusive basis, but are often launched as<br />

a generally available product. Currently<br />

available CDM media are listed on the<br />

opposite page.<br />

Note: Many CDM media have become<br />

standard products and are classed as<br />

<strong>BioProcess</strong> media. They are supported<br />

accordingly. These media are described<br />

elsewhere in this catalog in the relevant<br />

technique sections.<br />

Custom Designed Media projects<br />

A CDM project is run according to ISO<br />

9001 routines and in collaboration<br />

with the customer, often under<br />

a confidentiality agreement. An<br />

experienced team works with you from<br />

the initial discussions right through to<br />

bulk delivery: establishing your needs,<br />

sorting through choices, and producing<br />

and testing the finished product to meet<br />

your delivery schedules. The final product<br />

is often a new combination of our existing<br />

base matrices and a ligand. The ligand<br />

could be one of our own, be available<br />

from an external supplier, extracted from<br />

a ligand library or discovered by you.<br />

Projects are carried out in three stages<br />

– media definition, media assurance and<br />

full-scale production and validation.<br />

Media definition<br />

The first stage involves discussions about<br />

the construction (matrix, ligands and<br />

coupling chemistry) required to obtain<br />

the desired product function. Alternatives<br />

can be suggested and samples prepared<br />

for your evaluation. From this evaluation<br />

and further discussions, the medium is<br />

defined.<br />

Media assurance<br />

After proof-of-principle has been<br />

obtained, a robust and scalable<br />

manufacturing process is developed.<br />

This includes optimization of the<br />

medium design and development of<br />

relevant analytical methods to secure<br />

functionality.<br />

Preliminary specifications are set for the<br />

mutually agreed test criteria. Pilot scale<br />

volumes can be delivered when needed.<br />

100 www.gelifesciences.com/bioprocess

---

Full-scale production and<br />

validation<br />

In the final stage the process is<br />

scaled up to a manufacturing scale<br />

appropriate for the customer needs.<br />

Test methods are validated and<br />

final specifications are set. If the<br />

product has potential as a widelyused<br />

product, it will be launched as<br />

a CDM product in the catalog. After<br />

delivery of several manufacturing<br />

batches to the customer, the process<br />

is validated. CDM products are not<br />

kept in stock but only manufactured<br />

on order.<br />

Every CDM product is designed to<br />

meet the stringent quality standards<br />

for commercial industrial use. Each<br />

undergoes full quality control, both<br />

during development and at full-scale<br />

production. Specific studies, such<br />

as stability, can be performed and<br />

Regulatory Support Files can be<br />

provided.<br />

Custom products<br />

<strong>GE</strong> <strong>Healthcare</strong> offers a large<br />

selection of prepacked columns and<br />

bulk media encompassing most<br />

liquid chromatography techniques.<br />

Should you require a special<br />

configuration or combination of<br />

column and medium not offered in the<br />

catalog, just contact your local sales<br />

office and ask for Custom <strong>Product</strong>s.<br />

For further<br />

information<br />

about CDM,<br />

please contact<br />

your local<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

office.<br />

See also process<br />

development<br />

on page 158 for<br />

details.<br />

Ordering information<br />

<strong>Product</strong> Pack size Code number<br />

6-AKS Sepharose 4 Fast Flow 1 L 17-3100-04<br />

Alpha-1 Antitrypsin Select 25 mL 17-5472-01<br />

200 mL 17-5472-02<br />

1 L 17-5472-03<br />

5 L 17-5472-04<br />

Amino Sepharose 6 Fast Flow 1 L 17-3092-09<br />

Capto Blue (hs) 25 mL 17-5452-01<br />

500 mL 17-5452-02<br />

5 L 17-5452-04<br />

Capto Octyl 25 mL 17-5465-01<br />

100 mL 17-5465-02<br />

Chelating Sepharose Big Beads 1 L 17-5272-03<br />

10 L 17-5272-05<br />

IgSelect 25 mL 28-4113-01<br />

200 mL 21-4113-02<br />

1 L 28-4113-03<br />

LambdaFabSelect 25 mL 17-5482-03<br />

200 mL 17-5482-03<br />

1 L 17-5482-03<br />

5 L 17-5482-04<br />

MacroCap Q 25 mL 17-5469-01<br />

500 mL 17-5469-02<br />

5 L 17-5469-04<br />

Plasminogen Removal Gel 1 L 28-4109-03<br />

Procainamide Sepharose 4 Fast Flow 1 L 28-4111-03<br />

5 L 28-4111-04<br />

VIISelect 25 mL 17-5477-01<br />

200 mL 17-5477-02<br />

1 L 17-5477-03<br />

5 L 17-5477-04<br />

VIIISelect 25 mL 17-5450-01<br />

500 mL 17-5450-02<br />

4<br />

Chromatography media<br />

www.gelifesciences.com/bioprocess 101

---

5<br />

Chromatography columns<br />

AxiChrom 106<br />

Chromaflow 110<br />

BPG 114<br />

INdEX 122<br />

FineLINE 126<br />

HiScale 132<br />

Custom-packed laboratory columns 134<br />

Manufacturing Solutions – column packing 136<br />

102 www.gelifesciences.com/bioprocess

---

Columns for process<br />

chromatography<br />

5<br />

When a chromatographic step is<br />

developed to be an integral part<br />

of a manufacturing process, the<br />

choice of column is important to<br />

assure consistent performance<br />

and reliable operation. With over<br />

30 years experience in process<br />

chromatography, <strong>GE</strong> <strong>Healthcare</strong><br />

can provide you with a wide range<br />

of columns that ensures the highest<br />

performance from our separation<br />

media and meets the demands<br />

of modern biopharmaceutical<br />

manufacturing. Know-how in packing<br />

methodology is available through our<br />

User Manuals. Workshops with lectures<br />

and hands-on training can be arranged<br />

through our Fast Trak services.<br />

Chromatography columns<br />

104 www.gelifesciences.com/bioprocess

---

Points to consider when selecting your column<br />

• Dimensions: To determine the<br />

appropriate column diameter at fullscale,<br />

calculate the column volume<br />

(or medium quantity) required based<br />

on your current scale, keeping bed<br />

height constant (usually 5 to 20 cm<br />

for adsorptive techniques and 50<br />

to 70 cm for gel filtration). If the<br />

exact diameter is not available,<br />

choose a wider diameter column,<br />

the advantage being increased<br />

capacity.<br />

• Specifications: Particle size,<br />

size distribution, flow rates and<br />

the solvent used will affect your<br />

choice of column. As particle size<br />

decreases, operational pressures<br />

increase. Two different media with<br />

the same nominal particle size,<br />

but with different particle size<br />

distributions may have significantly<br />

different pressure requirements.<br />

Solvent systems may restrict<br />

the choice of column materials,<br />

for example plastic or rubber<br />

components are unsuitable for use<br />

with some organic solvents. High<br />

salt buffers may dictate the grade<br />

or type of metal component, such<br />

as stainless steel 316L.<br />

• Design features: Proven hygienic<br />

design and high quality materials are<br />

necessary if the column is to be used<br />

for biopharmaceutical production. A<br />

fixed bed column is easier to clean<br />

than the respective variable bed<br />

height column, but this must be set<br />

against the greater flexibility afforded<br />

by the variable height.<br />

For media requiring additional<br />

bed compression at the end of the<br />

packing procedure, a variable bed<br />

height column would be needed. In<br />

process development, diagnostics,<br />

or reagent manufacturing, some<br />

design criteria are less critical, and<br />

for example the use of threaded or<br />

sanitary connections may not be as<br />

important.<br />

Select only columns with a<br />

proven distribution system since<br />

performance can be jeopardized with<br />

inadequate distribution of sample<br />

and buffer. Bed support porosity is<br />

dictated by the particle size of the<br />

medium used.<br />

• Regulatory support: Columns used<br />

in biopharmaceutical production or<br />

other regulated environments are<br />

scrutinized by regulatory authorities.<br />

Increasingly, documentation<br />

on materials compliance and<br />

toxicological data are requested.<br />

<strong>GE</strong> <strong>Healthcare</strong> supports the columns<br />

recommended for use in therapeutic<br />

manufacturing with hardware<br />

product documentation. The<br />

information in these files can save<br />

you valuable time when submitting<br />

clinical and marketing applications<br />

to regulatory authorities. In addition,<br />

Fast Trak can support installation<br />

and operational qualifications.<br />

• Technical support online: The<br />

process chromatography technical<br />

support portal provides users<br />

with a range of information<br />

including column and system<br />

recommendations, spare parts<br />

and accessories for columns<br />

and systems, column packing<br />

and testing information, and<br />

troubleshooting guides. Refer to<br />

Regulatory and Technical Support<br />

Services.<br />

5<br />

Chromatography columns<br />

For further information on Online regulatory and technical support,<br />

see page 226.<br />

Visit us on the web at www.gelifesciences.com/purification-techsupport<br />

www.gelifesciences.com/bioprocess 105

---

AxiChrom columns<br />

5<br />

Chromatography columns<br />

AxiChrom columns simplify column<br />

handling at all scales from process<br />

development to full-scale production.<br />

AxiChrom columns introduce three<br />

key features – Intelligent Packing,<br />

Intuitive handling, and Predictable<br />

scale-up – that together make process<br />

chromatography easier, safer, and<br />

more efficient.<br />

Intelligent Packing<br />

Verified, preprogrammed, axial<br />

compression packing methods<br />

save time and ensure accurate and<br />

reproducible packing results. This<br />

built-in experience reduces operatordependence<br />

and facilitates faster<br />

product change-over.<br />

Visit us on the web at<br />

www.gelifesciences.com/axichrom<br />

Intuitive handling<br />

Columns are simple to operate and<br />

service. Pivot or swing-out column<br />

tubes are safer and easier to handle.<br />

AxiChrom Master and UNICORN<br />

wizards guide users through key<br />

process steps to save time in method<br />

creation, set-up and maintenance.<br />

Predictable scale-up<br />

Straightforward scale-up and techtransfer<br />

due to a liquid distribution<br />

system designed using the same<br />

analytical and computational fluid<br />

dynamic modeling tools. Sanitizable<br />

columns support cleaning validation.<br />

Full technical and regulatory support<br />

promote fast, trouble-free start-up.<br />

The entire AxiChrom column line, from<br />

50 to 1000 mm, provides exceptional<br />

performance with new generation,<br />

high-flow Capto and MabSelect<br />

media families as well as with other<br />

<strong>BioProcess</strong> media.<br />

106 www.gelifesciences.com/bioprocess

---

AxiChrom features<br />

• User-configurable including stainless<br />

steel or plastic bed supports, 10 or<br />

20 µm, column material, column<br />

tube length; contact local sales<br />

representative<br />

• Small (50–70 mm) columns with two<br />

different tube lengths allowing bed<br />

volumes between 0.2 to 2 L<br />

• Available with stainless steel or<br />

single-use plastic bed supports<br />

• Pressure rating at 20 bar g (50 mm),<br />

15 bar g (70 mm), and 4 bar g<br />

(300–1000 mm)<br />

• Sanitary design with recommended<br />

CIP methods<br />

• Preprogrammed, verified packing<br />

methods for Capto, MabSelect and<br />

Sepharose Fast Flow media families<br />

through Intelligent Packing<br />

• cGMP compliant documentation<br />

• The same level of documentation<br />

is available for all column sizes,<br />

including traceability to batch level<br />

for wetted materials meets the<br />

requirements of USP Class VI, 21 CFR<br />

Part 177 and animal-free origin<br />

• Supported with IQ/OQ<br />

documentation packages<br />

What do I need?<br />

Useful accessories<br />

Pivot stand needs to be ordered<br />

separately for AxiChrom 50. The<br />

column is delivered with a foot stand.<br />

Tubing kits are available for different<br />

set ups depending on column<br />

dimension, chromatography medium,<br />

and chromatography system.<br />

Available toolkits (with optional torque<br />

wrench) simplify maintenance and<br />

assure column functionality.<br />

Useful spare parts to keep on site<br />

Bed supports, a complete set of<br />

O-rings and scraper sealing.<br />

Assembly/disassembly of column<br />

The centering plug delivered with<br />

the column must be used when<br />

assembling the 50-200 columns. A tool<br />

kit with the necessary tools can be<br />

ordered separately.<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 107

---

Technical specifications<br />

AxiChrom 50 AxiChrom 70 AxiChrom 100 AxiChrom 140 AxiChrom 200<br />

Inner column diameter (mm) 50 70 100 140 200<br />

Column type 50/300 50/500 70/300 70/500 100/300 100/500 140/300 140/500 200/300 200/500<br />

Bed height 1 (cm) 10–30 30–50 10–30 30–50 10–30 30–50 10–30 30–50 10–30 30–50<br />

Weight, empty column 2 (kg) 6.5 7.5 10 11.5 16.3 19.3 28.5 31.5 41.5 45.5<br />

Weight, column stand (kg) 7 7.5 7 7.5 7 7.5 23.5 25 23.5 25<br />

Max. operating work height (mm) 1400 1700 1650 1800 1650 1800 2000 2100 2000 2100<br />

Max. operating pressure (bar g) 10 8 8 6 5<br />

Max. packing pressure (bar g) 20 15 10 8 6<br />

Footprint, foot (mm × mm) 352 × 352<br />

Footprint, stand (mm × mm) 350 × 360 350 × 360 615 × 550<br />

Operating temperature (°C) 2–30 2–30 2–30<br />

Adapter movement Internal hydraulic Internal hydraulic Internal hydraulic<br />

Bed support (μm) 10, 20 3 10, 20 3 10, 20 3<br />

1<br />

Adapter stroke length for short column tube: Min/max limits 5–35 cm<br />

Adapter stroke length for long column tube: Min/max limits 30–60 cm<br />

2<br />

Weight includes stainless steel bed support<br />

3<br />

20 μm supports are standard; 10 μm can be special ordered<br />

5<br />

Chromatography columns<br />

AxiChrom 300 AxiChrom 400 AxiChrom 450 AxiChrom 600 AxiChrom 800 AxiChrom 1000<br />

Inner column<br />

diameter (mm) 300 400 450 600 800 1000<br />

Column type 300/300 300/500 400/300 400/500 450/300 450/500 600/300 600/500 800/300 800/500 1000/300 1000/500<br />

Bed height 1 (cm) 10–30 10–50 10–30 10–50 10–30 10–50 10–30 10–50 10–30 10–50 10–30 10–50<br />

Weight, empty column 2 (kg) 420 440 460 480 710 760 835 900 2150 2240 2560 2680<br />

Min height (mm) 1450 1710 1455 1715 1500 1760 1600 1860 1750 2010 1905 2165<br />

Max. operating work height (mm) 2060 2580 2060 2580 2080 2600 2190 2710 2480 3000 2490 3010<br />

Max. height for maintenance (mm) 2200 2720 2200 2720 2230 2750 2340 2860 2630 3150 2650 3170<br />

Footprint, foot (mm × mm) 520 × 1110 600 × 1110 620 × 1110 780 × 1180 1080 × 1470 1300 × 1720<br />

Max. operating pressure (bar g) 4<br />

Operating temperature (°C) 2–30<br />

Adapter movement<br />

Servo motor<br />

Bed support (μm) 10, 20<br />

1<br />

Adapter stroke length for short column tube: Min/max limits 1–57 cm<br />

Adapter stroke length for long column tube: Min/max limits 1–83 cm<br />

2<br />

Weights are for PMMA column tube and stainless steel bed support<br />

AxiChrom 50 AxiChrom 70 AxiChrom 100 AxiChrom 140 AxiChrom 200<br />

Bed height (cm)<br />

Column volume 1 (L)<br />

10<br />

0.2<br />

30<br />

0.6<br />

50<br />

1.0<br />

10<br />

0.4<br />

30<br />

1.2<br />

50<br />

1.9<br />

10<br />

0.8<br />

30<br />

2.4<br />

50<br />

3.9<br />

10<br />

1.5<br />

30<br />

4.6<br />

50<br />

7.7<br />

10<br />

3.1<br />

30<br />

9.4<br />

50<br />

15.7<br />

AxiChrom 300 AxiChrom 400 AxiChrom 450 AxiChrom 600 AxiChrom 800 AxiChrom 1000<br />

Bed height (cm)<br />

Column volume 1 (L)<br />

10<br />

7<br />

30<br />

21<br />

50<br />

35<br />

10<br />

13<br />

30<br />

38<br />

50<br />

63<br />

10<br />

16<br />

30<br />

48<br />

50<br />

80<br />

10<br />

28<br />

30<br />

85<br />

50<br />

141<br />

10<br />

50<br />

30<br />

151<br />

50<br />

251<br />

10<br />

79<br />

30<br />

236<br />

50<br />

393<br />

1<br />

Column volumes do not take medium compression into consideration<br />

For extensive information on spare parts,<br />

accessories, and dimensions of AxiChrom columns,<br />

visit www.gelifesciences.com/axichrom<br />

108 www.gelifesciences.com/bioprocess

---

AxiChrom 140 and AxiChrom 200<br />

Parts/Accessories Quantity Code number<br />

Ordering information<br />

<strong>Product</strong><br />

Code number<br />

Mechanical locking 140 1 28-9433-88<br />

Mechanical locking 200 1 28-9433-53<br />

Silicone tubing kit AxiChrom 140, i.d. 3.2 (ÄKTAprocess) 1 28-9429-86<br />

Silicone tubing kit AxiChrom 140, i.d. 4.8 (ÄKTAprocess) 1 28-9429-93<br />

Silicone tubing kit AxiChrom 200, i.d. 6.4 (ÄKTAprocess) 1 28-9430-20<br />

TC 25 Clamp SS 5 28-4043-38<br />

TC gasket 25/6.5 10 28-4034-13<br />

TC end cap TC 25 1 28-4043-39<br />

Media stirrer (80 mm) 1 28-9191-03<br />

Media stirrer (150 mm) 1 28-9191-04<br />

User Manual AxiChrom 140 and 200 1 28-9489-52<br />

Tool kit small AxiChrom 50/70/100/140/200 1 28-9361-36<br />

Tool kit large AxiChrom 50/70/100/140/200 1 28-9442-61<br />

Torque wrench kit AxiChrom 1 28-9361-37<br />

Torque driver kit AxiChrom 1 28-9361-39<br />

Outlet tubing kit AxiChrom 140, 200 1 28-9430-41<br />

AxiChrom 50/300/Glass/20SS 28-9018-31<br />

AxiChrom 50/500/Glass/20SS 28-9018-41<br />

AxiChrom 70/300/Glass/20SS 28-9018-40<br />

AxiChrom 70/500/Glass/20SS 28-9018-47<br />

AxiChrom 100/300/Glass/20SS 28-9032-74<br />

AxiChrom 100/500/Glass/20SS 28-9032-76<br />

AxiChrom 140/300/Glass/20SS 28-9077-02<br />

AxiChrom 140/500/Glass/20SS 28-9439-27<br />

AxiChrom 200/300/Glass/20SS 28-9077-03<br />

AxiChrom 200/500/Glass/20SS 28-9439-28<br />

AxiChrom 300, 400, 450, 600, 800, and 1000<br />

Please contact your<br />

<strong>GE</strong> <strong>Healthcare</strong> representative<br />

The AxiChrom names above reflect: inner column diameter/maximum bed height/column<br />

material/bed support size and material.<br />

Note: AxiChrom 50-1000 columns are available with 10 µm stainless steel bed supports as<br />

well as 10 µm and 20 µm plastic bed supports, and can be ordered via a sales configurator.<br />

Please see additional information below.<br />

AxiChrom 50, AxiChrom 70, and AxiChrom 100<br />

Parts/Accessories Quantity Code number<br />

Pivot stand 50/70/100–300 1 28-4017-09<br />

Pivot stand 50/70/100–500 1 28-4017-10<br />

AxiChrom foot 70 1 28-4019-37<br />

Mechanical locking 50 1 28-4018-39<br />

Mechanical locking 70 1 28-4018-40<br />

Mechanical locking 100 1 28-4018-41<br />

Tool kit small AxiChrom 50/70/100/140/200 1 28-9361-36<br />

Tool kit complete AxiChrom 50/70/100/140/200 1 28-9442-61<br />

Torque wrench kit AxiChrom 1 28-9361-37<br />

Torque driver kit 1 28-9361-39<br />

Tubing kit AxiChrom 50 ÄKTAexplorer / desk 1 28-9055-41<br />

Tubing kit AxiChrom 50 ÄKTAexplorer / floor 1 28-9056-03<br />

Tubing kit AxiChrom 50 ÄKTApilot / desk 1 28-9056-76<br />

Tubing kit AxiChrom 50 ÄKTApilot / floor 1 28-9136-13<br />

Tubing kit AxiChrom 70 ÄKTApilot / floor 1 28-9136-14<br />

Media stirrer (40 mm, for AxiChrom 50/70) 1 28-9231-80<br />

Media stirrer (80 mm, for AxiChrom 100/140) 1 28-9191-03<br />

Literature<br />

Data file<br />

Code number<br />

AxiChrom columns 28-9290-41<br />

Application note<br />

Sanitization of AxiChrom columns 28-9290-42<br />

High-productivity capture of alpha-chymotrypsin on Capto S ion<br />

exhanger 28-4078-15<br />

Handling of stainless steel column parts in sensitive environments 28-9433-77<br />

Configurable AxiChrom columns, parts, and<br />

accessories<br />

Smaller columns without standard code numbers and<br />

all larger columns with diameters of 300 mm and larger,<br />

are configurable and ordered via a sales configurator.<br />

Columns can be tailored to requirements using this<br />

configurator. The configurator also creates an extensive<br />

documentation package including General Specification,<br />

Bill of Materials, Assembly Drawing, Spare Parts List, Site<br />

Preparation <strong>Guide</strong>, as well as a price quotation. Via the<br />

sales configurator, dynamic wizards for accessories and<br />

spare parts recommend a number of accessories and<br />

spare parts exactly matching the column and interface to<br />

a chromatography system. This facilitates easy, fast and<br />

correct selection, all fulfilling the same standards as the<br />

column.<br />

Examples of accessories: tubings, T-junctions, reducers,<br />

gaskets and clamps, casters, safety valves, manual valves,<br />

tool kit, and media stirrer.<br />

The sales configurator is also used to recommend upgrade<br />

kits for ÄKTAprocess systems that were delivered prior<br />

to Intelligent Packing being available. By entering the<br />

ÄKTAprocess system serial number, the applicable kit(s) for<br />

that system is given.<br />

Please contact a <strong>GE</strong> <strong>Healthcare</strong> sales representative<br />

for assistance in using the AxiChrom configurator.<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 109

---

Chromaflow columns<br />

5<br />

Chromatography columns<br />

Chromaflow columns represent an<br />

innovative development in process<br />

scale chromatography resulting in<br />

improved process reliability, safety<br />

and economics.<br />

With Chromaflow columns, packing,<br />

operation, unpacking and cleaning<br />

can be done without removing the lid<br />

or adaptor – all due to the design of<br />

the nozzle in both the top and bottom<br />

end-pieces. With the establishment of<br />

packing protocols for individual media,<br />

large-scale chromatography is more<br />

convenient, scalable and safer for<br />

both the operators and the product.<br />

Chromaflow columns are intended<br />

for GMP production. Materials of<br />

manufacture and column design,<br />

which are consistent over all scales,<br />

meet the demands of regulatory<br />

authorities for cGMP facilities<br />

producing biopharmaceuticals.<br />

For customized Chromaflow<br />

columns, please contact your local<br />

representative.<br />

Chromaflow range<br />

• Diameters from 300 to 2000 mm<br />

• Design principle is common to all column<br />

dimensions making scale-up a simple<br />

operation<br />

• 3 bar pressure rating as standard and up<br />

to 5 bar as custom made<br />

• Transparent, high quality cast acrylic or<br />

electropolished stainless steel tube<br />

• Hygienic design tested in microbial<br />

challenge studies<br />

• Packing stations simplify packing and<br />

unpacking<br />

• All polymeric materials are approved<br />

according to USP Class VI tests for<br />

toxicity<br />

• Full documentation package Validation<br />

support documentation available on<br />

request<br />

• Documentation to support validation<br />

delivered with the product<br />

• Available with external hydraulics for<br />

adapter movement and maintenance<br />

purposes<br />

110 www.gelifesciences.com/bioprocess

---

Properties of Chromaflow columns<br />

Design specifications<br />

Design temperature 4°C to 30°C<br />

Operating pressure 3 bar<br />

CE-directive compliance PED/ATEX100<br />

Design standard<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>GE</strong>P<br />

Surface finishes, stainless steel<br />

Internal wetted<br />

< 0.5 μm Ra EP<br />

Non-wetted parts<br />

< 3 μm Ra EP<br />

Material specifications<br />

Tube<br />

Acrylic (PMMA), 316L<br />

Distributor plates<br />

Polypropylene<br />

Bed supports<br />

Polyethylene or<br />

316L/S32205<br />

Seals<br />

FEP encapsulated<br />

silicone & EPDM<br />

Nozzle body<br />

Polypropylene<br />

Nozzle tube<br />

PEEK, 316L<br />

Nozzle tip<br />

PEEK<br />

Stand 316<br />

For more information contact your <strong>GE</strong> <strong>Healthcare</strong><br />

representative.<br />

Principle of operation<br />

Nozzles sit in both the top and bottom<br />

of the column allowing packing<br />

in either an upward or downward<br />

direction. There are three nozzle<br />

positions: mid-position, for priming<br />

and packing; retracted, for running;<br />

and fully extended into the column<br />

for unpacking and cleaning. The<br />

nozzle also enables isolation of<br />

slurry lines from the mobile phase<br />

during operation, allowing removal of<br />

residual medium and cleaning of the<br />

slurry lines independently of the rest<br />

of the column.<br />

In the example opposite, packing is via<br />

the lower nozzle with upward flow.<br />

Packing position<br />

The bottom nozzle extends part of the<br />

way (mid position) into the column.<br />

The top nozzle is fully retracted. Slurry<br />

enters the column via the bottom<br />

nozzle and excess liquid exits via the<br />

top mobile phase outlet. After packing,<br />

the slurry lines are isolated from the<br />

mobile phase and can be cleaned<br />

independently from the rest of the<br />

column.<br />

Running position<br />

The top and bottom nozzles are<br />

retracted. Mobile phase enters the<br />

column directly into an annulus<br />

immediately behind the bed support.<br />

The annulus is cut through at an angle<br />

to ensure that the linear flow rate is<br />

kept constant during distribution of<br />

the mobile phase across the bed.<br />

Unpacking position<br />

In this position, both bottom and top<br />

nozzles are fully extended into the<br />

column, thereby exposing a third<br />

passage through which medium<br />

leaves the column. Cleaning solution<br />

can be pumped through the nozzles<br />

and sprayed into the column. In<br />

this way, the column is easily and<br />

effectively cleaned without exposing<br />

the interior or the medium to the<br />

outside, or without dismantling the<br />

column.<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 111

---

Ordering information<br />

Chromaflow columns Bed support Bed support Bed support<br />

with acrylic tubes 10 mm SS sinter 20 mm SS sinter 20 mm PE sinter<br />

I.d. 400 mm Man. nozzle<br />

Stroke length 100-300 18-1150-40 18-1159-40 18-1161-40<br />

Stroke length 200-400 18-1157-42 18-1159-42 18-1161-42<br />

Stroke length 300-500 18-1157-44 18-1159-44 18-1161-44<br />

I.d. 400 mm Auto. nozzle<br />

Stroke length 100-300 18-1157-41 18-1159-41 18-1161-41<br />

Stroke length 200-400 18-1157-43 18-1159-43 18-1161-43<br />

Stroke length 300-500 18-1157-45 18-1159-45 18-1161-45<br />

I.d. 400 mm SFP* Man. nozzle<br />

Stroke length 100-300 18-1170-53 18-1176-12 11-0011-85<br />

Stroke length 200-400 11-0011-80 11-0011-83 11-0011-86<br />

Stroke length 300-500 11-0011-82 11-0011-84 11-0011-87<br />

I.d. 400 mm SFP Auto. nozzle<br />

Stroke length 100-300 11-0011-89 11-0011-91 11-0011-94<br />

Stroke length 200-400 11-0011-88 11-0011-92 11-0011-95<br />

Stroke length 300-500 11-0011-90 11-0011-93 11-0011-96<br />

5<br />

Chromatography columns<br />

I.d. 600 mm Man. nozzle<br />

Stroke length 100-300 18-1150-60 18-1159-60 18-1161-60<br />

Stroke length 200-400 18-1157-62 18-1159-62 18-1161-62<br />

Stroke length 300-500 18-1157-64 18-1159-64 18-1161-64<br />

I.d. 600 mm Auto. nozzle<br />

Stroke length 100-300 18-1157-61 18-1159-61 18-1161-61<br />

Stroke length 200-400 18-1157-63 18-1159-63 18-1161-63<br />

Stroke length 300-500 18-1157-65 18-1159-65 18-1161-65<br />

I.d. 800 mm Man. nozzle<br />

Stroke length 100-300 18-1150-80 18-1159-80 18-1161-80<br />

Stroke length 200-400 18-1157-82 18-1159-82 18-1161-82<br />

Stroke length 300-500 18-1157-84 18-1159-84 18-1161-84<br />

I.d. 800 mm Auto. nozzle<br />

Stroke length 100-300 18-1157-81 18-1159-81 18-1161-81<br />

Stroke length 200-400 18-1157-83 18-1159-83 18-1161-83<br />

Stroke length 300-500 18-1157-85 18-1159-85 18-1161-85<br />

I.d. 1000 mm Man. nozzle<br />

Stroke length 100-300 18-1150-10 18-1160-10 18-1162-10<br />

Stroke length 200-400 18-1158-12 18-1160-12 18-1162-12<br />

Stroke length 300-500 18-1158-14 18-1160-14 18-1162-14<br />

I.d. 1000 mm Auto. nozzle<br />

Stroke length 100-300 18-1158-11 18-1160-11 18-1162-11<br />

Stroke length 200-400 18-1158-13 18-1160-13 18-1162-13<br />

Stroke length 300-500 18-1158-15 18-1160-15 18-1162-15<br />

For column specifications other than listed in the table, please contact your local <strong>GE</strong> <strong>Healthcare</strong> representative.<br />

* SFP = Small Flow Path on mobile phase, only available on 400 mm i.d. columns.<br />

112 www.gelifesciences.com/bioprocess

---

Options to the standard configuration<br />

Details<br />

Casters<br />

Nozzle pipings<br />

Description<br />

Chromaflow Packing stations<br />

For columns with a maximum diameter up to 1000 mm.<br />

Extension pipings for the Mobile phase inlet<br />

top and Slurry outlet top (avoids tubing getting bent)<br />

Chromaflow Packing station Pack 50 18-1163-74<br />

Chromaflow Packing station Pack 100 18-1162-08<br />

Chromaflow Packing station Pack 200<br />

Chromaflow Packing station Pack 400<br />

Chromaflow Packing station selection guide<br />

Custom order<br />

Custom order<br />

Packing Station Min L/min Max L/min*<br />

Pack 50 10 50<br />

Pack 100 30 100<br />

Pack 200 60 200<br />

Pack 400 100 400<br />

Chromaflow MKIII caster kits<br />

Casters to 400–600 mm MKIII columns 18-1171-51<br />

Casters to 800–1000 mm MKIII columns 18-1171-52<br />

Chromaflow Nozzle pipings<br />

Chromaflow Nozzle piping 400 1/2 in 18-1172-01<br />

Chromaflow Nozzle piping 400 3/4 in 18-1172-00<br />

Chromaflow Nozzle piping 400 1 in 18-1171-99<br />

Chromaflow Nozzle piping 600 1/2 in 18-1172-06<br />

Chromaflow Nozzle piping 600 3/4 in 18-1172-05<br />

Chromaflow Nozzle piping 600 1 in 18-1172-04<br />

Chromaflow Nozzle piping 800 1/2 in 18-1171-94<br />

Chromaflow Nozzle piping 800 3/4 in 18-1171-93<br />

Chromaflow Nozzle piping 800 1 in 18-1171-92<br />

Chromaflow Nozzle piping 1000 1/2 in 18-1172-09<br />

Chromaflow Nozzle piping 1000 3/4 in 18-1172-08<br />

Chromaflow Nozzle piping 1000 1 in 18-1172-07<br />

* Packing flow rate depends on back pressure as well as air supply pressure and flow rate.<br />

Accessories for Chromaflow columns<br />

Accessory Code number Qty/pack Material<br />

Valves<br />

4-port 2-way, i.d. 10 mm, 25 mm TC 18-1012-56 1 SS 316L/PTFE<br />

4-port 4-way, i.d. 10 mm, 25 mm TC 18-1012-57 1 SS 316L/PTFE<br />

3-port 2-way, i.d. 15 mm, 25 mm TC 44-5499-90 1 SS 316L/PTFE<br />

4-port 4-way, i.d. 20 mm, 51 mm TC 44-2302-01 1 SS 316L/PTFE<br />

3-port 2-way, i.d. 22 mm, 51 mm TC 44-1583-01 1 SS 316L/PTFE<br />

3-port 2-way, i.d. 35 mm, 51 mm TC 44-5494-65 1 SS 316L/PTFE<br />

Valve sealing washer fits 10 mm 2 and 4-way valves 18-1128-69 2 PTFE<br />

Tubing with sanitary fitting 25 mm TC<br />

i.d. 10 mm, 900 mm 18-1012-62 1 PVC<br />

i.d. 10 mm, 1400 mm 18-1012-63 1 PVC<br />

i.d. 10 mm, 1700 mm 18-1012-64 1 PVC<br />

i.d. 10 mm, 2000 mm 18-1012-87 1 PVC<br />

i.d. 14 mm, 750 mm 18-1027-28 1 PVC<br />

i.d. 14 mm, 1800 mm 18-1027-29 1 PVC<br />

Tubing with sanitary fitting 51 mm TC<br />

i.d. 19 mm, 900 mm 28-4042-30 2 PVC<br />

i.d. 19 mm, 1400 mm 28-4042-35 2 PVC<br />

i.d. 19 mm, 2000 mm 28-4042-32 2 PVC<br />

i.d. 19 mm, 4000 mm 28-4042-33 2 PVC<br />

Clamp gasket<br />

25 mm i.d., 10 mm 18-1035-79 2 EPDM<br />

25 mm i.d., 12 mm 18-0200-00 2 EPDM<br />

51 mm i.d., 22 mm 28-9668-86 1 EPDM<br />

51 mm i.d., 38 mm 44-0515-01 5 EPDM<br />

Clamp 25 mm 18-1001-31 1 SS 304<br />

Clamp 51 mm 44-7134-01 1 SS 304<br />

Blind flange 25 mm incl. gasket 18-1001-25 1 SS 304/EPDM<br />

Blind flange 51 mm incl. gasket 44-7135-01 1 SS 304/EPDM<br />

Safety valve, 3 bar, 51 mm TC 18-5738-01 1 SS 316/EPDM<br />

T-junction i.d. 10 mm, 2 × 25 mm, 1 × 51 mm TC 18-1003-63 1 SS 316<br />

T-junction i.d. 22 mm, 3 × 51 mm TC 44-5509-89 SS 316<br />

Castors, assembly kit 400-600 18-1171-51 *<br />

Castors, assembly kit 800-1000 18-1171-52 *<br />

Pressure sensor i.d. 10 mm 25 mm TC 28-9343-23 1 SS 316<br />

Pressure sensor i.d. 22 mm 51 mm TC 28-9343-24 1 SS 316<br />

Connectors<br />

i.d. 10, 25 mm TC 3/4 in 20 UNF threaded 18-1012-68 2 PP<br />

i.d. 10, 25 mm TC-i.d. 14, 51 mm TC 18-1027-25 2 PP<br />

i.d. 14, 51 mm TC-i.d. 22, 51 mm TC 18-1027-26 2 PP<br />

i.d. 22, 51 mm TC – i.d. 10, 25 mm TC 18-1174-11 1 PP<br />

i.d. 22, 51 mm TC – i.d. 14, 25 mm TC 18-1174-12 1 PP<br />

* The kit contains a complete set for a column<br />

Material abbreviations: EPDM=ethylene propylene diene, PP=polypropylene, PTFE=polytetrafluoroethene,<br />

PVC=polyvinyl chloride, SS=stainless steel<br />

Literature<br />

Data file<br />

Code number<br />

Chromaflow columns 18-1138-92<br />

Application note<br />

Sanitization of Chromaflow 400 column 18-1118-85<br />

Documentation to support validation available online<br />

at www.gelifesciences.com<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 113

---

BPG columns<br />

BPG columns are glass columns designed for use in the<br />

production of biopharmaceuticals or any product made<br />

in a regulated or current Good Manufacturing Practice<br />

(cGMP) environment. The columns are manufactured with<br />

materials carefully selected for their compatibility with<br />

the solvents most commonly used in biopharmaceutical<br />

manufacture. All polymeric materials are approved<br />

according to USP Class VI tests for toxicity.<br />

5<br />

Chromatography columns<br />

BPG range<br />

• Scalable from inner diameters of<br />

100 mm to 450 mm and bed volumes from 2 to 121 L<br />

• Pressure rating up to 8 bar<br />

• Proven hygienic design and easy cleaning-in-place<br />

• For use with a variety of techniques and<br />

chromatographic media, especially <strong>BioProcess</strong> media<br />

(Superdex, Sepharose High Performance and Fast Flow,<br />

and Sephacryl)<br />

• Proven distribution system<br />

• Sanitary TC connections throughout<br />

• Materials include electropolished stainless steel,<br />

calibrated borosilicate glass, EPDM and fluoroplastics<br />

– all with high chemical resistance<br />

• All polymeric materials are approved according to USP<br />

Class VI tests for toxicity<br />

• IQ and OQ documentation packages available<br />

• Validation support documentation available on request<br />

• Packing devices available for long bed heights<br />

114 www.gelifesciences.com/bioprocess

---

Overview of BPG columns<br />

Column<br />

Diameter<br />

(mm)<br />

Column<br />

Area<br />

(cm 2 )<br />

Bed height (cm)<br />

Volume (L)<br />

Column<br />

Packing Running<br />

Packing<br />

(cm) Min Max 1 extension 2 extension 3 Min Max 1 extension 2<br />

Height<br />

with with<br />

with<br />

Running<br />

with<br />

extension 3<br />

Max.<br />

pressure<br />

(bar g) 4<br />

Total<br />

weight<br />

(kg)<br />

Adapter<br />

weight<br />

(kg)<br />

Overall<br />

dimensions<br />

(cm) D × W × H<br />

100 78.5 50 0 26 34 45 0.0 2.0 2.7 3.5 8 15 7 48 × 48 × 127<br />

100 78.5 75 25 41 55 65 2.0 3.2 4.3 5.1 8 16 7 48 × 48 × 152<br />

100 78.5 95 45 54 72 78 3.5 4.2 5.7 6.1 8 17 7 48 × 48 × 172<br />

140 154 50 0 26 34 45 0.0 4.0 5.2 6.9 6 25 11 59 × 59 × 127<br />

140 154 75 25 41 55 65 3.9 6.3 8.5 10.0 6 26 11 59 × 59 × 152<br />

140 154 95 45 54 72 78 6.9 8.3 11.1 12.0 6 27 11 59 × 59 × 172<br />

200 314 50 0 26 34 45 0.0 8.2 10.7 14.1 6 34 13 59 × 59 × 127<br />

200 314 75 25 41 55 65 7.8 12.9 17.3 20.4 6 36 13 59 × 59 × 152<br />

200 314 95 45 54 72 78 14.1 17.0 22.6 24.5 6 39 13 59 × 59 × 172<br />

296 688 50 0 26 34 45 0.0 17.9 23.4 31.0 4 68 29 69 × 69 × 133<br />

296 688 75 25 41 55 65 17.2 28.2 37.8 44.7 4 73 29 69 × 69 × 158<br />

296 688 95 45 54 72 78 31.0 37.2 49.5 53.7 4 78 29 69 × 69 × 178<br />

446 1562 50 3 23 28 43 4.7 35.4 44.3 66.4 2.5 200 100 80 × 80 × 140<br />

446 1562 75 28 39 44 58 43.7 60.3 75.1 91.3 2.5 215 100 80 × 80 × 165<br />

446 1562 100 53 55 77 83 82.8 85.2 120.4 130.4 2.5 230 100 80 × 80 × 190<br />

Bed volumes and bed heights are based on a slurry concentration of 75% and a packing compression of 15%. Where compression is the difference in volume between a sedimented bed and a bed under pressure.<br />

1<br />

Values achievable without a packing extension.<br />

2<br />

Values achievable when a packing extension is used for sedimentation of the bed (75% of the slurry must fit into the column and extension when the adapter is mounted).<br />

3<br />

Values achievable when the packing extension remains attached to the column for the duration of column use. The adapter must seal at least 5 cm into the column tube to avoid high tensions in the glass tube.<br />

4<br />

Use a manometer to monitor the pressure.<br />

What do I need?<br />

The column<br />

BPG 100, 140, and 200; stand kit must<br />

be ordered separately. BPG 100 has<br />

adjustable feet, wheels with brakes<br />

are available. BPG 140 and 200 stands<br />

have wheels with brakes as standard.<br />

BPG 300 and 450 are supplied with<br />

stainless steel stand with wheels and<br />

foot-operated brakes.<br />

Useful spare parts<br />

Nets: The column is delivered with<br />

23 µm (polypropylene) nets.<br />

For media with an average particle<br />

diameter < 70 µm, change to 10 µm<br />

(polyamide) or 12 µm (PEEK) in<br />

both adaptors and endpieces. For<br />

Sepharose Big Beads use 54 µm nets.<br />

Longer bed heights<br />

Packing extensions are available for<br />

all diameters.<br />

Isolating the column after packing<br />

We recommend using sanitary<br />

stainless steel valves of the<br />

appropriate inner diameter to prevent<br />

contamination of the packed bed.<br />

The 2-way or 4-way valves with a<br />

6 mm i.d. are suitable for BPG 100, 140<br />

and 200 columns. The 10 mm i.d. is<br />

suitable for BPG 300 and 450 columns.<br />

For storage purposes, the 25 mm blind<br />

flange with a clamp and gasket can<br />

be used to seal off the column.<br />

5<br />

Chromatography columns<br />

O-rings: FEP adaptor and sealing<br />

O‐rings if solvents not compatible with<br />

the EPDM O-rings supplied with the<br />

column.<br />

Gaskets: Use PTFE gaskets if solvent<br />

not compatible with EPDM.<br />

Spare parts to keep on site<br />

All nets, support screens and O-rings.<br />

In some cases, a spare tube may be<br />

advisable.<br />

Standard accessories:<br />

packing extension,<br />

tubing, valves, safety<br />

valves, air trap,<br />

T-junction, pressure<br />

relief valve, clamps,<br />

gaskets, manometer<br />

and top-valve.<br />

www.gelifesciences.com/bioprocess 115

---

5<br />

Connecting the column to your system<br />

A clamp and gasket, 6 or 10 mm i.d., are required to<br />

connect the 25‐mm sanitary flanged inlet/outlet to either<br />

valves or tubing of the same type. Preflanged tubing in<br />

6 and 10 mm i.d. is available.<br />

Assembly/disassembly of column<br />

A torque wrench with an appropriate sized socket is<br />

required and can be ordered separately.<br />

Useful column accessories<br />

Air Traps: BPG Air Trap Complete includes the air trap,<br />

mounting bracket, steel valves, clamps and gaskets. For air<br />

traps for BPG 100, 140 and 200, tubing is included.<br />

Top valve: Manually operated valve recommended at the<br />

top of the airtrap as an air outlet control.<br />

Manometers: Manometer kits contain a pressure gauge,<br />

T-junction, and necessary clamps and gaskets for sanitary<br />

connections.<br />

Pressure relief valves: Connected between the pump and<br />

column inlet permit flow delivery at a constant pressure<br />

throughout the packing procedure.<br />

Safety valve: Precalibrated valve that releases pressure<br />

if the calibrated value is exceeded. Recommended if the<br />

column may exceed its maximum pressure limit and no<br />

other pressure sensor is included in the chromatographic<br />

system. T-junction, clamps and gaskets have to be ordered<br />

separately.<br />

Earlier design: For ordering accessories and spare parts to<br />

the former design of the BPG 100, 200 and 300 columns,<br />

design pressure 3 bar, see Instruction Manual, Code<br />

number 18-1030-99.<br />

Suitable systems: BPG columns are designed for use<br />

with ÄKTAprocess or ÄKTApilot systems and have design<br />

pressures of 8 bar (BPG 100), 6 bar (BPG 140 and 200), 4 bar<br />

(BPG 300) and 2.5 bar (BPG 450). Please contact your local<br />

<strong>GE</strong> <strong>Healthcare</strong> representative for details.<br />

Chromatography columns<br />

Ordering information<br />

Column 500 mm 750 mm 950 mm Stand<br />

BPG 100 18-1103-01 18-1103-02 18-1103-03 18-1031-10<br />

BPG 140 18-1113-08 44-7320-47 18-1113-09 18-1031-20<br />

BPG 200 18-1103-11 18-1103-12 18-1103-13 18-1031-20<br />

BPG 300 18-1103-21 18-1103-22 18-1103-23 included<br />

1000 mm<br />

BPG 450 18-1103-71 18-1103-72 18-1103-73 included<br />

Each column includes as standard: 23 µm polypropylene filter bed supports and<br />

polypropylene coarse bed supports, 2 clamps, 2 EPDM gaskets, 2 blank caps and<br />

O-rings in EPDM.<br />

Air trap, top valve, manometer and safety valve.<br />

Literature<br />

Data files<br />

Code number<br />

BPG Columns 100, 140, 200, 300,<br />

and 450 series 18-1115-23<br />

Application notes<br />

Sanitization of BPG Columns 18-1020-86<br />

Sanitization of BPG 450 Column 18-1117-76<br />

Documentation to support validation available on request.<br />

Contact your local <strong>GE</strong> <strong>Healthcare</strong> office.<br />

Column with packing<br />

extension.<br />

116 www.gelifesciences.com/bioprocess

---

Accessories for BPG 100, 140, and 200 columns<br />

Accessory Material Qty/Pk BPG 100<br />

Code number<br />

BPG 140<br />

Code number<br />

BPG 200<br />

Code number<br />

Air trap complete 1 316/glass 1 18-1102-96 18-1102-97 18-1102-97<br />

Top valve 1 316/EPDM 1 18-1121-44 18-1121-44 18-1121-44<br />

T-junction i.d. 6 mm 2 316 1 28-4057-65 28-4057-65 28-4057-65<br />

Valve sealing washer 3 PTFE 2 18-1128-69 18-1128-69 18-1128-69<br />

Manometer kit 4 (0-10 bar) 304/316/EPDM 1 18-1031-07 18-1031-07 18-1031-07<br />

Wheel with brake, columns 70-100 28-9979-44 - -<br />

Wheel with brake, columns 140-300 - 28-9270-79 28-9270-79<br />

Adjustable foot - 1 18-1126-93 18-1126-93 18-1126-93<br />

Torque wrench 304 18-0251-37 18-0251-37 18-0251-37<br />

12-point opening socket 304 18-1031-03 18-1031-04 18-1031-04<br />

Allen key 304 18-1030-98 18-1030-98 18-1030-98<br />

Packing device 5,6 glass 1 18-1104-75 18-1113-33 18-1104-77<br />

Grounding kit - 1 18-1157-87 18-1157-87 18-1157-87<br />

Media stirrer (80 mm plate diam.) PP 1 28-9191-03 28-9191-03 28-9191-03<br />

Tubing with sanitary fitting 1 (i.d. 6 mm)<br />

30 cm PVC 1 18-0005-42 18-0005-42 18-0005-42<br />

75 cm PVC 1 18-0005-43 18-0005-43 18-0005-43<br />

125 cm PVC 1 18-0005-44 18-0005-44 18-0005-44<br />

150 cm PVC 1 18-0005-45 18-0005-45 18-0005-45<br />

200 cm PVC 1 18-0005-47 18-0005-47 18-0005-47<br />

Connectors (see p 130–131)<br />

TC-6 mm threaded PP 2 18-0251-98 18-0251-98 18-0251-98<br />

TC-25 mm clamp,<br />

6 mm 1/2 in threaded PP 2 18-1012-67 18-1012-67 18-1012-67<br />

TC-M6 threaded PP 2 28-4057-64 - -<br />

TC-i.d. 22, 51 mm TC PP 2 18-1012-69 18-1012-69 18-1012-69<br />

Clamps, gaskets<br />

Clamp 25 mm 316 5 28-4043-38 28-4043-38 28-4043-38<br />

Clamp 51 mm 304 5 44-7134-01 44-7134-01 44-7134-01<br />

TC-Gasket 25 mm i.d 8 mm EPDM 5 28-9509-48 28-9509-48 28-9509-48<br />

TC-Gasket 25 mm i.d. 6.5 mm FPM/FKM 2 28-9914-43 28-9914-43 28-9914-43<br />

Gasket 51 mm i.d. 22 mm EPDM 5 44-7133-01 44-7133-01 44-7133-01<br />

TC-Gasket 5 mm i.d. 22mm FPM/FKM 2 28-9914-54 28-9914-54 28-9914-54<br />

Blind flange 25 mm incl. gasket 304/EPDM 1 18-1001-25 18-1001-25 18-1001-25<br />

Blind flange 51 mm incl. gasket 304/EPDM 1 44-7135-01 44-7135-01 44-7135-01<br />

Valves<br />

4port, 2way i.d. 6mm 1 316L/PTFE 1 18-5757-01 18-5757-01 18-5757-01<br />

4port, 4way i.d. 6mm 1 316L/PTFE 1 18-5758-01 18-5758-01 18-5758-01<br />

Pressure relief valve i.d. 6mm 1 316/FPM 1 18-1105-36 18-1105-36 18-1105-36<br />

Safety valve 4, 7 316/PTFE 1 18-1035-80 18-1035-81 18-1035-81<br />

5<br />

Chromatography columns<br />

1<br />

25 mm TC<br />

2<br />

2 × 25 mm, 1 × 51 mm TC<br />

3<br />

Fits 6 and 10 mm, 2- and 4-way valves<br />

4<br />

51 mm TC<br />

5<br />

The packing device consists of a 380 mm height glass tube, flanges, rods, O-rings in EPDM, nuts and screws<br />

6<br />

For O-rings as spare parts, see column documentation manuals<br />

7<br />

BPG 100 - 8 bar, BPG 140 and 200 - 6 bar<br />

www.gelifesciences.com/bioprocess 117

---

5<br />

Chromatography columns<br />

Accessories for BPG 300 and 450 columns<br />

Accessory Material Qty/Pk BPG 300<br />

Code number<br />

BPG 450<br />

Code number<br />

Air trap complete 1 304/316/glass/ EPDM 1 18-1102-98 18-1103-00<br />

Top valve 1 316/EPDM 1 18-1121-44 18-1121-44<br />

Torque wrench 304 1 18-0251-37 18-0251-37<br />

12-point opening socket 304 1 18-1031-05 18-1105-31<br />

Allen key 304 1 18-1030-98 18-1030-98<br />

Packing device 2, 3 glass 1 18-1108-16 -<br />

Packing device 4,3 316 1 - 18-1105-32<br />

T-junction i.d. 10 mm 5 316 1 28-4057-75 28-4057-75<br />

Valve sealing washer 6 PTFE 2 18-1128-69 18-1128-69<br />

Manometer kit7 (0–6 bar) 316 L 28-9944-72 28-9944-72<br />

Wheel with brake, columns 140-300 - 1 28-9270-79 -<br />

Wheel with brake BPG 450 - 28-9226-77<br />

Media stirrer (150 mm plate diameter) PP 1 28-9191-04 28-9191-04<br />

Tubing with sanitary fitting 1<br />

length<br />

i.d.<br />

30 cm 10 mm PVC 1 18-1012-85 18-1012-85<br />

40 cm 10 mm PVC 1 18-1012-86 18-1012-86<br />

75 cm 14 mm PVC 1 - 18-1027-28<br />

90 cm 10 mm PVC 1 18-1012-62 18-1012-62<br />

140 cm 10 mm PVC 1 18-1012-63 18-1012-63<br />

170 cm 10 mm PVC 1 18-1012-64 18-1012-64<br />

180 cm 14 mm PVC 1 - 18-1027-29<br />

200 cm 10 mm PVC 1 18-1012-87 18-1012-87<br />

Connectors (see p 130–131)<br />

TC 25 mm clamp-10mm 1/2in Th PP 2 18-1012-68 18-1012-68<br />

TC 25 ID10/TC51 ID14 PP 2 18-1027-25 18-1027-25<br />

Connector TC50 ID14 / TC50 ID22 PP 2 - 18-1027-26<br />

Clamps, gaskets<br />

Clamp 25 mm 304 1 28-4043-38 28-4043-38<br />

Clamp 25 mm 316 12 44-0568-01 44-0568-01<br />

Clamp 51 mm 304 1 44-7134-01 44-7134-01<br />

Gasket 25 mm i.d. 10 mm EPDM 2 18-1035-79 18-1035-79<br />

TC-Gasket 25/10,5mm FPM/FKM 2 28-9914-44 28-9914-44<br />

Gasket 25 mm i.d. 12 mm EPDM 2 - 18-0200-00<br />

Gasket 25 mm i.d. 12 mm FPM/FKM 2 - 28-9914-47<br />

Blind flange 25 mm incl. gasket 304/EPDM 1 18-1001-25 18-1001-25<br />

Gasket 51 mm i.d. 10 mm EPDM 5 18-1012-88 18-1012-88<br />

Gasket 51 mm i.d. 14 mm EPDM 5 - 18-1017-57<br />

Gasket 51 mm i.d. 22 mm EPDM 5 44-7133-01 44-7133-01<br />

Gasket 51 mm i.d. 22 mm FPM/FKM 2 28-9914-54 28-9914-54<br />

Blind flange 51 mm incl. gasket 304/EPDM 1 44-7135-01 44-7135-01<br />

Valves<br />

4port, 2way i.d. 10 mm 1 316L/PTFE 1 18-1012-56 18-1012-56<br />

4port, 4way i.d. 10 mm 1 316L/PTFE 1 18-1012-57 18-1012-57<br />

3port, 2way i.d. 15 mm 1 316L/PTFE 1 - 44-5499-90<br />

Pressure relief valve i.d. 10 mm 1 316/FPM 1 18-1106-97 18-1106-97<br />

Safety valve 7 316/EPDM 1 18-1035-82 18-1103-65<br />

1<br />

25 mm TC<br />

2<br />

The packing device consists of a 380 mm height glass tube, flanges, rods, O-rings in EPDM, nuts and screws<br />

3<br />

For O-rings as spare parts, see Flange O-rings for the respective column in Table 1 on page 3<br />

4<br />

The packing device consists of a 300 mm high stainless steel tube, O-rings, nuts and a clamp<br />

5<br />

2 × 25 mm, 1 × 51 mm TC<br />

6<br />

Fits 6 and 10 mm, 2- and 4-way valves<br />

7<br />

BPG 300-4 bar, BPG 450-2.5 bar<br />

118 www.gelifesciences.com/bioprocess

---

Spare parts for BPG 100, 140, and 200 columns<br />

Description Material In contact with<br />

process liquid?<br />

Qty/pk BPG 100<br />

Code number<br />

BPG 140<br />

Code number<br />

BPG 200<br />

Code number<br />

Column tube 500 Borosilicate glass Yes 1 18-0251-01 18-1112-95 18-1152-01<br />

Column tube 750 Borosilicate glass Yes 1 18-0251-02 28-9319-71 18-1152-02<br />

Column tube 950 Borosilicate glass Yes 1 18-0251-03 18-1112-96 18-1152-03<br />

Rod for tube 500 316 1 18-1105-80 18-1105-83 18-1105-83<br />

Rod for tube 750 316 1 18-1105-81 18-1105-84 18-1105-84<br />

Rod for tube 950 316 1 18-1105-82 18-1105-85 18-1105-85<br />

<strong>Guide</strong> ring PTFE 1 18-0251-22 18-1112-97 18-0252-22<br />

Net, 54 μm, end-piece PP Yes 2 18-1126-97 18-1126-99 18-1127-01<br />

Net, 23 μm, end-piece PP Yes 2 18-9252-01 18-1113-00 18-9254-01<br />

Net, 10 μm, end-piece PA Yes 2 18-0251-77 18-1113-02 18-0252-77<br />

Net, 12 μm, end-piece PEEK Yes 2 18-1148-38 18-1148-40 18-1148-42<br />

Support net, end-piece PP Yes 2 18-0251-55 18-1112-98 18-0252-55<br />

Flange O-ring EPDM Yes 2 18-8494-01 18-1113-06 18-8489-01<br />

Flange O-ring FEP Yes 1 18-0019-41 18-1113-07 18-0019-51<br />

Nut, M6 316 5 19-1582-01 – –<br />

Nut, M8 316 5 – 19-0763-01 19-0763-01<br />

Washer A4 4 18-1143-26 - -<br />

Washer A4 4 - 18-1113-29 18-1113-29<br />

Flange 316 1 18-1134-21 18-1113-21 18-1134-22<br />

End-piece 316L Yes 1 18-1144-18 18-1113-20 18-1112-62<br />

Bolt 316 4 18-1145-08 18-1145-08 18-1145-08<br />

Washer 316 4 18-1143-26 18-1113-29 18-1113-29<br />

Stand, complete 316L 1 18-1031-10 18-1031-20 18-1031-20<br />

Clamp, 25 mm 304 1 18-1001-31 18-1001-31 18-1001-31<br />

Adjusting knob PEEK 1 18-1109-27 18-1109-27 18-1109-27<br />

Domed nut 316 4 18-1143-25 18-1113-27 18-1113-27<br />

Adjuster nut, body 316 1 11-0003-01 18-1113-26 18-1113-26<br />

Bushing ring POM 2 18-0264-01 18-0267-01 18-0267-01<br />

Top plate 316 1 18-1143-24 18-1113-24 28-9325-15<br />

Adjuster nut, insert PEEK 1 18-0251-20 18-0252-20 18-0252-20<br />

Allen screw, M8 × 45 316 5 19-6375-01 19-6375-01 19-6375-01<br />

Allen screw, M4 × 14 316 5 19-6356-01 19-6356-01 19-6356-01<br />

Stopper 316 1 – 18-1113-25 18-1113-25<br />

Adaptor head screw 316 3 18-8457-01 18-8457-01 18-8457-01<br />

Sealing unit 316L 1 18-1147-47 18-1113-31 18-1147-48<br />

Adaptor O-ring EPDM Yes 2 18-8475-01 18-1113-10 18-0275-01<br />

Adaptor O-ring FEP Yes 1 18-0019-40 18-1113-11 18-0019-50<br />

Inner adaptor tube 316 1 18-1113-23 18-1113-23 18-1113-23<br />

Outer adaptor tube 316 1 18-1134-83 18-1134-83 18-1134-83<br />

Screw, M6 × 12 316L/PTFE 3 18-1145-08 18-1145-08 18-1145-08<br />

Spring 316/PTFE 1 18-8491-01 18-8491-01 18-8491-01<br />

Adaptor plate1 S318032 Yes 1 18-1112-80 18-1113-30 18-1112-81<br />

Support net, adaptor PP Yes 2 18-1103-04 18-1112-99 18-0252-56<br />

Net, 54 μm adaptor<br />

Net, 23 μm adaptor<br />

Net, 10 μm adaptor<br />

Net, 12 μm adaptor<br />

PP<br />

PP<br />

PA<br />

PEEK<br />

Yes<br />

Yes<br />

Yes<br />

Yes<br />

2<br />

2<br />

2<br />

2<br />

18-1126-96<br />

18-1103-08<br />

18-1103-05<br />

18-1148-37<br />

18-1126-98<br />

18-1113-01<br />

18-1113-03<br />

18-1148-39<br />

18-1127-00<br />

18-9253-01<br />

18-0252-76<br />

18-1148-41<br />

TC-gasket 25/8 EPDM EPDM Yes 2 28-9509-48 28-9509-48 28-9509-48<br />

Feet, stand 316 1 18-1126-93 18-1126-93 18-1126-93<br />

Wheel with brake,<br />

Columns 70-100 - 1 28-9979-44 - -<br />

Wheel with brake,<br />

Columns 140-300 1 - 28-9270-79 28-9270-79<br />

4-port, 2-way valve 316L/PTFE Yes 1 18-5757-01 18-5757-01 18-5757-01<br />

Tubing - Yes 1 – – –<br />

Washer PP 1 18-1142-79 - -<br />

Washer PP 1 18-1142-80 18-1142-80 18-1142-80<br />

5<br />

Chromatography columns<br />

1<br />

Tube i.d. 4 mm (BPG 100), 6 mm (BPG 140 and 200)<br />

2<br />

Comparable to 316L<br />

www.gelifesciences.com/bioprocess 119

---

5<br />

Chromatography columns<br />

Spare parts for BPG 300 columns<br />

Description Material In contact with<br />

process liquid?<br />

Qty/pk BPG 300<br />

Code number<br />

Adaptor top plate- Flange 300 316 1 28-9282-81<br />

Nut, M12 316 6 18-1012-24<br />

Cup spring washer 1 316 6 18-1012-25<br />

Washer 2 316 6 18-1012-61<br />

Nut, M10 316 5 18-1012-44<br />

Flange 316 - -<br />

O-ring, 301 × 6 mm EPDM Yes 2 18-1012-26<br />

O-ring, 301 × 6 mm FEP Yes 1 18-1012-27<br />

Rod for T300/500 316 1 18-1012-31<br />

Rod for T300/750 316 1 18-1012-32<br />

Rod for T300/950 316 1 18-1012-33<br />

Column tube T300/500 Borosilicate glass Yes 1 18-1012-28<br />

Column tube T300/750 Borosilicate glass Yes 1 18-1012-29<br />

Column tube T300/950 Borosilicate glass Yes 1 18-1012-30<br />

Net, 23 μm, endpiece PP Yes 2 18-1012-34<br />

Net, 10 μm, endpiece PA Yes 2 18-1012-35<br />

Net, 12 μm, endpiece PEEK Yes 2 18-1148-44<br />

Net, 54 μm, endpiece PP Yes 2 18-1127-03<br />

Support net, endpiece PP Yes 2 18-1012-36<br />

Distribution plate PP Yes 2 18-1012-37<br />

Endpiece 316L Yes 1 18-1140-47<br />

Gasket Kit TC25 i.d. 12mm EPDM Yes 10 28-9667-41<br />

TC-Gasket 25/10.5mm FPM/FKM Yes 5 28-9914-44<br />

Connector 25 mm/10 mm 3 PP Yes - –<br />

4-port, 2-way manual valve 316L/PTFE Yes 1 18-1012-56<br />

Stand, complete 316L 1 18-1012-38<br />

Washer 316 6 18-1012-61<br />

Bolt, M12 × 25 316 6 18-1012-65<br />

Wheel with brake, columns 140-300 – 1 28-9270-79<br />

Seal adjuster PEEK 1 18-1012-41<br />

Adaptor height adjuster 316 1 18-1128-31<br />

Bushing ring POM 2 18-1012-42<br />

Adaptor top plate 316L 1 18-1129-06<br />

Nut, M10 316 5 18-1012-44<br />

Stop screw, complete 316/POM 1 18-1012-43<br />

Adjuster nut, insert PEEK 1 18-1012-45<br />

Sealing unit 316L 1 18-1147-49<br />

Adaptor head screw, M8 316 3 18-1012-46<br />

Allen screw, M8 × 60 316 5 18-1012-47<br />

O-ring, 274 × 8 mm EPDM 2 18-1012-51<br />

O-ring, 274 × 8 mm FEP 1 18-1012-52<br />

Inner adaptor tube 316 1 18-1147-83<br />

Outer adaptor tube 316L 1 18-1142-93<br />

Screw, M8 × 16 316L/PTFE 5 18-1145-10<br />

Spring 316/PTFE 1 18-1012-50<br />

Adaptor plate 4 S31803 5 1 18-1112-82<br />

Support net, adaptor PP Yes 2 18-1012-53<br />

Net, 23 μm, adaptor PP 2 18-1012-54<br />

Net, 10 μm, adaptor PA Yes 2 18-1012-55<br />

Net, 12 μm, adaptor PEEK 2 18-1148-43<br />

Net, 54 μm, adaptor PP 2 18-1127-02<br />

Tubing 3 - – –<br />

Clamp, 25 mm 316 5 28-4043-38<br />

1<br />

For columns with adaptor top plate clamp<br />

2<br />

For columns with adaptor plate assembled with screws and nuts<br />

3<br />

See column documentation manuals<br />

4<br />

Tube i.d. 10 mm<br />

5<br />

Comparable to 316L<br />

120 www.gelifesciences.com/bioprocess

---

Spare parts for BPG 450 columns<br />

Description Material In contact with<br />

process liquid?<br />

Qty/pk BPG 450<br />

Code number<br />

Endpiece 316L Yes 1 18-1109-67<br />

Support net, endpiece PP Yes 1 18-1104-35<br />

Flange PP/316 Yes 1 18-1109-68<br />

U-shaped seal EPDM Yes 1 18-1104-40<br />

U-shaped seal FPM/FKM Yes 1 28-9921-87<br />

Net, 54 μm, endpiece PP Yes 1 18-1127-05<br />

Net, 23 μm, endpiece PP Yes 1 18-1103-19<br />

Net, 10 μm, endpiece PA Yes 1 18-1103-18<br />

Net, 12 μm, endpiece PEEK Yes 1 18-1148-46<br />

Flange O-ring 446 × 6 EPDM Yes 2 18-1105-33<br />

Flange O-ring 446 × 6 FEP Yes 1 18-1117-67<br />

Allen screw M8 × 50 316 5 18-1109-40<br />

Rod BPG 450/500 316 1 18-1106-18<br />

Rod BPG 450/750 316 1 18-1103-09<br />

Rod BPG 450/1000 316 1 18-1103-10<br />

Sealing unit 316L 1 18-1109-69<br />

Pin bolt 316 3 18-3001-07<br />

Stop screw 316 2 19-4363-01<br />

Glass tube BPG 450/500 Borosilicate glass Yes 1 18-1103-14<br />

Glass tube 450/750 Borosilicate glass Yes 1 18-1103-15<br />

Glass tube 450/1000 Borosilicate glass Yes 1 18-1103-16<br />

Revolving stop cap POM 1 18-1107-43<br />

Revolving stop 316L 1 18-1109-41<br />

Screw M8 × 50 316 5 18-1109-40<br />

Spacer 316L 1 18-1109-42<br />

Lid 316 1 18-1109-70<br />

Bushing ring PP 2 18-1109-43<br />

Adaptor height adjuster POM 1 18-1109-44<br />

Handle 316 1 18-1109-45<br />

Nut flange PEEK 1 18-1109-46<br />

Seal adjuster PEEK 1 18-1109-47<br />

Handle 316 1 18-1109-48<br />

Knob PP 1 18-1109-49<br />

Screw M10 × 65 316 2 18-1109-50<br />

Washer 10.5 × 20 316 10 18-1109-51<br />

Domed nut M10 and washer 316 1 18-1103-20<br />

Adaptor screw 316L 1 18-1109-54<br />

Adjustment tube 316 1 18-1109-55<br />

Inlet tube i.d. 12 mm 316L Yes 1 18-1109-53<br />

O-ring 12.3 × 2.4 EPDM Yes 2 18-1103-70<br />

O-ring 12.3 × 2.4 FEP Yes 1 18-1117-65<br />

Screw M4 × 16 316 2 18-1109-56<br />

Spring 316/PTFE 1 18-1107-44<br />

Screw M5 × 10 316 2 18-1109-57<br />

Snap plug PP Yes 2 18-1107-45<br />

Adaptor plate S31803 1 Yes 1 18-1109-71<br />

Screw M8 × 25 316L/PTFE 3 18-1145-12<br />

O-ring 419 × 10 EPDM Yes 1 18-1017-47<br />

O-ring 419 × 10 FEP Yes 1 18-1117-66<br />

Distributor plate PP Yes 2 18-1106-04<br />

Adaptor support net PP Yes 1 18-1104-34<br />

Net 54 μm adaptor PP Yes 1 18-1127-04<br />

Net 23 μm adaptor PP Yes 1 18-1001-62<br />

Net 10 μm adaptor PA Yes 1 18-1017-46<br />

Net 12 μm adaptor PEEK Yes 1 18-1148-45<br />

Screw M10 × 80 316 2 18-1109-59<br />

Screw M10 × 16 316 2 18-1109-60<br />

Bracket 316 1 18-1109-61<br />

Screw M5 × 16 316 2 18-1109-62<br />

Bottom inlet tube 316L 1 18-1109-63<br />

Allen screw M10 × 40 316L Yes 1 18-1109-65<br />

Leg 316 2 18-1109-66<br />

Wheel with brake BPG 450 316 1 28-9226-77<br />

Eye bolt 1 18-1109-64<br />

Adaptor stopper 1 18-1115-18<br />

5<br />

Chromatography columns<br />

1<br />

Comparable to 316L<br />

www.gelifesciences.com/bioprocess 121

---

INdEX columns<br />

INdEX are easy-to-use, general<br />

purpose, glass columns well-suited<br />

for applications such as process<br />

development and diagnostics<br />

production. These columns are<br />

characterized by their simple design<br />

and the novel, axial compression<br />

packing method that yields a densely<br />

packed bed in under 10 minutes.<br />

5<br />

Chromatography columns<br />

INdEX range<br />

• Scalable from inner diameters of<br />

70 to 200 mm and bed volumes<br />

from 0.1 to 25 L<br />

• Pressure rating 3 bar<br />

• For use with an array of techniques<br />

and media, especially Sepharose<br />

Fast Flow<br />

• Proven distribution system<br />

Overview of INdEX columns<br />

Tube<br />

inner<br />

diam<br />

Tube<br />

height<br />

• Dynamic axial compression yields<br />

densely packed, high efficiency<br />

beds<br />

• Materials include electropolished<br />

stainless steel, borosilicate glass<br />

and polymers<br />

• Packing devices for longer bed<br />

heights<br />

Crosssectional<br />

area Bed height (cm) Bed volume (l)<br />

Max<br />

pressure<br />

Column (mm) (cm) (cm 2 ) min max 1,2 min max 1,2 (bar) 3<br />

INdEX 70/500 70 50 38 3 32 (41) 0.1 1.2 (1.6) 3<br />

INdEX 70/950 70 95 38 48 61 (79) 1.8 2.3 (3.0) 3<br />

INdEX 100/500 100 50 79 3 32 (41) 0.2 2.5 (3.2) 3<br />

INdEX 100/950 100 95 79 48 61 (79) 3.8 4.8 (6.2) 3<br />

INdEX 140/500 140 50 154 3 32 (41) 0.5 4.9 (6.3) 3<br />

INdEX 140/950 140 95 154 48 61 (79) 7.4 9.4 (12.2) 3<br />

INdEX 200/500 200 50 314 3 32 (41) 0.9 10.0 (12.9) 3<br />

INdEX 200/950 200 95 314 48 61 (79) 15.1 19.2 (24.8) 3<br />

1<br />

Maximum bed volumes and bed heights are based on a slurry concentration of 75% and<br />

a packing compression of 15%.<br />

2<br />

The figures within brackets are achievable using a packing device.<br />

3<br />

Use a manometer to monitor the pressure.<br />

122 www.gelifesciences.com/bioprocess

---

What do I need?<br />

Stands and wheels<br />

INdEX 70 and 100 stands have<br />

adjustable feet. Castors with brakes<br />

are available. INdEX 140 and 200<br />

stands have castors with brakes as<br />

standard.<br />

Useful spare parts<br />

Nets: The column is delivered with<br />

23 µm (polypropylene) nets. For media<br />

with an average particle diameter<br />

< 70 µm, change to 10 µm (polyamide)<br />

in both adaptors and end-pieces.<br />

Seals: Inspect the seals on a regular<br />

basis for signs of wear.<br />

Spare parts to keep on site<br />

All nets, support screens and O-rings.<br />

In some cases, a spare tube may be<br />

advisable.<br />

Longer bed heights<br />

Packing extensions are available<br />

for all diameters. For packing INdEX<br />

columns with the packing device for<br />

BPG columns, an extra lid kit has to be<br />

ordered.<br />

Isolating the column after<br />

packing<br />

We recommend using 25 mm blind<br />

flanges with clamp and gasket to<br />

prevent contamination of the packed<br />

bed.<br />

Connecting the column to<br />

your system<br />

A clamp and gasket, 6 mm i.d., is<br />

required to connect the 25 mm<br />

sanitary flanged inlet/outlet to either<br />

valves or tubing of the same type.<br />

Preflanged tubing in 6 mm i.d. is also<br />

available.<br />

Assembly/disassembly of<br />

column<br />

No tools are required as all fittings are<br />

finger-tight.<br />

Useful column accessories<br />

Air Traps: INdEX Air Trap Complete<br />

includes the air trap, mounting<br />

bracket, steel valves, clamps, gaskets<br />

and tubings, 25 mm TC.<br />

Top valve: Manually operated valve<br />

recommended at the top of the airtrap<br />

as an air outlet control.<br />

Manometers: Manometer kits<br />

contain a pressure gauge, T-junction,<br />

necessary clamps and gaskets for<br />

sanitary connections.<br />

Pressure relief valve: Required for<br />

the hydraulic packing procedure. It<br />

is connected between the pump and<br />

hydraulic inlet to ensure flow delivery<br />

at a constant pressure throughout the<br />

packing procedure.<br />

Safety valve: Precalibrated valve that<br />

releases pressure if the calibrated<br />

value is exceeded. Recommended<br />

if the column may exceed its<br />

maximum pressure limit and no other<br />

pressure sensor is included in the<br />

chromatographic system. T-junction,<br />

clamps and gaskets have to be<br />

ordered separately.<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 123

---

Packing extension.<br />

Ordering information<br />

Column<br />

Code number<br />

INdEX 70/500 18-1115-06<br />

INdEX 70/950 18-1115-07<br />

INdEX 100/500 18-1104-15<br />

INdEX 100/950 18-1104-16<br />

INdEX 140/500 18-1115-08<br />

INdEX 140/950 18-1115-09<br />

INdEX 200/500 18-1104-17<br />

INdEX 200/950 18-1104-18<br />

Stand<br />

INdEX 70 stand 18-1103-60<br />

INdEX 100 stand 18-1103-60<br />

INdEX 140 stand 18-1103-61<br />

INdEX 200 stand 18-1103-61<br />

Stands must be ordered separately<br />

Air trap, top valve,<br />

pressure gauge and<br />

safety valve.<br />

5<br />

Chromatography columns<br />

Accessories for INdEX columns<br />

Accessory INdEX 70 INdEX 100 INdEX 140 INdEX 200 Qty/pack Material<br />

Air Trap Complete 3 18-1102-96 18-1102-96 18-1102-97 18-1102-97 1 SS 316/Glass<br />

Top valve 3 18-1121-44 18-1121-44 18-1121-44 18-1121-44 1 SS 316/EPDM<br />

Valves<br />

4-port, 2-way 3 18-5757-01 18-5757-01 18-5757-01 18-5757-01 1 SS 316L/PTFE<br />

4-port, 4-way 3 18-5758-01 18-5758-01 18-5758-01 18-5758-01 1 SS 316L/PTFE<br />

Valve sealing, washer 6 18-1128-69 18-1128-69 18-1128-69 18-1128-69 2 PTFE<br />

T-junction 5 18-1104-29 18-1104-29 18-1104-29 18-1104-29 1 SS 316<br />

Safety valve 4 18-5738-01 18-5738-01 18-5738-01 18-5738-01 1 SS 316/EPDM<br />

Pressure relief valve 3 18-1105-36 18-1105-36 18-1105-36 18-1105-36 1 SS 316/FPM<br />

Manometer 4 18-1119-29 18-1119-29 18-1119-29 18-1119-29 1 SS 316<br />

Manometer kit 4 18-1119-28 18-1119-28 18-1119-28 18-1119-28 1 –<br />

Castor 18-1001-09 18-1001-09 18-1001-09 18-1001-09 1 –<br />

Adjustable foot 18-1126-93 18-1126-93 18-1126-93 18-1126-93 1 –<br />

Tubing with sanitary fitting<br />

i.d. 6 mm 3<br />

30 cm 18-0005-42 18-0005-42 18-0005-42 18-0005-42 1 PVC<br />

75 cm 18-0005-43 18-0005-43 18-0005-43 18-0005-43 1 PVC<br />

125 cm 18-0005-44 18-0005-44 18-0005-44 18-0005-44 1 PVC<br />

150 cm 18-0005-45 18-0005-45 18-0005-45 18-0005-45 1 PVC<br />

200 cm 18-0005-47 18-0005-47 18-0005-47 18-0005-47 1 PVC<br />

Connectors (see p 130–131)<br />

i.d. 6 mm. 25 mm TC<br />

6 mm threaded 18-0251-98 18-0251-98 18-0251-98 18-0251-98 2 PP<br />

UNF threaded 18-1012-67 18-1012-67 18-1012-67 18-1012-67 2 PP<br />

25 mm TC-M6 threaded 18-1031-09 18-1031-09 – – 2 PP<br />

25 mm TC-i.d. 22 mm,<br />

51 mm TC 18-1012-69 18-1012-69 18-1012-69 18-1012-69 2 PP<br />

Clamp 25 mm 18-1001-31 18-1001-31 18-1001-31 18-1001-31 1 SS 304<br />

Clamp 51 mm 44-7134-01 44-7134-01 44-7134-01 44-7134-01 1 SS 304<br />

Gasket 25 mm 18-0019-27 18-0019-27 18-0019-27 18-0019-27 2 EPDM<br />

Gasket 51 mm 18-1012-88 18-1012-88 18-1012-88 18-1012-88 5 EPDM<br />

Blind flange, 25 mm incl. gasket 18-1001-25 18-1001-25 18-1001-25 18-1001-25 1 SS 304/EPDM<br />

Blind flange 51 mm incl. gasket 44-7135-01 44-7135-01 44-7135-01 44-7135-01 1 SS 304/EPDM<br />

Packing device with PP lid 1 18-1114-35 18-1104-22 18-1114-36 18-1104-23 1 Glass<br />

Lid kit 2 for packing device 18-1108-63 18-1114-37 18-1108-64 1 –<br />

1<br />

The packing device consists of PP lid, a 380 mm glass tube, flanged, rods, O-rings in EPDM, bed support, adaptor bed support,<br />

screws and nuts.<br />

2<br />

The lid kit consists of PP lid, O-rings in EPDM, bed support, adaptor bed support, screws and nuts. The lid kit can be used together<br />

with the packing devices for BPG 100, 140 and 200 columns on INdEX columns of the same size.<br />

3<br />

25 mm TC.<br />

4<br />

51 mm TC.<br />

5<br />

2 × 25 mm, 1 × 51 mm TC.<br />

6<br />

Fits 2-way and 4-way valves.<br />

124 www.gelifesciences.com/bioprocess

---

Spare parts for INdEX columns<br />

INdEX 70 INdEX 100 INdEX 140 INdEX 200<br />

Code number<br />

Qty/pack Material<br />

Column tube 500 18-1114-14 18-1104-49 18-1114-12 18-1104-51 1 Borosilicate glass<br />

Column tube 950 18-1114-15 18-1104-50 18-1114-13 18-1104-52 1 Borosilicate glass<br />

Bed support, adaptor 18-1114-24 18-0251-56 18-1112-99 18-0252-56 2 PP<br />

Bed support 23 µm,<br />

adaptor 18-1114-26 18-9251-01 18-1113-01 18-9253-01 2 PP<br />

Bed support 10 µm,<br />

adaptor 18-1114-28 18-0251-76 18-1113-03 18-0252-76 2 PA<br />

Bed support, end-piece 18-1114-25 18-0251-55 18-1112-98 18-0252-55 2 PP<br />

Bed support 23 µm,<br />

end-piece 18-1114-27 18-9252-01 18-1113-00 18-9254-01 2 PP<br />

Bed support 10 µm,<br />

end-piece 18-1114-29 18-0251-77 18-1113-02 18-0252-77 2 PA<br />

Material abbreviations: EPDM=ethylene propylene diene, FPM=fluorocarbon rubber, PA=polyamide,<br />

PP=polypropylene, PTFE=polytetrafluoroethene, PVC=polyvinyl chloride, SS=stainless steel.<br />

Literature<br />

Data file<br />

Code number<br />

INdEX Columns 70-200 series 18-1115-61<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 125

---

FineLINE columns<br />

The FineLINE range of columns has been developed for<br />

use with all SOURCE media. The novel, hydraulic packing<br />

method packs SOURCE in a matter of minutes, giving<br />

densely packed beds and very high packing efficiencies:<br />

more than 22 000 plates/m with SOURCE 15 and more than<br />

11 000 plates/m with SOURCE 30.<br />

FineLINE Pilot 35 is well-suited for both downscaling from<br />

the larger FineLINE columns and upscaling from laboratory<br />

RESOURCE and ÄKTAdesign columns. This 35‐mm inner<br />

diameter column has a tube manufactured from calibrated<br />

borosilicate glass. FineLINE Pilot 35 can also be run on<br />

ÄKTAexplorer.<br />

5<br />

Chromatography columns<br />

The larger FineLINE 70, 100P, 200P and 350P columns are<br />

intended for scale-up work and small-scale production.<br />

Column tubes are manufactured in electropolished<br />

stainless steel and are available in two tube lengths:<br />

350 and 700 mm.<br />

FineLINE range<br />

• Standard inner diameters of 35, 70, 100, 200 mm<br />

and 350P<br />

• Optimized for use with all SOURCE media<br />

• Proven single inlet/outlet distribution with special<br />

multilayer bed supports for uniform flow at low<br />

back pressures<br />

• Very easy and fast to pack<br />

• Materials include electropolished stainless steel,<br />

calibrated borosilicate glass and EPDM<br />

• All polymeric materials are approved according to<br />

USP Class VI tests for toxicity<br />

• Documentation to support validation delivered with the<br />

product<br />

Overview of FineLINE columns<br />

Tube Cross Bed Bed Bed Bed<br />

inner Tube sectional height height vol vol Design<br />

diam height area min max min max pressure<br />

Column (mm) (mm) (cm 2 ) (mm) (mm) (mL) (mL) (bar)<br />

FineLINE Pilot 35 35 330 10 30 150 29 144 20<br />

FineLINE 70 70 350 38 30 150 115 577 20<br />

FineLINE 70L 70 700 38 50 300 192 1155 20<br />

FineLINE 100P 100 350 79 30 150 236 1178 20<br />

FineLINE 100LP 100 700 79 50 300 393 2355 20<br />

FineLINE 200P 200 350 314 30 150 942 4710 20<br />

FineLINE 200LP 200 700 314 50 300 1570 9420 20<br />

FineLINE 350P 350 350 962 30 150 2884 14424 20<br />

FineLINE 350LP 350 700 962 50 300 4808 28848 20<br />

126 www.gelifesciences.com/bioprocess

---

What do I need?<br />

The stand for FineLINE 70/70L and<br />

FineLine 100P/100LP has adjustable<br />

feet. Wheels with brakes are available<br />

as an accessory.<br />

The stand for FineLINE 200P/200LP<br />

has wheels with brakes as standard.<br />

Note: For FineLINE 70, 100, and 200<br />

columns, the stand must be ordered<br />

as an optional component.<br />

Useful spare parts<br />

Bed supports<br />

Columns are delivered with 2‐µm nets;<br />

10‐µm nets are also available.<br />

Seals<br />

Order solvent-resistant seals (O-ring<br />

kit PFR) if the EPDM O-rings supplied<br />

with the columns are not compatible<br />

with the solvent to be used.<br />

Spare parts to keep on site<br />

A complete set of O-rings.<br />

FineLINE Pilot 35<br />

Complete set of O-rings, flanging<br />

start-up, extra tubing and connectors.<br />

Isolating the column after<br />

packing<br />

We recommend using stainless steel<br />

valves 2- or 4-way with i.d. 6 mm to<br />

close off the top and bottom of the<br />

column and prevent contamination<br />

of the bed. For storage purposes, the<br />

25 mm blind flanges with clamps and<br />

gaskets can be used to seal off the<br />

column.<br />

For FineLINE Pilot 35, an extra SRV-1<br />

valve is inserted to close of the bottom<br />

of the column. The stop plug for the<br />

upper column inlet is supplied with the<br />

column.<br />

Connecting the column to<br />

your system<br />

Clamps and gaskets with i.d. 6 mm<br />

are required to connect the 25 mm<br />

sanitary flanged inlet/outlet to either<br />

valves or tubing of the same type.<br />

Preflanged tubing with i.d. 6 mm is<br />

available from <strong>GE</strong> <strong>Healthcare</strong>.<br />

FineLINE Pilot 35 is delivered with<br />

flanged 1.2 mm i.d. propylene tubing<br />

and M6 connectors. A separate tubing<br />

kit is needed to connect the column to<br />

ÄKTAdesign systems.<br />

Assembly/disassembly of<br />

column<br />

Standard wrenches are recommended<br />

in a non-explosive environment.<br />

In potentially explosive atmospheres,<br />

only tools and protective equipment<br />

specially adapted to that environment<br />

should be used for operation and<br />

maintenance.<br />

Note: Standard wrenches are not<br />

supplied with the column, except for<br />

FineLINE Pilot 35.<br />

Useful column accessories<br />

Pressure gauge<br />

We recommend fitting a pressure<br />

gauge capable of measuring a<br />

negative pressure of –1 bar at the<br />

top mobile phase connection to<br />

indicate the pressure in the column.<br />

This monitors the operating pressure<br />

and ensures that the correct axial<br />

compression packing pressure is set<br />

when packing the column.<br />

Pressure relief valve<br />

Required for the packing procedure.<br />

It is connected between the pump<br />

and the hydraulic inlet to ensure<br />

flow delivery at constant pressure.<br />

A suitable pressure relief valve<br />

designated RL4 is available.<br />

Note: The valve is not supplied with<br />

the column and should therefore be<br />

ordered separately.<br />

As the pressure relief valve is just<br />

required when packing the column,<br />

only one valve will generally be<br />

needed irrespective of the number of<br />

columns in use.<br />

(A manometer is seldom needed for<br />

FineLINE Pilot 35 since the pressurerelief<br />

valve is preset to 10 bar).<br />

Ordering information<br />

Column<br />

Code number<br />

FineLINE Pilot 35 18-1102-02<br />

Pressure Relief Valve 18-1110-90<br />

FineLINE 70 18-1152-98<br />

FineLINE 70L 18-1152-99<br />

FineLINE 100P 11-0027-98<br />

FineLINE 100LP 11-0027-99<br />

Stand 100 18-1031-10<br />

FineLINE 200P 11-0031-14<br />

FineLINE 200LP 11-0031-15<br />

Stand 200 18-1031-20<br />

Pressure Relief Valve 18-1105-36<br />

FineLINE 350P EPDM 2 µm 11-0027-90<br />

FineLINE 350P EPDM 10 µm 11-0027-91<br />

FineLINE 350P PFR 2 µm 11-0027-92<br />

FineLINE 350P PFR 10 µm 11-0027-93<br />

FineLINE 350P PFR 2 µm Oligo 11-0027-94<br />

FineLINE 350P PFR 10 µm Oligo 11-0027-95<br />

FineLINE 350LP EPDM 2 µm 11-0027-84<br />

FineLINE 350LP EPDM 10 µm 11-0027-85<br />

FineLINE 350LP PFR 2 µm 11-0027-86<br />

FineLINE 350LP PFR 10 µm 11-0027-87<br />

FineLINE 350LP PFR 2 µm Oligo 11-0027-88<br />

FineLINE 350LP PFR 10 µm Oligo 11-0027-89<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 127

---

Accessories for FineLINE Pilot 35 column<br />

Designation Material Qty/pack Code number<br />

Tubing Kit for ÄKTAexplorer - 1 18-1121-65<br />

Tubing Connector, SRTC2 PEEK 5 19-2143-01<br />

Tubing Connector PP 5 19-7476-01<br />

Tubing D-flanged i.d. 1.2 mm, 420 mm ETFE/PEEK/PP 1 18-1102-20<br />

Tubing D-flanged i.d. 1.2 mm, 750 mm ETFE/PEEK/PP 1 18-4546-01<br />

Tubing i.d 1.2 mm, 2000 mm ETFE 1 19-4370-01<br />

Stop Plug - 1 18-1102-21<br />

Domed Nut M6 PP 4 18-2450-01<br />

Flanging/Start up Kit 120 V - 1 18-4603-70<br />

Flanging/Start up Kit 220 V - 1 18-4603-71<br />

Flanging Tip Kit i.d. 1.2 mm - 1 18-4597-01<br />

Pressure Relief Valve SS 316/ETFE/ PEEK/PP 1 18-1110-90<br />

Spare parts for FineLINE Pilot 35 column<br />

Designation Material Qty/pack Code number<br />

Glass tube Borosilicate glass 1 18-1102-16<br />

Adaptor bed support 2 µm PP/SS 316L 1 18-1102-10<br />

Bottom bed support 2 µm PP/SS 316L 1 18-1102-11<br />

*Sealing Kit comprising: EPDM 1 18-1102-12<br />

O-ring 39.2 × 1.6 1<br />

O-ring 28.25 × 2.62 4<br />

O-ring 12.3 × 2.4 1<br />

O-ring 19.2 × 3 1<br />

O-ring 3.6 × 1.6 2<br />

* includes all O-rings for FineLINE Pilot 35 column.<br />

On/Off Valve i.d. 1.5 SRV-1 FP 1 19-2145-01<br />

Valve SRV-3 FP 1 18-1110-95<br />

Mechanical locking - 1 28-9172-95<br />

O-rings 28.3 × 2.6 mm* PFR 1 18-1102-15<br />

*Adaptor filter rings in PFR.<br />

5<br />

Chromatography columns<br />

Accessories for FineLINE 70/70L, 100P/100LP, 200P/200LP, and 350P/350LP columns<br />

Description For columns Material Qty per pack Code number Note<br />

O-ring Kit PFR 70 1 PFR 4 18-1155-43<br />

1<br />

Includes:<br />

100 2 PFR 4 18-1105-45<br />

200 3 PFR 4 18-1106-23<br />

350 4 PFR 1 18-1136-98<br />

Grounding kit All - 1 18-1157-87<br />

Wheel set (4 pcs included) 70/100 - 1 28-9979-44<br />

200 28-9270-79<br />

350 - 1 18-1156-46<br />

Valves - 25 mm TC<br />

4-port, 2-way, i.d. 6 mm 70/100/200 316L/PTFE 1 18-5757-01<br />

4-port, 4-way, i.d. 6 mm 70/100/200 316L/PTFE 1 18-5758-01<br />

4-port, 2-way, i.d. 10 mm 350 316L/PTFE 1 18-1012-56<br />

4-port, 4-way, i.d. 10 mm 350 316L/PTFE 1 18-1012-57<br />

Sealings washer 5 Salvi valves All PTFE 2 18-1128-69<br />

Ball valve, 12 mm All 316L/PTFE 1 18-1105-37<br />

Pressure relief valve 70/100/200 (RL3, i.d. 6 mm) 316L/PTFE 1 18-1105-36<br />

350 (RL4, i.d. 10 mm) 316L/PTFE 1 18-1106-97<br />

Gasket kit, pressure relief valve 70/100/200 (RL3) 316L/Viton 1 18-1105-52<br />

350 (RL4) 316L/Viton 1 18-1158-26<br />

Safety valve All 316 1 18-1156-37<br />

Tubing with sanitary fitting, i.d. 6 mm, 25 mm TC<br />

0.30 m 70/100/200 PVC 1 18-0005-42<br />

0.75 m 70/100/200 PVC 1 18-0005-43<br />

1.25 m 70/100/200 PVC 1 18-0005-44<br />

1.50 m 70/100/200 PVC 1 18-0005-45<br />

2.00 m 70/100/200 PVC 1 18-0005-47<br />

Tubing with sanitary fitting, i.d. 10 mm, 25 mm TC<br />

0.3 m All PVC 1 18-1012-85<br />

0.9 m All PVC 1 18-1012-62<br />

1,0 m All PVC 1 18-1156-38<br />

1.4 m All PVC 1 18-1012-63<br />

1.7 m All PVC 1 18-1012-64<br />

2.0 m All PVC 1 18-1156-39<br />

3.0 m All PVC 1 18-1156-40<br />

Connectors<br />

TC gasket 25/6 mm 70/100/200 PFR 5 44-5513-44<br />

70/100/200 EPDM 2 18-0019-27<br />

TC gasket 25/8 mm 70/100/200 PFR 5 44-5501-19<br />

70/100/200 EPDM 10 18-1163-94<br />

TC gasket 25/12 mm All PFR 5 44-5501-20<br />

All EPDM 2 18-0200-00<br />

TC gasket 50/22 mm All PFR 5 44-7133-01<br />

All EPDM 1 44-5511-02<br />

Clamp 25 mm All 304 1 18-1001-31<br />

All 12 44-0568-01<br />

Clamp 51 mm All PFR 1 44-7134-01<br />

Blind flange 25 mm including gasket All 304/EPDM 1 18-1001-25<br />

O-ring, 74.6 × 3.53, PFR, 18-1153-63<br />

O-ring, 5.3 × 2.4, PFR, 18-1105-51<br />

O-ring, 61.2 × 3.53, PFR, 18-1153-65<br />

2<br />

Includes:<br />

O-ring, 104.37 × 3.53, PFR, 18-1105-50<br />

O-ring, 5.3 × 2.4, PFR, 18-1105-51<br />

O-ring, 91.67 × 3.53, PFR, 18-1105-49<br />

3<br />

Includes:<br />

O-ring, 202.79 × 3.53, PFR, 18-1106-30<br />

O-ring, 7.3 × 2.4, PFR, 18-1106-31<br />

O-ring, 187.3 × 6.99, PFR, 18-1106-29<br />

4<br />

Includes:<br />

Two O-rings 350 × 5<br />

Two O-rings 15.2 × 3.5<br />

One O-ring 329.5 × 6.99<br />

One O-ring 85.32 × 3.53<br />

5<br />

Fits 18-5757-01, 18-5758-01,<br />

18-1012-56 and 18-1012-57<br />

128 www.gelifesciences.com/bioprocess

---

Spare parts for FineLINE columns<br />

Description 70/70L 100P/100LP 200P/200LP 350P/350LP Quantity Material<br />

Bed support, adaptor complete, 2 mm 18-1153-61 11-0034-04 11-0034-06 11-0034-08 1 SS 316 L<br />

Bed support, adaptor complete, 10 mm 18-1153-67 11-0034-72 11-0034-74 11-0034-10 1 SS 316 L<br />

Bed support, end piece complete, 2 mm 18-1153-62 11-0034-05 11-0034-07 11-0034-09 1 SS 316 L<br />

Bed support, end piece complete 10 mm 18-1153-68 11-0034-73 11-0034-75 11-0034-11 1 SS 316 L<br />

O-ring 104.37 × 3.53 18-1103-89 3 EPDM<br />

O-ring 104.37 × 3.53 18-1105-50 1 PTFE<br />

O-ring 202.79 × 3.53 18-8489-01 2 EPDM<br />

O-ring 202.79 × 3.53 18-1106-30 1 PFR<br />

O-ring 5.3 × 2.4 18-1103-92 5 EPDM<br />

O-ring 5.3 × 2.4 18-1105-51 2 PFR<br />

O-ring 7.3 × 2.4 18-1103-90 5 EPDM<br />

O-ring 7.3 × 2.4 18-1106-31 2 PFR<br />

O-ring 64.5 × 3 18-1105-48 18-1105-48 1 EPDM<br />

O-ring 91.67 × 3.53 18-1103-91 2 EPDM<br />

O-ring 91.67 × 3.53 18-1105-49 1 PFR<br />

O-ring 187.3 × 6.99 18-1106-26 1 EPDM<br />

O-ring 187.3 × 6.99 18-1106-29 1 PFR<br />

Piston seal 18-1039-56* 18-1106-28* 1 EPDM<br />

Piston seal 18-1149-99* 2 EPDM<br />

O-ring 350 × 5 18-1153-72 1 EPDM<br />

O-ring 350 × 5 18-1153-76 1 PFR<br />

O-ring 15.2 × 3.5 18-1153-74 2 EPDM<br />

O-ring 15.2 × 3.5 18-1153-78 2 PFR<br />

O-ring 55.35 × 3.53 18-1153-73 1 EPDM<br />

O-ring 55.35 × 3.53 18-1153-77 1 PFR<br />

O-ring 329.5 × 6.99 18-1153-75 1 EPDM<br />

O-ring 329.5 × 6.99 18-1153-79 1 PFR<br />

Piston seal 18-1149-99 2 EPDM<br />

Material abbreviations: EPDM=ethylene propylene diene, ETFE=ethylene tetrafluoroethylene, FP=fluoroplastic,<br />

PEEK=polyetheretherketone, PFR=perfluor rubber, PP=polypropylene, PTFE=polytetrafluoroethene, PVC=polyvinyl chloride,<br />

SS=stainless steel<br />

* When ordering piston seals for pre-2007 FineLINE columns, please contact your <strong>GE</strong> <strong>Healthcare</strong> sales representative for the correct<br />

code number.<br />

5<br />

Chromatography columns<br />

Literature<br />

Data file<br />

Code number<br />

FineLINE Pilot 35 Column 18-1104-95<br />

FineLINE 70/70L, 100/100L, 200/200L 18-1130-00<br />

Application note<br />

Scaling up high performance chromatography<br />

on SOURCE media and FineLINE columns 18-1117-49<br />

Documentation to support validation available on request. Contact your<br />

local <strong>GE</strong> <strong>Healthcare</strong> office.<br />

www.gelifesciences.com/bioprocess 129

---

A guide to plastic connectors for process-scale columns<br />

Connector i.d. 25 mm, 50 mm TC- i.d. 36 mm,<br />

50 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-58<br />

Connector i.d. 6 mm, 25 mm TC- i.d. 14 mm,<br />

25 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-56<br />

25 6<br />

14 25<br />

50 25<br />

36 50<br />

Connector i.d. 6 mm, 25 mm TC- i.d. 10 mm,<br />

25 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-55<br />

Connector i.d. 14 mm, 25 mm TC- i.d. 22 mm,<br />

50 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-62<br />

25 6<br />

10 25<br />

5<br />

25 14<br />

22 50<br />

Connector M6 - i.d. 6 mm, 25 mm TC,<br />

PEEK, USP Class VI,<br />

Code no 28-4057-64<br />

M6<br />

6<br />

25<br />

Chromatography columns<br />

Connector i.d. 10 mm, 25 mm TC- i.d. 22 mm,<br />

50 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-59<br />

25 10<br />

22 50<br />

Connector i.d. 6 mm, 25 mm TC- i.d. 22 mm,<br />

50 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-61<br />

Connector 3/4”-20 UNF - i.d. 10 mm,<br />

25 mm TC, PP,<br />

Code no 18-1012-68<br />

25 10 3/4”20 UNF<br />

14<br />

Connector 3/4”-20 UNF - i.d. 6 mm,<br />

25 mm TC, PP,<br />

Code no 18-1012-67<br />

25 6 3/4”20 UNF<br />

14<br />

25 6<br />

22 50<br />

Connector i.d. 6 mm, Jaco- i.d. 6 mm,<br />

M6 , PP, Code no 18-4603-89.<br />

Connector i.d. 10 mm, 25 mm TC- i.d. 14 mm,<br />

25 mm TC, PEEK, USP Class VI,<br />

Code no 28-4057-57<br />

6 6<br />

20<br />

25 10 14 25<br />

Connector i.d. 6 mm-i.d. 6,<br />

25 mm TC, PP,<br />

Code no 18-0251-98<br />

1 inch = 25 mm UNF = Standard for finer pitch which<br />

fits a lot of female connectors<br />

6 6 25<br />

130 www.gelifesciences.com/bioprocess

---

Connector i.d. 2.7 mm – M6<br />

Code number 18-4652-01<br />

Connector i.d. 3 mm – M6 – Jaco 6 mm<br />

Code number 18-4603-89<br />

M6<br />

2.7<br />

6 m6 6<br />

20<br />

Connector i.d. 1.8 mm – M6<br />

Code number 19-7476-01<br />

Connector SRTC-3 M6-M6<br />

Code number 19-2144-01<br />

M6<br />

1.8<br />

M6<br />

5<br />

Connector i.d. 3.8 mm – M6<br />

Code number 18-1124-16<br />

M6 3.2<br />

Connector SRTC-2 M6-M6<br />

Code number 19-2143-01<br />

M6<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 131

---

HiScale columns<br />

5<br />

Chromatography columns<br />

HiScale is a family of pressurestable,<br />

empty columns based on the<br />

well-established XK column line and<br />

designed for process development<br />

and preparative chromatography.<br />

The user-friendly design allows for an<br />

optimized process, through simplified<br />

and reproducible operation. The range<br />

of functional advantages makes<br />

HiScale columns well-suited for work<br />

that requires ease-of-use, robustness,<br />

and process control.<br />

Features and benefits of HiScale<br />

columns include:<br />

• Pressure stability up to 20 bar,<br />

providing compatibility with modern<br />

<strong>BioProcess</strong> media<br />

• Axial compression of the gel bed<br />

and a plunger mechanism enabling<br />

a wide range of packing protocols<br />

• Column measurement scale and<br />

ergonomical design of the end cap,<br />

enabling precise packing<br />

• Adapter QuickLock mechanism,<br />

facilitating column handling and<br />

cleaning<br />

• Dual adapters, offering high<br />

flexibility and dynamic protocols<br />

• Compatibility with all methods<br />

currently used with <strong>GE</strong> <strong>Healthcare</strong>’s<br />

XK columns<br />

HiScale columns are available in<br />

a number of sizes. Columns are<br />

comprised of an inner glass tube and<br />

an outer protective polycarbonate<br />

tube. The default filter size is 20 μm,<br />

but other sizes are available.<br />

Visit us on the web at<br />

www.gelifesciences.com/hiscale<br />

132 www.gelifesciences.com/bioprocess

---

HiScale column sizes<br />

Column<br />

Max bed height<br />

(cm)<br />

Max volume<br />

(ml)<br />

HiScale 16/20 20 40<br />

HiScale 16/40 40 80<br />

HiScale 26/20 20 106<br />

HiScale 26/40 40 212<br />

HiScale 50/20 20 393<br />

HiScale 50/40 40 785<br />

Ordering information<br />

Column* Quantity Code number<br />

HiScale 16/20 1 28-9644-41<br />

HiScale 16/40 1 28-9644-24<br />

HiScale 26/20 1 28-9645-14<br />

HiScale 26/40 1 28-9645-13<br />

HiScale 50/20 1 28-9644-45<br />

HiScale 50/40 1 28-9644-44<br />

* Each HiScale column is delivered with two adapters<br />

Adustment of the end cap on<br />

HiScale columns enables controlled<br />

axial compression of the gel bed.<br />

Accessories<br />

Item<br />

HiScale 16<br />

Code number<br />

HiScale 26<br />

Code number<br />

HiScale 50<br />

Code number<br />

No. per pack<br />

Spanner wrench 28-9647-76 28-9647-77 28-9647-78 2<br />

Long column holder 18-1126-32 18-1126-32 1<br />

Short column holder 18-1113-17 18-1113-17 1<br />

Column holder ÄKTA avant 28-9562-82 28-9562-82 1<br />

Column clamp ÄKTA avant 28-9563-19 28-9563-19 1<br />

Column holder, steel 28-9644-99 1<br />

Superloop, 1/16 in fittings 10 mL 18-1113-81 18-1113-81 18-1113-81 1<br />

Superloop, 1/16 in fittings 50 mL 18-1113-82 18-1113-82 18-1113-82 1<br />

Superloop, M6 fittings 150 mL 18-1023-85 18-1023-85 18-1023-85 1<br />

Union 5/16 in female - 1/16 in male 18-1142-08 8<br />

Fingertight union 1/16 in male/M6 female 18-1112-58 18-1112-58 18-1112-58 8<br />

Connector 1/16 in male/Luer female 18-1112-51 18-1112-51 2<br />

Net ring 10 μm 18-8761-01 18-8760-01 18-8759-01 5<br />

Net ring 80 μm 18-1000-69 5<br />

Tubing 1 mm i.d. 18-1115-83 18-1115-83 2 m<br />

Tubing 2 mm i.d. 28-9663-76 1 m<br />

Tubing cutter 18-1112-46 18-1112-46 1<br />

Packing connector 28-9645-03 1<br />

O-ring, packing connector 28-9666-53 2<br />

Column tube 20 28-9666-46 28-9666-48 28-9666-49 1<br />

Column tube 40 28-9666-52 28-9666-51 28-9666-50 1<br />

Packing tube 20 28-9803-83 28-9802-51 1<br />

Packing tube 40 28-9645-05 28-9645-06 1<br />

O-ring, packing tube 28-9666-54 28-9666-55 2<br />

Accessory kit* 28-9663-67 28-9663-74 28-9663-75 1<br />

* Each HiScale column is delivered with two adapters<br />

5<br />

Chromatography columns<br />

www.gelifesciences.com/bioprocess 133

---

Custom-packed<br />

laboratory columns<br />

5<br />

<strong>GE</strong> <strong>Healthcare</strong> offers a large selection<br />

of prepacked columns and bulk media<br />

available, encompassing most liquid<br />

chromatography techniques. If you<br />

require a special configuration, a<br />

combination of column and medium<br />

not offered in our standard column<br />

offerings, contact the Custom<br />

<strong>Product</strong>s group through your local<br />

<strong>GE</strong> <strong>Healthcare</strong> office.<br />

• Each custom column is packed and<br />

tested under ISO 9001 standards.<br />

• Each columns comes with user<br />

instructions and a result of<br />

analysis that describes the column<br />

performance.<br />

• Delivery time is between two and<br />

four weeks, depending on specific<br />

media and column specifications.<br />

Chromatography columns<br />

HiPrep columns<br />

HiLoad columns<br />

Custom prepacked columns that meet your<br />

exact requirements<br />

HiTrap columns<br />

HiScreen columns<br />

134 www.gelifesciences.com/bioprocess

---

Custom <strong>Product</strong>s adapts the exact combination of media<br />

and column to solve specific purification problems. With<br />

years of experience in chromatography and column<br />

packing, you can rely on the Custom <strong>Product</strong>s group<br />

to tailor a solution to fit your separation objectives and<br />

save you time. The group works with you from the initial<br />

discussions right through to delivery, establishing your<br />

needs and sorting through the choices.<br />

Selection guide – Available columns<br />

C Column<br />

FineLINE Pilot 35<br />

HiPrep Column<br />

HiTrap Column<br />

HR 16 Column<br />

PC Column (Precision Column)<br />

MultiTrap 96-well filter plates<br />

PE Column (PEEK)<br />

SC Column (Precision Column)<br />

SR Column (Solvent Resistant)<br />

ST Column (Stainless Steel)<br />

Tricorn High Performance Column<br />

XK Column<br />

Selection guide – Available affinity media<br />

2’5’ ADP Sepharose 4B<br />

7-Methyl-GTP Sepahrose 4B<br />

Benzamidine Sepharose 6B<br />

Benzamidine Sepharose Fast Flow<br />

(high sub)<br />

Blue Sepharose 6 Fast Flow<br />

Blue Sepharose CL-6B<br />

Blue Sepharose High Performance<br />

Calmodulin Sepharose 4B<br />

Chelating Sepharose Big Beads<br />

Chelating Sepharose Fast Flow<br />

Chelating Sepharose High Performance<br />

Con A Sepharose 4B<br />

EAH Sepharose 4B<br />

ECH Sepharose 4B<br />

GammaBind G Sepharose<br />

GammaBind Plus Sepharose<br />

Gelatin Sepharose 4B<br />

Glutathione Sepharose 4 Fast Flow<br />

Glutathione Sepharose 4B<br />

Glutathione Sepharose High Performance<br />

Heparin Sepharose 6 Fast Flow<br />

Heparin Sepharose High Performance<br />

IgG Sepharose Fast Flow<br />

Lentil Lectin Sepharose 4B<br />

Lysine Sepharose 4B<br />

MabSelect<br />

MabSelect SuRe<br />

MabSelect Xtra<br />

NHS-activated Sepharose 4 Fast Flow<br />

NHS-activated Sepharose High<br />

Performance<br />

Ni Sepharose 6 Fast Flow<br />

Ni Sepharose High Performance<br />

nProtein A Sepharose 4 Fast Flow<br />

PlasmidSelect Xtra<br />

Poly(A) Sepharose 4B<br />

Poly(U) Sepharose 4B<br />

Protein A Sepharose CL-4B, 6MB<br />

Protein G Sepharose 4 Fast Flow<br />

Protein G Sepharose High Performance<br />

rmpProtein A Sepharose 4 Fast Flow<br />

rProtein A Sepharose Fast Flow<br />

5<br />

Selection guide – Available gel filtration media<br />

Selection guide – Available RPC media<br />

SOURCE 5RPC<br />

SOURCE 15RPC<br />

SOURCE 30RPC<br />

Sephacryl S-100 HR<br />

Sephacryl S-200 HR<br />

Sephacryl S-300 HR<br />

Sephacryl S-400 HR<br />

Sephacryl S-500 HR<br />

Sephacryl S-1000 SF<br />

Sephadex G-10<br />

Sephadex G-15<br />

Sephadex G-25 Coarse, Medium, Fine,<br />

Superfine<br />

Sephadex G-50 Coarse, Medium, Fine,<br />

Superfine<br />

Sephadex G-75 Medium, Superfine<br />

Sephadex G-100 Medium, Superfine<br />

Sepharose CL-2B, -4B, -6B<br />

Sepharose 2B, 4B, 6B<br />

Superdex Peptide<br />

Superdex 30 prep grade<br />

Superdex 75<br />

Superdex 75 prep grade<br />

Superdex 200<br />

Superdex 200 prep grade<br />

Superose 6<br />

Superose 6 prep grade<br />

Superose 12<br />

Superose 12 prep grade<br />

Selection guide – Available HIC media<br />

Butyl Sepharose High Performance<br />

Butyl-S Sepharose 6 Fast Flow<br />

Butyl Sepharose 4 Fast Flow<br />

Butyl Sepharose 4B<br />

Octyl Sepharose 4 Fast Flow<br />

Octyl Sepharose CL-4B<br />

Phenyl Sepharose CL-4B<br />

μRPC C2/C18<br />

Phenyl Sepharose Fast Flow (high sub)<br />

Phenyl Sepharose Fast Flow (low sub)<br />

Phenyl Sepharose High Performance<br />

SOURCE 15ETH<br />

SOURCE 15ISO<br />

SOURCE 15PHE<br />

Chromatography columns<br />

Selection guide – Available ion exchange media<br />

Capto MMC<br />

Capto Q<br />

CM Sephadex C-25, C-50<br />

CM Sepharose Fast Flow<br />

DEAE Sephadex A-25, A-50<br />

DEAE Sepharose Fast Flow<br />

Mini Q, Mini S<br />

Mono Q, Mono S, Mono P<br />

PBE 94, 118<br />

Q Sepharose Big Beads<br />

Q Sepharose Fast Flow<br />

Q Sepharose High Performance<br />

Q Sepharose XL<br />

QAE Sephadex A-25, A-50<br />

SOURCE 15Q, 15S<br />

SOURCE 30Q, 30S<br />

SP Sephadex C-25, C-50<br />

SP Sepharose Big Beads<br />

SP Sepharose Fast Flow<br />

SP Sepharose High Performance<br />

SP Sepharose XL<br />

Visit us on the web at<br />

www.gelifesciences.com/bioprocess<br />

FineLINE Pilot 35 column<br />

www.gelifesciences.com/bioprocess 135

---

Manufacturing Solutions –<br />

column packing<br />

Manufacturing Solutions is aimed at<br />

developing products and services<br />

that simplify the daily work in process<br />

development and manufacturing. The<br />

products include Media Wand and<br />

Media Handling Unit, devices that<br />

enable efficient and simple handling of<br />

large-scale media volumes, and slurry<br />

tanks, which simplify and improve the<br />

column packing process.<br />

Media Wand Slurry tank AxiChrom ÄKTAprocess<br />

• Simplifies media handling<br />

• Saves time and labor<br />

• Gentle to media<br />

• Better packing results<br />

• Closed environment<br />

• Simplified storage<br />

• Intelligent packing<br />

• Intuitive handling<br />

• Predictable scale-up<br />

• Configurable<br />

• UNICORN control<br />

• Inline Conditioning<br />

(optional)<br />

5<br />

Media Wand<br />

Chromatography columns<br />

Media Wand 50 and Media Wand 100<br />

simplify a number of time-consuming<br />

tasks such as:<br />

• removal of supernatant from the<br />

shipping container<br />

• addition of buffer or WFI<br />

(Water-For-Injection)<br />

• generation of slurry<br />

• transfer of slurry from the shipping<br />

container<br />

In addition, Media Wand and Media<br />

Handling Unit (MHU) eliminate the<br />

need for heavy lifting and shaking,<br />

enabling faster handling of media<br />

volumes with reduced labor.<br />

Decanting Device 50 (for Media<br />

Wand 50) and Decanting Device 100<br />

(for Media Wand 100) are shields,<br />

connected to the spray nozzle of the<br />

Media Wand, which act to prevent loss<br />

of media during decanting. The Media<br />

Handling Unit CIP-manifold simplifies<br />

the cleaning-in-place process of the<br />

Media Handling Unit. When working<br />

with solvents, PTFE tubing (2 m<br />

stainless steel over braid and silicon<br />

covered tubing) should be used to<br />

connect the Media Wand to the Media<br />

Handling Unit. PTFE tubing eliminates<br />

any potential differences in static<br />

electricity between the Media Wand<br />

and the Media Handling Unit.<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

Media Wand 50 1 28-9227-64<br />

Media Wand 100 1 28-9227-67<br />

Media Handling Unit 1 28-9227-69<br />

Decanting Device 50 1 28-9227-70<br />

Decanting Device 100 1 28-9227-71<br />

CIP-manifold MHU 1 28-9227-73<br />

PTFE-tubing 1 28-9230-74<br />

Media Wand 50 is designed for use<br />

with containers containing 5 to 10 L<br />

of media, and Media Wand 100 for<br />

the containers with up to 60 L of<br />

media. While the Chromaflow Pack<br />

Station 100 can also be used with<br />

Media Wand, the Media Handling Unit<br />

offers more functions and thereby<br />

provides easier and safer operations.<br />

136 www.gelifesciences.com/bioprocess

---

Slurry tanks<br />

Advantages of a well-designed slurry tank include:<br />

• Simplified buffer exchange (from transport liquid to<br />

packing buffer and to preservative when storing media)<br />

and adjustment of slurry concentration<br />

• Generation of a homogenous slurry<br />

• Supports all packing methodologies, including pressure<br />

packing of brittle media<br />

• Simplified, more ergonomic, and safer operator working<br />

conditions<br />

<strong>GE</strong> <strong>Healthcare</strong> provides slurry tanks up to 2000 L and with<br />

a range of customizations including weight determination,<br />

vacuum functions, air blow/buffer drain, and sample valves.<br />

Tank functions are easily controlled from the operator<br />

panel.<br />

Slurry tanks simplify column packing and provide for safer<br />

and more cost-effective process development. By gently<br />

generating an even particle size distribution throughout the<br />

slurry, slurry tanks can help prevent excessive shear forces<br />

that may otherwise lead to media degradation, clogged<br />

nets, and increased back pressure. Slurry tanks also<br />

support a range of additional process steps when packing<br />

and unpacking media. The ability to transfer media/buffer<br />

via pressure results in time and material savings as well as<br />

improved operating conditions.<br />

Technical specifications<br />

Operating pressure<br />

-1 to 3 bar g<br />

Process air consumption<br />

200 NL/min<br />

Instrument air consumption<br />

50 NL/min<br />

Pressure requirement, process air/instrument air 5-10/6-10 bar g<br />

Number of inlets 3<br />

Number of outlets 2<br />

Tank bottom valve 1<br />

Sprayballs 2<br />

Protection class<br />

IP55<br />

Tank, piping material<br />

316L<br />

Process wetted gaskets and elastomers<br />

EPDM<br />

Design temperature range<br />

4°C-40°C<br />

Power supply<br />

3 × 400 VAC, 50-60 Hz<br />

Literature<br />

Data file<br />

Code number<br />

Slurry tanks 28-9785-97<br />

5<br />

Chromatography columns<br />

For information on ordering slurry<br />

tanks, please contact your local<br />

<strong>GE</strong> <strong>Healthcare</strong> representative or visit:<br />

www.gelifesciences.com/cbs<br />

www.gelifesciences.com/bioprocess 137

---

6<br />

Chromatography systems<br />

ÄKTA avant 140<br />

ÄKTApilot 141<br />

ÄKTAprocess 142<br />

Inline conditioning 144<br />

Customized <strong>BioProcess</strong> Solutions 145<br />

UNICORN control 146<br />

138 www.gelifesciences.com/bioprocess

---

6<br />

Chromatography systems<br />

www.gelifesciences.com/bioprocess 139

---

ÄKTA avant system<br />

Security: reliable results with complete sample security<br />

and regulatory compliance<br />

• Ensure sample integrity by contaminant-protected and<br />

cooled, integrated fraction collector<br />

• Work faster while meeting regulatory requirements with<br />

21 CFR part 11 compliant UNICORN 6 software<br />

• Easily trace column run data history with UniTag scanning<br />

• Column protection via flow regulation controlled by<br />

differential pressure measurement<br />

Scalability: achieve direct, dependable scalability while<br />

systematically anticipating errors<br />

• Automatic conversion of UNICORN 6 methods when<br />

scaling up and down between the two ÄKTA avant versions<br />

• Take full advantage of modern high flow rate <strong>BioProcess</strong><br />

media such as MabSelect and Capto<br />

• Scale quickly and predictably from screening and<br />

method optimization using HiScreen columns, to finetuning<br />

and robustness testing on AxiChrom columns<br />

6<br />

Chromatography systems<br />

ÄKTA avant is a preparative chromatography system<br />

designed for rapid and secure development of scalable<br />

chromatographic methods and processes.<br />

Available in two versions, ÄKTA avant systems have<br />

different flow rates and pressure specifications but share<br />

the same hardware setup. With flow rates up to 25 mL/min,<br />

ÄKTA avant 25 system is designed for media screening and<br />

method optimization. ÄKTA avant 150 system, with flow<br />

rates up to 150 mL/min, is designed for scaling up to larger<br />

columns, as well as fine-tuning and robustness testing<br />

of the optimized process. ÄKTA avant is operated using<br />

UNICORN 6 control software, which has been specially<br />

developed to increase productivity and efficiency.<br />

ÄKTA avant offers a complete solution for rapid, high-quality<br />

protein separations while maintaining flexibility and reliability.<br />

Speed: Increase productivity<br />

• Maximal information from a minimal number of<br />

experiments with Design of Experiments (DoE) support<br />

integrated into UNICORN 6 software<br />

• BufferPro automated online buffer preparation enables<br />

quick and easy preparation of single buffers as well as<br />

screening for optimal buffer compositions, including pH<br />

scouting<br />

• Ease-of-use in every detail<br />

Ordering information<br />

System and software<br />

Code number<br />

ÄKTA avant 25 28-9308-42<br />

ÄKTA avant 150 28-9763-37<br />

UNICORN 6.1 local or remote workstation license with DVD 28-9806-84<br />

UNICORN 6.1 local or remote workstation license without DVD 28-9835-31<br />

UNICORN 6.1 DVD package 28-9806-81<br />

Related literature<br />

Code number<br />

Data file: UNICORN 6 control software 28-9573-46<br />

Validation Support File: UNICORN software 28-9626-50<br />

Application note: Rapid process development for purification of a<br />

MAb using ÄKTA avant 25 28-9573-47<br />

Application note: Rapid method development for native protein<br />

purification using ÄKTA avant 25 chromatography system 28-9623-37<br />

Application note: Fast process development of a single-step<br />

purification using ÄKTA avant systems 28-9827-80<br />

Brochure: ÄKTA avant 28-9594-86<br />

Selection guide: Prepacked chromatography columns for ÄKTA<br />

design systems 28-9317-78<br />

More information available on www.gelifesciences.com/akta<br />

140 www.gelifesciences.com/bioprocess

---

ÄKTApilot system<br />

ÄKTApilot is a high-performance, automated liquid<br />

chromatography system designed for process<br />

development, process scale-up, scale-down and smallscale<br />

production. The system has the capacity to purify<br />

from milligrams to tens of grams of product and is<br />

biocompatible, hygienic and sanitizable.<br />

• Hygienic design enables purification of microbial-free<br />

and contaminant-free products<br />

• High dynamic capacity<br />

— flow capacity 4 to 400 mL/min with 0 to 100% gradient<br />

— 4 to 800 mL/min flow with limited gradient<br />

— possibility to purify 10 g product per cycle<br />

• Built-in and EVB sanitary fraction collection valves for<br />

maximum use of bench space<br />

• Fast and convenient start with UNICORN<br />

— Method Wizard for easy programming<br />

— preprogrammed sanitization method and column lists<br />

— constant pressure regulation of flow rate during<br />

sample application and during column packing<br />

• Validation support<br />

— IQ/OQ documentation available<br />

— UNICORN supports FDA 21 CFR Part 11 for Electronic<br />

Signatures and Electronic Records<br />

• Bench top design — fits in small areas<br />

• All wetted parts are externally mounted and are easily<br />

changeable for<br />

— convenient product change-over when campaigning<br />

— simplified cleaning validation<br />

The sanitary system for rapid process<br />

development and small-scale production<br />

The system consists of the ÄKTApilot separation unit, a<br />

computer including a flat-screen monitor and UNICORN<br />

control system. UNICORN ensures quick, simple<br />

communication between systems and users and meets the<br />

stringent control and data handling procedures of modern<br />

production and laboratory facilities. Method wizards<br />

provide easy method generation. Optimized methods are<br />

transferred easily from laboratory to production scale.<br />

In addition to the two outlet fraction valves, you can<br />

connect four extra EVB 988 valves (External Valve Block).<br />

Two extra EVB 981 inlet valves can also be connected on<br />

the outlet valve rack.<br />

Trouble-free sanitization<br />

ÄKTApilot system is easily sanitized with 1 M sodium<br />

hydroxide (NaOH). Microbial challenge tests that subject<br />

the system to infection with solutions containing three<br />

strains of bacteria recommended by the United States<br />

Pharmacopoeia (USP 25), and a strain of yeast commonly<br />

found in production environments gave 6 log reduction<br />

results that fulfill the USP 25 requirements.<br />

Ordering information<br />

<strong>Product</strong><br />

Code number<br />

ÄKTApilot 18-1170-63<br />

Additional items<br />

EVB 981 (Inlet) 28-4079-75<br />

EVB 988 (Outlet) 28-4079-78<br />

EVB Rack 28-4079-72<br />

CIP Manifold 28-4009-03<br />

ÄKTApilot Tubing Kit Column 18-1167-68<br />

ÄKTApilot Valve Membrane CPL 18-1169-10<br />

ÄKTApilot Elbow 90 TC25 Short 18-1169-19<br />

ÄKTApilot TUBE S7 CPL 18-1169-71<br />

ÄKTApilot TUBE S8 CPL 18-1169-75<br />

Wetted parts kit 18-1171-07<br />

O-ring, top air trap 18-1169-12<br />

Connector M6 fem. – 5/16 fem. 18-1169-17<br />

Connector M6 fem. – 5/16 male 18-1169-16<br />

Clamp TC 25 18-1169-18<br />

Connector TC – 5/16 fem. 18-1169-22<br />

Connector TC – 5/16 male 18-1169-23<br />

TC-gasket 25/4 mm 18-1169-24<br />

TC-gasket 25/6.5 mm 18-1169-25<br />

T-connector 5/16 – 24 18-1170-59<br />

Connector 5/16 fem. – 5/16 fem. 18-1173-51<br />

Data files<br />

ÄKTApilot 18-1167-90<br />

UNICORN Control System 18-1156-35<br />

6<br />

Chromatography systems<br />

Visit us on the web at www.gelifesciences.com/akta<br />

www.gelifesciences.com/bioprocess 141

---

ÄKTAprocess system<br />

Versatile user configuration<br />

ÄKTAprocess offers a versatile platform providing<br />

thousands of configuration possibilities. The system is<br />

available in three flow rate ranges that extend up to<br />

2000 l/h for large volume manufacturing. The compact<br />

design with a built-in computer allows the system to fit<br />

neatly into a plant. ÄKTAprocess can be constructed in<br />

either electropolished stainless steel or polypropylene,<br />

depending on your process conditions and plant<br />

requirements.<br />

6<br />

Chromatography systems<br />

ÄKTA platform enters<br />

production-scale chromatography<br />

ÄKTAprocess is an automated liquid chromatography<br />

system built for process scale-up and large-scale<br />

biopharmaceutical manufacturing. The proven design<br />

has been verified during development and can be user<br />

configured to meet specific process demands. It is the<br />

obvious choice of system to use when scaling up processes<br />

developed on smaller ÄKTAexplorer and ÄKTApilot systems.<br />

• Versatile user configuration with UNICORN control<br />

• Post-purchase configuration increasing usability and<br />

lifespan<br />

• Traceable USP Class VI, CFR 177 and animal-free origin<br />

materials<br />

• Regulatory documentation and services<br />

• One inch tubing size now available<br />

The systems can be configured to develop gradients at<br />

any flow rate with feedback loop technology. This ensures<br />

thorough mixing of liquids/solvents without air bubbles<br />

so that even challenging gradients can be created with<br />

2% accuracy. The UNICORN software allows standalone<br />

operation or integration into any plant-wide control<br />

system. Additional configurations include, for example, the<br />

choice of extra inlets and outlets, the type and quantity<br />

of selected monitors, and isocratic versus gradient<br />

functionality.<br />

Sanitary design<br />

ÄKTAprocess has a number of features that make<br />

sanitization with 1 M sodium hydroxide simple and<br />

effective. UNICORN allows automated cleaning-in-place<br />

(CIP) and the air trap makes CIP more efficient. All wetted<br />

parts can be changed to prevent cross-contamination<br />

when the system is used for campaigning.<br />

In a sanitization study, the system was subjected to high<br />

level of microbial challenge organisms (1 × 10 6 Colony<br />

Forming Units CFU/mL). The yeast Pichia pastoris was used<br />

for antimicrobial testing. The results show that the system<br />

is sanitized effectively and that the numbers of viable<br />

organisms are efficiency reduced.<br />

For more information, please contact your local<br />

<strong>GE</strong> <strong>Healthcare</strong> representative. See also chromatography<br />

system at www.gelifesciences.com/bioprocess<br />

142 www.gelifesciences.com/bioprocess

---

Inlets<br />

Up to ten<br />

inlet valves.<br />

Air<br />

Air sensor<br />

System<br />

pump 1<br />

Pumps<br />

A second pump<br />

is available for<br />

gradient formation.<br />

C<br />

Cond cell<br />

Pressure<br />

sensor<br />

P<br />

Air outlet<br />

valve,<br />

controlled<br />

Air sensor<br />

Air trap<br />

A liquid vortex at high flow rates allows<br />

the system to expel air effectively during<br />

operation and make CIP more effective.<br />

Filter<br />

Optional filter<br />

housing for<br />

particle or<br />

sterile filration.<br />

Flow meter<br />

pH cell<br />

Packing/CIP valves<br />

Additional valves are<br />

available for automation<br />

of CIP and intelligent<br />

packing of AxiChrom<br />

columns.<br />

Outlets<br />

Up to ten<br />

outlet valves.<br />

Air<br />

F<br />

pH<br />

Column 1<br />

P<br />

C<br />

UV<br />

Pressure<br />

sensor<br />

Cond cell<br />

UV cell<br />

Sample pump<br />

A dedicated sample<br />

pump is available.<br />

Columns<br />

An additional branch of valves<br />

is available for connection of a<br />

second column.<br />

UV cell<br />

Single or multiple wavelength<br />

UV detector.<br />

The liquid flow path.<br />

Validatable control with UNICORN software<br />

UNICORN software is a single familiar interface for both<br />

chromatography and membrane separations that provides<br />

efficient control of process, flexible method programming,<br />

extensive data evaluation, and powerful reporting<br />

functionality. Improved and cost-effective process security<br />

is now provided as a standard. The system control unit,<br />

CU 960, allows process operation even if communication<br />

with system computer and UNICORN is lost either<br />

physically or due to operating system faults.<br />

For integration purposes, UNICORN communicates with<br />

control systems within the plant via OLE for Process Control<br />

(OPC). OPC supports application area such as data access<br />

for real time values and security control to protect sensitive<br />

information.<br />

Safety stock of spare parts and consumables<br />

Securing the supply of spare parts and consumables<br />

ensures maximum uptime of your ÄKTAprocess system.<br />

Our safety stock agreements for ÄKTAprocess can be<br />

tailored to meet your unique availability needs.<br />

System specifications<br />

System specifications<br />

System flow rate<br />

6 mm i.d. PP* 4–180 L/h<br />

3/8 in o.d. (7.7 mm i.d.) SS † 4–180 L/h<br />

10 mm i.d. PP 13–600 L/h<br />

1/2 in o.d. (9.4 mm i.d.) SS 13–600 L/h<br />

1 in o.d. (20.4 mm i.d.) PP 45–2000 L/h<br />

1 in o.d. (22.1 mm i.d.) SS 45–2000 L/h<br />

UV wavelength range<br />

Single (280 nm) or multiple wavelengths<br />

pH range 0–14 (spec. valid between 2 and 12)<br />

Conductivity range<br />

1 mS/cm to 200 mS/cm<br />

Ingress protection,<br />

cabinet electrical NEMA 4X / IP 56<br />

Electrical standards UL 508A, EN 61010-1<br />

Tubing size<br />

PP: 6 mm, 10 mm, SS: 3/8 in and 1/2 in<br />

Skid size<br />

6 mm, 10 mm, 3/8 in and 1/2 in (W×D×H): 850 mm × 1205 mm × 1670 mm<br />

(D=750 mm if monitor and keyboard included)<br />

1 in PP and SS (W×D×H): 1050 mm × 1730 mm × 1900 mm<br />

(D=2275 mm if monitor and keyboard included)<br />

* PP = polypropylene,<br />

†<br />

SS = 316 L stainless steel.<br />

Operating conditions<br />

Operating pressure and temperature<br />

PP (6 mm, 10 mm, and 1 in) 6 bar (max 40°C)<br />

SS (3/8 in and 1/2 in)<br />

10 bar (max 40°C)<br />

SS (1 in)<br />

6 bar (max 40°C)<br />

Surrounding temperature: 2–30°C<br />

Applied solutions:<br />

PP systems: 4–60°C (max 3 bar at 40–60°C)<br />

Applied solutions:<br />

SS systems: 4–80°C (max 3 bar at 40–60°C and<br />

max 1 bar at 60–80°C)<br />

6<br />

Chromatography systems<br />

Literature<br />

Data file<br />

ÄKTAprocess 11-1135-43<br />

www.gelifesciences.com/bioprocess 143

---

Inline conditioning for process<br />

chromatography systems<br />

The intelligent control strategy of the inline conditioning/<br />

chromatography system is designed to prepare buffers to<br />

be automatically adjusted, thereby improving the quality of<br />

the process.<br />

Flow<br />

Acid/Acid component<br />

P1<br />

Flow<br />

Cond UV pH Cond UV pH<br />

Optional<br />

organic<br />

solvents<br />

on one<br />

or several<br />

inlets<br />

Base/base component<br />

Water<br />

P2<br />

P3<br />

Flow<br />

Flow<br />

Prepared<br />

buffer to<br />

column<br />

Salt<br />

P4<br />

Flow<br />

Optional inlets<br />

P5<br />

A flowscheme for a typical system designed for inline conditioning.<br />

6<br />

Chromatography systems<br />

Inline conditioning (IC) is a solution for researchers and<br />

process engineers who need to formulate buffer solutions<br />

precisely at the time of use, using stock solutions of the<br />

buffer components. When using inline conditioning, the<br />

storage of prepared buffer is eliminated (thus reducing<br />

facility space limitations) and time and effort to transport<br />

and maintain buffer containers is reduced.<br />

Another advantage of Inline conditioning is that by including<br />

the buffer preparation within the chromatography run, all<br />

relevant data for buffer characteristics and for the run itself<br />

are recorded by the control software at the same time,<br />

resulting in one batch record for both operations.<br />

<strong>GE</strong> Healtcare’s inline conditioning technology provides a<br />

number of advantages to biopharmaceutical producers.<br />

The primary benefits include:<br />

• Secured, timely mixing of different solutions by a single<br />

system<br />

• Easy method set-up and IC control with UNICORN<br />

• Reproducible results<br />

• Allows for use of smaller tanks or disposable bags<br />

• PAT-based IC process technology<br />

System characteristics and IC accuracy<br />

UV wavelength range<br />

pH range 0-14<br />

pH accuracy*<br />

Conductivity range<br />

Conductivity accuracy*<br />

Single (280 nm) or multiple wavelengths<br />

0.2 pH units<br />

1 mS/cm to 200 mS/cm<br />

± 2% or 0.5 mS<br />

Process temperature<br />

4°C to 80°C (stainless steel systems)<br />

4°C to 60°C (polypropylene systems)<br />

Electrical standards UL 508A, EN 61010-1<br />

* Accuracy values are minimum – much higher accuracy can be reached under most<br />

conditions.<br />

Literature<br />

Data file<br />

Inline conditioning for process chromatography systems 28-9785-96<br />

For ordering information and further technical details,<br />

please contact your regional <strong>GE</strong> <strong>Healthcare</strong> sales office.<br />

144 www.gelifesciences.com/bioprocess

---

Customized <strong>BioProcess</strong> Solutions<br />

For some applications only customized solutions fit the bill.<br />

Through its Customized <strong>BioProcess</strong> Solutions (CBS) group,<br />

<strong>GE</strong> <strong>Healthcare</strong> can offer a wide range of engineered<br />

solutions for chromatography, membrane filtration<br />

and oligonucleotide synthesis. The CBS group has more<br />

than 20 years’ experience of engineering systems<br />

and columns to meet customer’s application needs,<br />

specifications, and regulatory requirements. The choice<br />

of components, materials, manufacturing methods<br />

and system configuration are made by the customer in<br />

consultation with our engineers to ensure performance<br />

and compatibility. Choice of control software includes<br />

DeltaV, UNICORN, PLC or any other requirement. Auxiliary<br />

equipment can also be manufactured according to<br />

specifications.<br />

A key element of <strong>GE</strong> <strong>Healthcare</strong>’s offering is its service<br />

organization. Service agreements ensure rapid service<br />

and replacement spare parts delivered within 48 hours<br />

minimize expensive downtime.<br />

CBS DeltaV Standard Control Platform<br />

CBS DeltaV Standard Control Platform is a flexible control<br />

software that simplifies process automation of protein<br />

purification by industrial-scale chromatography. The<br />

control platform employs Emerson DeltaV software, which<br />

has a solid track record of providing excellent control<br />

capability in the pharmaceutical and biotechnology<br />

industries.<br />

Benefits of the CBS DeltaV Standard Control Platform include:<br />

• Efficient and dedicated control solutions for<br />

chromatography purification of proteins<br />

• Flexible operation (recipe) development and assessment<br />

• Extensive analytical functions for chromatography data<br />

with UNICORN Evaluation<br />

• Full integration with existing DeltaV systems<br />

• Extensive support (e.g., audit trails) for regulatory support<br />

compliance<br />

For more information on CBS DeltaV Standard Control<br />

Platform, see datafile: 28-4074-95<br />

6<br />

Chromatography systems<br />

For more information, please contact your local<br />

<strong>GE</strong> <strong>Healthcare</strong> representative or visit the CBS homepage<br />

www.gelifesciences.com/cbs<br />

www.gelifesciences.com/bioprocess 145

---

UNICORN control<br />

Among the many features of UNICORN are easy method<br />

programming, powerful functions for method assessment,<br />

a dynamic display to keep you posted on process status,<br />

and the configurable user access profiles to keep your<br />

methods secure. In addition, UNICORN can simultaneously<br />

supervise up to four liquid handling units from a single<br />

work-station, independently or in a pre-programmed<br />

sequence. Full validation support for the control system<br />

software is available to help speed your product to market.<br />

The software consists of separate modules for method<br />

programming, system control and data evaluation.<br />

6<br />

Chromatography systems<br />

UNICORN is the control system for real-time control of<br />

protein purification unit operations (column packing,<br />

chromatography and filtration) from laboratory bench,<br />

through development, to full-scale production. UNICORN<br />

is used world-wide in over a thousand laboratories<br />

and controls hundreds of process development and<br />

production systems.<br />

UNICORN control system meets the needs of full-scale<br />

production with manufacturing systems, while maintaining<br />

the flexibility needed for method and process development<br />

with the range of systems in the ÄKTA family.<br />

This flexibility allows quick and simple transition from one<br />

stage of a project to the next. Clinical trial equipment can<br />

be turned into a final production installation overnight.<br />

Documentation and user interface remain consistent from<br />

one step to the next and re-investment and validation<br />

requirements are reduced to a minimum. UNICORN can<br />

also be adapted to control other liquid handling process<br />

units, or to connect to other control systems in a plant via<br />

the OPC interface.<br />

Method text editor.<br />

Easy method programming<br />

Most complex valving sequences are handled through<br />

valve macros. Programming can be done in time, volume or<br />

column volume base.<br />

Automatic scouting of important separation variables<br />

is easily performed. Conditional responses to specific<br />

monitor signals (UV, conductivity, pH, pressure and air) are<br />

established through simple WATCH commands.<br />

Main Menu Method Editor System Control Evaluation<br />

System Strategy<br />

UNICORN control module.<br />

Built-in strategy for all<br />

ÄKTAdesign systems<br />

UNICORN architecture.<br />

Customized strategy for <strong>BioProcess</strong> Systems<br />

and other liquid handling modules<br />

Modular hardware<br />

Real-time process monitoring<br />

As the chromatography run progresses, selected monitor<br />

signals are displayed numerically or as trend curves. The<br />

process picture with actual flow path and the continuously<br />

updated logbook can be displayed.<br />

146 www.gelifesciences.com/bioprocess

---

Real-time control<br />

Up to four systems can be connected to one UNICORN<br />

workstation where individual controllers handle the realtime<br />

control of each system. Data evaluation or methods<br />

programming can be done while the systems are running.<br />

The control unit CU 950 (Ethernet and USB) provides a high<br />

degree of security for control and data. The unit secures<br />

started runs even if the local PC and communication is<br />

disrupted. CU 950 Advanced also contains an internal<br />

memory that collects data in case of communication<br />

failure.<br />

Extensive data evaluation<br />

All monitor data are stored in a Result File for storage and<br />

evaluation. Extensive data processing routines include<br />

curve smoothing, differentiation, normalization, baseline<br />

calculation, peak integration and height equivalent to a<br />

theoretical plate (HETP) calculations.<br />

Start protocols are user-defined questions that must be<br />

answered before a run can be started. Questions can<br />

vary between simple operator prompts to those requiring<br />

mandatory answers and authorized approval.<br />

Notebooks permit additional text to be included in the<br />

process documentation. Separate files are generated for<br />

method notes, start notes, run notes, and evaluation notes.<br />

These notes can be entered at the designated time and<br />

cannot be altered after the run is complete.<br />

All programmed and manual events occurring during the<br />

run, including alarms and warnings, are documented in the<br />

logbook and cannot be altered.<br />

Security<br />

UNICORN provides a system for password authorization<br />

and access control. Operators log in by name and<br />

password. The user profile includes an access level that<br />

defines system functions available to each operator.<br />

Scalability<br />

Using UNICORN for method or process development on<br />

ÄKTA systems simplifies scale-up to <strong>BioProcess</strong> system.<br />

Personnel retraining is minimized and continuity exists in<br />

batch documentation and report generation.<br />

6<br />

UNICORN Method Development<br />

Evaluation procedures can be<br />

retrieved from a programmed<br />

method to process data and<br />

generate reports as part of<br />

an automated procedure.<br />

Batch documentation<br />

Along with the chromatographic results of each run, the<br />

Result File also includes the programmed method, start<br />

protocols, notebooks and the logbook. These files are<br />

protected and cannot be manipulated. Processed data<br />

generated from an evaluation procedure are stored in the<br />

Result File, but separate from the original data.<br />

Lab Scale Pilot Scale Manufacturing<br />

Scale<br />

up/down<br />

Scale<br />

up/down<br />

UNICORN methods can be transferred between systems at different scales.<br />

Validation support<br />

UNICORN is fully compliant with 21 CFR Part 11 and is<br />

extensively documented for validation purposes.<br />

A Validation Support File is available describing our<br />

software development model including routines and test<br />

models.<br />

Chromatography systems<br />

Installation and Operational Qualification documentation<br />

packages consisting of preprinted forms and test methods<br />

are also available (see p 224).<br />

www.gelifesciences.com/bioprocess 147

---

6<br />

Chromatography systems<br />

OPC Connectivity<br />

The UNICORN OPC server provides a<br />

standardized integration interface to<br />

support integration between UNICORN<br />

and other software systems such<br />

as laboratory information systems<br />

(LIMS) and manufacturing execution<br />

systems like DCS and MES. OPC<br />

enables open connectivity via open<br />

standards created in collaboration<br />

with a number of worldwide leading<br />

automation manufacturers, including<br />

Microsoft.<br />

UNICORN OPC server supports the<br />

following four areas:<br />

• UNICORN OPC Data Access gives<br />

access to all process data (e.g., real<br />

time values, valve status, process<br />

step information and commands)<br />

• UNICORN Alarm & Events server<br />

informs an OPC client application<br />

that a system parameter has<br />

exceeded an upper or lower limit<br />

value. The UNICORN Alarm & Events<br />

server also provides information<br />

about the process (LogBook).<br />

• UNICORN Historical Data Access<br />

allows any OPC client application<br />

access to the entire batch result<br />

generated by UNICORN<br />

• UNICORN OPC Security controls<br />

client access to the UNICORN<br />

OPC DA, A&E and HDA to protect<br />

sensitive information and to guard<br />

against unauthorized modification<br />

of process parameters. This is an<br />

important security feature.<br />

Network support<br />

Network support allows control and<br />

monitoring of systems from any<br />

connected UNICORN workstation,<br />

subject to access rights defined by<br />

the system administrator. UNICORN<br />

is specifically designed for Windows<br />

networks operating system control.<br />

The figure below illustrates how it<br />

can be applied in a fully networked<br />

system. This facility gives a larger<br />

number of operators access to what<br />

is happening. Nevertheless, security<br />

is still very controlled and subject to<br />

strict user-defined access rights.<br />

Network support also enables results<br />

to be automatically saved on a server.<br />

Evaluation and generation of reports<br />

can then be made locally or at a<br />

remote PC.<br />

Computer and networking specifications<br />

System recommendations for UNICORN v. 5.31<br />

Workstation<br />

PC – Pentium 4, 1.5 GHz or higher<br />

1024 Mb RAM<br />

500 Mb disk space available at all times<br />

NTFS file system<br />

Controller<br />

CU-900 requires 1/2 length PCI slot<br />

CU-950 USB requires USB 1.1 Port<br />

CU-950 Advanced requires a 10 Mbit network interface<br />

card<br />

Network server<br />

Microsoft Windows 2003 Server, TCP/IP<br />

Operating system<br />

Microsoft Windows XP Professional (32-bit, with SP3)<br />

Microsoft Windows 7 Professional (32-bit)<br />

Microsoft Windows 7 Professional (64-bit)<br />

System recommendations for UNICORN 6.1<br />

Workstation<br />

Dual-Core PC with 3 GB RAM<br />

Network<br />

100 Mbit Ethernet LAN<br />

Two network cards on Instrument server PC<br />

Operating system<br />

Microsoft Windows XP Professional SP3<br />

Microsoft Windows Vista Business SP1<br />

Ordering information<br />

Please contact your local <strong>GE</strong> <strong>Healthcare</strong> sales office.<br />

Literature<br />

Data file<br />

Code number<br />

UNICORN control system 18-1156-35<br />

UNICORN 6 control software 28-9573-46<br />

Validation support and service 18-1104-73<br />

Validation Support File<br />

UNICORN 5.3 11-0029-86<br />

UNICORN 6.1 11-0029-79<br />

UNICORN network allows sharing of systems and a central location for data storage.<br />

Information on OPC-based integration<br />

Application note<br />

DeltaV* integration 04-0021-64<br />

iFix integration 04-0030-58<br />

MS SQL Server integration 04-0030-59<br />

InTouch integration 04-0030-60<br />

Data file<br />

OPC 11-0004-15<br />

Manual<br />

OPC 04-0023-04<br />

* DeltaV is a trademark owned by Emerson Process<br />

Management, Inc.<br />

148 www.gelifesciences.com/bioprocess

---

6<br />

Chromatography systems<br />

www.gelifesciences.com/bioprocess 149

---

7<br />

<strong>Product</strong>s for process development<br />

High-throughput process development 153<br />

PreDictor 96-well filter plates 154<br />

PreDictor RoboColumn 156<br />

HiScreen columns 157<br />

Examples of prepacked columns 158<br />

Selection kits 160<br />

Custom-packed columns 161<br />

Systems for method and process development 162<br />

150 www.gelifesciences.com/bioprocess

---

7<br />

Process development<br />

www.gelifesciences.com/bioprocess 151

---

<strong>Product</strong>s for process development<br />

7<br />

<strong>GE</strong> <strong>Healthcare</strong> supports all stages of the<br />

drug development process, from early<br />

discovery to the development of clinical<br />

material and the final transfer to fullscale<br />

production. Process development,<br />

the design and scale-up of a process<br />

for clinical production, is supported by<br />

numerous products and services.<br />

High-throughput process development<br />

(HTPD) is a method that shortens<br />

development time and increases<br />

the amount of information available<br />

during early process development.<br />

PreDictor 96-well filter plates, prefilled<br />

with <strong>GE</strong> <strong>Healthcare</strong> <strong>BioProcess</strong><br />

chromatography media, support<br />

HTPD by allowing parallel screening of<br />

chromatographic conditions, either in a<br />

manual or in an automated workflow. As<br />

a result, a large number of experimental<br />

conditions may be evaluated<br />

simultaneously, with minimal sample<br />

consumption. Assist software supports<br />

the PreDictor workflow from set-up of<br />

experimental design to data evaluation.<br />

PreDictor RoboColumn units are mini<br />

columns prepacked with <strong>GE</strong> <strong>Healthcare</strong><br />

<strong>BioProcess</strong> chromatography media.<br />

When used together with a robotoic<br />

system such as Tecan, PreDictor<br />

RoboColumn units perform automated<br />

parallel screening of media and process<br />

conditions with minimal sample<br />

consumption.<br />

There are different types of prepacked<br />

columns containing various types of<br />

<strong>BioProcess</strong> media. The 10 cm bed height<br />

HiScreen columns contain media from<br />

the Capto, Capto ImpRes, and MabSelect<br />

families, as well as Sepharose Fast Flow<br />

and Sepharose High Performance.<br />

ÄKTA avant and ÄKTApilot are<br />

members of the ÄKTA family of<br />

chromatography systems and are<br />

well-suited for process development.<br />

As well as operating a wide range of<br />

prepacked columns, ÄKTA avant can<br />

also operate HiScale, FineLINE Pilot 35,<br />

and AxiChrom 50 columns. FineLINE 70,<br />

AxiChrom 50, 70, and 100, and BPG 100<br />

can be connected to ÄKTApilot. The<br />

control software for ÄKTA systems<br />

is UNICORN, which can also be<br />

used for pilot-scale systems and<br />

full production. UNICORN combines<br />

the flexibility needed for method<br />

and process development with the<br />

stringent requirements for commercial<br />

manufacture of biopharmaceuticals.<br />

ReadyToProcess is our platform of<br />

ready-to-use products, engineered<br />

for convenience and speed. The<br />

product line is designed to meet the<br />

biopharmaceutical industry’s need for<br />

increased flexibility and Lean enabling<br />

solutions – from cell culture and<br />

fermentation to purification and final<br />

filling. ReadyToProcess products include<br />

WAVE Bioreactors, WAVE Mixer, fluid<br />

handling as well<br />

as ready-to-use<br />

filtration and<br />

chromatography<br />

solutions.<br />

For more<br />

information on<br />

ReadyToProcess<br />

products, see<br />

pages 34–72.<br />

Process development<br />

Lead<br />

identification<br />

Research<br />

Pre-clinical testing<br />

Process Development<br />

Clinical phase<br />

I<br />

Clinical phase<br />

II<br />

Process Dev<br />

Pilot Scale<br />

Clinical phase<br />

III<br />

Marketing<br />

approval<br />

Market<br />

introduction<br />

GMP <strong>Product</strong>ion<br />

PreDictor formats<br />

HiTrap/HiScreen<br />

HiScale<br />

ReadyToProcess<br />

AxiChrom<br />

<strong>GE</strong> <strong>Healthcare</strong>’s formats for process development through manufacturing.<br />

152 www.gelifesciences.com/bioprocess

---

High-throughput process development<br />

The challenge of process development<br />

Efficient process development is crucial for the overall efficiency of biopharma<br />

development. By pushing more projects through the early pipeline and rapidly<br />

identifying and discontinuing the unsuccessful ones, resources can be focused<br />

on those that are likely to succeed. In addition, purification processes should be<br />

well characterized to increase robustness and to minimize the need for additional<br />

optimization during further clinical development.<br />

Total characterization space<br />

Detailed studies to define design space<br />

Area for further optimization<br />

Scale-up<br />

Conceptual visualization of a workflow for<br />

process development. Parallel screening<br />

using PreDictor plates or PreDictor<br />

RoboColumn makes it possible to explore a<br />

large experimental space (left). Once optimal<br />

conditions have been identified, fine-tuning and<br />

verification are carried out on packed columns<br />

using ÄKTA systems (middle). The design space,<br />

shown in blue (middle), is identified and scaled<br />

up to a robust production scale process (right).<br />

PreDictor prefilled 96-well filter<br />

plates, Assist software, and<br />

PreDictor RoboColumns<br />

for screening of conditions<br />

ÄKTA avant systems, integrated<br />

DoE module in UNICORN 6,<br />

HiScreen, and HiTrap columns<br />

for optimization<br />

ReadyToProcess platform<br />

and AxiChrom columns<br />

for scale-up and production<br />

Increased throughput with parallel operation<br />

HTPD is a methodology that shortens development time and increases the amount<br />

of information available during early process development, while keeping sample<br />

consumption low. Chromatographic conditions are evaluated in parallel using 96-<br />

well filter plates or miniaturized columns. As a result, a large number of experimental<br />

conditions may be evaluated simultaneously. This allows screening of a large<br />

experimental space, to identify the subspace that is most favourable with respect to<br />

one or several defined responses. Once this subspace has been found, optimization<br />

and scale-up may be done on packed columns using ÄKTA systems.<br />

7<br />

Process development<br />

Media<br />

in well<br />

Wash/<br />

Equilibration<br />

Sample<br />

addition<br />

Incubation<br />

Wash<br />

1–3 times<br />

Elution<br />

1–3 times<br />

A batch uptake experiment occurring in the<br />

wells of PreDictor filter plates. The steps in<br />

PreDictor plate experiments are the same<br />

as in a typical chromatography experiment:<br />

equilibration, sample loading, wash, and elution.<br />

Vacuum filtration or centrifugation<br />

Vacuum filtration or centrifugation<br />

Waste<br />

Analysis<br />

www.gelifesciences.com/bioprocess 153

---

PreDictor 96-well filter plates<br />

A)<br />

Binding capacity (mg/ml)<br />

180<br />

160<br />

140<br />

120<br />

100<br />

80<br />

60<br />

40<br />

20<br />

pH 4.25<br />

pH 4.75<br />

pH 5.25<br />

7<br />

Process development<br />

PreDictor 96-well filter plates are prefilled with <strong>BioProcess</strong><br />

chromatography media. They are developed to support<br />

HTPD by allowing parallel screening of chromatographic<br />

conditions, either in a manual or in an automated<br />

workflow. Data generated by using PreDictor plates show<br />

good correlation with data obtained in chromatography<br />

columns, which makes the plates an excellent tool for initial<br />

screening of process conditions.<br />

PreDictor plates shorten time-to-clinic and increase<br />

productivity in the process development lab by:<br />

• reducing experimental time: the time-scale for<br />

performing screening experiments can be reduced from<br />

weeks to hours<br />

• lowering sample consumption: the amount of sample<br />

required for these experiments is significantly lower than<br />

for column experiments<br />

• increasing process understanding: the ability to screen a<br />

large experimental space leads to an increase in process<br />

understanding and in the potential to design a robust<br />

process early in development<br />

B)<br />

Dynamic binding capacity (mg/ml)<br />

0<br />

160<br />

140<br />

120<br />

100<br />

80<br />

60<br />

40<br />

20<br />

0<br />

0 0.05 0.1 0.15 0.2<br />

Ionic strength (M)<br />

pH 4.25<br />

pH 4.75<br />

pH 5.25<br />

0 0.05 0.1 0.15 0.2<br />

Ionic strength (M)<br />

Determination of loading conditions for conalbumin on Capto S. A) binding<br />

capacities at 60 minutes in PreDictor Capto S plates (2 µL). Error bars<br />

represent one standard deviation, based on triplicates.B) dynamic binding<br />

capacities (DBC) at 10% breakthrough for conalbumin on Capto S.<br />

Residence time 2 minutes, column Tricorn 5/100 (CV 2 mL).<br />

Visit us on the web at www.gelifesciences.com/predictor<br />

154 www.gelifesciences.com/bioprocess

---

Ordering information<br />

Single medium plates No. supplied Code number<br />

PreDictor Capto Q, 2 µL 4 × 96-well filter plates 28-9257-73<br />

PreDictor Capto Q, 20 μL 4 × 96-well filter plates 28-9258-06<br />

PreDictor Capto Q, 50 μL 4 × 96-well filter plates 28-9258-07<br />

PreDictor Capto S, 2 μL 4 × 96-well filter plates 28-9258-08<br />

PreDictor Capto S, 20 μL 4 × 96-well filter plates 28-9258-09<br />

PreDictor Capto S, 50 μL 4 × 96-well filter plates 28-9258-10<br />

PreDictor Capto DEAE, 2 μL 4 × 96-well filter plates 28-9258-11<br />

PreDictor Capto DEAE, 20 μL 4 × 96-well filter plates 28-9258-12<br />

PreDictor Capto DEAE, 50 μL 4 × 96-well filter plates 28-9258-13<br />

PreDictor Capto L, 6 μL 4 × 96-well filter plates 17-5478-30<br />

PreDictor Capto L, 20 μL 4 × 96-well filter plates 17-5478-31<br />

PreDictor Capto L, 50 μL 4 × 96-well filter plates 17-5478-32<br />

PreDictor Capto MMC, 6 μL 4 × 96-well filter plates 28-9258-14<br />

PreDictor Capto MMC, 20 μL 4 × 96-well filter plates 28-9258-15<br />

PreDictor Capto MMC, 50 μL 4 × 96-well filter plates 28-9258-16<br />

PreDictor Capto adhere, 6 μL 4 × 96-well filter plates 28-9258-17<br />

PreDictor Capto adhere, 20 μL 4 × 96-well filter plates 28-9258-18<br />

PreDictor Capto adhere, 50 μL 4 × 96-well filter plates 28-9258-19<br />

PreDictor Capto SP ImpRes, 6 μL 4 × 96-well filter plates 17-5468-16<br />

PreDictor Capto SP ImpRes, 20 μL 4 × 96-well filter plates 17-5468-17<br />

PreDictor Capto Q ImpRes, 6 μL 4 × 96-well filter plates 17-5470-16<br />

PreDictor Capto Q ImpRes, 20 μL 4 × 96-well filter plates 17-5470-17<br />

PreDictor MabSelect, 6 µL 4 × 96-well filter plates 28-9258-20<br />

PreDictor MabSelect, 20 μL 4 × 96-well filter plates 28-9258-21<br />

PreDictor MabSelect, 50 μL 4 × 96-well filter plates 28-9258-22<br />

PreDictor MabSelect SuRe, 6 μL 4 × 96-well filter plates 28-9258-23<br />

PreDictor MabSelect SuRe, 20 μL 4 × 96-well filter plates 28-9258-24<br />

PreDictor MabSelect SuRe, 50 μL 4 × 96-well filter plates 28-9258-25<br />

PreDictor MabSelect SuRe LX, 6 μL 4 × 96-well filter plates 17-5474-30<br />

PreDictor MabSelect SuRe LX, 20 μL 4 × 96-well filter plates 17-5474-31<br />

PreDictor MabSelect SuRe LX, 50 μL 4 × 96-well filter plates 17-5474-32<br />

PreDictor MabSelect Xtra, 6 μL 4 × 96-well filter plates 28-9432-75<br />

PreDictor MabSelect Xtra, 20 μL 4 × 96-well filter plates 28-9432-76<br />

PreDictor MabSelect Xtra, 50 μL 4 × 96-well filter plates 28-9432-77<br />

PreDictor Q Sepharose Fast Flow, 6 μL 4 × 96-well filter plates 28-9432-69<br />

PreDictor Q Sepharose Fast Flow, 20 μL 4 × 96-well filter plates 28-9432-70<br />

PreDictor Q Sepharose Fast Flow, 50 μL 4 × 96-well filter plates 28-9432-71<br />

PreDictor SP Sepharose Fast Flow, 6 μL 4 × 96-well filter plates 28-9432-72<br />

PreDictor SP Sepharose Fast Flow, 20 μL 4 × 96-well filter plates 28-9432-73<br />

PreDictor SP Sepharose Fast Flow, 50 μL 4 × 96-well filter plates 28-9432-74<br />

PreDictor Butyl Sepharose 4 Fast Flow, 6 μL 4 × 96-well filter plates 17-0980-16<br />

PreDictor Butyl Sepharose 4 Fast Flow, 50 μL 4 × 96-well filter plates 17-0980-17<br />

PreDictor Butyl-S Sepharose 6 Fast Flow, 6 μL 4 × 96-well filter plates 17-0978-16<br />

PreDictor Butyl-S Sepharose 6 Fast Flow, 50 μL 4 × 96-well filter plates 17-0978-17<br />

Note: For optimal results, different applications will require different amount of<br />

chromatography media in the wells. Thus plates with each chromatography medium<br />

are available with three different volumes of media. Generally, for binding studies<br />

plates with 2 or 6 µL chromatography media should be used. For wash and elution<br />

studies larger gel volumes are required and both feed/sample concentration and the<br />

actual load (load density) will determine what plate to use. The first option for wash<br />

studies is the 50 µL plates. For elution studies the 20 µL plate should be tested first.<br />

Ordering information<br />

Single medium plates No. supplied Code number<br />

PreDictor Capto Butyl, 6 μL 4 × 96-well filter plates 17-5459-16<br />

PreDictor Capto Butyl, 50 μL 4 × 96-well filter plates 17-5459-17<br />

PreDictor Capto Octyl, 6 μL 4 × 96-well filter plates 17-5465-16<br />

PreDictor Capto Octyl, 50 μL 4 × 96-well filter plates 17-5465-17<br />

PreDictor Capto Phenyl (high sub), 6 μL 4 × 96-well filter plates 17-5451-16<br />

PreDictor Capto Phenyl (high sub), 50 μL 4 × 96-well filter plates 17-5451-17<br />

PreDictor Octyl Sepharose 4 Fast Flow, 6 μL 4 × 96-well filter plates 17-0946-16<br />

PreDictor Octyl Sepharose 4 Fast Flow, 50 μL 4 × 96-well filter plates 17-0946-17<br />

PreDictor Phenyl Sepharose 6 Fast Flow<br />

(high sub), 6 μL 4 × 96-well filter plates 17-0973-16<br />

PreDictor Phenyl Sepharose 6 Fast Flow<br />

(high sub), 50 μL 4 × 96-well filter plates 17-0973-17<br />

PreDictor Phenyl Sepharose 6 Fast Flow<br />

(low sub), 6 μl 4 × 96-well filter plates 17-0965-16<br />

PreDictor Phenyl Sepharose 6 Fast Flow<br />

(low sub), 50 μL 4 × 96-well filter plates 17-0965-17<br />

PreDictor LambdaFabSelect, 6 µL 4 × 96-well filter plates 17-5482-13<br />

PreDictor LambdaFabSelect, 20 µL 4 × 96-well filter plates 17-5482-14<br />

PreDictor LambdaFabSelect, 50 µL 4 × 96-well filter plates 17-5482-15<br />

Screening plates No. supplied Code number<br />

PreDictor AIEX screening 2 μL/6 μL 4 × 96-well filter plates 28-9432-88<br />

PreDictor AIEX screening 20 μL 4 × 96-well filter plates 28-9432-89<br />

PreDictor CIEX screening 2 μL/6 μL 4 × 96-well filter plates 28-9432-90<br />

PreDictor CIEX screening 20 μL 4 × 96-well filter plates 28-9432-91<br />

PreDictor HIC screening high hydrophobicity,<br />

6 μL 4 × 96-well filter plates 28-9923-92<br />

PreDictor HIC screening high hydrophobicity,<br />

50 μL 4 × 96-well filter plates 28-9923-97<br />

PreDictor HIC screening low hydrophobicity,<br />

6 μL 4 × 96-well filter plates 28-9923-95<br />

PreDictor HIC screening low hydrophobicity,<br />

50 μL 4 × 96-well filter plates 28-9923-98<br />

Adsorption isotherm plates No. supplied Code number<br />

PreDictor Capto Q isotherm 4 × 96-well filter plates 28-9432-78 1<br />

PreDictor Capto S isotherm 4 × 96-well filter plates 28-9432-79 1<br />

PreDictor Capto DEAE isotherm 4 × 96-well filter plates 28-9432-80 1<br />

PreDictor Capto MMC isotherm 4 × 96-well filter plates 28-9432-81 1<br />

PreDictor Capto adhere isotherm 4 × 96-well filter plates 28-9432-82 1<br />

PreDictor MabSelect isotherm 4 × 96-well filter plates 28-9432-83 1<br />

PreDictor MabSelect SuRe isotherm 4 × 96-well filter plates 28-9432-84 1<br />

PreDictor MabSelect Xtra isotherm 4 × 96-well filter plates 28-9432-85 1<br />

PreDictor Q Sepharose Fast Flow isotherm 4 × 96-well filter plates 28-9432-86 1<br />

PreDictor SP Sepharose Fast Flow isotherm 4 × 96-well filter plates 28-9432-87 1<br />

1<br />

Plates are manufactured on request.<br />

Additional media are<br />

available on request.<br />

7<br />

Process development<br />

www.gelifesciences.com/bioprocess 155

---

PreDictor RoboColumn<br />

7<br />

Process development<br />

PreDictor RoboColumn units are miniaturized<br />

chromatographic columns prepacked with <strong>BioProcess</strong><br />

chromatography media from <strong>GE</strong> <strong>Healthcare</strong>. The<br />

columns are available for several chromatographic<br />

techniques such as ion exchange chromatography,<br />

affinity chromatography, multimodal chromatography,<br />

and hydrophobic interaction chromatography. These<br />

miniaturized columns support HTPD using a robotic<br />

liquid handling workstation, such as Freedom EVO from<br />

Tecan, for fully automated and parallel chromatographic<br />

separations.<br />

PreDictor RoboColumn offers:<br />

• Miniaturized column format: facilitates screening<br />

of a wide range of parameters with small sample<br />

consumption<br />

• Reduced experimental time: automation and parallel<br />

screening minimizes manual labor and saves time<br />

• Increased process understanding: high-throughput<br />

workflow allows investigation of enlarged experimental<br />

space for better process understanding.<br />

Visit us on the web at www.gelifesciences.com/predictor<br />

Ordering information<br />

<strong>Product</strong> 1<br />

Code number<br />

Ion exchange chromatography (IEX)<br />

PreDictor RoboColumn Capto Q, 200 μL 28-9860-72<br />

PreDictor RoboColumn Capto Q, 600 μL 28-9861-75<br />

PreDictor RoboColumn Capto S, 200 μL 28-9860-81<br />

PreDictor RoboColumn Capto S, 600 μL 28-9861-76<br />

PreDictor RoboColumn Capto DEAE, 200 μL 28-9860-82<br />

PreDictor RoboColumn Capto DEAE, 600 μL 28-9861-77<br />

PreDictor RoboColumn Q Sepharose HP, 200 μL 28-9861-03<br />

PreDictor RoboColumn Q Sepharose HP, 600 μL 28-9861-92<br />

PreDictor RoboColumn SP Sepharose HP, 200 μL 28-9861-04<br />

PreDictor RoboColumn SP Sepharose HP, 600 μL 28-9861-93<br />

PreDictor RoboColumn Q Sepharose FF, 200 μL 28-9860-86<br />

PreDictor RoboColumn Q Sepharose FF, 600 μL 28-9861-80<br />

PreDictor RoboColumn SP Sepharose FF, 200 μL 28-9860-87<br />

PreDictor RoboColumn SP Sepharose FF, 600 μL 28-9861-81<br />

PreDictor RoboColumn Capto Q ImpRes, 200 μL 28-9969-18<br />

PreDictor RoboColumn Capto Q ImpRes, 600 μL 28-9973-91<br />

PreDictor RoboColumn Capto SP ImpRes, 200 μL 28-9974-49<br />

PreDictor RoboColumn Capto SP ImpRes, 600 μL 28-9974-50<br />

Multimodal chromatography (MM)<br />

PreDictor RoboColumn Capto MMC, 200 μL 28-9860-84<br />

PreDictor RoboColumn Capto MMC, 600 μL 28-9861-78<br />

PreDictor RoboColumn Capto adhere, 200 μL 28-9860-85<br />

PreDictor RoboColumn Capto adhere, 600 μL 28-9861-79<br />

Affinity chromatography (AC)<br />

PreDictor Robocolumn 50 μl 28-0034-20<br />

PreDictor Robocolumn, 200 μl 28-0034-21<br />

PreDictor RoboColumn MabSelect, 50 μL 28-9862-02<br />

PreDictor RoboColumn MabSelect, 200 μL 28-9861-06<br />

PreDictor RoboColumn MabSelect SuRe, 50 μL 28-9862-03<br />

PreDictor RoboColumn MabSelect SuRe, 200 μL 28-9861-07<br />

PreDictor RoboColumn MabSelect Xtra, 50 μL 28-9862-04<br />

PreDictor RoboColumn MabSelect Xtra, 200 μL 28-9861-08<br />

PreDictor RoboColumn MabSelect SuRe LX, 200 μL 28-9974-40<br />

PreDictor RoboColumn MabSelect SuRe LX, 600 μL 28-9974-51<br />

Hydrophobic interaction chromatography (HIC)<br />

PreDictor RoboColumn Capto Phenyl (high sub), 200 μL 28-9860-88<br />

PreDictor RoboColumn Capto Phenyl (high sub), 600 μL 28-9861-82<br />

PreDictor RoboColumn Capto Butyl, 200 μL 28-9860-97<br />

PreDictor RoboColumn Capto Butyl, 600 μL 28-9861-83<br />

PreDictor RoboColumn Phenyl Sepharose 6FF (high sub), 200 μL 28-9860-98<br />

PreDictor RoboColumn Phenyl Sepharose 6FF (high sub), 600 μL 28-9861-84<br />

PreDictor RoboColumn Phenyl Sepharose 6FF (low sub), 200 μL 28-9860-99<br />

PreDictor RoboColumn Phenyl Sepharose 6FF (low sub), 600 μL 28-9861-88<br />

PreDictor RoboColumn Butyl Sepharose 4FF, 200 μL 28-9861-00<br />

PreDictor RoboColumn Butyl Sepharose 4FF, 600 μL 28-9861-89<br />

PreDictor RoboColumn Butyl-S Sepharose 6FF, 200 μL 28-9861-01<br />

PreDictor RoboColumn Butyl-S Sepharose 6FF, 600 μL 28-9861-90<br />

PreDictor RoboColumn Octyl Sepharose 4FF, 200 μL 28-9861-02<br />

PreDictor RoboColumn Octyl Sepharose 4FF, 600 μL 28-9861-91<br />

PreDictor RoboColumn Butyl Sepharose HP, 200 μl 28-9861-73<br />

PreDictor RoboColumn Butyl Sepharose HP, 600 μl 28-9861-95<br />

PreDictor RoboColumn Phenyl Sepharose HP, 200 μL 28-9861-05<br />

PreDictor RoboColumn Phenyl Sepharose HP, 600 μL 28-9861-94<br />

1<br />

Pack size = One row of eight columns<br />

Note: PreDictor RoboColumn units are packed by Atoll GmbH and are identical to<br />

Atoll GmbH RoboColumn units.<br />

156 www.gelifesciences.com/bioprocess

---

HiScreen columns<br />

HiScreen columns are prepacked with many different<br />

<strong>BioProcess</strong> media designed for method optimization<br />

and parameter screening in process development. The<br />

10 cm bed height makes it possible to perform scalable<br />

experiments at relevant fluid velocities.<br />

The HiScreen columns are part of the process development<br />

platform available from <strong>GE</strong> <strong>Healthcare</strong>. All media prepacked<br />

in HiScreen columns are available in different formats and<br />

bulk packs, for all scales, from development work and pilot<br />

studies to routine production.<br />

The volume of the HiScreen column is small, 4.7 mL,<br />

which reduces costs by decreasing sample and buffer<br />

consumption. The 10 cm bed height of these prepacked<br />

columns makes them a good choice for method<br />

optimization and parameter screening (e.g., selectivity,<br />

capacity, binding and elution conditions) and following<br />

scale-up. If possible, two columns can be connected in<br />

series to give a bed height of 20 cm.<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

AC<br />

HiScreen Capto L 1 × 4.7 mL 17-5478-14<br />

HiScreen MabSelect 1 × 4.7 mL 28-9269-73<br />

HiScreen MabSelect Xtra 1 × 4.7 mL 28-9269-76<br />

HiScreen MabSelect SuRe 1 × 4.7 mL 28-9269-77<br />

HiScreen MabSelect SuRe LX 1 × 4.7 mL 17-5474-15<br />

HiScreen IMAC FF 1 × 4.7 mL 28-9505-17<br />

HiScreen Ni FF 1 × 4.7 mL 28-9782-44<br />

HiScreen Capto Blue 1 × 4.7 mL 28-9924-74<br />

HiScreen Blue FF 1 × 4.7 mL 28-9782-43<br />

IEX<br />

HiScreen Capto Q ImpRes 1 × 4.7 mL 17-5470-15<br />

HiScreen Capto SP ImpRes 1 × 4.7 mL 17-5468-15<br />

HiScreen Capto Q 1 × 4.7 mL 28-9269-78<br />

HiScreen Capto S 1 × 4.7 mL 28-9269-79<br />

HiScreen Capto DEAE 1 × 4.7 mL 28-9269-82<br />

HiScreen Q FF 1 × 4.7 mL 28-9505-10<br />

HiScreen SP FF 1 × 4.7 mL 28-9505-13<br />

HiScreen Q HP 1 × 4.7 mL 28-9505-11<br />

HiScreen SP HP 1 × 4.7 mL 28-9505-15<br />

HiScreen DEAE FF 1 × 4.7 mL 28-9782-45<br />

Multimodal<br />

HiScreen Capto MMC 1 × 4.7 mL 28-9269-80<br />

HiScreen Capto adhere 1 × 4.7 mL 28-9269-81<br />

HiScreen Capto Core 700 1 × 4.7 mL 17-5481-15<br />

HIC<br />

HiScreen Butyl FF 1 × 4.7 mL 28-9269-84<br />

HiScreen Butyl-S FF 1 × 4.7 mL 28-9269-85<br />

HiScreen Octyl FF 1 × 4.7 mL 28-9269-86<br />

HiScreen Phenyl FF (high sub) 1 × 4.7 mL 28-9269-88<br />

HiScreen Phenyl FF (low sub) 1 × 4.7 mL 28-9269-89<br />

HiScreen Phenyl HP 1 × 4.7 mL 28-9505-16<br />

HiScreen Butyl HP 1 × 4.7 mL 28-9782-42<br />

HiScreen Capto Phenyl (high sub) 1 × 4.7 mL 28-9924-72<br />

HiScreen Capto Butyl 1 × 4.7 mL 28-9924-73<br />

Visit us on the web at<br />

www.gelifesciences.com/protein-purification<br />

7<br />

Process development<br />

HiScreen columns benefits:<br />

• Designed for method optimization and parameter<br />

screening<br />

• Easy connection in series to achieve 20 cm bed height<br />

• Convenient and time-saving due to prepacked format<br />

• Small column volume gives fast results and minimal<br />

sample/buffer consumption<br />

• Reproducible results comparable to <strong>BioProcess</strong> scale<br />

columns packed with the same media as the same linear<br />

fluid velocity can be used<br />

www.gelifesciences.com/bioprocess 157

---

Examples of prepacked columns<br />

Affinity columns<br />

Gel filtration columns<br />

7<br />

Process development<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiTrap Benzamidine FF (high sub) 2 × 1 mL 17-5143-02<br />

HiTrap Benzamidine FF (high sub) 5 × 1 mL 17-5143-01<br />

HiTrap Benzamidine FF (high sub) 1 × 5 mL 17-5144-01<br />

HiTrap Protein L 5 × 1 mL 17-5478-51<br />

HiTrap Protein L 1 × 5 mL 17-5478-15<br />

HiTrap Protein L 5 × 5 mL 17-5478-55<br />

HiTrap Heparin HP 5 × 1 mL 17-0406-01<br />

HiTrap Heparin HP 1 × 5 mL 17-0407-01<br />

HiTrap Heparin HP 5 × 5 mL 17-0407-03<br />

HiPrep Heparin FF 16/10 1 × 20 mL 28-9365-49<br />

HiPrep IMAC FF 16/10 1 × 20 mL 28-9365-52<br />

HiTrap IMAC FF 5 × 1 mL 17-0921-02<br />

HiTrap IMAC FF 5 × 5 mL 17-0921-04<br />

HiTrap NHS-activated HP 5 × 1 mL 17-0716-01<br />

HiTrap NHS-activated HP 1 × 5 mL 17-0717-01<br />

HiTrap MabSelect SuRe 5 × 1 mL 11-0034-93<br />

HiTrap MabSelect SuRe 1 × 5 mL 11-0034-94<br />

HiTrap MabSelect SuRe 5 × 5 mL 11-0034-95<br />

HiTrap MabSelect 5 × 1 mL 28-4082-53<br />

HiTrap MabSelect 1 × 5 mL 28-4082-55<br />

HiTrap MabSelect 5 × 5 mL 28-4082-56<br />

HiTrap MabSelect Xtra 5 × 1 mL 28-4082-58<br />

HiTrap MabSelect Xtra 1 × 5 mL 28-4082-60<br />

HiTrap MabSelect Xtra 5 × 5 mL 28-4082-61<br />

HiTrap rProtein A FF 2 × 1 mL 17-5079-02<br />

HiTrap rProtein A FF 5 × 1 mL 17-5079-01<br />

HiTrap rProtein A FF 1 × 5 mL 17-5080-01<br />

HiTrap rProtein A FF 5 × 5 mL 17-5080-02<br />

HisTrap FF crude 5 × 1 mL 11-0004-58<br />

HisTrap FF crude 5 × 5 mL 11-0004-59<br />

HisPrep FF 16/10 1 × 20 mL 28-9365-51<br />

GSTrap FF 5 × 1 mL 17-5130-01<br />

GSTrap FF 2 × 1 mL 17-5130-02<br />

GSTrap FF 1 × 5 mL 17-5131-01<br />

GSTrap FF 5 × 5 mL 17-5131-02<br />

GSTPrep FF 16/10 1 × 20 mL 28-9365-50<br />

Note: For complete HiTrap and HiPrep columns offering visit<br />

www.gelifesciences.com/protein-purification<br />

Order online at www.gelifesciences.com/orderonline<br />

Hydrophobic interaction chromatography columns<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiLoad 16/600 Superdex 30 pg 1 × 120 mL 28-9893-31<br />

HiLoad 26/600 Superdex 30 pg 1 × 320 mL 28-9893-32<br />

HiLoad 16/600 Superdex 75 pg 1 × 120 mL 28-9893-33<br />

HiLoad 26/600 Superdex 75 pg 1 × 320 mL 28-9893-34<br />

HiLoad 16/600 Superdex 200 pg 1 × 120 mL 28-9893-35<br />

HiLoad 26/600 Superdex 200 pg 1 × 320 mL 28-9893-36<br />

HiPrep 16/60 Sephacryl S-100 HR 1 × 120 mL 17-1165-01<br />

HiPrep 26/60 Sephacryl S-100 HR 1 × 320 mL 17-1194-01<br />

HiPrep 16/60 Sephacryl S-200 HR 1 × 120 mL 17-1166-01<br />

HiPrep 26/60 Sephacryl S-200 HR 1 × 320 mL 17-1195-01<br />

HIPrep 16/60 Sephacryl S-300 HR 1 × 120 mL 17-1167-01<br />

HiPrep 26/60 Sephacryl S-300 HR 1 × 320 mL 17-1196-01<br />

HiPrep 16/60 Sephacryl S-400 HR 1 × 120 mL 28-9356-04<br />

HiPrep 26/60 Sephacryl S-400 HR 1 × 320 mL 28-9356-05<br />

HiPrep 16/60 Sephacryl S-500 HR 1 × 120 mL 28-9356-06<br />

HiPrep 26/60 Sephacryl S-500 HR 1 × 320 mL 28-9356-07<br />

Order online at www.gelifesciences.com/orderonline<br />

Desalting/Buffer exchange columns<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiTrap Desalting 5 × 5 mL 17-1408-01<br />

HiPrep 26/10 Desalting 1 × 53 mL 17-5087-01<br />

HiPrep 26/10 Desalting 4 × 53 mL 17-5087-02<br />

Order online at www.gelifesciences.com/orderonline<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiPrep Phenyl FF (high sub) 16/10 1 × 20 mL 28-9365-45<br />

HiPrep Phenyl FF (low sub) 16/10 1 × 20 mL 28-9365-46<br />

HiPrep Butyl FF 16/10 1 × 20 mL 28-9365-47<br />

HiPrep Octyl FF 16/10 1 × 20 mL 28-9365-48<br />

HiLoad 16/10 Phenyl Sepharose HP 1 × 20 mL 17-1085-01<br />

HiLoad 26/10 Phenyl Sepharose HP 1 × 53 mL 17-1086-01<br />

HiTrap HIC Selection Kit 7 × 1 mL 28-4110-07<br />

HiTrap Butyl HP 5 × 1 mL 28-4110-01<br />

HiTrap Butyl HP 5 × 5 mL 28-4110-05<br />

HiTrap Butyl-S FF 5 × 1 mL 17-0978-13<br />

HiTrap Butyl-S FF 5 × 5 mL 17-0978-14<br />

HiTrap Butyl FF 5 × 1 mL 17-1357-01<br />

HiTrap Butyl FF 5 × 5 mL 17-5197-01<br />

HiTrap Octyl FF 5 × 1 mL 17-1359-01<br />

HiTrap Octyl FF 5 × 5 mL 17-5196-01<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiTrap Phenyl FF (high sub) 5 × 1 mL 17-1355-01<br />

HiTrap Phenyl FF (high sub) 5 × 5 mL 17-5193-01<br />

HiTrap Phenyl FF (low sub) 5 × 1 mL 17-1353-01<br />

HiTrap Phenyl FF (low sub) 5 × 5 mL 17-5194-01<br />

HiTrap Phenyl HP 5 × 1 mL 17-1351-01<br />

HiTrap Phenyl HP 5 × 5 mL 17-5195-01<br />

Order online at www.gelifesciences.com/orderonline<br />

Order online at www.gelifesciences.com/orderonline<br />

158 www.gelifesciences.com/bioprocess

---

Ion exchange columns<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiLoad 16/10 Q Sepharose HP 1 × 20 mL 17-1064-01<br />

HiLoad 16/10 SP Sepharose HP 1 × 20 mL 17-1137-01<br />

HiLoad 26/10 Q Sepharose HP 1 × 53 mL 17-1066-01<br />

HiLoad 26/10 SP Sepharose HP 1 × 53 mL 17-1138-01<br />

HiPrep Q XL 16/10 1 × 20 mL 28-9365-38<br />

HiPrep SP XL 16/10 1 × 20 mL 28-9365-40<br />

HiPrep DEAE FF 16/10 1 × 20 mL 28-9365-41<br />

HiPrep CM FF 16/10 1 × 20 mL 28-9365-42<br />

HiPrep Q FF 16/10 1 × 20 mL 28-9365-43<br />

HiPrep SP FF 16/10 1 × 20 mL 28-9365-44<br />

HiTrap Capto IEX Selection Kit 5 × 1 mL 28-9343-88<br />

HiTrap IEX Selection Kit 7 × 1 mL 17-6002-33<br />

HiTrap ANX FF (high sub) 5 × 1 mL 17-5162-01<br />

HiTrap ANX FF (high sub) 5 × 5 mL 17-5163-01<br />

HiTrap Capto Q ImpRes 5 × 1 mL 17-5470-51<br />

HiTrap Capto Q ImpRes 5 × 5 mL 17-5470-55<br />

HiTrap Capto SP ImpRes 5 × 1 mL 17-5468-51<br />

HiTrap Capto SP ImpRes 5 × 5 mL 17-5468-55<br />

HiTrap Capto DEAE 5 × 1 mL 28-9165-37<br />

HiTrap Capto DEAE 5 × 5 mL 28-9165-40<br />

HiTrap Capto Q 5 × 1 mL 11-0013-02<br />

HiTrap Capto Q 5 × 5 mL 11-0013-03<br />

HiTrap Capto S 5 × 1 mL 17-5441-22<br />

HiTrap Capto S 5 × 5 mL 17-5441-23<br />

HiTrap CM FF 5 × 1 mL 17-5056-01<br />

HiTrap CM FF 5 × 5 mL 17-5155-01<br />

HiTrap DEAE FF 5 × 1 mL 17-5055-01<br />

HiTrap DEAE FF 5 × 5 mL 17-5154-01<br />

HiTrap Q FF 5 × 1 mL 17-5053-01<br />

HiTrap Q FF 5 × 5 mL 17-5156-01<br />

HiTrap Q HP 5 × 1 mL 17-1153-01<br />

HiTrap Q HP 5 × 5 mL 17-1154-01<br />

HiTrap Q XL 5 × 1 mL 17-5158-01<br />

HiTrap Q XL 5 × 5 mL 17-5159-01<br />

HiTrap SP FF 5 × 1 mL 17-5054-01<br />

HiTrap SP FF 5 × 5 mL 17-5157-01<br />

HiTrap SP HP 5 × 1 mL 17-1151-01<br />

HiTrap SP HP 5 × 5 mL 17-1152-01<br />

HiTrap SP XL 5 × 1 mL 17-5160-01<br />

HiTrap SP XL 5 × 5 mL 17-5161-01<br />

Order online at www.gelifesciences.com/orderonline<br />

Reversed phase chromatography column<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

SOURCE 15RPC ST 4.6/100* 1 17-5068-01<br />

* Column not suitable for use with ÄKTAprime plus chromatography system.<br />

Please contact us for assistance with selection of columns for ÄKTAprime plus or<br />

check the guide Prepacked chromatography columns for ÄKTA system, 28-9317-78.<br />

Order online at www.gelifesciences.com/orderonline<br />

Prepacked columns for purification of<br />

high-quality plasmid DNA<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

PlasmidSelect Xtra Starter Kit 1 28-4052-68<br />

PlasmidSelect Xtra Screening Kit 1 28-4052-69<br />

Order online at www.gelifesciences.com/orderonline<br />

Multimodal chromatography columns<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

HiTrap Capto adhere 5 × 1 mL 28-4058-44<br />

HiTrap Capto adhere 5 × 5 mL 28-4058-46<br />

HiTrap Capto MMC 5 × 1 mL 11-0032-73<br />

HiTrap Capto MMC 5 × 5 mL 11-0032-75<br />

HiTrap Capto Core 700 5 × 1 mL 17-5481-51<br />

Order online at www.gelifesciences.com/orderonline<br />

7<br />

Process development<br />

www.gelifesciences.com/bioprocess 159

---

Selection kits<br />

In addition to the individual columns, there are a number of selection kits<br />

available. These kits usually contain three to seven prepacked columns that<br />

enable you to quickly screen potential media.<br />

IEX Selection Kit<br />

Eight different Sepharose media differentiated by process stage<br />

For Capture, Q Sepharose Big Beads and SP Sepharose Big Beads in 50 mL<br />

packs. For Intermediate Purification, Q Sepharose Fast Flow, SP Sepharose<br />

Fast Flow, CM Sepharose Fast Flow, and DEAE Sepharose Fast Flow in 50 mL<br />

packs. For Polishing, Q Sepharose High Performance and SP Sepharose High<br />

Performance in 1 mL prepacked HiTrap columns.<br />

HiTrap Capto IEX Selection Kit (28-9343-88)<br />

Different ion exchange and multimodal ligands on Capto enable<br />

convenient and easy screening<br />

Contains three different ion exchange ligands and two different multimodal<br />

ligands based on Capto. Prepacked with Capto Q, Capto S, Capto DEAE, Capto<br />

MMC, Capto adhere as well as connectors and detailed instructions.<br />

7<br />

HiTrap IEX Selection Kit (17-6002-33)<br />

Seven different ion exchange ligands on Sepharose Fast Flow and<br />

Sepharose XL enable fast and easy screening<br />

Contains seven 1 mL HiTrap columns prepacked with SP Sepharose Fast Flow,<br />

Q Sepharose Fast Flow, CM Sepharose Fast Flow, DEAE Sepharose Fast Flow,<br />

ANX Sepharose 4 Fast Flow (high sub), SP Sepharose XL and Q Sepharose XL as<br />

well as connectors and detailed instructions.<br />

Process development<br />

HiTrap HIC Selection Kit (28-4110-07)<br />

For screening different HIC media and experimental conditions<br />

Contains seven 1 mL HiTrap columns prepacked with Phenyl Sepharose High<br />

Performance, Phenyl Sepharose 6 Fast Flow (high sub), Phenyl Sepharose 6<br />

Fast Flow (low sub), Butyl Sepharose High Performance, Butyl Sepharose 4<br />

Fast Flow, Butyl-S Sepharose 6 Fast Flow, Octyl Sepharose 4 Fast Flow,<br />

connectors and detailed instructions.<br />

PlasmidSelect Xtra platform kits<br />

PlasmidSelect Xtra Starter Kit (28-4052-68)<br />

Fast and convenient process development<br />

Contains one HiPrep 26/10 Sepharose 6 FF column (53 mL), one HiTrap<br />

PlasmidSelect Xtra column (5 mL) and one HiTrap SOURCE 30Q column (5 mL)<br />

plus accessories. Does not include buffers.<br />

PlasmidSelect Xtra Screening Kit (28-4052-69)<br />

Quick and easy analysis with an ÄKTAdesign system<br />

Contains five 5 mL HiTrap Sepharose HP and five 1 mL HiTrap PlasmidSelect Xtra<br />

columns plus accessories. Does not include buffers.<br />

160 www.gelifesciences.com/bioprocess

---

Custom-packed columns<br />

Custom products adapt the exact combination of media and column to solve<br />

specific purification problems. With years of experience in chromatography and<br />

column packing, you can rely on the Custom <strong>Product</strong>s group to tailor a solution<br />

to fit your separation objectives and save you time. The group works with you<br />

from the initial discussions right through to delivery, establishing your needs and<br />

sorting through the choices.<br />

• Each custom column is packed and tested under ISO 9001 standards<br />

• A result of analysis and user instruction that describe the column performance<br />

is supplied with the column<br />

• Delivery time is between three and five weeks, depending on media and<br />

column specifications<br />

<strong>GE</strong> <strong>Healthcare</strong> offers the largest selection of prepacked columns and bulk media<br />

available, encompassing most liquid chromatography techniques. However,<br />

should you require a special configuration – contact the Custom <strong>Product</strong>s group<br />

through your local <strong>GE</strong> <strong>Healthcare</strong> office to discuss your ideas and receive a free<br />

quotation.<br />

7<br />

Process development<br />

www.gelifesciences.com/bioprocess 161

---

Systems for method and process development<br />

ÄKTA avant system<br />

ÄKTA avant is designed for fast and secure development<br />

of scalable chromatographic methods and processes.<br />

The system is available in two versions: ÄKTA avant 25 is<br />

optimized for media screening and method optimization<br />

using small columns. ÄKTA avant 150 is designed for<br />

scaling up to larger columns, as well as fine-tuning and<br />

robustness testing of the optimized process.<br />

ÄKTA avant is operated by UNICORN 6 software, which has<br />

been developed to increase productivity and efficiency.<br />

This version of UNICORN features an intuitive user<br />

interface, an improved method editor, and integrated<br />

Design of Experiments (DoE) functionality. Using the DoE<br />

functionality in ÄKTA avant, it is not only possible to plan an<br />

experimental series to maximize the amount of information<br />

obtained from a minimum number of experiments; the<br />

system can also run it in an automated fashion, saving<br />

time and money.<br />

For more information on ÄKTA avant, see page 140<br />

7<br />

Process development<br />

ÄKTApilot system<br />

ÄKTApilot system is a bench-top process development and<br />

production system based on the ÄKTA design platform.<br />

The broad dynamic capacity enables easy scale-up/<br />

down. The hygienic design, high level of automation,<br />

accuracy, reproducibility, and reliable operation makes<br />

this an excellent system for scale-up, process optimization,<br />

and production. This design gives a smooth path to cGMP<br />

workflow.<br />

ÄKTApilot and UNICORN software cut preparation times<br />

to a minimum while maintaining accuracy and assuring<br />

reproducibility. This allows quick and simple transfer from<br />

one stage of a project to the next.<br />

The Method Wizard, together with a flexible system<br />

configuration, allows fast and easy purification or column<br />

packing. The system supports you in process development,<br />

scale-up/-down and pharmaceutical production. The<br />

Scouting feature gives automatic support in process<br />

development and optimization.<br />

For more information on ÄKTApilot system, see page 141<br />

162 www.gelifesciences.com/bioprocess

---

7<br />

Process development<br />

www.gelifesciences.com/bioprocess 163

---

8Filtration products<br />

Cross flow filtration 170<br />

Normal flow filtration 189<br />

Filtration hardware 194<br />

164 www.gelifesciences.com/bioprocess

---

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 165

---

Filtration<br />

Cross flow filtration (CFF), normal (”dead-end”) flow filtration<br />

(NFF), and chromatographic separations are all frequently<br />

required in the purification process of biological fluids.<br />

CFF and NFF are “positive barrier” separations and thus<br />

complement chromatography.<br />

<strong>GE</strong> <strong>Healthcare</strong> provides filtration solutions and support<br />

for integrated bioprocessing applications at every step<br />

and every scale of the drug development, validation and<br />

manufacturing process.<br />

The following classes of filtration consumables are available:<br />

• Cassettes<br />

• Cross flow filtration:<br />

– hollow fiber cartridges<br />

– flat sheet cassettes<br />

• Normal flow filtration:<br />

– prefiltration<br />

– final filtration<br />

• Sterile grade filter<br />

For the latest information about our filtration products,<br />

visit www.gelifesciences.com/filtration<br />

Scanning electron microscope Optical microscope Visible to naked eye<br />

Ionic range Molecular range Macro molecular range Micro particle range Macro particle range<br />

Micrometers<br />

(Log scale) 0.001 0.01 0.1 1.0 10 100 1000<br />

Angstrom units<br />

(Log scale)<br />

1<br />

2<br />

3<br />

Approx. molecular wt.<br />

(Saccharide type-no scale) 100 200 1000 10,000 20,000 100,000 500,000<br />

5<br />

8<br />

10 100<br />

1000<br />

4<br />

10<br />

20<br />

30<br />

50<br />

80<br />

200<br />

300<br />

500<br />

800<br />

2000<br />

3000<br />

5000<br />

8000<br />

2<br />

3<br />

5<br />

8<br />

10 5 10 6 10 7<br />

2<br />

3<br />

5<br />

8<br />

2<br />

3<br />

5<br />

8<br />

2<br />

Relative size<br />

of biological<br />

Endotoxin/pyrogen<br />

Albumin protein<br />

materials Rhinovirus HIV<br />

Parainfluenza<br />

Poxvirus-Variola<br />

Yeast cells<br />

Red<br />

blood<br />

cells<br />

Pollen<br />

Adenovirus<br />

Mycobacterium<br />

Virus<br />

Bacteria<br />

Milled flour<br />

8<br />

Relative size<br />

of common<br />

materials<br />

Metal ion<br />

Sugar<br />

Aqueous salts<br />

Gelatin<br />

Carbon black<br />

Latex/emulsion<br />

Paint pigment<br />

Pinpoint<br />

Beach sand<br />

Ion ex.<br />

resin<br />

bead<br />

Filtration products<br />

Process for<br />

separation<br />

Atomic radius<br />

Reverse Osmosis (RO)<br />

Synthetic<br />

dye<br />

Cross Flow Filtration (CFF)<br />

Nano Filtration (NF)<br />

Colloidal silica<br />

Ultra Filtration (UF)<br />

Note: 1 micron (1x10 -6 meters) ≈ 4x10 -5 inches (0.00004 inches); 1 angstrom unit = 10 -10 meters = 10 -4 micrometers (microns)<br />

Micro Filtration (MF)<br />

A.C. fine test dust<br />

Human hair<br />

Normal Flow Filtration (NFF)<br />

Particle Filtration (PF)<br />

<strong>GE</strong> <strong>Healthcare</strong>’s products span a wide range of filtration applications.<br />

166 www.gelifesciences.com/bioprocess

---

Cross Flow<br />

Flow<br />

Pressure<br />

How cross flow membranes work<br />

Permeate Flow<br />

How normal or dead-end flow filters work<br />

Time<br />

Cross Flow<br />

Flow<br />

Feed Flow<br />

Flow<br />

Pressure<br />

Pressure<br />

Permeate Flow<br />

Time<br />

Filtrate Flow<br />

Time<br />

The feed stream moves parallel to the membrane surface (cross flow)<br />

and purified Feed liquid Flowpasses through the membrane (permeate). Most of<br />

the particulates and aggregates are carried Flowaway by the cross flow.<br />

Pressure<br />

The feed stream moves perpendicular to the membrane and<br />

purified liquid passes through the membrane (filtrate). Particulates<br />

and aggregates remain behind as ‘filter cake’, reducing flow and/or<br />

increasing pressure over time.<br />

Filtrate Flow<br />

Time<br />

Filtration – how it works<br />

Membrane filters retain matter primarily due to size<br />

differences between the molecules and the pores in the<br />

membrane. The precise nature of <strong>GE</strong> <strong>Healthcare</strong>’s porous<br />

synthetic membranes used in the CFF product range<br />

provides a range of benefits for bioprocess purification<br />

and recovery. The key advantage of a positive barrier is<br />

<strong>GE</strong> <strong>Healthcare</strong>’s advanced void-free technology, which<br />

allows optimal performance with a wide variety of feed<br />

stream constituents. Our manufacturing technology<br />

provides sharp cut-off to enhance clarification and<br />

fractionation applications. Our filters are engineered<br />

specifically for accurate linear scale-up, and our family<br />

of CFF and NFF devices offers consistent performance,<br />

excellent durability, and ease of use.<br />

Cross flow filtration vs. normal flow filtration<br />

Both technologies purify bioprocess solutions by removing<br />

contaminates with a fixed porous medium, yet each format<br />

has unique advantages. Generally, normal flow filters (NFF)<br />

are used where clarification and/or bio-burden reduction<br />

is desired in relatively low-solid streams, for protecting or<br />

enhancing downstream operations, or when final polishing<br />

is required to achieve sterility. Cross flow filters (CFF) are<br />

best suited for higher solids, more viscous feed solutions,<br />

and/or where concentration or purification of cells or target<br />

species is desired.<br />

The guide below provides further information. Where<br />

functional needs overlap, a <strong>GE</strong> <strong>Healthcare</strong> Filtration<br />

Specialist can help you find the optimal configuration for<br />

your specific operation.<br />

<strong>Guide</strong> to selecting normal flow or cross flow filtration<br />

NFF<br />

MF Range × ×<br />

UF Range ×<br />

High solids handling ×<br />

Diafiltration ×<br />

Concentration ×<br />

Disposable ×<br />

1<br />

Recirculation required ×<br />

Clean & reuse ×<br />

Air applications ×<br />

Aseptic environment × ×<br />

Sterile applications × ×<br />

Integrity-testable × ×<br />

Validation guides × ×<br />

Self-contained available × ×<br />

SIP × ×<br />

Autoclavable × ×<br />

× = suitable for use.<br />

1<br />

some models available; contact <strong>GE</strong> <strong>Healthcare</strong>.<br />

CFF<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 167

---

8<br />

Filtration products<br />

Cross flow filtration<br />

<strong>GE</strong> <strong>Healthcare</strong> separation cassettes and cartridges are<br />

designed for cross flow (tangential flow) operation. Unlike<br />

single pass or normal flow (dead end) filtration, cross flow<br />

filtration continuously sweeps the membrane surface<br />

by circulating the feed stream across it. This circulation<br />

minimizes blinding of the membrane pores and promotes<br />

consistent, long-term productivity. It also allows units to be<br />

cleaned, stored, and re-used as needed.<br />

As the feed stream is pumped through the cassette or<br />

cartridge, the retentate (the materials excluded by the<br />

membrane pores) continues through the recirculation<br />

loop, while the permeate, including solvent and solutes, is<br />

transported through the membrane pores and collected<br />

separately.<br />

Cross flow filtration format selection guide<br />

Attribute Hollow fiber Cassette<br />

Low binding Best Best<br />

Aseptic processing Best Good<br />

Reliable liner scale up Best Best<br />

High solids Best Good<br />

Low solids concentration Good Best<br />

Perfusion Best NR<br />

Cell clarification Best Good<br />

Plasma concentration Good Best<br />

Diafiltration Best Good<br />

Single use Good Good<br />

Laboratory scale Best Best<br />

Low hold up Good Best<br />

UF Best Best<br />

MF Best NA<br />

Steam-in-Place Best NR<br />

Multiple feed channel heights Best Limited<br />

Normal flow filtration<br />

<strong>GE</strong> <strong>Healthcare</strong> provides comprehensive normal flow<br />

filtration products designed to maximize process efficiency<br />

from early-phase product development through to full<br />

bioprocess production.<br />

Liquid sterilization<br />

Filters incorporating high-flow membrane formats minimize<br />

filtration system sizes while meeting full validation and<br />

integrity test requirements.<br />

Bioburden reduction<br />

Extensive range of membrane and depth media products<br />

meet individual application requirements.<br />

Clarification<br />

Range of absolute-rated, prefiltration products providing<br />

consistent performance with broad chemical compatibility.<br />

Range of Normal flow filtration filters<br />

Formats Prefilters Bio-burden<br />

reduction*<br />

Sterilizing grade<br />

Flat disc × × ×<br />

Capsules × × ×<br />

10 in cartridges × × ×<br />

20 in cartridges × × ×<br />

30 in cartridges × ×<br />

Pore sizes<br />

0.1 ×<br />

0.2 × ×<br />

0.45 ×<br />

0.65 ×<br />

1.0 ×<br />

3.0 ×<br />

5.0 ×<br />

10.0 ×<br />

20.0 ×<br />

* 1 to 5 Logs<br />

168 www.gelifesciences.com/bioprocess

---

Systems<br />

<strong>GE</strong> <strong>Healthcare</strong> filtration systems are engineered with<br />

consistent flow paths for straightforward scale-up/<br />

scale-down, easing the transition from research to pilot<br />

to full production. In addition, <strong>GE</strong> <strong>Healthcare</strong> has highly<br />

experienced technical resources available for consultation<br />

and input into process development.<br />

ÄKTAcrossflow<br />

The purification of biomolecules normally uses filtration<br />

to concentrate and wash feed prior to chromatography.<br />

ÄKTAcrossflow is a fully automated system for cross flow<br />

filtration (ultrafiltration/diafiltration and cell separation)<br />

designed for process development and optimization.<br />

ÄKTAcrossflow is suitable for installation in a laboratory<br />

environment, which reduces facility and infrastructure<br />

expenditure. The benchtop system is compact and has a<br />

sanitary design with changeable wetted parts.<br />

UniFlux systems<br />

UniFlux systems provide a highly flexible means<br />

for incorporating filtration solutions into an overall<br />

downstream process. Available in 4 sizes (10, 30, 120,<br />

and 400 Lpm) for pilot to production scales, UniFlux is a<br />

fully automated system with UNICORN control software,<br />

now expanded to encompass filtration as well as<br />

chromatography.<br />

Designed to maximize productivity in cross flow filtration,<br />

UniFlux works in concert with other <strong>GE</strong> <strong>Healthcare</strong><br />

components to provide consistent, repeatable – and<br />

validatable – results. UniFlux was developed with input<br />

from several <strong>GE</strong> <strong>Healthcare</strong> customers with needs ranging<br />

from research and development to biopharmaceutical<br />

manufacturing, thus helping ensure the relevance of each<br />

feature.<br />

All UniFlux systems are skid-mounted, mobile, and can<br />

fit through a standard doorway. The automated systems<br />

include the following features:<br />

• Rotary-lobe pump for reliable, shear-sensitive operation<br />

(diaphragm pump for UniFlux 10)<br />

• Sanitary diaphragm valves<br />

• Overpressure protection<br />

• Zero dead-leg piping in stainless steel<br />

• <strong>Product</strong> contact material 316L stainless steel<br />

• Monitoring of all major process parameters<br />

Automated systems also include the additional benefit<br />

of <strong>GE</strong> <strong>Healthcare</strong> UNICORN control system. UNICORN<br />

software, a single interface for the control of both filtration<br />

and chromatography systems, has become a standard<br />

in the industry with over 25 000 systems in use, many<br />

in approved manufacturing operations. The UNICORN<br />

operating system is an extremely powerful tool for process<br />

development and production control, providing flexibility to<br />

control processes with automatic TMP control or regulated<br />

flow control.<br />

GrandStand pilot/process systems<br />

GrandStand pilot/process systems are self-contained and<br />

designed for MaxCell Large Process Scale Cartridges up<br />

to 13 m 2 . Process volumes range from 50 to 1000 L and<br />

higher.<br />

Kvick cassette systems<br />

The Kvick Lab separation system uses up to five Kvick Lab<br />

cassettes, and includes a 2.5 L reservoir, rotary-lobe pump,<br />

pressure gauges, and necessary valves, piping, connectors,<br />

and fittings. The Kvick Flow system can accommodate up<br />

to 10 Kvick Flow cassettes.<br />

Scale-up<br />

In addition to laboratory-scale cross flow devices and<br />

systems, <strong>GE</strong> <strong>Healthcare</strong> also offers a complete range<br />

of products for biopharmaceutical scale-up to pilot and<br />

production operations. Hollow fiber ultrafiltration and<br />

microfiltration products are supplied as 25 different selfcontained<br />

cartridge designs ranging from 16 cm 2 to 28 m 2<br />

of effective membrane area.<br />

MidGee, MidGee Hoop and Xampler scale hollow fiber<br />

cartridges can be optimized in larger processes by using<br />

pilot scale cartridges/process scale cartridges. Steam-inplace<br />

hollow fiber cartridge elements for pharmaceutical<br />

manufacturing are also available.<br />

Like cartridges, Kvick Cassette offerings provide scalability<br />

from laboratory through pilot to production scale. Both<br />

Kvick Lab System and Kvick Flow System benefit from a<br />

design and engineering approach usually reserved for<br />

large-scale production equipment.<br />

Automated cross flow systems are available for hollow fiber<br />

and Kvick cassettes at laboratory-scale as ÄKTAcrossflow<br />

and at pilot/production-scale as UniFlux.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 169

---

Cross flow filtration<br />

Kvick Start cassettes<br />

Highly selective membranes provide reproducible and<br />

precise separations, thus maximizing yields. The cassettes<br />

are provided with UNF fittings for use with ÄKTAcrossflow,<br />

and with luer lok adapters for use with other systems. Kvick<br />

Start cassettes are available with 50 cm 2 of membrane<br />

surface area and six molecular weight cut-offs (5 kDa,<br />

10 kDa select, 10 kDa, 30 kDa, 50 kDa, and 100 kDa) to fit a<br />

broad range of cross flow applications.<br />

8<br />

Filtration products<br />

Kvick Start cassettes are for research, product<br />

development, lab scale evaluations and process<br />

development where starting material is limited.<br />

• UNF fittings for use in the ÄKTAcrossflow instrument and<br />

Luer-lok adapters for use in virtually all other crossflow<br />

instruments<br />

• Minimal working volume and minimum hold-up volume<br />

gives maximum product recovery<br />

• USP Class VI compliant<br />

• Low extractables<br />

• PES (polyethersulfone) membrane resists a wide range of<br />

chemicals<br />

• Precise, reproducibly selective membranes with a<br />

macrovoid-free structure for exceptional performance<br />

Kvick Start cassettes maximize product recovery by<br />

offering a small-area device capable of handling low<br />

working volumes with minimal hold-up. The cassettes offer<br />

easy setup and linear scalability to facilitate membrane<br />

evaluation trials, product screening, process development<br />

work and optimization of UF processes in downstream<br />

purification. When manifolded together, they allow<br />

concentration or diafiltration of product from less than<br />

15 mL to over 2 L.<br />

Ordering information<br />

Code number Model number Membrane area<br />

(cm 2 )<br />

Cassette<br />

(NMWC)<br />

Quantity<br />

11-0006-02 UFEST0005050ST 50 5000 1<br />

11-0006-04 UFEST0010050SE 50 10 000* 1<br />

11-0006-03 UFEST0010050ST 50 10 000 1<br />

11-0006-05 UFEST0030050ST 50 30 000 1<br />

11-0006-06 UFEST0050050ST 50 50 000 1<br />

11-0006-08 UFEST0100050ST 50 100 000 1<br />

11-0006-61 UFESTCPAK045ST 50 per cassette 5, 10, 10*, 30, 50<br />

and 100 kDa<br />

6<br />

* 10 kDa Select membrane is a tighter 10 kDa membrane and is particularly effective<br />

for recombinant proteins.<br />

Technical specifications<br />

Materials of construction<br />

Housing<br />

Urethane<br />

Membrane<br />

Polyethersulfone<br />

Membrane screen<br />

Polypropylene<br />

Port Sealer<br />

Solvent-free urethane (meth)acrylate blend<br />

Inner plates<br />

Polyester copolymer<br />

Shipping solution<br />

0.1-0.2 N NaOH and 20% to 22% glycerine<br />

Retentate hold-up volume<br />

1.4 mL<br />

Operating Conditions<br />

pH range, long term Storage 2–13<br />

pH range, short term Cleaning 1–14<br />

Maximum operating temperature 50°C<br />

Maximum inlet pressure<br />

4 barg (60 psig)<br />

Typical operating cross flow 27–36 mL/min<br />

170 www.gelifesciences.com/bioprocess

---

Kvick Lab SCU cassette<br />

Ordering information<br />

Code number Model number Membrane area Cassette Qty<br />

(m 2 ) (ft 2 ) (NMWC)<br />

11-0006-73 UFESC0005010SE 0.11 1.2 5000 1<br />

56-4115-30 UFESC0010010SE 0.11 1.2 10 000* 1<br />

56-4115-31 UFESC0010010ST 0.11 1.2 10 000 1<br />

56-4115-32 UFESC0030010ST 0.11 1.2 30 000 1<br />

56-4115-33 UFESC0050010ST 0.11 1.2 50 000 1<br />

56-4115-35 UFESC0100010ST 0.11 1.2 100 000 1<br />

56-4113-70 KLSC010ST Kvick Lab SCU holder 1<br />

* 10 kDa Select membrane is a tighter 10 kDa membrane<br />

Kvick SCU cassette specifications<br />

Materials of construction<br />

Housing<br />

Polyethersulfone<br />

Membrane<br />

Polyethersulfone<br />

Screen<br />

Polypropylene<br />

Encapsulent<br />

Silicone<br />

Preservative solution<br />

0.1-0.2 N NaOH and 20% to 22% glycerine<br />

Hold-up volume<br />

15.5 mL<br />

Recommended operating conditions<br />

pH range, long-term Storage 2 to 13<br />

pH range, short-term Cleaning 1 to 14<br />

Maximum operating temperature 50°C (122°F)<br />

Maximum inlet pressure<br />

3 barg (45 psig)<br />

Operating cross flow rate 850 mL/min (1.2 ft 2 )<br />

Easy use with minimum hold-up volume and maximum<br />

product recovery.<br />

• Precise, reproducibly selective membranes<br />

• Low extractables<br />

• PES (polyethersulfone) membrane resists a wide range of<br />

chemicals<br />

• Anti-dead space technology<br />

• 100% integrity tested<br />

• Macrovoid-free membrane structure for exceptional<br />

performance<br />

• Consistent fluid path for linear scale-up<br />

• USP Class VI compliant<br />

Kvick SCU cassettes give easy set-up, enhanced cleanability,<br />

minimum product hold-up volume, and optimum<br />

membrane selectivity. They are designed for laboratory<br />

work with starting volumes of less than 250 mL to 25 L. The<br />

self-contained holder does not require cassette installation,<br />

thus promoting easy set-up and use.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 171

---

Kvick Lab packets and Kvick Lab cassettes<br />

Ordering information<br />

Code number Model number Membrane area Cassette Quantity<br />

(m 2 ) (ft 2 ) (NMWC)<br />

56-4112-02 UFELA0005001ST 0.009 0.1 5000 1<br />

56-4112-06 UFELA0010001SE 0.009 0.1 10 000* 1<br />

56-4112-04 UFELA0010001ST 0.009 0.1 10 000 1<br />

56-4112-08 UFELA0030001ST 0.009 0.1 30 000 1<br />

56-4112-10 UFELA0050001ST 0.009 0.1 50 000 1<br />

56-4112-14 UFELA0100001ST 0.009 0.1 100 000 1<br />

56-4113-31 UFELA0005010ST 0.11 1.2 5000 1<br />

56-4113-26 UFELA0010010SE 0.11 1.2 10 000* 1<br />

56-4113-25 UFELA0010010ST 0.11 1.2 10 000 1<br />

56-4113-27 UFELA0030010ST 0.11 1.2 30 000 1<br />

56-4113-28 UFELA0050010ST 0.11 1.2 50 000 1<br />

56-4113-29 UFELA0100010ST 0.11 1.2 100 000 1<br />

8<br />

Filtration products<br />

Kvick Lab cassettes are designed for scale-up/scale-down<br />

studies with process volumes from 50 mL to 100 L.<br />

Kvick Lab packet is the smallest filtration device in the line<br />

of Kvick ultrafiltration (UF) cassettes from <strong>GE</strong> <strong>Healthcare</strong>.<br />

Kvick Lab packets are intended for the concentration<br />

and diafiltration of small process volumes ranging from<br />

approximately 50 to 2000 mL. Kvick Lab packets are<br />

specifically designed for use by process development<br />

engineers who are interested in developing process<br />

parameters for an ultrafiltration step that will be<br />

transitioned to full manufacturing scale. Kvick Lab packets<br />

are simple to use and effective for laboratory scientists<br />

with a need for rapid ultrafiltration of biomolecules. Kvick<br />

Lab packet cassettes fit into the Kvick Lab packet cassette<br />

holder, as well as competitive cassette holders.<br />

Kvick Lab cassettes are for laboratory work with starting<br />

volumes of less than 0.5 L up to 100 L. They fit into the<br />

Kvick Lab cassette holder, as well as competitive cassette<br />

holders, allowing existing equipment to benefit from high<br />

product recovery and better flux gains.<br />

The Kvick family of cassettes is designed for easy setup,<br />

simple cleaning, minimum product hold-up volume,<br />

and optimal membrane selectivity. Kvick cassettes are<br />

constructed of identical materials and have identical flow<br />

path geometries to ensure performance scalability and<br />

reproducibility across the full product range.<br />

• Precise, reproducibly selective membranes<br />

• Minimum hold-up volume and maximum product recovery<br />

• Low extractables<br />

• PES (polyethersulfone) membrane resists a wide range of<br />

chemicals<br />

• 100% integrity tested<br />

• Macrovoid-free membrane structure for exceptional<br />

performance<br />

• USP Class VI compliant<br />

* 10 kDa Select membrane is a tighter 10 kDa membrane<br />

Technical specifications<br />

Fit the following holders<br />

Materials of construction:<br />

Membrane<br />

Screen<br />

Encapsulent<br />

Preservative solution<br />

Hold-up volume<br />

Recommended operating conditions<br />

Kvick Lab holders, Kvick Lab packet holders, and<br />

competitive cassette holders<br />

Polyethersulfone<br />

Polypropylene<br />

Silicone<br />

0.1–0.2 N NaOH and 20% to 22% glycerine<br />

2 mL (Kvick Lab packet)<br />

15.5 mL (Kvick Lab)<br />

pH range, long term Storage 2–13<br />

pH range, short term Cleaning 1–14<br />

Maximum operating temperature 50°C<br />

Maximum inlet pressure<br />

Operating cross flow (0.1 ft 2 )<br />

Operating cross flow (1.2 ft 2 )<br />

4 barg (60 psig)<br />

85 mL/min for each cassette installed<br />

850 mL/min for each cassette installed<br />

172 www.gelifesciences.com/bioprocess

---

Kvick Flow cassettes<br />

Kvick Flow cassettes are for batch sizes with 5 to 1000 L<br />

starting volumes.<br />

• Precise, reproducibly selective membranes<br />

• Minimum hold-up volume and maximum product<br />

recovery<br />

• Low extractables<br />

• PES (polyethersulfone) membrane resists a wide range of<br />

chemicals<br />

• Anti-dead space technology<br />

• 100% integrity tested<br />

• Macrovoid-free membrane structure for exceptional<br />

performance<br />

• Consistent fluid path for linear scale-up<br />

• USP Class VI compliant<br />

Kvick Flow cassettes fit into the Kvick Flow cassette holder,<br />

and can also be installed in other cassette holders, allowing<br />

existing equipment to benefit from high product recovery<br />

and better flux gains.<br />

Ordering Information<br />

Kvick Flow cassettes<br />

Code number Model number Membrane area Cassette Qty<br />

(m 2 ) (ft 2 ) (NMWC)<br />

56-4113-49 UFEFL00050505S 0.46 5 5000 1<br />

56-4113-50 UFEFL0010050SE 0.46 5 10 000* 1<br />

56-4113-47 UFEFL0010050ST 0.46 5 10 000 1<br />

56-4113-51 UFEFL0030050ST 0.46 5 30 000 1<br />

56-4113-52 UFEFL0050050ST 0.46 5 50 000 1<br />

56-4113-54 UFEFL0100050ST 0.46 5 100 000 1<br />

56-4113-37 UFEFL0005250ST 2.33 25 5000 1<br />

56-4113-39 UFEFL0010250SE 2.33 25 10 000* 1<br />

56-4113-38 UFEFL0010250ST 2.33 25 10 000 1<br />

56-4113-40 UFEFL0030250ST 2.33 25 30 000 1<br />

56-4113-41 UFEFL0050250ST 2.33 25 50 000 1<br />

56-4113-43 UFEFL0100 250ST 2.33 25 100 000 1<br />

* 10 kDa Select membrane is a tighter 10 kDa membrane<br />

Kvick Flow cassette specifications<br />

Fits the following holders<br />

Materials of construction:<br />

Membrane<br />

Screen<br />

Encapsulant<br />

Preservative solution<br />

Hold-up volume (5 ft 2 )<br />

Hold-up volume (25 ft 2 )<br />

Recommended operating conditions<br />

pH range, long term Storage 2–13<br />

pH range, short term Cleaning 1–14<br />

Maximum operating temperature 50°C<br />

Maximum inlet pressure<br />

Operating cross flow (5 ft 2 )<br />

Operating cross flow (25 ft 2 )<br />

<strong>GE</strong> <strong>Healthcare</strong> Kvick cassette holders, and<br />

competitive cassette holders<br />

Polyethersulfone<br />

Polypropylene<br />

Silicone<br />

0.1–0.2 N NaOH and 20% to 22% glycerine<br />

30 mL per cassette<br />

150 mL per cassette<br />

4 barg (60 psig)<br />

3400 mL/min for each cassette installed<br />

17000 mL/min for each cassette installed<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 173

---

Kvick Lab packet holder<br />

The Packet & Holder combination is designed for:<br />

• Performing crossflow trials in preparation for scale up<br />

• Working with filters that have the same flow path lengths<br />

and geometries as our larger Kvick cassettes<br />

• Applications that require a surface area for processing<br />

larger volumes than is practical by using Kvick Start<br />

cassettes (50 cm 2 ). The holder is designed to also<br />

hold one Kvick Lab (0.11 m 2 ) cassette. Many Packet<br />

applications will involve 200 to 2000 mL of feed material<br />

per Packet (100 cm 2 ).<br />

Ordering information<br />

<strong>Product</strong> Code number Model number Qty<br />

Packet holder 11-0006-70 KLPH001SSU 1<br />

Kvick UNF accessory Kit 11-0006-71 KSP001AKT 1<br />

Kvick Lab packet holder torque wrench 56-4112-84 KLTW0001 1<br />

8<br />

Kvick Lab packet holder<br />

The Kvick Lab packet holder is a versatile device that<br />

houses Kvick Lab packets and facilitates their use on<br />

ÄKTAcrossflow and on other small-scale crossflow systems.<br />

The holder will support linear cross flow versus pressure<br />

drop (DP) through the range of 0.7 and 4 barg (10 and<br />

60 psig), indicating the structural strength of the unit. The<br />

holder is designed with UNF fittings for direct connection<br />

to the <strong>GE</strong> <strong>Healthcare</strong> ÄKTAcrossflow system. It also comes<br />

with an accessory kit for installation onto systems that use<br />

luer-style fittings.<br />

Technical specifications<br />

Materials of construction<br />

Holder<br />

Luer lock adapters<br />

Luer lock adapter gasket<br />

UNF block<br />

316L stainless steel with electropolished inner<br />

surface with Ra less than 0.63 µm (25 µin)<br />

400 stainless steel threaded posts<br />

Polypropylene<br />

EPDM<br />

PEEK<br />

Operating conditions<br />

Long-term storage pH 2–13<br />

Cleaning/sanitization 1–14<br />

Maximum inlet pressure 4 barg (60 psig)<br />

Operating cross flow rate 60 mL/min per 100 cm 2 filter<br />

Literature<br />

Data file for Kvick Lab packet and holder 18-1171-60<br />

User Manual for Kvick Lab packet holder 11-0003-86<br />

Filtration products<br />

174 www.gelifesciences.com/bioprocess

---

Kvick Lab cassette holder<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

Designed for fast assembly, Kvick Lab cassette holder<br />

utilizes sanitary connections.<br />

• Capacity of 1 to 5 Kvick Lab cassettes<br />

• Three forward facing ports for convenience<br />

• Vertical inlet and outlet flow paths for excellent drainage<br />

and product recovery, with less than 30 mL hold-up<br />

volume<br />

• Adjustable stand for ease of use on the laboratory bench<br />

The Kvick Lab cassette holder is for cross flow membrane<br />

separations at volumes from less than 0.5 L to 25 L. The<br />

holder is easy to set-up and quick and convenient to<br />

use. Its design with fewer parts and connections makes<br />

assembly very fast. Drainage and product recovery are<br />

excellent with less than 30 mL hold-up volume. Together,<br />

this holder and Kvick cassettes enable fast and accurate<br />

concentration and diafiltration of biological solutions.<br />

Furthermore, trial data can be scaled quickly to larger<br />

systems. <strong>Product</strong> development scale-up is linear from<br />

laboratory to production.<br />

Kvick Lab Holder (KLHR0105000SS) 1 56-4112-79<br />

Accessories<br />

Diaphragm Valve, stainless steel, 1/2 in sanitary<br />

connections (KFSY01071DV05) 1 56-4112-95<br />

1/2 in Sanitary Clamp (KFSY0107TCL05 ) 1 56-4112-85<br />

1/2 in Sanitary Gasket, EPDM (KFSY0107TCG05) 1 56-4112-86<br />

Kvick Lab Holder torque wrench (KLTW0001) 1 56-4112-84<br />

Kvick Lab Cassette Gasket (KYLAGS001011) 1 56-4113-64<br />

Kvick Lab Cassette Gasket (KYLAGS001033) 3 56-4113-65<br />

In-line pressure gauge, 0–4 barg<br />

(0–60 psig) (KLSY0105PGA60) 1 56-4113-07<br />

Kvick Lab Pressure Gauge Kit (KLSY0105PRKIT) 1 56-4113-69<br />

1/2 in Sanitary to 1/4 in Hose Barb Adaptor<br />

(KLSY0105HB4F01) 1 56-4115-26<br />

1/2 in Sanitary to 3/8 in Hose Barb Adaptor<br />

(KLSY0105HBF01) 1 56-4113-97<br />

Technical specifications<br />

Kvick Lab cassette holders<br />

Feed, retentate and permeate port fittings 1/2 in sanitary<br />

Dimensions (W × L × H)<br />

13.2 × 22.6 × 16.7 cm (5.2 × 8.9 × 6.6 in)<br />

Weight<br />

7.7 kg (17 lb)<br />

Max. temperature<br />

121°C (250°F)<br />

Max. operating pressure<br />

4 bar (60 psi)<br />

Installable membrane area 0.01–0.55 m 2 (0.11–6.0 ft 2 )<br />

System hold-up volume<br />

30 mL<br />

Materials of construction:<br />

Wetted parts<br />

Polished 316L stainless steel, Ra < 0.8 μm<br />

Non-wetted parts<br />

Tie rods, washers, stand: Stainless steel<br />

Tie rod nuts<br />

Bronze<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 175

---

Kvick Flow cassette holder<br />

Specifications<br />

Feed and retentate port fittings<br />

Permeate port fitting<br />

Maximum temperature<br />

Maximum feed pressure<br />

Maximum cassette holding capacity<br />

Holdup volume (nominal)<br />

Dimensions (W × L × H)<br />

Weight<br />

1 in TC<br />

1 in TC<br />

50°C (122°F)<br />

0 to 4 barg (5 to 60 psig)<br />

(15) Kvick Flow 5 or<br />

(3) Kvick Flow 25 cassettes<br />

90 mL, feed/retentate side<br />

8 × 59 × 36 cm (11 × 17 × 14 in)<br />

36 kg (80 lb)<br />

8<br />

Filtration products<br />

Designed for flexibility and ease of use, Kvick Flow cassette<br />

holders may be used for concentration and diafiltration of<br />

biological solutions. With other products in the Kvick family,<br />

trial data can be linearly scaled up or down covering a<br />

great range of scales from laboratory to pilot to production<br />

processes.<br />

Benefiting from a design and engineering approach usually<br />

reserved for large-scale production systems, Kvick Flow<br />

cassette holders provide:<br />

• Three forward facing ports for the convenience of pipe<br />

connection<br />

• Vertically-oriented cassettes for easy installation<br />

• Two versions: hydraulic holder for easy operation and<br />

manual holder for low cost<br />

Materials of construction<br />

Wetted parts:<br />

Front plate (distribution manifold)<br />

Back plate<br />

Other parts:<br />

Tie rods, washers, stand, and spacers<br />

Rail adapter<br />

Tie rod nuts<br />

Ordering Information<br />

Polished 316L stainless steel, Ra < 0.65 μm<br />

Polished 316L stainless steel, Ra < 0.65 μm<br />

316L stainless steel<br />

PTFE<br />

Brass<br />

Code number Model number Description<br />

56-4115-93 KFHR0115000SS Kvick Flow hydraulic holder, US-style power<br />

connection<br />

56-4115-93 KFHR0115000SS20 Kvick Flow hydraulic holder, EU-style power<br />

connection<br />

11-0006-67 KFHR0115TQE Kvick Flow manual holder<br />

56-4113-63 KFLGS001033 Kvick Flow cassette gasket<br />

56-4113-78 KFSY0107CPM10 1 in sanitary CPM-style fitting for pressure<br />

gauge<br />

56-4113-79 KFSY0107APGA100 Pressure gauge, 0–6.9 barg (0-100 psig),<br />

CPM style<br />

56-4113-80 KFSY0107APSW100 Pressure gauge, 0–6.9 barg (0-100 psig),<br />

CPM style<br />

56-4113-89 KFSY0107CPMORI 0.75 in O-ring for CPM fitting<br />

56-4113-17 KFSY0105TCG10 0.5 in sanitary gasket, EPDM<br />

56-4112-88 KFSY0107TCG15 1.5 in sanitary gasket, EPDM<br />

56-4112-89 KFSY0107TCL15 1.5 in sanitary clamp, SS<br />

56-4112-94 KFST01071DV10 1 in sanitary inline diaphragm valve<br />

176 www.gelifesciences.com/bioprocess

---

Start AXM/AXH cross flow cartridges<br />

Start hollow fiber cartridges are comprised of polysulfone<br />

(PS)-based membranes of seven UF molecular weight<br />

ratings and four MF micron ratings for processing a<br />

wide range of cells, viruses, and biomolecules. These<br />

membranes exhibit sharp rejection curves, leading to<br />

reproducible, precise separations and maximized protein<br />

yield. Each of these membranes is identical to membranes<br />

in the <strong>GE</strong> <strong>Healthcare</strong>’s pilot- and process-scale hollow<br />

fiber cartridges to ensure relevance of performance data<br />

generated by using hollow fiber Start AXM and Start AXH<br />

cross flow cartridges.<br />

Hollow fiber Start AXM and Start AXH cross flow cartridges.<br />

• Rapid concentration and/or diafiltration of biological<br />

solutions and suspensions using an open flow path<br />

design<br />

• Integrated UNF fittings for feed, and retentate permeate<br />

connections allows direct connection to ÄKTAcrossflow<br />

system<br />

• Membrane area of 40 cm 2 (AXH) or 50 cm 2 (AXM) allows<br />

direct performance comparison when evaluating multiple<br />

membrane pore sizes<br />

• Standard path lengths of 30 and 60 cm enables accurate<br />

scale-up and scale-down studies<br />

Hollow fiber Start AXM and Start AXH cross flow cartridges<br />

are self-contained, disposable filtration devices. They<br />

enable process development and optimization of<br />

ultrafiltration (UF) and microfiltration (MF) operations for cell<br />

processing and upstream clarification of biopharmaceutical<br />

solutions.<br />

The cartridges are designed for small scale processing,<br />

rapid laboratory concentration, and/or diafiltration of<br />

biological solutions at research-scale volumes with<br />

convenience and speed. The cartridges are easy to use<br />

and minimize membrane polarization due to the “sweeping<br />

action” generated by a recirculation pump. Typical<br />

application areas for Start cross flow cartridges include cell<br />

harvesting and washing, clarification of lysates and cell<br />

cultures, and concentration, diafiltration, and purification<br />

of monoclonal antibodies, plasmids, proteins, viruses,<br />

vaccines, colloids, and plasma.<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

Start AXM (UFP-3-C-2U) 1 11-0005-43<br />

Start AXM (UFP-10-C-2U) 1 11-0005-44<br />

Start AXM (UFP-30-C-2U) 1 11-0005-45<br />

Start AXM (UFP-100-C-2U) 1 11-0005-46<br />

Start AXM (UFP-300-C-2U) 1 11-0005-47<br />

Start AXM (UFP-500-C-2U) 1 11-0005-48<br />

Start AXM (UFP-500-E-2U) 1 11-0005-49<br />

Start AXM (UFP-750-E-2U) 1 11-0005-50<br />

Start AXM (CFP-1-E-2U) 1 11-0005-51<br />

Start AXM (CFP-2-E-2U) 1 11-0005-52<br />

Start AXM (CFP-4-E-2U) 1 11-0005-53<br />

Start AXM (CFP-6-D-2U) 1 11-0005-54<br />

Start AXH (UFP-3-C-H24U) 1 11-0005-37<br />

Start AXH (UFP-10-C-H24U) 1 11-0005-38<br />

Start AXH (UFP-30-C-H24U) 1 11-0005-39<br />

Start AXH (UFP-100-C-H24U) 1 11-0005-40<br />

Start AXH (UFP-300-C-H24U) 1 11-0005-41<br />

Start AXH (UFP-500-C-H24U) 1 11-0005-42<br />

Technical specifications<br />

Start AXM<br />

Start AXH<br />

Diameter 0.6 cm (0.25 in) 0.3 cm (0.125 in)<br />

Path length 30 cm (12 in) 60 cm (24 in)<br />

Connections:<br />

Feed/retentate UNF fitting UNF fitting<br />

Permeate UNF fitting UNF fitting<br />

Membrane area (nominal) 50 cm 2 (7.75 in 2 ) 40 cm 2 (6.2 in 2 )<br />

Hold-up volume (nominal):<br />

Lumen side 1–1.5 mL < 1 mL<br />

Shell side 1 mL < 1 mL<br />

Materials of Construction:<br />

Hollow fibers Polysulfone Polysulfone<br />

Housing components Polysulfone Polysulfone<br />

Potting Epoxy Epoxy<br />

Fitting caps Vinyl Vinyl<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 177

---

MidGee cross flow cartridges<br />

Ordering information<br />

<strong>Product</strong>* Quantity Code number<br />

MidGee Cartridge,100 kD, 0.5 mm lumen<br />

(UFP-100-C-MM01A) 1 56-4100-36<br />

MidGee Cartridge, 100 kD, 1.0 mm lumen<br />

(UFP-100-E-MM06A) 6 56-4100-41<br />

MidGee Cartridge, 10 kD, 1.0 mm lumen<br />

(UFP-10-E-MM01A) 1 56-4100-16<br />

MidGee Cartridge,30 kD, 0.5 mm lumen<br />

(UFP-30-C-MM01A) 1 56-4100-20<br />

MidGee Cartridge, 30 kD, 1.0 mm lumen<br />

(UFP-30-E-MM06A) 6 56-4100-25<br />

MidGee Cartridge, 500 kD, 1.0 mm lumen<br />

(UFP-500-E-MM01A) 1 56-4100-56<br />

MidGee Cartridge, 750 kD, 1.0 mm lumen<br />

(UFP-750-E-MM06A) 6 56-4108-07<br />

MidGee cross flow cartridges are for biological solution<br />

volumes up to 200 mL.<br />

Order online at www.gelifesciences.com/orderonline<br />

* This table shows examples of MidGee cartridges currently available. For complete<br />

product lists and ordering information, please contact your local <strong>GE</strong> <strong>Healthcare</strong><br />

representative.<br />

8<br />

Filtration products<br />

• Rapid concentration and/or diafiltration of critical<br />

biological solutions and suspensions<br />

• Ultrafiltration pore sizes from 1000 to 750 000 NMWC,<br />

microfiltration pore sizes from 0.1 to 0.65 microns<br />

• Maximum product recovery due to cross flow design.<br />

• Sealed system permits convenient, continuous handsfree<br />

diafiltration<br />

• Contaminating proteins and electrolytes can be washed<br />

through membrane fibers and reduced to undetectable<br />

levels<br />

• Low hold-up volume for concentration of 2 to 5 mL<br />

(cartridge hold-up volume 0.5 mL)<br />

• Quick, convenient Luer-Lok connections<br />

MidGee disposable cross flow cartridges are for smallscale<br />

processing, rapid laboratory concentration and/or<br />

diafiltration of biological solution volumes up to 200 mL<br />

with a convenience and speed impossible to achieve with<br />

stirred cells or dialysis tubing. Test data can be used to<br />

linearly scale up to larger cartridge and system designs or<br />

for scale-down process optimization and trouble-shooting<br />

experiments.<br />

Technical specifications<br />

MidGee cross flow cartridges<br />

Diameter<br />

0.3 cm (0.125 in)<br />

Length<br />

30.8 cm (12.125 in)<br />

Endfitting connections<br />

Male Luer-Lok<br />

Permeate connections<br />

Male Luer-Lok<br />

Membrane area (nominal) 16 to 26 cm 2 (2.3–4.03 in 2 )<br />

Hold-up volume (nominal):<br />

Lumen side<br />

0.25 mL<br />

Shell side<br />

0.25 mL<br />

Autoclavable<br />

All except 1000 NMWC models<br />

Materials of construction:<br />

Hollow fibers<br />

Polysulfone<br />

Shell<br />

Polysulfone<br />

Luer Lok fittings<br />

Polycarbonate<br />

Potting<br />

Epoxy<br />

178 www.gelifesciences.com/bioprocess

---

MidGee Hoop cross flow cartridges<br />

MidGee Hoop cross flow cartridges are well-suited for<br />

scaling trials.<br />

• Rapid concentration and/or diafiltration of critical<br />

biological solutions<br />

• Ultra-compact design<br />

• Full range of UF/MF pore sizes and lumen diameters<br />

• 60 and 110 cm path lengths match pilot/production scale<br />

designs<br />

• Autoclavable<br />

• Require minimal solution volume/pump capacity<br />

• High product recoveries with minimal shear denaturation<br />

• No ‘wall effects’ to distort scale-up projections<br />

Throughout the R&D process, access to product is often<br />

limited. As a result, investigations into optimization of<br />

operating conditions are sometimes postponed or avoided<br />

entirely. Now scale-up and scale-down using minimum<br />

product volumes is easy with our MidGee Hoop cross flow<br />

cartridges. Hoop cartridges provide all the critical features<br />

of full production scale in a miniature cross flow device,<br />

allowing simulation of process parameters – including path<br />

length – with minimal solution volume and pump capacity.<br />

The uniform flow path design from laboratory to production<br />

scale makes hollow fibers the most attractive of the various<br />

cross flow configurations for linear scale-up.<br />

Ordering information<br />

<strong>Product</strong>* Quantity Code number<br />

MidGee Hoop Cartridge, 0.1 micron,<br />

1.0 mm lumen, 60 cm (CFP-1-E-H22LA) 1 56-4100-96<br />

MidGee Hoop Cartridge, 0.2 micron,<br />

1.0 mm lumen, 60 cm (CFP-2-E-H22LA) 1 56-4100-97<br />

MidGee Hoop Cartridge, 0.45 micron,<br />

1.0 mm lumen, 60 cm (CFP-4-E-H22LA) 1 56-4100-98<br />

MidGee Hoop Cartridge, 0.65 micron,<br />

0.75 mm lumen, 60 cm (CFP-6-D-H22LA) 1 56-4100-99<br />

MidGee Hoop Cartridge, 100kD,<br />

0.5 mm lumen, 60 cm (UFP-100-C-H24LA) 1 56-4101-03<br />

MidGee Hoop Cartridge, 100kD,<br />

1.0 mm lumen, 60 cm (UFP-100-E-H22LA) 1 56-4100-92<br />

MidGee Hoop Cartridge, 10kD,<br />

0.5 mm lumen, 110 cm (UFP-10-C-H42LA) 1 56-4101-08<br />

MidGee Hoop Cartridge, 10kD,<br />

1.0 mm lumen, 110 cm (UFP-10-E-H22LA) 1 56-4100-89<br />

MidGee Hoop Cartridge, 300kD,<br />

0.5 mm lumen, 60 cm (UFP-300-C-H42LA) 1 56-4101-15<br />

MidGee Hoop Cartridge, 300kD,<br />

1.0 mm lumen, 60 cm (UFP-300-E-H22LA) 1 56-4100-93<br />

MidGee Hoop Cartridge, 30kD,<br />

0.5 mm lumen, 110 cm (UFP-30-C-H42LA) 1 56-4101-10<br />

MidGee Hoop Cartridge, 30kD,<br />

1.0 mm lumen, 60 cm (UFP-30-E-H22LA) 1 56-4100-90<br />

MidGee Hoop Cartridge, 3kD,<br />

0.5 mm lumen, 60 cm (UFP-3-C-H42LA) 1 56-4101-06<br />

MidGee Hoop Cartridge, 500kD,<br />

0.5 mm lumen, 110 cm (UFP-500-C-H42LA) 1 56-4101-17<br />

MidGee Hoop Cartridge, 50kD,<br />

1.0 mm lumen, 60 cm (UFP-50-E-H22LA) 1 56-4100-91<br />

MidGee Hoop Cartridge, 750kD,<br />

1.0 mm lumen, 110 cm (UFP-750-E-H42LA) 1 56-4101-19<br />

* This table shows examples of MidGee Hoop cartridges currently available. For<br />

complete product lists and ordering information, please contact your local<br />

<strong>GE</strong> <strong>Healthcare</strong> representative.<br />

Technical specifications<br />

MidGee Hoop cross flow cartridges<br />

Diameter<br />

0.3 cm (0.125 in)<br />

Length (nominal)<br />

60 cm (23.6 in)<br />

110 cm (43.3 in)<br />

Endfitting connections<br />

Male Luer-Lok<br />

Permeate connections<br />

Male Luer-Lok<br />

Membrane area (nominal) 29–73 cm 2 (4.5–11.3 in 2 )<br />

Hold-up volume (nominal):<br />

60 cm model 0.5 to 1.0 mL each (lumen and shell side)<br />

110 cm model 0.6 to 2 mL each (lumen and shell side)<br />

Materials of construction:<br />

Hollow fibers<br />

Polysulfone<br />

Shell<br />

Polysulfone<br />

Luer Lok fittings<br />

Polycarbonate<br />

Potting<br />

Epoxy<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 179

---

Xampler laboratory cartridges<br />

8<br />

Filtration products<br />

Xampler cartridges can be manifolded together to achieve<br />

a wide range of process requirements.<br />

• Nominal flow path lengths of 30 and 60 cm allow<br />

optimization of process conditions and assist future<br />

scale-up<br />

• Low flow rate requirements allow the use of smaller<br />

pumps<br />

• Polysulfone membrane minimizes non-specific protein<br />

binding and provides high product recovery<br />

• Range of membrane areas suits different processing<br />

needs<br />

• Offered with Tri-Clamp end fittings for quick and easy<br />

aseptic connection<br />

• Autoclavable (with the exception of 1000 NMWC) devices<br />

address the need for small-volume sanitary processing<br />

Xampler ultrafiltration and microfiltration cartridges are for<br />

laboratory scale processing with solution volumes typically<br />

ranging from a few hundred milliliters to about five liters.<br />

Nominal flow path lengths are 30 and 60 cm and<br />

membrane areas range from 0.01 to 0.14 m 2 (0.12 to 1.5 ft 2 ).<br />

Moreover, they are directly scalable to pilot and process<br />

scale cartridges with equivalent path lengths.<br />

Xampler cartridges have self-contained housings that<br />

match Kvick Lab benchtop systems. Vertical operation<br />

achieves complete process fluid drainage and maximum<br />

product recovery.<br />

Ordering information<br />

<strong>Product</strong>* Quantity Code number<br />

Xampler Cartridge, 0.1 micron, 0.75 mm lumen,<br />

size 3M, autoclavable (CFP-1-D-3MA) 1 56-4101-40<br />

Xampler Cartridge, 0.2 micron, 1.0 mm lumen, size<br />

3X2M, autoclavable (CFP-2-E-3X2MA) 1 56-4101-57<br />

Xampler Cartridge, 0.45 micron, 1.0 mm lumen,<br />

size 3M, autoclavable (CFP-4-E-3MA) 1 56-4101-43<br />

Xampler Cartridge, 0.65 micron, 0.75 mm lumen,<br />

size 3M, autoclavable (CFP-6-D-3MA) 1 56-4101-44<br />

Xampler Cartridge, 100kD, 0.5 mm lumen,<br />

size 3M, autoclavable (UFP-100-C-3MA) 1 56-4101-33<br />

Xampler Cartridge, 10kD, 1.0 mm lumen,<br />

size 3M, autoclavable (UFP-10-E-3MA) 1 56-4101-28<br />

Xampler Cartridge, 1kD, 0.5 mm lumen,<br />

size 3M (UFP-1-C-3M) 1 56-4101-20<br />

Xampler Cartridge, 300kD, 0.5 mm lumen,<br />

size 3M, autoclavable (UFP-300-C-3MA) 1 56-4101-35<br />

Xampler Cartridge, 30kD, 1.0 mm lumen,<br />

size 3M, autoclavable (UFP-30-E-3MA) 1 56-4101-30<br />

Xampler Cartridge, 3kD, 0.5 mm lumen,<br />

size 3M, autoclavable (UFP-3-C-3MA) 1 56-4101-22<br />

Xampler Cartridge, 3kD, 0.5 mm lumen,<br />

size 3M, autoclavable (UFP-3-C-3X2MA) 1 56-4101-45<br />

Xampler Cartridge, 500kD, 0.5 mm lumen,<br />

size 3M, autoclavable (UFP-500-C-3MA) 1 56-4101-37<br />

Xampler Cartridge, 50kD, 1.0 mm lumen,<br />

size 3M, autoclavable (UFP-50-E-3MA) 1 56-4101-32<br />

Xampler Cartridge, 5kD, 0.5 mm lumen,<br />

size 3M, autoclavable (UFP-5-C-3MA) 1 56-4101-24<br />

* This table shows examples of Xampler cartridges currently available. For complete<br />

product lists and ordering information, please contact your local <strong>GE</strong> <strong>Healthcare</strong><br />

representative.<br />

Technical specifications<br />

Xampler cross flow cartridges<br />

Diameter:<br />

3M, 3X2M 0.9 cm (0.375 in)<br />

4, 4M, 4X2M 1.9 cm (0.75 in)<br />

Length:<br />

3M<br />

31.7 cm (12.5 in)<br />

3X2M<br />

63.5 cm (25 in)<br />

4 36.2 cm (14.25 in)<br />

4M<br />

34.5 cm (13.6 in)<br />

4X2M<br />

66 cm (26 in)<br />

Endfitting connections:<br />

3M, 3X2M, 4M, 4X2M 0.5 in Tri-Clamp<br />

4 0.375 in Tubing barb<br />

Permeate connections:<br />

3M, 3X2M 0.25 in Tubing nipple<br />

4, 4M, 4X2M 0.375 in Tubing nipple<br />

Membrane area (nominal) 110–1400 cm 2 (17–216 in 2 )<br />

Hold-up volume (nominal):<br />

Lumen side<br />

2–30 mL<br />

Shell side<br />

5–75 mL<br />

Autoclavable<br />

All except 1000 NMWC models<br />

Materials of construction:<br />

Hollow fibers<br />

Polysulfone<br />

Shell<br />

Polysulfone<br />

Potting<br />

Epoxy<br />

Fiber bundle<br />

Polypropylene<br />

180 www.gelifesciences.com/bioprocess

---

Pilot scale hollow fiber cartridges<br />

To bridge the several steps<br />

between research and production<br />

volumes, <strong>GE</strong> <strong>Healthcare</strong> offers<br />

a full range of pilot scale<br />

ultrafiltration and microfiltration<br />

hollow fiber membrane cartridges.<br />

These cartridges feature industry<br />

standard 1.5 in Tri-Clamp sanitary<br />

feed and retentate fittings. Both<br />

30 and 60 cm flowpath lengths<br />

are offered with cartridges that<br />

provide an order-of-magnitude<br />

membrane area span from 0.12<br />

to 1.15 m 2 (1.3 to 12.5 ft 2 ). Please<br />

feel free to contact our technical<br />

support team for guidance with<br />

linear scaling parameters for small<br />

volume processing.<br />

Ordering information for pilot scale microfiltration cartridges<br />

Code number Model number Pore size<br />

(μm)<br />

Fiber ID<br />

(mm)<br />

Membrane area<br />

(m 2 ) (ft 2 )<br />

Nominal flowpath<br />

length (cm)<br />

56-4102-46 CFP-1-D-5A 0.1 0.75 0.16 1.7 30<br />

56-4102-47 CFP-1-E-5A 0.1 1 0.12 1.3 30<br />

56-4102-48 CFP-2-E-5A 0.2 1 0.12 1.3 30<br />

56-4102-49 CFP-4-E-5A 0.45 1 0.12 1.3 30<br />

56-4102-50 CFP-6-D-5A 0.65 0.75 0.16 1.7 30<br />

56-4102-69 CFP-1-D-6A 0.1 0.75 0.37 4 60<br />

56-4102-70 CFP-1-E-6A 0.1 1 0.28 3 60<br />

56-4102-71 CFP-2-E-6A 0.2 1 0.28 3 60<br />

56-4105-61 CFP-2-G-6A 0.2 1.75 0.23 2.5 60<br />

56-4102-72 CFP-4-E-6A 0.45 1 0.28 3 60<br />

56-4102-73 CFP-6-D-6A 0.65 0.75 0.37 4 60<br />

56-4102-86 CFP-1-D-8A 0.1 0.75 0.41 4.4 30<br />

56-4102-87 CFP-1-E-8A 0.1 1 0.36 3.9 30<br />

56-4102-88 CFP-2-E-8A 0.2 1 0.36 3.9 30<br />

56-4102-89 CFP-4-E-8A 0.45 1 0.36 3.9 30<br />

56-4102-90 CFP-6-D-8A 0.65 0.75 0.41 4.4 30<br />

56-4103-09 CFP-1-D-9A 0.1 0.75 0.93 10 60<br />

56-4103-10 CFP-1-E-9A 0.1 1 0.84 9 60<br />

56-4103-11 CFP-2-E-9A 0.2 1 0.84 9 60<br />

56-4105-62 CFP-2-G-9A 0.2 1.75 0.59 6.3 60<br />

56-4103-12 CFP-4-E-9A 0.45 1 0.84 9 60<br />

56-4103-13 CFP-6-D-9A 0.65 0.75 0.93 10 60<br />

8<br />

Filtration products<br />

Note: All pilot scale cartridges are autoclavable except those with 1000 NMWC ultrafiltration membranes.<br />

www.gelifesciences.com/bioprocess 181

---

Ordering information for pilot scale ultrafiltration cartridges<br />

8<br />

Filtration products<br />

Code number Model number Pore size<br />

(NMWC)<br />

Fiber ID<br />

(mm)<br />

Membrane area<br />

(m 2 ) (ft 2 )<br />

Nominal flowpath<br />

length (cm)<br />

56-4102-26 UFP-1-C-5 1000 0.5 0.20 2.1 30<br />

56-4102-28 UFP-3-C-5A 3000 0.5 0.20 2.1 30<br />

56-4102-30 UFP-5-C-5A 5000 0.5 0.20 2.1 30<br />

56-4102-31 UFP-5-E-5A 5000 1 0.12 1.3 30<br />

56-4102-33 UFP-10-C-5A 10 000 0.5 0.20 2.1 30<br />

56-4102-34 UFP-10-E-5A 10 000 1 0.12 1.3 30<br />

56-4102-35 UFP-30-C-5A 30 000 0.5 0.20 2.1 30<br />

56-4102-36 UFP-30-E-5A 30 000 1 0.12 1.3 30<br />

56-4102-37 UFP-50-C-5A 50 000 0.5 0.20 2.1 30<br />

56-4102-38 UFP-50-E-5A 50 000 1 0.12 1.3 30<br />

56-4102-39 UFP-100-C-5A 100 000 0.5 0.20 2.1 30<br />

56-4102-40 UFP-100-E-5A 100 000 1 0.12 1.3 30<br />

56-4102-41 UFP-300-C-5A 300 000 0.5 0.20 2.1 30<br />

56-4102-42 UFP-300-E-5A 300 000 1 0.12 1.3 30<br />

56-4102-43 UFP-500-C-5A 500 000 0.5 0.20 2.1 30<br />

56-4102-44 UFP-500-E-5A 500 000 1 0.12 1.3 30<br />

56-4102-45 UFP-750-E-5A 750 000 1 0.12 1.3 30<br />

56-4102-51 UFP-1-C-6 1000 0.5 0.48 5.2 60<br />

56-4102-52 UFP-3-C-6A 3000 0.5 0.48 5.2 60<br />

56-4102-54 UFP-5-C-6A 5000 0.5 0.48 5.2 60<br />

56-4102-55 UFP-5-E-6A 5000 1 0.28 3 60<br />

56-4102-56 UFP-10-C-6A 10 000 0.5 0.48 5.2 60<br />

56-4102-57 UFP-10-E-6A 10 000 1 0.28 3 60<br />

56-4102-58 UFP-30-C-6A 30 000 0.5 0.48 5.2 60<br />

56-4102-59 UFP-30-E-6A 30 000 1 0.28 3 60<br />

56-4102-60 UFP-50-C-6A 50 000 0.5 0.48 5.2 60<br />

56-4102-61 UFP-50-E-6A 50 000 1 0.28 3 60<br />

56-4102-62 UFP-100-C-6A 100 000 0.5 0.48 5.2 60<br />

56-4102-63 UFP-100-E-6A 100 000 1 0.28 3 60<br />

56-4102-64 UFP-300-C-6A 300 000 0.5 0.48 5.2 60<br />

56-4102-65 UFP-300-E-6A 300 000 1 0.28 3 60<br />

56-4102-66 UFP-500-C-6A 500 000 0.5 0.48 5.2 60<br />

56-4102-67 UFP-500-E-6A 500 000 1 0.28 3 60<br />

56-4102-68 UFP-750-E-6A 750 000 1 0.28 3 60<br />

56-4102-74 UFP-3-C-8A 3000 0.5 0.53 5.7 30<br />

56-4102-76 UFP-10-C-8A 10 000 0.5 0.53 5.7 30<br />

56-4102-77 UFP-30-C-8A 30 000 0.5 0.53 5.7 30<br />

56-4102-78 UFP-50-C-8A 50 000 0.5 0.53 5.7 30<br />

56-4102-79 UFP-100-C-8A 100 000 0.5 0.53 5.7 30<br />

56-4102-80 UFP-100-E-8A 100 000 1 0.36 3.9 30<br />

56-4102-81 UFP-300-C-8A 300 000 0.5 0.53 5.7 30<br />

56-4102-82 UFP-300-E-8A 300 000 1 0.36 3.9 30<br />

56-4102-83 UFP-500-C-8A 500 000 0.5 0.53 5.7 30<br />

56-4102-84 UFP-500-E-8A 500 000 1 0.36 3.9 30<br />

56-4102-85 UFP-750-E-8A 750 000 1 0.36 3.9 30<br />

56-4102-91 UFP-1-C-9 1000 0.5 1.15 12.5 60<br />

56-4102-92 UFP-3-C-9A 3000 0.5 1.15 12.5 60<br />

56-4102-94 UFP-5-C-9A 5000 0.5 1.15 12.5 60<br />

56-4102-96 UFP-10-C-9A 10 000 0.5 1.15 12.5 60<br />

56-4102-97 UFP-10-E-9A 10 000 1 0.84 9 60<br />

56-4102-98 UFP-30-C-9A 30 000 0.5 1.15 12.5 60<br />

56-4102-99 UFP-30-E-9A 30 000 1 0.84 9 60<br />

56-4103-00 UFP-50-C-9A 50 000 0.5 1.15 12.5 60<br />

56-4103-01 UFP-50-E-9A 50 000 1 0.84 9 60<br />

56-4103-02 UFP-100-C-9A 100 000 0.5 1.15 12.5 60<br />

56-4103-03 UFP-100-E-9A 100 000 1 0.84 9 60<br />

56-4103-04 UFP-300-C-9A 300 000 0.5 1.15 12.5 60<br />

56-4103-05 UFP-300-E-9A 300 000 1 0.84 9 60<br />

56-4103-06 UFP-500-C-9A 500 000 0.5 1.15 12.5 60<br />

56-4103-07 UFP-500-E-9A 500 000 1 0.84 9 60<br />

56-4103-08 UFP-750-E-9A 750 000 1 0.84 9 60<br />

Note: All pilot scale cartridges are autoclavable except those with 1000 NMWC ultrafiltration membranes.<br />

182 www.gelifesciences.com/bioprocess

---

Process scale hollow fiber cartridges<br />

Process scale hollow fiber cartridges offered by <strong>GE</strong> <strong>Healthcare</strong> are provided in<br />

eight basic configurations covering a membrane area range of 0.92 to 28 m 2 (9.9<br />

to 300 ft 2 ) depending on the fiber internal diameter.<br />

All of these process scale cartridges feature sanitary connections for both the<br />

feed/retentate and permeate ports. Use of this industry standard makes for<br />

easy connections to tanks, pumps, manifolds, and instrumentation.<br />

<strong>GE</strong> <strong>Healthcare</strong> GrandStand systems are cart-mounted units designed to<br />

accommodate the full range of ultrafiltration and microfiltration process scale<br />

cartridges offered by the company. The various GrandStand configurations are<br />

capable of concentration and/or diafiltration of solution volume ranging from<br />

50 to 1000 L or more.<br />

8<br />

Ordering information for process scale microfiltration cartridges<br />

Code number Model number Pore size<br />

(μm)<br />

Fiber ID<br />

(mm)<br />

Membrane area<br />

(m 2 ) (ft 2 )<br />

Nominal flowpath<br />

length (cm)<br />

56-4103-31 CFP-1-E-35A 0.1 1 0.92 9.9 30<br />

56-4103-32 CFP-2-E-35A 0.2 1 0.92 9.9 30<br />

56-4103-33 CFP-4-E-35A 0.45 1 0.92 9.9 30<br />

56-4103-34 CFP-6-D-35A 0.65 0.75 1 10.8 30<br />

56-4103-69 CFP-1-D-55A 0.1 0.75 2.5 27 60<br />

56-4103-70 CFP-1-E-55 0.1 1 2.1 23 60<br />

56-4103-72 CFP-1-E-55A 0.1 1 2.1 23 60<br />

56-4103-73 CFP-2-E-55 0.2 1 2.1 23 60<br />

56-4103-75 CFP-2-E-55A 0.2 1 2.1 23 60<br />

56-4105-63 CFP-2-G-55 0.2 1.75 1.8 19.4 60<br />

56-4103-76 CFP-4-E-55 0.45 1 2.1 23 60<br />

56-4103-78 CFP-4-E-55A 0.45 1 2.1 23 60<br />

56-4103-79 CFP-6-D-55A 0.65 0.75 2.5 27 60<br />

Filtration products<br />

Note: Process scale microfiltration cartridges with model numbers that end in “A” are autoclavable.<br />

www.gelifesciences.com/bioprocess 183

---

Ordering information for process scale ultrafiltration cartridges<br />

8<br />

Filtration products<br />

Code number Model number Pore size<br />

(NMWC)<br />

Fiber ID<br />

(mm)<br />

Membrane area<br />

(m 2 ) (ft 2 )<br />

Nominal flowpath<br />

length (cm)<br />

56-4103-14 UFP-3-C-35 3000 0.5 1.35 14.5 30<br />

56-4103-16 UFP-5-C-35 5000 0.5 1.35 14.5 30<br />

56-4103-17 UFP-5-E-35 5000 1 0.92 9.9 30<br />

56-4103-19 UFP-10-C-35 10 000 0.5 1.35 14.5 30<br />

56-4103-20 UFP-10-E-35 10 000 1 0.92 9.9 30<br />

56-4103-21 UFP-30-C-35 30 000 0.5 1.35 14.5 30<br />

56-4103-22 UFP-30-E-35 30 000 1 0.92 9.9 30<br />

56-4103-23 UFP-100-C-35 100 000 0.5 1.35 14.5 30<br />

56-4103-24 UFP-100-E-35 100 000 1 0.92 9.9 30<br />

56-4103-25 UFP-300-C-35 300 000 0.5 1.35 14.5 30<br />

56-4103-28 UFP-500-E-35 500 000 1 0.92 9.9 30<br />

56-4103-29 UFP-750-E-35 750 000 1 0.92 9.9 30<br />

56-4103-35 UFP-3-C-55 3000 0.5 3.25 35 60<br />

56-4103-39 UFP-5-C-55 5000 0.5 3.25 35 60<br />

56-4103-41 UFP-5-E-55 5000 1 2.1 23 60<br />

56-4103-43 UFP-10-C-55 10 000 0.5 3.25 35 60<br />

56-4103-45 UFP-10-E-55 10 000 1 2.1 23 60<br />

56-4103-47 UFP-30-C-55 30 000 0.5 3.25 35 60<br />

56-4103-49 UFP-30-E-55 30 000 1 2.1 23 60<br />

56-4103-51 UFP-50-C-55 50 000 0.5 3.25 35 60<br />

56-4103-53 UFP-50-E-55 50 000 1 2.1 23 60<br />

56-4103-55 UFP-100-C-55 100 000 0.5 3.25 35 60<br />

56-4103-57 UFP-100-E-55 100 000 1 2.1 23 60<br />

56-4103-59 UFP-300-C-55 300 000 0.5 3.25 35 60<br />

56-4103-61 UFP-300-E-55 300 000 1 2.1 23 60<br />

56-4103-63 UFP-500-C-55 500 000 0.5 3.25 35 60<br />

56-4103-65 UFP-500-E-55 500 000 1 2.1 23 60<br />

56-4103-67 UFP-750-E-55 750 000 1 2.1 23 60<br />

56-4103-80 UFP-3-C-75 3000 0.5 6 65 110<br />

56-4103-84 UFP-5-C-75 5000 0.5 6 65 110<br />

56-4103-88 UFP-10-C-75 10 000 0.5 6 65 110<br />

56-4103-90 UFP-10-E-75 10 000 1 3.7 40 110<br />

56-4103-92 UFP-30-C-75 30 000 0.5 6 65 110<br />

56-4103-94 UFP-30-E-75 30 000 1 3.7 40 110<br />

56-4103-96 UFP-50-E-75 50 000 1 3.7 40 110<br />

56-4103-98 UFP-100-C-75 100 000 0.5 6 65 110<br />

56-4104-00 UFP-100-E-75 100 000 1 3.7 40 110<br />

56-4104-04 UFP-300-E-75 300 000 1 3.7 40 110<br />

56-4104-06 UFP-500-C-75 500 000 0.5 6 65 110<br />

56-4104-08 UFP-500-E-75 500 000 1 3.7 40 110<br />

56-4104-10 UFP-750-E-75 750 000 1 3.7 40 110<br />

Note: Process scale ultrafiltration cartridges are not autoclavable; however, autoclavable versions of select housing sizes 35 and<br />

55 are available on special order.<br />

184 www.gelifesciences.com/bioprocess

---

MaxCell process scale hollow fiber cartridges<br />

MaxCell cartridges for high-volume, cross flow<br />

bioprocessing applications.<br />

• Exceptional processing economies<br />

• Streamlined design utilizes space very effectively<br />

MaxCell cartridges can be manifolded with spacing as close<br />

as 18 cm (7 in) on center for incorporation into a compact<br />

membrane separations system. System sizing can be<br />

accurately scaled from testing laboratory and pilot scale<br />

cartridges, such as MidGee and Xampler cartridges. In<br />

addition, MaxCell cartridges can be used in place of other<br />

manufacturer’s cartridges.<br />

Ordering information for MaxCell process scale ultrafiltration cartridges<br />

Code number Model number Pore size Fiber ID Membrane area Nominal flowpath<br />

(NMWC) (mm) (m 2 ) (ft 2 ) length (cm)<br />

56-4104-69 UFP-10-C-45 10 000 0.5 3.5 37 30<br />

56-4104-70 UFP-30-C-45 30 000 0.5 3.5 37 30<br />

56-4104-75 UFP-3-C-65 3000 0.5 6.1 66 60<br />

56-4104-77 UFP-5-C-65 5000 0.5 6.1 66 60<br />

56-4104-78 UFP-5-E-65 5000 1 4.4 47 60<br />

56-4104-79 UFP-10-C-65 10 000 0.5 6.1 66 60<br />

56-4104-80 UFP-10-E-65 10 000 1 4.4 47 60<br />

56-4104-81 UFP-30-C-65 30 000 0.5 6.1 66 60<br />

56-4104-82 UFP-30-E-65 30 000 1 4.4 47 60<br />

56-4104-84 UFP-50-E-65 50 000 1 4.4 47 60<br />

56-4104-85 UFP-100-C-65 100 000 0.5 6.1 66 60<br />

56-4104-86 UFP-100-E-65 100 000 1 4.4 47 60<br />

56-4104-87 UFP-300-C-65 300 000 0.5 6.1 66 60<br />

56-4104-88 UFP-300-E-65 300 000 1 4.4 47 60<br />

56-4104-89 UFP-500-C-65 500 000 0.5 6.1 66 60<br />

56-4104-90 UFP-500-E-65 500 000 1 4.4 47 60<br />

56-4104-91 UFP-750-E-65 750 000 1 4.4 47 60<br />

56-4104-95 UFP-3-C-85 3000 0.5 13 140 110<br />

56-4104-98 UFP-5-E-85 5000 1 9 97 110<br />

56-4104-99 UFP-10-C-85 10 000 0.5 13 140 110<br />

56-4105-00 UFP-10-E-85 10 000 1 9 97 110<br />

56-4105-01 UFP-30-C-85 30 000 0.5 13 140 110<br />

56-4105-02 UFP-30-E-85 30 000 1 9 97 110<br />

56-4105-03 UFP-50-C-85 50 000 0.5 13 140 110<br />

56-4105-04 UFP-50-E-85 50 000 1 9 97 110<br />

56-4105-05 UFP-100-C-85 100 000 0.5 13 140 110<br />

56-4105-06 UFP-100-E-85 100 000 1 9 97 110<br />

56-4105-07 UFP-300-E-85 300 000 1 9 97 110<br />

56-4105-08 UFP-500-C-85 500 000 0.5 13 140 110<br />

56-4105-09 UFP-500-E-85 500 000 1 9 97 110<br />

56-4105-10 UFP-750-E-85 750 000 1 9 97 110<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 185

---

Ordering information for MaxCell process scale microfiltration cartridges<br />

Code number Model number Pore size Fiber ID Membrane area Nominal flowpath<br />

(μm) (mm) (m 2 ) (ft 2 ) length (cm)<br />

56-4104-71 CFP-1-E-45 0.1 1 2.5 27 30<br />

56-4104-72 CFP-2-E-45 0.2 1 2.5 27 30<br />

56-4104-73 CFP-4-E-45 0.45 1 2.5 27 30<br />

56-4104-74 CFP-6-D-45 0.65 0.75 2.65 28.5 30<br />

56-4104-92 CFP-1-E-65 0.1 1 4.4 47 60<br />

56-4104-93 CFP-2-E-65 0.2 1 4.4 47 60<br />

56-4104-94 CFP-4-E-65 0.45 1 4.4 47 60<br />

56-4108-12 CFP-6-D-65 0.65 0.75 4.9 53 60<br />

56-4111-77 CFP-1-E-85 0.1 1 9 97 110<br />

56-4106-12 CFP-2-E-85 0.2 1 9 97 110<br />

Accessories for MaxCell process scale cartridges<br />

Code number Model number Description<br />

56-4107-26 RBMX-16PS-ST Straight adaptor for MaxCell cartridge, polysulfone<br />

56-4107-37 KAMX-16PS Straight adaptor kit for MaxCell cartridge, polysulfone.<br />

Kit contains 2 RBMX-16PS-ST polysulfone straight adaptors,<br />

2 polysulfone cartridge end nuts and 2 silicone O-rings.<br />

56-4107-38 KAMX-16EL-PS Elbow adaptor kit for MaxCell cartridge, polysulfone.<br />

Kit contains 2 RBMX-16PS-EL polysulfone elbow adaptors,<br />

2 polysulfone cartridge end nuts, and 2 silicone O-rings.<br />

56-4106-70 CL16-LT 2-in TC toggle clamp, 304 SS<br />

56-4109-98 KG16S 2-in TC silicone gasket, pack of 4<br />

56-4106-92 K04ORS MaxCell O-ring set, 2 silicone O-rings<br />

56-4107-39 SWR-MX01 MaxCell wrench set, standard<br />

56-4107-40 SWR-MX02 MaxCell wrench set, applied torque<br />

MaxCell cartridge physical dimensions<br />

Technical specifications<br />

Housing Diameter Length Endfitting Permeate<br />

size (cm) (in) (cm) (in) connections connections<br />

8<br />

45 10.8 4.25 39.4* 15.5* 2 in sanitary 1.5 in sanitary<br />

65 10.8 4.25 62.5* 24.6* 2 in sanitary 1.5 in sanitary<br />

85 10.8 4.25 120.0* 47.3* 2 in sanitary 1.5 in sanitary<br />

*Add 4.25 in (10.8 cm) for straight adaptors (2) at retentate ends.<br />

Filtration products<br />

MaxCell cartridge membrane area as a function<br />

of housing size and lumen diameter<br />

Housing Membrane Fiber Membrane area<br />

size inner diameter (mm) (m 2 ) (ft 2 )<br />

45 0.5 3.5 37<br />

0.75 2.65 28.5<br />

1 2.3 25<br />

65 0.5 6.1 66<br />

1 4.4 47<br />

85 0.5 13 140<br />

1 9 95<br />

186 www.gelifesciences.com/bioprocess

---

ProCell hollow fiber cartridges<br />

Ordering information<br />

ProCell ultrafiltration cartridges<br />

Code number Model number Pore size Membrane fiber Membrane area<br />

(NMWC) ID (mm) (m 2 ) (ft 2 )<br />

56-4105-13 UFP-10-C-154 10 000 0.5 28 305<br />

56-4105-11 UFP-500-E-152 500 000 1 9 97<br />

56-4105-14 UFP-500-E-154 500 000 1 19.5 210<br />

ProCell microfiltration cartridges<br />

Code number Model number Pore size Membrane fiber Membrane area<br />

(NMWC) ID (mm) (m 2 ) (ft 2 )<br />

56-4105-12 CFP-2-E-152 0.2 1 9 97<br />

ProCell hollow fiber cartridges of 15 cm (6 in) diameter<br />

are for large production scale processes and are installed<br />

inside sanitary stainless steel housings.<br />

• Sanitary design for production scale applications<br />

• Selection of UF/MF pore sizes and lumen diameters<br />

• 316 L stainless steel housings<br />

• Efficient processing of thousands of liters<br />

• Compact design with low hold-up volume<br />

• Multiple cartridges can be manifolded into compact<br />

production systems<br />

ProCell hollow fiber cartridges of 15 cm (6 in) diameter are<br />

for large production scale ultrafiltration and microfiltration.<br />

Containing up to 28 m 2 (300 ft 2 ) of membrane area in a<br />

single, compact module, these cartridges are well suited to<br />

a wide range of bioprocessing applications.<br />

ProCell cartridges are available in two path lengths and<br />

in a selection of ultrafiltration nominal molecular weight<br />

cut-offs and microfiltration pore sizes, as well as several<br />

membrane fiber inner diameters.<br />

ProCell stainless steel housings<br />

(one housing required per cartridge)<br />

Code number Model number Description<br />

56-4106-35 SS-152TC Housing assembly for ProCell – 152M cartridges<br />

316LSS with 2 each gaskets and 2 each clamps<br />

56-4106-36 SS-154TC Housing assembly for ProCell – 154M cartridges<br />

316LSS with 2 each gaskets and 2 each clamps<br />

Accessories for ProCell process scale cartridges<br />

Code number Model number Description<br />

56-4109-96 KG12S 1.5 in TC gasket, silicone, pack of 4<br />

56-4109-98 KG16S 2 in TC gasket, silicone, pack of 4<br />

11-0005-28 KG48S 6 in TC [schedule 5 pipe] gasket, silicone, pack of 4<br />

56-4106-67 CL12 1.5 in TC quick disconnect clamp, 304 SS<br />

56-4106-70 CL16-LT 2 in TC quick disconnect clamp, 304 SS<br />

56-4106-74 CL48 6 in TC [schedule 5 pipe] clamp, 304 SS<br />

56-4106-96 K06ORS ProCell cartridge O-ring set, 2 silicone O-rings<br />

Technical specifications<br />

ProCell housing physical dimensions*<br />

Housing Diameter** Length** Endfitting Permeate<br />

size (cm) (in) (cm) (in) connections connections<br />

152 16.8 6.6 81 32 2 in TC 1.5 in TC<br />

154 16.8 6.6 139 55 2 in TC 1.5 in TC<br />

*Stainless steel housing dimensions.<br />

**Nominal, not for design purposes.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 187

---

Steam-in-place hollow fiber cartridges<br />

Steam-in-place hollow fiber cartridges/housings (STM style)<br />

• Strong polysulfone cartridge elements<br />

• Leak-proof, sanitary closure<br />

• Available in UF and MF pore sizes<br />

Polysulfone cartridge elements have the strength and<br />

integrity to withstand the rigors of steam-in-place<br />

operations. Cartridges slip into stainless steel housings for<br />

safety and containment. A double O-ring seal at the inlet<br />

and outlet of the cartridge element ensures leak-proof,<br />

sanitary closure within the housing.<br />

The element design allows quick yet thorough steam<br />

penetration of the membranes. Furthermore, all cartridge<br />

components are USP Class VI tested. Cartridges are<br />

available in both ultrafiltration (UF) and microfiltration (MF)<br />

pore sizes in a choice of cartridge lengths.<br />

STM cartridge ordering information<br />

STM ultrafiltration cartridges<br />

Code number Model number Pore size Fiber ID Membrane area<br />

(NMWC) (mm) (m 2 ) (ft 2 )<br />

56-4104-13 UFP-30-E-35STM 30 000 1 0.8 8.5<br />

56-4104-14 UFP-100-E-35STM 100 000 1 0.8 8.5<br />

56-4104-27 UFP-500-E-55STM 500 000 1 2.1 23<br />

56-4104-20 UFP-10-C-55STM 10 000 0.5 3.25 35<br />

56-4104-22 UFP-30-C-55STM 30 000 0.5 3.25 35<br />

56-4104-24 UFP-50-C-55STM 50 000 0.5 3.25 35<br />

56-4104-25 UFP-100-C-55STM 100 000 0.5 3.25 35<br />

STM microfiltration cartridges<br />

Code number Model number Pore size Fiber ID Membrane area<br />

(μm) (mm) (m 2 ) (ft 2 )<br />

56-4104-28 CFP-1-E-55STM 0.1 1 2.1 23<br />

56-4104-29 CFP-2-E-55STM 0.2 1 2.1 23<br />

56-4104-30 CFP-4-E-55STM 0.45 1 2.1 23<br />

Accessories for STM steam-in-place cartridges<br />

Code number Model number Description<br />

56-4109-94 KG4S 0.5 in TC gasket, silicone, pack of 4<br />

56-4109-96 KG12S 1.5 in TC gasket, silicone, pack of 4<br />

11-0005-25 KG24S 3 in TC [schedule 5 pipe] gasket, silicone, pack of 4<br />

56-4106-65 CL4 0.5 in TC quick disconnect clamp, 304 SS<br />

56-4106-67 CL12 1.5 in TC quick disconnect clamp, 304 SS<br />

56-4106-71 CL24 3 in TC [schedule 5 pipe] clamp, 304 SS<br />

56-4106-90 K02ORS STM O-ring set, silicone, pack of 8<br />

56-4105-90 VPC4 0.5 in TC permeate-side condensate drain or vent<br />

valve, 316L SS<br />

8<br />

Filtration products<br />

Technical specifications<br />

Cartridge housing assembly<br />

All housing assemblies are of 316L stainless steel with sanitary construction. The<br />

O-ring material is silicone. The retentate and permeate ports are 1.5-in sanitary<br />

clamp configuration allowing for quick and easy connection to steam and process<br />

piping. In operation, the housing should be piped in a vertical orientation. It is<br />

recommended to steam the complete element and housing assembly for 30 minutes<br />

at 121°C to 123°C and at 1 barg (15 psig). Steam should be delivered to both sides of<br />

the membrane to ensure full steam penetration and to minimize the delta P across<br />

the membrane during the steam sterilization cycle. A 0.5-in sanitary clamp port<br />

is positioned on the low point of the housing shell to ensure complete removal of<br />

concentrate.<br />

<strong>GE</strong> <strong>Healthcare</strong> offers a complete SIP protocol. To ensure that the cycle will support<br />

the rigors of a full validation and maximize the cartridge lifetime, <strong>GE</strong> <strong>Healthcare</strong><br />

strongly suggests that customers adhere to all recommendations of the SIP protocol.<br />

188 www.gelifesciences.com/bioprocess

---

Normal flow filtration<br />

ULTA Pure SG<br />

ULTA Pure SG filters have low chemical and protein binding<br />

characteristics, which result in minimal levels of material<br />

lost to adsorption. They can handle a wide range of liquids<br />

across the full pH range including many organic solvents.<br />

The filter cartridges have low extractable levels. The<br />

membrane is inherently hydrophilic and the filters can be<br />

easily and repeatedly integrity tested.<br />

ULTA Pure SG filters feature:<br />

• 0.2 micron polyethersulphone membrane<br />

• Microbially retentive and conforming to ASTM F838-83<br />

methodology<br />

• High throughputs and flow rates<br />

• Low adsorption of chemicals and proteins<br />

• Wide range of chemical compatibility<br />

• Inherently hydrophilic membrane<br />

Technical specifications<br />

ULTA Pure SG utilizes the properties of a patented<br />

microbially retentive polyethersulphone membrane to<br />

provide sterilizing grade filtration to meet the specific needs<br />

of the pharmaceutical industry. ULTA Pure SG membranes<br />

have an asymmetrical pore structure with a high voids<br />

volume, which offers high dirt holding capacity, resulting in<br />

higher throughputs and higher flow rates than symmetrical<br />

membranes.<br />

Filtration area 2 in Capsule 0.05 m 2 (0.6 ft 2 )<br />

Recommended operating conditions 4 in Capsule 0.11 m 2 (1.2 ft 2 ). Capsules may<br />

be operated up to a temperature of 40°C<br />

(104°F) at line pressures up to 5.0 bar (72 psig)<br />

for liquids and 4.0 bar (58 psi) in air/gas.<br />

Materials of construction<br />

Filtration membrane<br />

Polyethersulfone<br />

Upstream support<br />

Polyester<br />

Downstream support<br />

Polyester<br />

Inner core<br />

Polypropylene<br />

Sleeve<br />

Polypropylene<br />

Endcaps (cartridge)<br />

Nylon<br />

Endcap insert<br />

316 stainless steel<br />

Small capsule body (2, 4, 6 in) Nylon<br />

Full size capsule body (5, 10, 20, 30 in) Polypropylene<br />

Capsule vent seals<br />

Silicone<br />

Cartridge o-rings (full size)<br />

Silicone or EPDM<br />

Literature<br />

ULTA Pure SG, Data file 11-0012-06<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong> sales representative.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 189

---

ULTA Pure HC<br />

The inherent low protein binding properties of the HC<br />

membrane minimize product loss due to adsorption. The<br />

filters have low extractable levels and broad chemical<br />

compatibility. The membrane is inherently hydrophilic and<br />

the filters can be easily and repeatedly integrity tested.<br />

ULTA Pure HC features include:<br />

• Optimized membrane configuration allows up to ten<br />

times the throughput to blockage<br />

• Integral prefilter layer can condense filter trains for<br />

greater processing economy<br />

• Sterility tested<br />

• Low adsorption of proteins for minimal loss of expensive<br />

pharmaceutical product<br />

8<br />

Filtration products<br />

ULTA Pure HC capsules and cartridges have been<br />

specifically designed to extend the throughput of a<br />

traditional sterilizing grade filter through the incorporation<br />

of an integral PES pre-filter layer. The optimized ULTA<br />

Pure HC membrane configuration features a highly<br />

asymmetric membrane prefilter layer, which significantly<br />

extends throughput and prevents problems associated<br />

with premature filter blockage with complex solutions.<br />

The integral prefilter layer can also result in compression<br />

of filter trains for greater economy on a wide variety of<br />

intermediate and final sterilizing applications. ULTA Pure HC<br />

cartridge filters are high capacity and fast flowing.<br />

Technical specifications<br />

Filtration area<br />

Recommended operating conditions<br />

Materials of construction<br />

Filtration membrane<br />

Prefiltration membrane<br />

Upstream support<br />

Downstream support<br />

Inner core<br />

Sleeve<br />

Small capsule body (2, 4, 6 in)<br />

Large capsule body (5, 10, 20, 30 in)<br />

Capsule vent seals<br />

Cartridge end caps<br />

Cartridge end cap insert<br />

Cartridge 0-rings (full size)<br />

Literature<br />

0.54 m 2 (5.8 ft 2 ) per 250 mm (10 in) module.<br />

Up to 70°C (158°F) continuous operating<br />

temperature and higher short-term<br />

temperatures during CIP.<br />

Polyethersulfone<br />

Polyethersulfone<br />

Polyester<br />

Polyester<br />

Polypropylene<br />

Polypropylene<br />

Nylon<br />

Polypropylene<br />

Silicone<br />

Nylon<br />

316 stainless steel<br />

Silicone or EPDM<br />

ULTA Pure HC, Data file 28-9094-70<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong> sales representative.<br />

190 www.gelifesciences.com/bioprocess

---

ULTA Prime CG<br />

The cartridges give an LRV > 5 when challenged with<br />

Brevundimonas diminuta in accordance with methods<br />

specified in ASTM F838-05 (10 7 organisms/cm 2 minimum).<br />

Pleated polyethersulfone (PES) membranes combined<br />

with thermal-bonded construction in both capsule and<br />

cartridge formats ensure low extractables and quick flushup<br />

devices. All products are 100% integrity tested before<br />

release and are shipped with a certificate of quality. Filters<br />

are flushed with pharmaceutical-grade purified water prior<br />

to packaging.<br />

Liquid column guard filters for reducing bioburden and<br />

prefiltering upstream solutions.<br />

• Can be repeatedly steam sterilized in situ, autoclaved at<br />

up to 130°C, or sanitized with hot water at up to 90°C<br />

• Compatible with a wide range of chemicals<br />

• Materials conform to the relevant biological safety<br />

requirements of 21 CFR Part 177 and current USP Plastics<br />

Class VI - 121°C and ISO10993 equivalents<br />

• Meet current USP quality standards for oxidizable<br />

substances<br />

• Aqueous extracts from ULTA Prime CG contain<br />

< 0.125 EU/mL when tested in accordance with the<br />

standard (LAL) test for endotoxins<br />

• Effluent quality conforms to the requirements of USP<br />

28 (TOC) and USP 28 (conductivity)<br />

• Full pharmaceutical validation guide available on request<br />

ULTA Prime CG filter cartridges and capsules are specifically<br />

designed for bioburden control and particle retention in<br />

a variety of pH ranges and feed streams. They can act<br />

immediately before chromatography columns and prefilter<br />

solutions upstream of the sterilizing grade filter. For general<br />

bioburden control, they give log reduction of bacteria when<br />

sterility is not required.<br />

Technical specifications<br />

Filtration area<br />

0.54 m 2 (5.8 ft 2 ) per 250 mm (10 in) module.<br />

Recommended operating conditions Up to 70°C (158°F) continuous operating<br />

temperature and higher short-term<br />

temperatures during CIP.<br />

Materials of construction<br />

Filtration membrane<br />

Polyethersulfone<br />

Prefilter membrane<br />

Polyester<br />

Upstream support<br />

Polyester<br />

Downstream support<br />

Polyester<br />

Inner core<br />

Polypropylene<br />

Sleeve<br />

Polypropylene<br />

Endcaps (cartridge)<br />

Nylon<br />

Endcap insert<br />

316 stainless steel<br />

Small capsule body (2, 4, 6 in) Nylon<br />

Full size capsule body (5, 10, 20, 30 in) Polypropylene<br />

Capsule vent seals<br />

Silicone<br />

Cartridge o-rings (full size)<br />

Silicone or EPDM<br />

Literature<br />

ULTA Prime CG, Data file 28-9094-69<br />

ULTA Prime CG capsule and cartridge pleated filters, Validation guide 28-9094-73<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong> sales representative.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 191

---

ULTA Prime GF<br />

ULTA Prime GF cartridges utilize a glass microfiber filter<br />

medium encased within an upstream polypropylene mesh<br />

and a downstream non-woven filter support material. ULTA<br />

Prime GF filter cartridges are dimensionally stable with no<br />

media migration. The pleat pack is supported by an inner<br />

polypropylene core and outer polypropylene cage, heatbonded<br />

to polypropylene end caps. The hydrophilic nature<br />

of ULTA Prime GF filter cartridges also makes them suitable<br />

for gravity-fed systems.<br />

Retention characteristics have been determined through<br />

controlled laboratory tests challenging with a standard<br />

aqueous suspension of ACFTD (AC Fine Test Dust) using online<br />

laser particle counters.<br />

8<br />

Filtration products<br />

Liquid filter cartridges for clarifying, stabilizing and reducing<br />

bioburden in aqueous solutions, media and biologicals.<br />

• High dirt-holding capacity and exceptional flow<br />

performance compared with polypropylene filters<br />

• Compatible with a wide range of chemicals<br />

• Cartridges can be repeatedly steam sterilized in situ,<br />

autoclaved at up to 121°C, or sanitized with hot water at<br />

up to 90°C. Capsules can be repeatedly autoclaved up to<br />

121°C<br />

• Materials conform to the relevant biological safety<br />

requirements of 21 CFR Part 177 current USP Plastics<br />

Class VI – 121°C and ISO10993 equivalents. (Low<br />

concentrations of surfactant maybe present)<br />

• Full pharmaceutical validation guide available on<br />

request.<br />

Technical specifications<br />

Filtration area<br />

Up to 0.6m 2 (6.3ft 2 ) per 250 mm (10 in) module.<br />

Recommended operating<br />

conditions Recommended operating conditions Up to 70°C<br />

(158°F) continuous operating temperature and<br />

higher short-term temperatures during CIP.<br />

Capsules may be operated up to a temperature of<br />

40°C (104°F) at line pressures up to 5.0 barg (72 psi)<br />

for liquids and 4.0 bar (58 psi) in air/gas.<br />

Materials of construction<br />

Filtration membrane<br />

Borosilicate glass microfiber<br />

Upstream support<br />

Polypropylene<br />

Downstream support<br />

Polypropylene<br />

Inner core<br />

Polypropylene<br />

Sleeve<br />

Polypropylene<br />

Endcaps (cartridge)<br />

Polypropylene<br />

Endcap insert<br />

316 stainless steel<br />

Capsule body<br />

Polypropylene<br />

Capsule vent seals<br />

Silicone<br />

Cartridge o-rings (full size) Silicone or EPDM<br />

Literature<br />

ULTA Prime GF, Data file 11-0026-26<br />

ULTA Prime GF capsule and cartridge filters, Validation guide 28-9094-72<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong> sales representative.<br />

192 www.gelifesciences.com/bioprocess

---

ULTA Prime PP<br />

The all-polypropylene construction of ULTA Prime PP<br />

cartridges ensures a wide range of chemical compatibility<br />

and makes them particularly suitable for filtering viscous<br />

and aggressive and chemicals and solvents. Cartridges<br />

do not hydrolyze in aggressive solutions and thus do not<br />

contaminate process fluids.<br />

Filter media of continuously-graded fiber density provide<br />

progressively finer particulate retention throughout<br />

the depth of the media. This, combined with optimized<br />

media pleating density, gives ULTA Prime PP cartridges<br />

exceptional lifetime performance.<br />

Retention characteristics have been determined by a<br />

single-pass technique using suspensions of ISO 12103<br />

Part 1 A2 Fine and A4 Coarse test dust in water.<br />

Liquid filter cartridges for clarifying and prefiltering in<br />

biopharmaceutical and ultra-pure applications.<br />

• Cartridges can be repeatedly steam sterilized in situ,<br />

autoclaved at up to 135°C, or sanitized with hot water at<br />

up to 90°C. Capsules can be repeatedly autoclaved up to<br />

135°C<br />

• Compatible with a wide range of chemicals<br />

• Materials conform to the relevant biological safety<br />

requirements of 21 CFR Part 177 and current USP Plastics<br />

Class VI - 121°C and ISO10993 equivalents<br />

• Full pharmaceutical validation guide available on request<br />

Technical specifications<br />

Filtration area<br />

Up to 0.6m 2 (6.3ft 2 ) per 250 mm (10 in) module.<br />

Recommended operating<br />

conditions Recommended operating conditions Up to 70°C<br />

(158°F) continuous operating temperature and<br />

higher short-term temperatures during CIP.<br />

Capsules may be operated up to a temperature of<br />

40°C (104°F) at line pressures up to 5.0 barg (72 psi)<br />

for liquids and 4.0 bar (58 psi) in air/gas.<br />

Materials of construction<br />

Filtration membrane<br />

Polypropylene<br />

Upstream support<br />

Polypropylene<br />

Downstream support<br />

Polypropylene<br />

Inner core<br />

Polypropylene<br />

Sleeve<br />

Polypropylene<br />

Endcaps (cartridge)<br />

Polypropylene<br />

Endcap insert<br />

316 stainless steel<br />

Capsule body<br />

Polypropylene<br />

Capsule vent seals<br />

Silicone<br />

Cartridge o-rings (full size) Silicone or EPDM<br />

Literature<br />

ULTA Prime PP, Data file 11-0012-07<br />

ULTA Prime PP capsule and cartridge filters, Validation guide 28-9094-71<br />

For ordering information, contact your local <strong>GE</strong> <strong>Healthcare</strong> sales representative.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 193

---

Filtration hardware<br />

ÄKTAcrossflow system<br />

UNICORN control software means one common control<br />

platform and user-interface for all scales of operation in<br />

filtration and chromatography. Scouting gives automatic<br />

support to process development and optimization. Method<br />

wizards and pre-programmed cleaning methods provide a<br />

high degree of efficiency. UNICORN is compatible with all<br />

applicable regulations, including 21 CFR Part 11.<br />

The system is for use with flat sheet cassettes and hollow<br />

fibers. A wide range of cross flow devices include MidGee<br />

hollow fiber cross flow cartridges and Kvick Start flat sheet<br />

cassettes. The cassettes require small working volumes and<br />

are well-suited for ultrafiltration and diafiltration process<br />

development. The cassettes have a surface are of 50 cm 2<br />

and can be combined for a total surface area of 150 cm 2 .<br />

8<br />

Filtration products<br />

Automated cross flow filtration for process development.<br />

• Broad range of applications that cover ultrafiltration and<br />

microfiltration<br />

• Flexible operation of either hollow fiber cartridges or<br />

cross flow cassettes<br />

• Thorough and efficient process development with full<br />

TMP and flux scouting<br />

• Single familiar UNICORN interface for both<br />

chromatography and membrane separations<br />

• No disruption to proteins or cells with low shear force<br />

pumps that require no cooling<br />

• Minimum working volume of 25 mL ensures operation<br />

of complete processes using filters between 40 cm 2 and<br />

150 cm 2<br />

• Supported with hardware product documentation to<br />

simplify validation<br />

• Well-suited for small scale processing of material for<br />

protein or clinical studies<br />

Membrane separations are normally used to concentrate<br />

and wash feed prior to chromatography. ÄKTAcrossflow<br />

is a fully-automated system for cross flow filtration<br />

(ultrafiltration/diafiltration and cell separation) during<br />

process development and optimization. The benchtop<br />

system is compact and has a sanitary design with<br />

changeable wetted parts. It can be installed in a laboratory,<br />

which reduces facility and infrastructure expenditure.<br />

Ordering information<br />

<strong>Product</strong> Quantity Code number<br />

ÄKTAcrossflow 1 18-1180-00<br />

Technical specifications<br />

Operating range<br />

Feed flow rate<br />

1–600 mL/min<br />

Transfer flow rate<br />

0.1–200 mL/min<br />

Permeate flow rate<br />

0.1–200 mL/min<br />

Max. system pressure<br />

5.2 bar (75.4 psi)<br />

Min. recirculation volume<br />

less than 25 mL (excluding cartridge)<br />

Detection and control<br />

Pressure transducers<br />

Less than ± 0.01 bar (0.15 psi)<br />

TMP control accuracy<br />

Less than ± 0.05 bar (0.73 psi)<br />

Literature<br />

Data file<br />

ÄKTAcrossflow systems 11-0032-71<br />

194 www.gelifesciences.com/bioprocess

---

UniFlux systems<br />

The UniFlux series is a line of cross flow filtration<br />

(CFF) systems that utilizes UNICORN software for full<br />

automation with data logging capabilites over the entire<br />

cross flow process. The systems are intended for pilot<br />

through production scale biological separations. They<br />

are available in four sizes and are capable of processing<br />

batches of 1 to 10 000 L of feed material. The systems<br />

are configured to operate hollow fiber cartridges suited<br />

for microfiltration applications such as cell clarification/<br />

harvesting, or cassettes/hollow fibers for ultrafiltration<br />

applications, such as protein concentration and diafiltration<br />

in downstream unit operations.<br />

UniFlux systems offer:<br />

• Flexible operation with either hollow fiber or cross flow<br />

cassettes<br />

• A broad range of applications covering both ultrafiltration<br />

and microfiltration<br />

• Single, familiar UNICORN interface for both<br />

chromatography and filtration<br />

• Reduced need for manual controls<br />

• Extensive real time data logging and reporting function<br />

Typical applications<br />

• Monoclonal antibody clarification/concentration<br />

• Recombinant protein concentration<br />

• Vaccine concentration/purification<br />

• Plasma purification/concentration<br />

• Cell harvesting/clarification<br />

System design<br />

UniFlux systems are designed to allow linear scalability for<br />

both hollow fiber and cassette filters, and for system sizes<br />

varying from lab to manufacturing scale. Zero dead-leg<br />

drain valves eliminate dead spaces during processing and<br />

cleaning. Low working/hold-up volumes ensure higher<br />

concentration factor capabilities, along with maximal<br />

recovered product. In addition, over-pressure monitoring<br />

protects membranes and hardware during operation. The<br />

standardized UniFlux design allows for short delivery lead<br />

times as well as simple and rapid upgrade possibilities. The<br />

system utilizes castors, which allow easy movement and<br />

passage through standard doorways.<br />

System components<br />

The UniFlux systems offer a flexible, configurable design.<br />

System components include:<br />

• Positive displacement type pump for low shear, negligible<br />

heat generation, and reliable operation. For the UniFlux<br />

10 system, a diaphragm pump is supplied; for larger<br />

systems, a rotary lobe pump is provided.<br />

• Automatic, sanitary diaphragm valves with position<br />

switches<br />

• Pressure sensors on feed, retentate, and permeate<br />

• Temperature sensor on retentate<br />

• Magnetic flowmeter on feed<br />

• Mass flowmeter on permeate line for UniFlux 30, 120, and<br />

400 systems. Magnetic flowmeter on permeate line of the<br />

UniFlux 10 system.<br />

• Hydraulic unit to compress cassette for UniFlux 30, 120<br />

and 400 systems. For enhanced safety the hydraulic<br />

pressure and generated force are monitored in UNICORN.<br />

• Zero dead leg piping in 316L stainless steel<br />

• Wetted surface finish Ra: System < 0.6 μm casette holder<br />

< 0.8 μm<br />

Integrated tanks<br />

CFF processes require a tank to feed the filter and to collect<br />

retentate. The tank is normally an integral part of the<br />

system and plays a major role in mixing, measurements,<br />

and minimizing recirculation volume. When running<br />

automated CFF, a tank needs to communicate with system<br />

control in order to enable a fully automated process. <strong>GE</strong><br />

<strong>Healthcare</strong> offers a series of tanks that communicate<br />

with UNICORN, allowing fully automated control of the<br />

tank sensors and mixer. Weight and volume in the tank<br />

are also monitored via UNICORN, allowing for control of<br />

concentration or diafiltration.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 195

---

Ordering information<br />

UniFlux systems, tanks, and accessories can be ordered through <strong>GE</strong> <strong>Healthcare</strong>’s online configurator.<br />

For assistance in placing your order, please contact your local <strong>GE</strong> <strong>Healthcare</strong> representative.<br />

System performance UniFlux 10 UniFlux 30 UniFlux 120 UniFlux 400<br />

Hollow fiber membranes<br />

Number of cartridges 1 1 2 up to 4 1<br />

Min/Max area (ft 2 ) 1.3/5.2 9.9/65 19.8/130 108/560<br />

Min/Max area (m 2 ) 0.12/0.48 0.92/6 1.8/12 10/52<br />

Cartridge size 5 or 6 35, 55, or 75 35, 55, or 75 45, 65, or 85<br />

Lumen diameter<br />

Consult your <strong>GE</strong> <strong>Healthcare</strong> representative for application specific information.<br />

1<br />

Number of cartridges possible to run in the system will be application dependent. Consult your <strong>GE</strong> <strong>Healthcare</strong> representative for further information.<br />

Cassette filters<br />

Number cassette holders 1 1 2 6<br />

Min/Max cassettes 1/5 Kvick Lab 1/10 Kvick Flow 2/20 Kvick Flow 6/60 Kvick Flow<br />

Min/Max area (ft 2 ) 1.2/6 5/50 10/100 30/300<br />

Min/Max area (m 2 ) 0.11/0.55 0.46/4.6 0.92/9.2 2.76/27.6<br />

System specifications<br />

Max recirculation flow rate 10 Lpm @ 4 bar 60 Lpm @ 4 bar 120 Lpm @ 4 bar 400 Lpm @ 4 bar<br />

Min recirculation flow rate 0.5 Lpm @ 4 bar 3 Lpm @ 4 bar 12 Lpm @ 4 bar 40 Lpm @ 4 bar<br />

Feed connection 1/2 in (TC25) 1 in (TC50) 1 ½ in (TC50) 3 in (TC91)<br />

Retentate connection 1/2 in (TC25) 1 in (TC50) 1 ½ in (TC50) 2 in (TC64)<br />

Permeate connection 3/8 in (TC25) 1/2 in (TC25) 3/4 in (TC25) 1 in (TC50)<br />

Feed tank capacity (L) 5 or 10 50 or 100 100, 250, or 600 600<br />

System hold up volume (L) 0.2 2 1 3 17<br />

System dimensions (W × L × H, mm) 750 × 860 × 2010 920 × 2000 × 1790 920 × 2070 × 1850 890 × 1660 × 1790<br />

Cassette membrane cart<br />

dimensions (W × L × H, mm) N/A N/A N/A 920 × 1410 × 1820<br />

Hollow fiber cart dimensions<br />

(W × L × H, mm) N/A N/A N/A 750 × 1060 × 1950<br />

2<br />

The tank is included in the system hold up volume as tank is mounted on the UniFlux 10 system skid.<br />

8<br />

Filtration products<br />

Tank specifications<br />

Tank size 50 100 250 600<br />

Working volume (L) 50 100 250 600<br />

Total volume (L) 66 127 378 890<br />

Tank skid dimensions (W × L × H, mm) 780 × 1190 × 1470 850 × 1270 × 1650 850 × 1380 × 1990 1340 × 1750 × 2100<br />

System compatibility UniFlux 30 UniFlux 30 or 120 UniFlux 120 UniFlux 120 or 400<br />

Minimum working volume tank 3 (L) 5.5 5.5 10 10<br />

3<br />

For total minimum working volume add the hold up volume for the UniFlux system.<br />

Utility requirements<br />

Compressed air<br />

6–10 Barg (87–145 psig). Dry particle free, non-condensing<br />

Power requirements<br />

Pump, hydraulic unit:<br />

UniFlux 30, 120, 400<br />

3-Phase, 400/480 VAC; 50/60 Hz; 10A to 30A<br />

UniFlux 10 1-Phase; 110/230 VAC; 50/60 Hz; 16/10A<br />

Control system hardware<br />

1-Phase; 110/230 VAC; 50/60 Hz; 16A<br />

Note: Power to the tanks is supplied from the UniFlux system.<br />

Literature<br />

Data file<br />

UniFlux system 18-1177-25<br />

196 www.gelifesciences.com/bioprocess

---

GrandStand pilot/process systems<br />

The GrandStand pilot/process system is a versatile, cartmounted<br />

system intended for pilot through production<br />

scale biological separations from 50 to 10 000 L. It<br />

accommodates ultrafiltration and microfiltration hollow<br />

fiber cartridges. The GrandStand system is capable of<br />

concentration and/or diafiltration.<br />

Feature rich basic system<br />

The basic GrandStand system consists of a heavy-duty<br />

stainless steel frame, positive displacement rotary lobe<br />

pump for gentle recirculation of biological solutions,<br />

diaphragm type backpressure valve, sanitary inlet and<br />

outlet pressure gauges, and a cone bottom clean-inplace<br />

(CIP) tank. A programmable AC inverter features a<br />

multitude of functions including the ability to set the pump<br />

acceleration time as well as to monitor pump speed. A<br />

high-pressure switch is incorporated for equipment and<br />

operator safety.<br />

Robust streamlined design<br />

The GrandStand system’s narrow profile allows it to fit<br />

through standard door openings for easy transport from<br />

the lab to the cold room to the manufacturing area.<br />

Heavy-duty swivel casters with a total locking feature<br />

provide mobility and stability. The system is designed<br />

to interchange easily between process and cleaning<br />

cycles. The modular design enhances the versatility of the<br />

GrandStand system to address changing needs associated<br />

with scale-up and sophistication from pilot to process scale.<br />

Modular kits enhance the flexibility of the GrandStand<br />

systems to meet the needs of process development and<br />

process manufacturing groups without the delivery issues<br />

associated with custom systems. Simply purchase the<br />

base system and the modules needed for your specific<br />

application. The system and selected modules ship<br />

together with easy instructions to assemble them on site.<br />

A service option is available for on site assembly combined<br />

with IQ/OQ. For those with changing requirements, simply<br />

select the modules that provide the necessary system<br />

upgrade thereby eliminating the need to purchase a<br />

completely new system.<br />

Available modules facilitate customization for:<br />

• Varying process volumes<br />

• Data acquisition<br />

• Flow rate<br />

• Pressure<br />

• Temperature<br />

• Conductivity<br />

• UV<br />

• Permeate flow control<br />

• Steam-in-place (SIP)<br />

GrandStand system specifications<br />

Base system GrandStand 450 GrandStand 550<br />

Weight (approximate) 1576 lb (715 kg) 1876 lb (851 kg)<br />

Materials of construction:<br />

Frame 304 stainless steel 304 stainless steel<br />

Fluid path 316 L stainless steel 316 L stainless steel<br />

Fluid path surface finish < 20 Ra μ in (0.5 Ra μm) < 20 Ra μ in (0.5 Ra μm)<br />

CIP tank 15 gal. Polypropylene 30 gal. Polypropylene<br />

Pump type Rotary lobe Rotary lobe<br />

Max Pump Flow rate 120 L/min@ 30 psig 400 L/min@ 30 psig<br />

O-rings, gaskets,<br />

valve diaphragms EPDM EPDM<br />

Power requirements<br />

230/460 vac 3 Phase 50/60 Hz (except 380 vac 3 Phase<br />

50/60 Hz for GSMRLP450380V and GSM550380V)<br />

System dead volume* 9.5 L 18.9 L<br />

*Approximate base system without tank or filter cartridge<br />

Note: To determine minimum working volume, add volume of filter holder, tank<br />

working volume to system dead volume.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 197

---

Ordering information<br />

Code Number Catalog Number Description<br />

Base System<br />

28-4005-31 GSMRLP550SYS 4 GrandStand 550 Modular System<br />

28-4005-32 GSMRLP450SYS 4 GrandStand 450 Modular System<br />

28-4004-48 GSMRLP550380V 4 GrandStand 550 Mod Sys 380VAC<br />

28-4004-49 GSMRLP450380V 4 GrandStand 450 Mod Sys 380VAC<br />

28-4004-53 GSMRLP550440V 4 GrandStand 550 Mod Sys 440VAC<br />

28-4004-54 GSMRLP450440V 4 GrandStand 450 Mod Sys 440VAC<br />

Filter Modules<br />

28-4005-45 GSM550HF4KIT GS 550 HF 4 Position Exp. Kit<br />

Data Acquisition<br />

28-4005-34 GSMDAQENCLKIT 1 GrandStand PLC Enclosure<br />

28-4005-35 GSMDAQPRESTRA 0–150 psig Pressure Transmitter<br />

28-4005-36 GSMDAQTEMPKIT Temperature Transmitter<br />

28-4004-46 GSMDAQMFM550 GS 550 Magnetic Flow Meter<br />

28-4004-47 GSMDAQMFM450 GS 450 Magnetic Flow Meter<br />

28-4005-38 GSMDAQUV1KIT 280 μm UVSensor With Display<br />

28-4005-39 GSMDAQCONTRA Conductivity Sensor With Display<br />

SIP Modules<br />

28-4005-40 GSMSIPCMPKIT GS HF SIP Manifold Kit<br />

56-4106-27 SS-35STM 3 Housing assembly for-35STM cartridges<br />

56-4106-28 SS-55STM 3 Housing assembly for-55STM cartridges<br />

56-4106-29 SS-35SMO-DP 3 Housing assembly for-35SMO cartridges<br />

56-4106-30 SS-55SMO-DP 3 Housing assembly for-55SMO cartridges<br />

56-4106-31 SS-45MSM-DP 3 Housing assembly for-45MSM cartridges<br />

56-4106-32 SS-65MSM-DP 3 Housing assembly for-65MSM cartridges<br />

56-4106-33 SS-85MSM-DP 3 Housing assembly for-85MSM cartridges<br />

56-4106-34 SS-85MSM-EL-DP 3 Housing assembly for-85MSM cartridges<br />

Permeate Pump<br />

28-4005-41 GSM450PERPRP GS 450 Permeate Pump Kit<br />

28-4005-42 GSM550PERPRP GS 550 Permeate Pump Kit<br />

28-4005-43 GSM550PERPRH GS 550 Add on Permeate Pump Head<br />

Service<br />

44-8200-07 44-8200-07 2 GrandStand Module Assembly to System and IQ/OQ<br />

8<br />

1<br />

GSMDAQENCLKIT is required to power any data acquisition module that is purchased.<br />

2<br />

Assembly of module kits is not available without IQ/OQ service.<br />

3<br />

Items are not included in modular accessory kits and must be purchased separately.<br />

4<br />

Includes one set of documentation. Additional set of documents can be supplied at an aditional cost.<br />

Filtration products<br />

198 www.gelifesciences.com/bioprocess

---

Customized filtration hardware<br />

<strong>GE</strong> <strong>Healthcare</strong> provides a wide range of customized solutions<br />

for your filtration needs. UniFlux systems can be customized<br />

to operate with hollow-fiber cartridges or cassettes/hollow<br />

fibers. In addition, integrated tanks can be customized (with<br />

valves, sensors, mixers, cooling jackets, hoses) to fit particular<br />

filtration needs. The flexible UNICORN control system can also<br />

be customized to match any desired hardware modifications.<br />

To explore the possible customized<br />

filtration possibilities, please<br />

contact your local <strong>GE</strong> <strong>Healthcare</strong><br />

representative.<br />

8<br />

Filtration products<br />

www.gelifesciences.com/bioprocess 199

---

9Protein interaction and stability analysis<br />

Biacore systems 202<br />

MicroCal systems 206<br />

200 www.gelifesciences.com/bioprocess

---

Protein interaction and stability analysis<br />

9<br />

www.gelifesciences.com/bioprocess 201

---

Biacore systems<br />

Protein interaction and stability analysis<br />

Biacore systems characterize<br />

molecules in terms of their:<br />

• specificity and selectivity of<br />

interaction<br />

• on and off rates (kinetics)<br />

• binding strength (affinity)<br />

Biacore systems allow for rapid,<br />

label-free interaction analyses, giving<br />

deeper insights into the interactions<br />

of proteins with other molecules, and<br />

leading to better decision making<br />

and increased productivity. The<br />

wealth of information provided by<br />

Biacore systems – binding kinetics,<br />

affinity, specificity, selectivity, and<br />

concentration measurement – is<br />

invaluable across many applications<br />

such as unraveling molecular<br />

mechanisms, fragment screening,<br />

vaccine research, antibody<br />

characterization, immunogenicity<br />

testing, process development, and<br />

quality control.<br />

The systems also provide sensitive<br />

binding activity measurements.<br />

This is based on the ability of the<br />

biomolecule of interest to interact<br />

with a specific binding partner, and<br />

may therefore be more informative<br />

than generic measurement techniques<br />

(e.g., total protein concentration).<br />

For more information, please visit:<br />

www.gelifesciences.com/biacore<br />

9<br />

202 www.gelifesciences.com/bioprocess

---

Biacore T200<br />

Work in GxP-regulated environments<br />

An optional GxP package allows Biacore T200 to integrate<br />

seamlessly into GxP-regulated workflows. The package<br />

provides software supporting GLP/GCP/GMP and 21 CFR<br />

Part 11 compliance, and includes validation support. For<br />

full validation support during the lifetime of the system,<br />

the package can be supplemented with <strong>GE</strong> <strong>Healthcare</strong><br />

Validation GxP service agreements.<br />

Technical specifications<br />

<strong>Product</strong>ive research and development<br />

Biacore T200 offers a versatile, multi-application solution<br />

for detailed studies of biomolecular interactions – in<br />

real time with exceptional sensitivity. Wizard-supported<br />

software for assay development, analysis, data evaluation<br />

and interpretation makes the system straightforward<br />

to use. Applications, such as antibody characterization,<br />

which could take a week by conventional methods, can be<br />

completed in days.<br />

The performance and versatility of Biacore T200 system<br />

allows users to:<br />

• Perform time-and cost-efficient concentration analyses<br />

in vaccine development<br />

• Select and characterize antibodies as research tools,<br />

assay components or therapeutics by fully defining their<br />

interaction behavior (e.g., on/off rates)<br />

• Define potential drug targets and diagnostic markers<br />

• Detect and characterize immune responses (e.g., anti-drug<br />

antibodies) during preclinical and clinical development<br />

• Increase understanding of molecular mechanisms and<br />

structure-function relationships<br />

• Select and optimize lead compounds during drug<br />

discovery<br />

Detection technology<br />

Surface Plasmon Resonance (SPR) biosensor<br />

Information provided<br />

Kinetic and affinity data (KD, ka, kd), specificity,<br />

selectivity, concentration, and thermodynamics<br />

data<br />

Data presentation<br />

Result tables, result plots and real time monitoring<br />

of sensorgrams<br />

Analysis time per cycle<br />

Typically 2–15 min<br />

Automation<br />

48 h unattended operation<br />

Sample type<br />

Low MW drug candidates to high molecular<br />

weight proteins (also DNA, RNA, polysaccharides,<br />

lipids, cells and viruses), in various sample<br />

environments (e.g., in DMSO-containing buffers,<br />

plasma, serum<br />

Required sample volume Injection volume + 20–50 µL (application<br />

dependent)<br />

Injection volume 2–350 µL<br />

Flow rate range<br />

From 1–100 µL/min<br />

Flow cell volume 0.06 µL<br />

Flow cell height 40 µm<br />

Sample/reagent capacity 1 × 96, or 384 well microplate + up to 33 reagent<br />

vials<br />

Analysis temperature range 4°C to 45°C (maximum 20°C below ambient<br />

temperature)<br />

Sample storage<br />

4°C to 45°C (maximum 15°C below ambient<br />

temperature)<br />

Sample refractive index range 1.33–1.40<br />

Buffer selector<br />

Automatic switching between 4 buffers<br />

Inline reference subtraction Automatic<br />

Literature<br />

Code number<br />

Brochure: Biacore T200 28-9794-12<br />

Data file: Biacore T200 28-9794-15<br />

Data file: Biacore T200 GxP Package 28-9809-50<br />

Data file: Biacore T200 Upgrade Kit 28-9794-14<br />

White Paper: Outstanding sensitivity for<br />

confident label-free interaction analysis 28-9794-20<br />

Protein interaction and stability analysis<br />

9<br />

www.gelifesciences.com/bioprocess 203

---

Biacore C<br />

Validation support<br />

Biacore C is fully supported with validation services,<br />

including Installation and Operational qualification (IQ/<br />

OQ) documentation upon system delivery and on-site IQ/<br />

OQ performance by a certified <strong>GE</strong> <strong>Healthcare</strong> engineer. To<br />

maintain the system in a validated state, a maintenance<br />

requalification service is also included.<br />

Technical specifications<br />

Protein interaction and stability analysis<br />

9<br />

Biacore C is an automated Surface Plasma Resonance<br />

(SPR) system specifically designed for concentration<br />

determination of biopharmaceuticals in GLP/GMP<br />

applications. Increasing speed and quality of concentration<br />

analysis, while meeting stringent regulations is essential for<br />

ensuring success in drug development and manufacturing<br />

quality control (QC). Biacore C has user-friendly<br />

software and advanced instrumentation, which provide<br />

comprehensive assay control, high quality data, and<br />

high reproducibility with minimal sample usage, thereby<br />

increasing efficiency and saving costs.<br />

Key applications areas are:<br />

• Manufacturing QC and IPC (In-Process Control)<br />

• Release assays<br />

System design and evaluation support<br />

Biacore C Control Software is designed to support the<br />

GLP/GMP regulated working processes with built-in<br />

validation features for compliance with worldwide<br />

regulations. Assay development, concentration analysis<br />

and evaluation of test data are straightforward with the<br />

user-friendly Wizard‐based software.<br />

Detection technology<br />

Data presentation<br />

Surface Plasmon Resonance (SPR)<br />

Result tables, plots, and real-time monitoring<br />

Automation<br />

Unattended working capacity for 2 × 96 well microtiter<br />

plates (automatic control of sample handling and injection)<br />

Flow rate range 1–100 µL/min in steps of 1 µL/min<br />

Flow rate precision Typically < 1%<br />

Injection volume 5–325 µL<br />

Analysis temperature 25°C ± 0.1°C<br />

Power requirements Autorange 100–230 VAC, 47–63 Hz<br />

Power consumption Max 400 VA<br />

Literature<br />

Data file<br />

Code number<br />

Biacore C 29-0167-72<br />

For more information, please visit:<br />

www.gelifesciences.com/biacore<br />

204 www.gelifesciences.com/bioprocess

---

Biacore system validation support<br />

Laboratories involved in pharmaceutical drug development<br />

and manufacturing must satisfy the GxP (GLP, GCP, GMP)<br />

regulations. Computer-controlled analytical systems<br />

used in GxP applications must be validated and properly<br />

maintained. Failure to comply with regulatory demands<br />

is not a viable option from either a safety or economic<br />

standpoint.<br />

Validation is the process of establishing documented<br />

evidence of control and is absolutely necessary for gaining<br />

product approval. Computer system validation ensures that:<br />

• Hardware and software function as designed<br />

• The process is controlled at all stages<br />

• Data are processed as intended<br />

Validation lifecycle model<br />

A validation life cycle model is applied to keep a system in<br />

a validated state during the entire product life cycle.<br />

User<br />

Requirements<br />

Functional<br />

Requirements<br />

Detailed<br />

Design<br />

Develop<br />

System<br />

Installation<br />

Qualification<br />

Operational<br />

Qualification<br />

Performance<br />

Qualification<br />

The validation life cycle ensures adequate validation of computerized<br />

systems.<br />

<strong>GE</strong> <strong>Healthcare</strong> offers a range of products and services to<br />

help customers meet the current regulatory requirements:<br />

• 21 CFR Part 11 compliance<br />

• Equipment qualification<br />

• Change Control Notifications (CNN)<br />

Security of electronic records<br />

For systems used in regulated applications, Biacore<br />

T200 GxP Package facilitates compliance with worldwide<br />

regulatory expectations by ensuring GxP support and<br />

21 CFR Part 11 compliance. For Biacore C, this support is<br />

included in the standard system. Protecting the security<br />

and integrity of electronic records (ER) is essential for<br />

compliance. This includes ensuring the reliability of ER used<br />

to support critical decisions.<br />

Key issues in complying with 21 CFR Part 11 are:<br />

• System validation support<br />

• Accurate, complete copies<br />

• Protection of records<br />

• Limiting system access<br />

• Audit trails<br />

• Authority checks<br />

The software has been developed in accordance with<br />

an accepted development model to ensure adequate<br />

validation support.<br />

Validation support with Biacore GxP services<br />

Equipment Qualification is the overall process of ensuring<br />

that a system performs according to specifications agreed<br />

by the user and vendor. Biacore systems are supported<br />

by Equipment Qualification meeting worldwide regulatory<br />

requirements.<br />

Biacore GxP Services include:<br />

• Instrument qualification (IQ/OQ/IPQ)<br />

• Requalifications (RQ)<br />

• Change Control Procedures (CCP)<br />

Equipment qualification is performed by qualified GxPtrained<br />

personnel when the system is installed in its<br />

selected operating environment. In addition, to keeping the<br />

system in a validated state, a requalification (RQ) is also<br />

provided. This supports the ongoing qualification process<br />

and ensures correct function and maintenance throughout<br />

the system's lifetime.<br />

Change Control Notification<br />

CCN is a free-of-charge, web based service offering<br />

customers notifications about changes in certain <strong>GE</strong><br />

<strong>Healthcare</strong> products that may impact customer processes<br />

and products. It provides a basis for customer evaluation<br />

and control of changes. For Biacore systems, the service is<br />

available for:<br />

• Biacore instruments and software<br />

• Biacore consumables<br />

Literature<br />

Data file<br />

For more information, please visit:<br />

www.gelifesciences.com/biacore<br />

Code number<br />

Biacore T200 GxP Package 28-9809-50<br />

Biacore C 29-0167-72<br />

Protein interaction and stability analysis<br />

9<br />

www.gelifesciences.com/bioprocess 205

---

MicroCal systems<br />

Ultrasensitive microcalorimetry<br />

provides fundamental information<br />

on thermodynamics in biomolecular<br />

interaction and stability analyses.<br />

This information helps scientists<br />

understand how biomolecules<br />

function, and why there are<br />

stable. Calorimetry data can be<br />

used to design new drugs, or to<br />

engineer proteins of higher stability<br />

or modified function. MicroCal<br />

Isothermal Titration Calorimetry<br />

(ITC) and Differential Scanning<br />

Calorimetry (DSC) instruments are<br />

designed and optimized for analysis<br />

of biomolecules in solution and are<br />

widely used at major pharmaceutical,<br />

biotech, academic and government<br />

institutions worldwide.<br />

For more information, please visit:<br />

www.gelifesciences.com/microcal<br />

Protein interaction and stability analysis<br />

9<br />

206 www.gelifesciences.com/bioprocess

---

MicroCal VP-Capillary DSC system<br />

Ordering information<br />

<strong>Product</strong><br />

Code number<br />

MicroCal VP-Capillary DSC 28-4289-48<br />

MicroCal Manual Capillary DSC 28-4289-46<br />

MicroCal VP-Capillary DSC Software 2.0 Upgrade 28-9784-80<br />

Capillary DSC system automation upgrade 28-4291-96<br />

Technical specifications<br />

Short-term noise (RMS average)<br />

0.05 μcal/°C*<br />

Baseline repeatability 1.5 μcal/°C †<br />

Experimental temperature range -10°C to 130°C ‡<br />

A new level of productivity for stability studies<br />

Differential scanning calorimetry (DSC) is a powerful<br />

analytical tool for characterizing the stability of proteins<br />

and other biomolecules. DSC directly measures the<br />

enthalpy (ΔH) and temperature (T m<br />

) of thermally induced<br />

structural transitions in solution. This information gives<br />

valuable insights into factors that stabilize or destabilize<br />

proteins, and other macromolecular systems, alone or as<br />

complexes. This information can be used to predict shelf<br />

lives, develop purification strategies, screen formulation<br />

conditions and characterize protein constructs.<br />

MicroCal VP-Capillary DSC System provides high<br />

throughput and sensitivity in an automated, integrated<br />

platform. The software streamlines the workflow with<br />

simplified experiment setup and flexible instrument<br />

scheduling and reduces the data analysis bottleneck with<br />

automated data analysis and improved data sorting.<br />

The automated data analysis features can reduce data<br />

analysis of a typical experiment from days to hours.<br />

All the features in MicroCal VP-Capillary DSC - automation,<br />

high sensitivity, minimal assay development time, and<br />

automated data analysis capabilities – result in highly<br />

reproducible results, as well as confident conclusions and<br />

decision making.<br />

Maximum scan rate<br />

Response time §<br />

User selectable response times (3)<br />

240°C/h<br />

5 s<br />

Sample volume 370 µL<br />

Typical sample concentration<br />

Cell design<br />

Cell to cell heat compensation<br />

Throughput<br />

Sample capacity<br />

High gain, low gain, and passive<br />

0.1 to 2.0 mg/mL<br />

Tantalum 130 μL, capillary type,<br />

fixed-in-place, non-removable<br />

Power feedback<br />

Up to 50 samples/24 h<br />

Six 96-well plates<br />

Sample compartment, temperature control 4°C to 70°C<br />

Self-contained pressuring system<br />

Weight<br />

Dimensions (W × H × D)<br />

0 to 45 psi<br />

25 kg<br />

101 × 70 × 68 cm<br />

* Using upscan mode at 200°C/h with 10 s filter and over a temperature range of<br />

10°C to 110°C, in passive mode.<br />

†<br />

Average standard deviation between successive upscans at 90°C/hr with 30 s data<br />

point filter over the temperature range 5°C to 110°C.<br />

‡<br />

Using upscan mode at 60°C/h. When using upscan mode at 200°C/h, the upper<br />

temperature limit is 115°C.<br />

§<br />

High feedback<br />

Literature<br />

Code number<br />

MicroCal VP-Capillary DSC system, Data file 28-9785-70<br />

MicroCal DSC, Brochure 28-9964-62<br />

Protein interaction and stability analysis<br />

9<br />

www.gelifesciences.com/bioprocess 207

---

10<br />

Oligonucleotide synthesis<br />

Synthesizers 211<br />

Columns 213<br />

Solid supports 214<br />

208 www.gelifesciences.com/bioprocess

---

Oligonucleotide synthesis<br />

10<br />

www.gelifesciences.com/bioprocess 209

---

Oligonucleotide synthesis<br />

Oligonucleotides are a major tool<br />

in drug discovery and diagnostic<br />

chip technology. They are used<br />

in initial research and screening<br />

through to target validation and<br />

drug production. Developers of<br />

oligonucleotide-based drugs have a<br />

clear need for regulatory compliant<br />

material to use in pre/early-phase<br />

clinical trials. Similarly, companies<br />

involved in molecular diagnostics<br />

need cost-effective oligonucleotidebased<br />

probes to include in<br />

commercial kits. Oligonuleotides<br />

synthesized on our instruments and<br />

supports are currently in several<br />

clinical trials.<br />

All our synthesizers are based on flowthrough<br />

column technology. This gives<br />

cost-efficient synthesis, creates less<br />

waste and allows simple scale-up. It<br />

also permits exact control of flow rate<br />

and thus fine control of reactions.<br />

All systems are compatible with most<br />

synthesis chemistries used today,<br />

including RNA synthesis. Recirculation<br />

of monomers over the column reactor<br />

is included. The common use of<br />

UNICORN control software means<br />

convenient scale-up from research<br />

to full production, and enables use of<br />

PAT (Process Analytical Technology) in<br />

combination with in-line monitors.<br />

System selection guide<br />

System<br />

ÄKTA oligopilot plus 10<br />

ÄKTA oligopilot plus 100<br />

OligoPilot 400<br />

OligoProcess<br />

Nominal scale*<br />

1–50 µmol<br />

250 µmol – 9 mmol<br />

4–30 mmol<br />

10-400, 60-4000 mmol (or higher)<br />

Oligonucleotide synthesis<br />

* All scale examples used Primer Support 5G loaded at 350 µmol/g, except the lower range in which custom Primer<br />

Support 40s was used with ÄKTA oligopilot plus 10. Longer oligos might require a lower loading and thus the<br />

corresponding scale is affected.<br />

10<br />

210 www.gelifesciences.com/bioprocess

---

Oligonucleotide synthesizers<br />

ÄKTA oligopilot plus<br />

ÄKTA oligopilot plus is a flexible, fully-automated DNA/RNA<br />

oligonucleotide synthesizer for use in research, process<br />

development and production. This compact, pump-driven<br />

system meets the needs of most synthesis chemistries<br />

thereby enabling cost-efficient, high-quality synthesis.<br />

ÄKTA oligopilot plus employs flow-through reactor<br />

technology and features column re-circulation, an<br />

important factor when performing RNA synthesis. It is<br />

available in two configurations: ÄKTA oligopilot plus 10 for<br />

synthesis in the 1 to 50 μmol range, and ÄKTA oligopilot<br />

plus 100 for the range 50 μmol to 9 mmol.<br />

The system is compatible with a range of column reactors,<br />

small scale cassettes and pre-packed disposable Oligosynt<br />

columns. For larger scale synthesis, the adjustable FineLINE<br />

35 oligo column has been specifically developed to allow<br />

synthesis at scales from 250 μmol to 3.8 mmol. Adjustable<br />

Column 200 mL enables 9 mmol synthesis.<br />

ÄKTA oligopilot plus is controlled via an external computer<br />

using UNICORN software specially designed for production<br />

needs.<br />

OligoPilot 400<br />

OligoPilot 400 is specifically developed for synthesizing<br />

oligonucleotides in quantities suitable for pre-clinical and<br />

early-phase clinical trials. The system uses flow-through<br />

column technology, UNICORN software and comes with the<br />

same level of technical support as ÄKTA oligopilot plus and<br />

OligoProcess Systems to allow seamless scale-up/scaledown.<br />

Synthesis scale range is from 4 to 30 mmol using column<br />

diameters of 70 and 100 mm. As much as 150 gram crude<br />

20-mer oligo per run can be produced with the 100 mm<br />

column.<br />

The synthesizer is designed in an integrated manner with<br />

reagent bottles and column reactors forming a single unit<br />

in the system. The system reduces facility expenditure<br />

since it can be installed in a laboratory. The tilted bottle<br />

holder allows organized and cost-efficient use of amidite.<br />

A rotating column holder that simplifies unpacking of the<br />

columns is also included.<br />

Oligonucleotide synthesis<br />

10<br />

Ordering information<br />

<strong>Product</strong><br />

Code number<br />

ÄKTA oligopilot plus 10 18-1140-42<br />

ÄKta oligopilot plus 100 18-1136-79<br />

For larger OligoPilot 400 and OligoProcess systems, contact your local representative<br />

www.gelifesciences.com/bioprocess 211

---

OligoProcess<br />

OligoProcess systems are custom-designed for reliable<br />

and cost-effective industrial production. They use the same<br />

flow-through column technology as the other synthesizers.<br />

<strong>Product</strong>ion range is from 50 mmol to over 1 mol, or more,<br />

of therapeutic oligonucleotides.<br />

The systems are explosion-proof and constructed with<br />

industrial grade components that withstand harsh<br />

synthesis chemicals. UNICORN control allows rapid<br />

scale‐up of methods developed on OligoPilot 400.<br />

OligoProcess systems are installed and qualified for GMP<br />

production by <strong>GE</strong> <strong>Healthcare</strong> personnel.<br />

continuously replace those used. Smooth liquid distribution<br />

ensures that coupling efficiencies remain the same, even in<br />

different parts of the column. This continuous replacement<br />

of consumed reagents keeps the concentration constant<br />

throughout the zone. Both the amidite concentration and<br />

the reaction rate remain the same throughout the reaction.<br />

In a batch reactor, on the other hand, consumed reagents<br />

are not replaced. Amidite concentration (red zone in Figure<br />

below) decreases continuously, thus lowering the overall<br />

reaction rate. Flow-through technology gives high amidite<br />

concentration to available reaction sites regardless of<br />

whether they are situated on the periphery of the bead<br />

or situated in deep cavities, since overpressure is created<br />

within the column.<br />

Moreover, flow-through technology gives faster synthesis<br />

cycle time, which thus reduces overall production time. In<br />

addition, reagent consumption is lower for flow-through<br />

technology and therefore less waste is produced. Finally,<br />

flow-through technology in combination with high<br />

accuracy pumps allows for more exact control of reagent<br />

contact times implying low batch to batch variation.<br />

A) Flow-through reactor. The coupling mixture moves down as a<br />

reagent zone, continuously replacing reagents consumed by<br />

the reaction. The amidite concentration is the same at the end<br />

of the reaction as at the beginning.<br />

B) Batch reactor. Reagents consumed by the coupling reaction<br />

are not replaced. Amidite concentrations fall to low levels.<br />

Oligonucleotide synthesis<br />

10<br />

Flow-through technology<br />

The flow-through reactor is a feature common to<br />

ÄKTA oligopilot plus, OligoPilot 400 and OligoProcess<br />

synthesizers. It is more efficient than typical batch reactors<br />

found in other systems. The better efficiency of a flowthrough<br />

reactor is due to the way the coupling mixture<br />

behaves. The figure illustrates this behavior. Coupling<br />

mixture is added to the solid support as a reagent zone<br />

(shown in blue) and is pushed through the column as<br />

a well-defined zone. Reagents at the front of this zone<br />

are consumed by the coupling reaction at a continuous<br />

rate. As this zone moves down the reactor, new reagents<br />

The flow-through reactor (A) is more efficient than a batch reactor (B). At<br />

the end of the reaction, when one equivalent has been consumed, the<br />

active concentration of amidite in OligoPilot 400 for example, can be more<br />

than 6 times higher.<br />

212 www.gelifesciences.com/bioprocess

---

Oligonucleotide synthesis<br />

columns<br />

The <strong>GE</strong> <strong>Healthcare</strong> range of<br />

oligonucleotide columns is<br />

manufactured to withstand the<br />

harsh organic conditions used in<br />

oligonucleotide synthesis. They are<br />

designed for use with ÄKTA oligopilot<br />

plus, OligoPilot 400 and OligoProcess<br />

systems and employ flow-through<br />

reactor technology.<br />

There are two ranges of medium<br />

pressure columns suitable for<br />

industrial oligonucleotide synthesis<br />

and production. At the lower end of<br />

the production scale, FineLINE steel<br />

columns have diameters of 35 (glass),<br />

70, and 100 (steel) mm. For large-scale<br />

industrial production, <strong>BioProcess</strong> MPLC<br />

columns cover the range of diameters<br />

from 50 to 1200 mm. Contact your<br />

local <strong>GE</strong> <strong>Healthcare</strong> office for more<br />

information about large-scale<br />

industrial columns.<br />

Highlights of oligonucleotide<br />

columns:<br />

• Solvent resistant<br />

• Convenient packing of solid<br />

supports<br />

• Stainless steel, fixed volume column<br />

reactors for use with ÄKTA oligopilot<br />

plus<br />

• Variable bed heights<br />

Ordering information<br />

<strong>Product</strong> Scale* Code number<br />

Stainless steel columns<br />

1.2 mL 50 μmol 18-1101-10<br />

6.3 mL 260 μmol 18-1101-13<br />

12 mL 500 μmol 18-1101-16<br />

24 mL 1 mmol 18-1101-19<br />

48 mL 2 mmol 18-1101-22<br />

Adjustable bed height columns<br />

FineLine 35 oligo<br />

10–100 mL 0.4–4 mmol 28-9468-41<br />

Adjustable column<br />

30–200 mL 1.2–8 mmol 18-1107-60<br />

*All scale examples used Prime Support 5G loaded at 350 μmol.<br />

Oligonucleotide synthesis<br />

10<br />

www.gelifesciences.com/bioprocess 213

---

Solid supports<br />

Polystyrene-based supports have been produced by<br />

<strong>GE</strong> <strong>Healthcare</strong> since the mid-1980’s. They allow<br />

high scales of synthesis per reaction volume<br />

and are suitable for synthesis chemistries<br />

that are incompatible or ineffective<br />

with glass beads.<br />

These solid supports not only exceed what you can<br />

achieve with glass beads, they also enable the synthesis of<br />

substantially higher yields of pure full-length products and<br />

reduce reagent consumption. A significant cost reduction, in<br />

other words.<br />

Our supports are produced in large quantities and are<br />

available world-wide via our global distribution network.<br />

Primer Support 5G<br />

Oligonucleotide synthesis<br />

10<br />

Primer Support 5G is the fifth generation solid support for oligonucleotide<br />

synthesis from <strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong>. This high-loaded solid support<br />

is optimized for synthesis of DNA and RNA oligonucleotides up to 25 bases<br />

in length. The base particle, based on cross-linked polystyrene, delivers a<br />

number of benefits compared to previous generations of solid supports.<br />

Primer Support 5G is designed for synthesis of therapeutic oligonucleotides,<br />

by biopharmaceutical companies, with high yield and purity.<br />

• High loading capacity<br />

For synthesis of DNA and RNA<br />

oligonucleotides of up to 25 bases,<br />

a nucleoside loading of 350 μmol/g<br />

for DNA and 300 μmol/g for RNA<br />

can be used without compromising<br />

yield or purity.<br />

• Cost efficient synthesis<br />

With higher nucleoside loading,<br />

Primer Support 5G delivers major<br />

cost savings compared to previous<br />

generations of solid supports.<br />

• Scalability<br />

Primer Support 5G meets<br />

industrial demands and offers<br />

excellent scalability, with<br />

synthesis of phophorothioate<br />

DNA oligonucleotides at scales<br />

from 100 μmol to 750 mmol.<br />

• Regulatory support<br />

Essential information for the<br />

registration of materials used for<br />

oligonucleotide production in the<br />

form of confidential Regulatory<br />

Support Files.<br />

214 www.gelifesciences.com/bioprocess

---

Oligosynt – prepacked disposable columns<br />

Long oligonucleotides (30 to 90 or<br />

more bases) are used as probes in<br />

analytical or diagnostic methods for<br />

applications such as blood testing,<br />

gene expression studies and genetic<br />

profiling or identification. To ensure<br />

optimal purity and yield of long<br />

oligonucleotides, <strong>GE</strong> <strong>Healthcare</strong><br />

provides Primer Support 200 loaded at<br />

nucleoside densities of 40 µmol/g. For<br />

convenience and ease of use, the solid<br />

support is prepacked in disposable<br />

Oligosynt columns that run on ÄKTA<br />

oligopilot instruments. Oligosynt<br />

combined with ÄKTA oligopilot is<br />

well-suited for GMP production of long<br />

oligonucleotides.<br />

• High quality and yield of long<br />

oligonucleotides<br />

More than 50% pure full-length product*.<br />

Less than 4% (n-1) contamination*.<br />

More than 300 OD/µmol crude yield*.<br />

• Convenience<br />

Columns are prepacked and disposable<br />

UNICORN method templates simplify<br />

operation.<br />

On-column cleavage possibility.<br />

• Reproducibility and reliability<br />

Reproducible performance with each<br />

batch of prepacked columns.<br />

All batches of solid support certified for<br />

use in long oligonucleotide synthesis.<br />

• Long oligonucleotide production<br />

Reagents and instrumentation from<br />

process development to production<br />

syntheses.<br />

Primer Support Regulatory Support Files<br />

available for product registration.<br />

IQ/OQ installation service available for<br />

ÄKTA oligopilot instruments.<br />

* Test 60mer sequence used:<br />

5’ATACCGATTAAGCGAAGTTTATACCGATTAAGCGAAGTTTATACC<br />

GATTAAGCGAAGTTT<br />

Custom Primer Support<br />

<strong>GE</strong> <strong>Healthcare</strong> offers Custom Primer<br />

Support to meet your exact needs<br />

by coupling with Unylinker, linkers,<br />

labels, modified bases, alternative<br />

protecting groups, or almost any<br />

molecule of your choice. Primer<br />

Support 5G can be loaded at 20 to<br />

400 μ mol/g and delivered in bulk or<br />

in prepacked, disposable Oligosynt<br />

columns.<br />

Primer Support 200 is also offered within<br />

the Custom Primer Support service.<br />

Note: Use of THF-based synthesis reagents from<br />

other vendors is NOT recommended for <strong>GE</strong> <strong>Healthcare</strong><br />

synthesizers. They may cause irreparable instrument<br />

damage.<br />

For more information, please contact<br />

your local sales representative or go<br />

to www.gelifesciences.com/oligo<br />

Oligonucleotide synthesis<br />

10<br />

www.gelifesciences.com/bioprocess 215

---

11<br />

Service and support<br />

Service agreements 218<br />

Smart Asset Management Services 219<br />

Application services - Fast Trak 220<br />

Validation Services 224<br />

Online regulatory and technical support 226<br />

System and column support 228<br />

Security of supply 229<br />

Literature 230<br />

216 www.gelifesciences.com/bioprocess

---

Service and support<br />

11<br />

www.gelifesciences.com/bioprocess 217

---

Service agreements<br />

<strong>Life</strong> <strong>Sciences</strong> Services has over<br />

50 years of experience as a<br />

provider of service solutions for the<br />

pharmaceutical and biotechnology<br />

industries. Maintaining complex<br />

instruments in prime condition is a<br />

science in itself - to optimize lifelong<br />

performance, we build serviceability<br />

into our equipment beginning at the<br />

R&D stage.<br />

Our service packages improve<br />

productivity and efficiency<br />

by optimizing the equipment<br />

maintenance, thereby minimizing<br />

downtime and repair costs.<br />

Service agreements offer the following<br />

benefits:<br />

• Confidence in your results through<br />

regular PM visits<br />

• Predictable ownership costs – rates<br />

are guaranteed for the duration of<br />

the contract<br />

• Minimal disruptions with priority<br />

response from our trained service<br />

engineers<br />

• Timely access to secured, productspecific<br />

wear parts to maximize<br />

uptime<br />

Service agreements<br />

FullCare<br />

A full-coverage, comprehensive<br />

service agreement that includes one<br />

annual PM visit, all parts, and travel<br />

and labor costs.<br />

FullCare Plus<br />

A full-coverage, comprehensive<br />

service agreement that includes two<br />

annual PM visits, all parts, and travel<br />

and labor costs.<br />

ExtendedCare<br />

A 24-month, full-coverage service<br />

agreement that includes one PM visit,<br />

all parts, and travel and labor costs.<br />

ExtendedCare Plus<br />

A 24-month, full-coverage service<br />

agreement that includes two PM<br />

visits (a comprehensive PM visit in the<br />

first year and a basic PM visit in the<br />

second year), all parts, and travel and<br />

labor costs.<br />

EssentialCare<br />

An annual Preventive Maintenance<br />

visit.<br />

Service and support<br />

For more information, please visit<br />

www.gelifesciences.com/service<br />

11<br />

218 www.gelifesciences.com/bioprocess

---

Smart Asset<br />

Management Services<br />

Over a period of 15 years,<br />

<strong>GE</strong> <strong>Healthcare</strong> has designed a<br />

business optimization process<br />

for asset management in both<br />

the laboratory and healthcare<br />

environments. Smart Asset<br />

Management Services (SAMS)<br />

was developed in response to the<br />

demands of a changing marketplace.<br />

SAMS is a modular, scalable service<br />

that enables consolidation of<br />

multivendor service support for lab<br />

assets, provides insights into asset<br />

utilization, and supports process<br />

optimization.<br />

Lab Optimization Solutions<br />

Lab Optimization Solutions support<br />

customers in the drive to asset<br />

management optimization by<br />

providing tools and analytics that<br />

enable smart decision-making, from<br />

service model optimization to CAPEX<br />

reduction via intelligent utilization.<br />

• Lab asset management<br />

assessments<br />

• Change management<br />

• Process optimization<br />

• Asset intelligence solutions<br />

For more information, please visit<br />

www.gelifesciences.com/service<br />

Multivendor <strong>Life</strong> Cycle Asset<br />

Management<br />

<strong>Life</strong> Cycle Asset Management goes<br />

beyond conventional maintenance<br />

for all lab equipment, regardless<br />

of manufacturer, by ensuring a<br />

predictable total cost of ownership per<br />

asset and providing powerful metrics<br />

and analytics, as well as an accurate<br />

evaluation of projected service costs<br />

and the level of service needed.<br />

• Pre-purchase planning<br />

• Install and move<br />

• Asset management and<br />

Maintenance<br />

• Redeployment and Disposition<br />

Partner Solutions<br />

Our goal is to help our customers’<br />

businesses thrive and grow. By<br />

leveraging our wealth of experience,<br />

business acumen, technical expertise<br />

and best practices gleaned from<br />

the broad spectrum of <strong>GE</strong> industries<br />

and other collaborations, we are<br />

able to provide a solid foundation on<br />

which to build a dynamic, long-term<br />

relationship.<br />

• Strategic partners<br />

• <strong>GE</strong> Finance Solutions<br />

• <strong>GE</strong> Energy & Water<br />

• <strong>GE</strong> Fleet Services<br />

Service and support<br />

11<br />

www.gelifesciences.com/bioprocess 219

---

Application services -<br />

Fast Trak<br />

Use our expertise to your<br />

advantage<br />

Fast Trak brings our extensive<br />

knowledge and experience in<br />

the upstream and downstream<br />

processing of biopharmaceuticals<br />

to your organization. Our global<br />

team of bioprocessing experts can<br />

support you in the optimization/<br />

troubleshooting of existing unit<br />

operations or in the design of efficient<br />

and cost-effective processes that<br />

meet current regulatory demands and<br />

reduce time-to-market.<br />

The services can be run onsite at<br />

your facility or at our global Fast Trak<br />

Centers. Our Centers in Shanghai,<br />

Bangalore, Munich, and New Jersey<br />

supplement your own laboratory and<br />

pilot plant capabilities, featuring full<br />

process development capabilities.<br />

The foundation for our efficient support<br />

services is our highly qualified, highly<br />

motivated Fast Trak bioprocessing<br />

staff. Their expert knowledge, skills,<br />

experience, and commitment play a<br />

substantial role and are based on more<br />

than 50 years of company history in<br />

the processing of biomolecules. Our<br />

Fast Trak experts have university<br />

degrees in a relevant field and handson<br />

experience in biomanufacturing in<br />

a regulated environment. For further<br />

support, our team of Fast Trak experts<br />

has access to a strong network of<br />

other expert and support teams within<br />

the global <strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

organization.<br />

Bioprocess development<br />

• Reviewing and assessing existing<br />

protocols to help define critical<br />

parameters<br />

• Offering resources for developing<br />

scalable up/downstream processes<br />

• Redesigning and optimizing<br />

individual steps or entire processes<br />

• Performing scale-up, scale-down,<br />

cleaning-in-place (CIP), and media<br />

lifetime studies<br />

• Troubleshooting different unit<br />

operations<br />

Consulting<br />

• Advising on regulatory trends and<br />

performing internal audits<br />

• Improving workflows by Lean Six<br />

Sigma programs<br />

Service and support<br />

11<br />

220 www.gelifesciences.com/bioprocess

---

Fast Trak training and<br />

education<br />

Now in its third decade, Fast Trak<br />

training and education continues<br />

to provide an exceptional learning<br />

experience for process development<br />

and manufacturing scientists,<br />

engineers, plant operators, and<br />

support staff. Fast Trak delivers<br />

hands-on training courses in all<br />

aspects of bioprocessing from cell<br />

culture and downstream process<br />

development to scale-up and<br />

manufacturing.<br />

The presentations and hands-on<br />

exercises allow participants to:<br />

• Integrate theory and practice with<br />

a high ratio of instructors and<br />

instruments to trainees<br />

• Understand the purification issues<br />

using automated systems for both<br />

chromatography and filtration<br />

• Gain an awareness of the regulatory<br />

aspects in today’s biotechnology<br />

processes<br />

• Fully utilize the tools and principles<br />

of effective biomanufacturing<br />

Standard courses<br />

The two to five day standard courses<br />

consist of theoretical and practical<br />

exercises, designed to give you an<br />

optimal learning experience. These<br />

training courses are run at our Fast<br />

Trak Centers in Germany, India,<br />

China, Singapore, and New Jersey<br />

(USA). UNICORN eCourses are taken<br />

at your convenience from your<br />

computer.<br />

Custom courses<br />

Custom courses are developed<br />

specifically to suit your organization’s<br />

particular needs. Custom training can<br />

be given at your facility or at a Fast<br />

Trak Center, allowing your company<br />

the flexibility to train complete teams.<br />

Training programs<br />

Training programs focused on your<br />

specific needs are developed in<br />

partnership with your company,<br />

taking into consideration all aspects<br />

of a biopharmaceutical’s lifecycle.<br />

Strategic training programs support<br />

your company in times of growth or<br />

transition by bringing your staff up to<br />

speed in a minimal amount of time,<br />

with a maximal amount of expertise.<br />

Online training — ease and flexibility<br />

UNICORN 6 eCourse (eSYS6) covers<br />

UNICORN 6 that supports the ÄKTA<br />

avant systems.<br />

Basic Training Course for UNICORN<br />

(eSYS1) covers UNICORN 3, 4 and 5 that<br />

support other ÄKTA systems.<br />

• Interactive step-by-step tutorials<br />

guide you through different tasks<br />

• Complete the training at your own<br />

pace over one year<br />

• The courses are accessed via Fast<br />

Trak Education Gateway and do not<br />

require an ÄKTA system or UNICORN<br />

software<br />

Visit us on the web at<br />

www.gelifesciences.com/fasttrak<br />

Service and support<br />

11<br />

www.gelifesciences.com/bioprocess 221

---

List of standard courses available worldwide<br />

Service and support<br />

Upstream processing<br />

Theory, Setup and Operation of<br />

Single-use WAVE Bioreactor (WAV1).<br />

A two day practical course providing<br />

theoretical and technical background<br />

knowledge as well as hands-on<br />

experience on the operation and<br />

optimal performance of the WAVE<br />

Bioreactor and related WAVE<br />

equipment.<br />

Advanced Bioreactor Cultivation<br />

Technology (CELL1). This three<br />

and a half day practical course<br />

provides in-depth training on cell<br />

culture technology, combining<br />

scientific background and handson<br />

experimentation for animal cell<br />

cultivation.<br />

Process development<br />

Introduction to Downstream<br />

Techniques and Bioprocessing (DEV1).<br />

A three or four day basic handson<br />

course on chromatographic<br />

techniques suitable for productionscale<br />

biomolecule purification.<br />

Downstream Bioprocess Development<br />

(DEV2). A five day hands-on course<br />

for people with basic experience who<br />

want to improve their knowledge in<br />

downstream process development.<br />

Bioprocess Scale-Up and Technology<br />

Transfer (DEV4). A three day handson<br />

course focused on designing and<br />

scaling up a laboratory scale process<br />

to production.<br />

Introduction to high-throughput<br />

process development - Workshop<br />

(HTPD1). This three day workshop,<br />

with practical exercises, focuses on<br />

process development and process<br />

optimization of chromatographic<br />

purification steps using HTPD.<br />

Single-Use Manufacturing<br />

Single-Use Manufacturing<br />

Technologies (SUM1). This training<br />

course focuses on the practical<br />

aspects of the application of<br />

disposable technology for process<br />

development and biomanufacturing.<br />

Monoclonal antibodies<br />

Downstream Bioprocessing of<br />

Monoclonal Antibodies (MAB1). A three<br />

and a half day practical course on the<br />

downstream processing of antibody<br />

molecules using chromatographic<br />

techniques.<br />

Membrane filtration<br />

Bioprocessing using Membrane<br />

Separations (MEM1). A two and a half<br />

day practical course on membrane<br />

separation techniques in downstream<br />

processing.<br />

Column packing<br />

Large-scale Column Packing (COL1).<br />

A three day practical course on<br />

packing, qualifying and maintaining<br />

production chromatography columns.<br />

UNICORN system control<br />

Advanced UNICORN System Control<br />

for Chromatography Systems (SYS2).<br />

A three day advanced course on<br />

conditional control programming to<br />

achieve optimal performance of the<br />

system, document and report results,<br />

as well as network considerations.<br />

UNICORN System Control for<br />

Automated Filtration Systems (SYS3).<br />

A two and a half day intensive course<br />

on system control with ÄKTAcrossflow<br />

systems.<br />

Validation<br />

Validation - Workshop (VWS1). A<br />

three day workshop where the latest<br />

regulatory issues associated with<br />

manufacturing a biopharmaceutical<br />

product and aspects of bioprocess<br />

validation will be presented and<br />

discussed.<br />

11<br />

222 www.gelifesciences.com/bioprocess

---

Fast Trak Centers<br />

Fast Trak, including training &<br />

education, process development,<br />

and consulting services are<br />

available from <strong>GE</strong> <strong>Healthcare</strong><br />

throughout the world via our<br />

Fast Trak Centers.<br />

Fast Trak Center Europe<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Oskar-Schlemmer-Strasse 11<br />

80807 München, Germany<br />

T: +49 (0) 89 96 28 16 90<br />

F: +49 (0) 89 96 28 16 79<br />

Email: fasttrak.europe@ge.com<br />

Fast Trak Center North America<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> Corp.<br />

800 Centennial Avenue<br />

Piscataway, NJ 08855-1327, USA<br />

T: +1 732 457 8064<br />

F: +1 732 457 8246<br />

Email: fasttrak.americas@ge.com<br />

Fast Trak Center India<br />

<strong>GE</strong> India Technology Centre Pvt. Ltd.<br />

John F. Welch Technology Center<br />

122, EPIP, Whitefield Road<br />

Bangalore - 560 066, India<br />

T: +91 80 4088 7394<br />

F: +91 80 2841 2111<br />

Email: fasttrak.india@ge.com<br />

Fast Trak Center Japan<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

Sanken Bldg, 3-25-1<br />

Hyakunincho 3-chome Shinjuku-ku<br />

169-0073 Tokyo, Japan<br />

T: +81 (0) 3 5331 9316<br />

F: +81 (0) 3 5331 9372<br />

Email: fasttrak.japan@ge.com<br />

Fast Trak Center China<br />

<strong>GE</strong> <strong>Healthcare</strong><br />

<strong>GE</strong> (China) Research and Development<br />

Center Co.,Ltd<br />

1800 Cai Lun Road<br />

Zhangjiang High-Tech Park, Pudong<br />

Shanghai 210203, China<br />

T: +86 21 50504666-2600<br />

F: +86 21 50808591<br />

Email: fasttrak.china@ge.com<br />

Administrative office<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> AB<br />

Björkgatan 30<br />

SE-751 84 Uppsala<br />

Sweden<br />

T: +46 18 612 1656<br />

Email: fasttrak.global@ge.com<br />

Fast Trak Center Singapore<br />

<strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong><br />

1 Maritime Square #13-01<br />

HarbourFront Centre<br />

Singapore 099253<br />

Singapore<br />

T: +65 6773 7303<br />

F: +65 6773 7302<br />

Email: lifesciences.sg@ge.com<br />

For further information, contact<br />

your nearest Fast Trak Center,<br />

<strong>GE</strong> <strong>Healthcare</strong> office, or visit:<br />

www.gelifesciences.com/fasttrak<br />

Service and support<br />

11<br />

www.gelifesciences.com/bioprocess 223

---

Validation Services<br />

Validation Services is an independent<br />

product and service provider within<br />

<strong>GE</strong> <strong>Healthcare</strong> that offers validation<br />

support and documentation. To<br />

date, we have supplied validation<br />

documentation to almost<br />

5000 biopharmaceutical and<br />

pharmaceutical projects. Facilities<br />

that have used Validation Services<br />

have been successfully audited on<br />

numerous occasions by the FDA and<br />

other regulatory bodies.<br />

Significant costs are incurred for each<br />

day that a new biotherapeutic is in<br />

process development rather than<br />

on the market. To stay competitive,<br />

it is imperative that regulatory<br />

compliance is achieved efficiently<br />

on production facilities as well as<br />

laboratory systems and processes.<br />

Historically, equipment qualification<br />

was considered a “one-off” activity<br />

necessary for using equipment in a<br />

regulated environment. However, the<br />

regulatory landscape has changed—<br />

the biopharma industry, as well as<br />

regulatory authorities, now require<br />

a validation lifecycle approach to<br />

demonstrate compliance throughout<br />

the equipment’s working life. Using<br />

a modern, risk-based strategy as<br />

implemented by <strong>GE</strong> <strong>Healthcare</strong><br />

Validation Services reduces errors and<br />

minimizes the often hectic validation<br />

activity before a candidate drug can<br />

enter production and the market.<br />

The life cycle approach as offered by<br />

Validation Services focuses on what is<br />

critical to end-product quality.<br />

For more information, please visit<br />

www.gelifesciences.com/validation<br />

Purchase planning<br />

• Customized approaches to documentation<br />

and validation<br />

• Validation impact assessment<br />

• Equipment qualification<br />

approach description<br />

Installation<br />

• IQ/OQ documentation<br />

• IQ/OQ performance<br />

Service and support<br />

11<br />

Decommissioning<br />

• Decommission your system<br />

• Prove status of a validated system after<br />

the last production cycle<br />

Maintenance and utilization<br />

• Change Control documents<br />

• Continuous verification<br />

• ValidationCare subscription<br />

Our lifecycle validation approach provides you with a service that begins with purchase planning<br />

and includes maintenance, utilization, and decommissioning of your equipment.<br />

224 www.gelifesciences.com/bioprocess

---

Accelerate your time to<br />

market<br />

The equipment qualification approach<br />

used by Validation Services is in<br />

alignment with GAMP5, ISPE, and ASTM<br />

E2500, whereby validation activities and<br />

documentation focus on end-product<br />

quality and are scaled according to risk,<br />

complexity, and novelty. This approach,<br />

based on scientific understanding and<br />

product knowledge, is recommended<br />

by the FDA initiative “Pharmaceutical<br />

cGMP for the 21st Century: A Risk-Based<br />

Approach”, September 2004.<br />

<strong>GE</strong> <strong>Healthcare</strong> equipment and software<br />

are developed and verified according to<br />

structured and documented procedures.<br />

This enables leverage of validation<br />

activities and results in a much faster<br />

qualification phase, decreasing the<br />

start-up phase at the customer site.<br />

Furthermore, our standardized test<br />

methodologies and modular formats<br />

enable efficient validation life cycle<br />

activities such as Change Control<br />

verifications and continuous verification<br />

following equipment upgrades and<br />

relocations.<br />

Validation Services offerings<br />

System impact assessment<br />

A risk-based assessment is based on the<br />

ISPE’s Baseline <strong>Guide</strong> to Commissioning<br />

and Qualification. The system impact<br />

assessment clarifies the impact of a<br />

system on end product quality, both at<br />

the system level and component level,<br />

by the application of a series of specific<br />

questions. Once the assessment is<br />

complete, each item is either formally<br />

included in the scope of the validation<br />

process or excluded from the validation<br />

process and placed into the less<br />

rigorous category of Good Engineering<br />

Practice (<strong>GE</strong>P). This is described in an<br />

Equipment Qualification Approach<br />

document supplied with documentation<br />

for each project.<br />

Increased efficiency and accuracy<br />

Validation Services procedures<br />

eliminate the piles of paper traditionally<br />

associated with FAT-SAT-IQ/OQ and<br />

replace them with a modern, efficient<br />

approach, which harvests the benefits<br />

of risk management and know-how<br />

from subject-matter experts. Validation<br />

Services therefore increases accuracy<br />

and quality while reducing non valueadded<br />

steps.<br />

By separation of protocols from record<br />

sheets, the Validation Services approach<br />

facilitates a timely review and approval<br />

process. Validation information is<br />

correctly documented in the correct<br />

part of the overall validation life cycle,<br />

and not duplicated throughout a<br />

documentation package.<br />

Modular validation strategy<br />

Consistency and quality is critical<br />

for successful compliance, and it<br />

is acknowledged that a consistent<br />

documentation package is indicative<br />

of the quality of the work it records. We<br />

have listened to your needs and have<br />

developed a LEAN approach combined<br />

with the latest IT tools to ensure<br />

consistent packages within the shortest<br />

time frame. Our modular validation<br />

strategy has been developed to<br />

actively support and comply during the<br />

lifecycle of a system and to minimize<br />

the impact of changes. This increases<br />

accuracy, versatility, and speed well<br />

beyond traditional validation. Exposure<br />

during inspections is minimized<br />

through modularity because only<br />

specific information that is asked for is<br />

presented at any given time.<br />

Summary<br />

<strong>GE</strong> <strong>Healthcare</strong> Validation Services<br />

ensure efficient verification of<br />

your <strong>GE</strong> <strong>Healthcare</strong> equipment<br />

compliance status, in line with current<br />

interpretation of regulatory directives<br />

and guidance. Our documentation<br />

supports your equipment throughout<br />

its entire lifecycle. When you choose<br />

<strong>GE</strong> <strong>Healthcare</strong> as your partner in<br />

validation support, you can be confident<br />

that your equipment is operating in a<br />

reliable, consistent, and GxP compliant<br />

manner.<br />

Brochure<br />

Code number<br />

Validation Services. Compliance<br />

support through lifecycle management 28-9642-88<br />

Service and support<br />

11<br />

www.gelifesciences.com/bioprocess 225

---

Online regulatory and<br />

technical support<br />

Regulatory support files<br />

<strong>GE</strong> <strong>Healthcare</strong> pioneered the<br />

development of Regulatory<br />

support files to provide customers<br />

with detailed information about<br />

performance, stability, extractable<br />

compounds, and analytical methods<br />

for <strong>BioProcess</strong> media. This information<br />

is an invaluable starting point for<br />

process development and validation,<br />

for preparing Standard Operating<br />

Procedures and quality control, and<br />

as support for clinical and marketing<br />

applications to regulatory agencies.<br />

<strong>GE</strong> <strong>Healthcare</strong> has over 15 years of<br />

experience in providing customers<br />

with Regulatory support files.<br />

Change Control Notifications<br />

Change control notifications alert<br />

subscribers of changes associated<br />

with the manufacture of products, in<br />

accordance with a change control<br />

policy.<br />

<strong>GE</strong> <strong>Healthcare</strong> offers this regulatory<br />

support online, including the following<br />

features:<br />

• Direct access<br />

• Email notification of updates<br />

• Downloadable files in Adobe Acrobat<br />

(.pdf) format<br />

• Online subscriptions<br />

• Sharing subscriptions with colleagues<br />

Visit us on the web at<br />

www.gelifesciences.com/rsf<br />

Service and support<br />

11<br />

As some of the information is proprietary, Regulatory support online is available only after signing a<br />

Secrecy agreement.<br />

226 www.gelifesciences.com/bioprocess

---

Technical support online<br />

Users of <strong>GE</strong> <strong>Healthcare</strong>´s columns<br />

and systems may need quick and<br />

easy access to information regarding<br />

their equipment. System support<br />

information is now available online,<br />

on an easily accessed tab for each<br />

product.<br />

Online technical support information<br />

includes:<br />

• Spare parts for columns, packing<br />

stations and systems<br />

• Accessories necessary for packing<br />

and running columns<br />

• Columns and systems<br />

recommended for your scale and<br />

selected medium<br />

• Column packing tips<br />

• A troubleshooting guide with<br />

solutions for specific issues<br />

• Maintenance instructions<br />

Service and support<br />

11<br />

Most <strong>GE</strong> products now have tabs providing extensive product support information.<br />

www.gelifesciences.com/bioprocess 227

---

System and column support<br />

Spare parts solutions<br />

Customized equipment tends to<br />

require a specialized spare parts<br />

solution. As only small numbers of<br />

these parts are needed, they are<br />

usually not kept in a standard service<br />

inventory. Due to the longer lead<br />

time for access to critical spare parts,<br />

we highly recommended that you<br />

purchase them in advance and keep<br />

them on-site in case of a breakdown.<br />

For customers with standard<br />

equipment and very high uptime<br />

demands, we also recommend that<br />

critical standard spare parts be<br />

purchased and kept on-site in case of<br />

breakdown. We can provide guidance<br />

as to which parts to keep in stock onsite<br />

to maximize uptime.<br />

Upgrades<br />

Our service engineers can perform<br />

certified hardware and software<br />

upgrades in a controlled manner<br />

according to Change Control<br />

Protocols. We ensure that all changes<br />

are carefully evaluated, verified,<br />

documented, and reviewed.<br />

Wear parts supply<br />

With any service agreement, identified<br />

wear parts will be held in inventory as<br />

agreed upon in case of breakdown.<br />

This ensures that critical wear parts<br />

are available at all times to our service<br />

contract customers.<br />

Service and support<br />

Visit us on the web at<br />

www.gelifesciences.com/<br />

purification_techsupport<br />

11<br />

228 www.gelifesciences.com/bioprocess

---

Security of supply<br />

Securing the supply of<br />

chromatography media is essential<br />

to successful biopharmaceutical<br />

development and manufacture. As<br />

protein-based drugs and/or vaccines<br />

progress further along their routeto-market,<br />

manufacturers need to<br />

be confident that they can produce<br />

enough material, on time, for<br />

clinical trials, product launches, and<br />

commercial manufacturing.<br />

The media must be of consistently high<br />

quality and delivered on time during all<br />

stages of your production cycle. With<br />

an annual media production exceeding<br />

450 000 L, <strong>GE</strong> <strong>Healthcare</strong> has the<br />

media production capacity to meet<br />

your needs.<br />

In part, security-of-supply means<br />

being certain that you will receive<br />

the right quantity of media,<br />

manufactured to specified quality<br />

levels, and delivered at the right<br />

time. Given today’s competitive<br />

marketplace, there really is no room<br />

for unnecessary risks.<br />

Large production capacity<br />

integrated with clear ordering<br />

and delivery routines make<br />

<strong>BioProcess</strong> Media available in<br />

the right quantity, at the right<br />

place, at the right time. Safety<br />

stock agreements ensure extra<br />

security of supply.<br />

Safety stock of<br />

chromatography media<br />

Media safety stock agreements offer<br />

assurance of a smooth, continuous<br />

supply of chromatography media.<br />

A customized media safety stock<br />

agreement guarantees:<br />

• Minimized downtime and product<br />

loss due to an incident occurring<br />

during development, campaign<br />

production or regular production<br />

• Minimized cash layout (transfer cost<br />

from balance sheet to profit and<br />

loss account)<br />

• Simplified risk management<br />

of consumption fluctuations<br />

of production material during<br />

therapeutic and clinical trials<br />

• Help in meeting security and safety<br />

demands of regulatory agencies<br />

and insurance companies<br />

<strong>GE</strong> <strong>Healthcare</strong> maintains full<br />

responsibility for effective media<br />

stocking, rotation, and rapid supply<br />

during any emergency situation. You<br />

choose:<br />

• Stock situation<br />

• Media products and quantities<br />

• Storage period<br />

• Commencement date<br />

Service and support<br />

11<br />

www.gelifesciences.com/bioprocess 229

---

Literature<br />

There is a wealth of literature available from <strong>GE</strong> <strong>Healthcare</strong> <strong>Life</strong> <strong>Sciences</strong>, and most of it is free. These include our product<br />

Data files, Application notes, well-known chromatography handbooks, as well as Upstream and Downstream, our magazine<br />

for bioprocessors. Most of these can be found in Acrobat pdf file format on our web site, www.gelifesciences.com/<br />

bioprocess. Contact us through your local <strong>GE</strong> <strong>Healthcare</strong> office or via the web site. We look forward to hearing from you.<br />

Upstream and Downstream<br />

Upstream and Downstream is our customer magazine that covers<br />

a range of topics, from cell culture and fermentation through<br />

downstream processing.<br />

Ordering information<br />

Code number<br />

Upstream and Downstream 5 29-0123-41<br />

Upstream and Downstream 4 28-9913-28<br />

Upstream and Downstream 3 28-9863-33<br />

Upstream and Downstream 2 28-9567-85<br />

Upstream and Downstream 1 28-9324-58<br />

Vaccines Supplement 28-9324-60<br />

Downstream 41 28-9179-38<br />

Downstream 40 28-9022-57<br />

Downstream 39 28-4021-59<br />

Downstream 38 11-1112-70<br />

Downstream 37 11-0008-46<br />

Downstream 36 18-1171-05<br />

Downstream 35 18-1161-89<br />

Downstream 34 18-1159-24<br />

Downstream 33 18-1150-32<br />

If you are not already on the<br />

mailing list and wish to receive<br />

Upstream and Downstream<br />

regularly, please contact your<br />

nearest <strong>GE</strong> <strong>Healthcare</strong> office.<br />

Technique handbooks<br />

These handbooks are designed as an introduction to the principles<br />

behind each technique and as a practical guide to the selection<br />

and use of the products available from <strong>GE</strong> <strong>Healthcare</strong>. They are<br />

regularly updated and are frequently used in university education.<br />

Service and support<br />

11<br />

Handbooks<br />

Code number<br />

Gel Filtration: Principles and Methods 18-1022-18<br />

Ion Exchange Chromatography and chromatofocusing: Principles and Methods 11-0004-21<br />

Affinity Chromatography: Principles and Methods 18-1022-29<br />

Hydrophobic Interaction Chromatography & Reversed Phase Chromatography:<br />

Principles and Methods 11-0012-69<br />

Strategies for Protein Purification 28-9833-31<br />

Microcarrier Cell Culture: Principles and Methods 18-1140-62<br />

Antibody Purification Handbook 18-1037-46<br />

Recombinant Protein Purification Handbook, Principles and Methods 18-1142-75<br />

Cell Separation Media: Methodology and applications 18-1115-69<br />

Isolation of Mononuclear Cells: Methodology and applications 18-1152-69<br />

2-D Electrophoresis: Principles and Methods 80-6429-60<br />

GST Gene Fusion Systems Handbook 18-1157-58<br />

Purifying Challenging Proteins: Principle and Methods 28-9095-31<br />

Protein Sample Preparation Handbook 28-9887-41<br />

Western Blotting, Principles and Methods 28-9998-97<br />

230 www.gelifesciences.com/bioprocess

---

Data files, Application notes<br />

and Posters<br />

Data files are available on request for most of our<br />

products. These are often complemented with specific<br />

technical information or relevant case studies published<br />

separately as Application notes or Posters. You can<br />

download many of these in PDF format from our web<br />

site. Find them under related literature beside product<br />

information.<br />

Books<br />

Handbook of Process Chromatography – Development,<br />

Manufacturing, Validation and Economics<br />

Hagel, L., G. Jagschies, and G. Sofer.<br />

Academic Press, London, 2007,<br />

(ISBN10: 0123740231, ISBN13: 9780123740236)<br />

A completely revised edition of the book first published<br />

in 1997. Over the last 10 years the biotechnology and<br />

biologics industries have gained extensive knowledge<br />

and experience in downstream processing using<br />

chromatography and other technologies associated with<br />

recovery and purification unit operations.<br />

Protein Purification Principles, High Resolution Methods<br />

and Applications<br />

Edited by J-C. Janson. Wiley-Liss, New York 2011,<br />

(ISBN 978-0-471-74661-4).<br />

This standard work in the field of protein purification covers<br />

a broad range of techniques, both in chromatography and<br />

electrophoresis. It provides a comprehensive background<br />

for anyone seriously moving into the area. Since the<br />

Second Edition of Protein Purification was published in<br />

1998, the sequencing of the human genome and other<br />

developments in biosciences has dramatically changed the<br />

landscape of protein research. This new edition addresses<br />

these developments, featuring a wealth of new topics and<br />

several chapters that have been completely rewritten.<br />

Service and support<br />

Ordering information<br />

<strong>Product</strong><br />

Code number<br />

Handbook of Process Chromatography: A <strong>Guide</strong> to Optimization,<br />

Scale-up and Validation (2nd Edition) 18-1121-56<br />

Protein Purification Principles, High Resolution Methods and<br />

Applications (3rd Edition) 28-9953-26<br />

11<br />

www.gelifesciences.com/bioprocess 231

---

12<br />

Index and legal<br />

A to Z of media and chemicals 234<br />

Terms and conditions of sale 268<br />

Trademarks 271<br />

Licensing information 271<br />

Alphabetical index 272<br />

232 www.gelifesciences.com/bioprocess

---

A–Z of media and chemicals<br />

This is an alphabetical listing of our chromatography media (resins)<br />

and other chemical products for industrial scale applications; it<br />

includes technical and ordering information. For laboratory scale<br />

media, columns and equipment, and convenience products and kits<br />

for research applications, please consult www.gelifesciences.com.<br />

Lot number-specific Certificates of Analysis and country-specific<br />

Material Safety Data Sheets are available on the internet.<br />

Note: pH stability (operational) = for long term exposure<br />

CIP = Cleaning-in-Place pH for short term exposure<br />

For ion exchangers, the working pH range is dependent on<br />

the titration curve. Pressure is given in kPa; conversion as<br />

follows (100 kPa = 0.1 MPa = 1 bar = 14.5 psi).<br />

■ = <strong>BioProcess</strong> media<br />

CDM = Custom Designed Media<br />

CDM 6-AKS Sepharose 4 Fast Flow. See p 86, 101<br />

Pack size<br />

Code number<br />

1 L 17-3100-04<br />

Regulatory Support File 11-0028-04<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Ligand density<br />

epoxy<br />

carboxylic acid groups on long spacer<br />

arm<br />

23–31 µmol carboxylic acid groups/mL<br />

drained medium<br />

For coupling to -NH 2<br />

pH stability of medium<br />

after coupling<br />

3–13, depending on ligand stability<br />

Pressure/flow spec. 150–250 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

CDM Amino Sepharose 6 Fast Flow. See p 86, 101<br />

Pack size<br />

Code number<br />

1 L 17-3092-09<br />

Regulatory Support File 11-0028-05<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Ligand density<br />

For coupling to<br />

Chloride ion capacity<br />

pH stability of medium<br />

after coupling<br />

epoxy<br />

amino groups on long spacer arm<br />

~ 10 µmol primary amino groups/mL<br />

drained medium<br />

-COOH, -CHO<br />

17–22 µmol Cl - /mL drained medium<br />

3–13, depending on ligand stability<br />

Pressure/flow spec. 200–400 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

Index and legal<br />

12<br />

CDM Alpha-1 Antitrypsin Select. See p 101<br />

Pack size<br />

Code number<br />

25 mL 17-5472-01<br />

200 mL 17-5472-02<br />

1 L 17-5472-03<br />

5 L 17-5472-04<br />

Regulatory Support File 11-0029-76<br />

Technical data<br />

Composition<br />

Highly cross-linked spherical<br />

agarose<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Coupling chemistry NHS<br />

Ligand<br />

AAT binding ligand<br />

Ligand density<br />

~ 5.5 mg/mL medium<br />

Binding capacity<br />

~ 10 mg AAT/mL medium<br />

pH stability (operational) 3–10<br />

CIP stability (short-term) 2–11<br />

Pressure/flow spec. At least 600 cm/h in a 1 m column<br />

with 20 cm bed height at 20°C<br />

using process buffers with the same<br />

viscosity as water at < 3 bar (0.3 Mpa)<br />

■ ANX Sepharose 4 Fast Flow (high sub). See p 81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-1287-10<br />

500 mL 17-1287-01<br />

5 L 17-1287-04<br />

10 L 17-1287-05<br />

60 L 17-1287-60<br />

Data file 18-1142-25<br />

Regulatory Support File 11-0028-07<br />

Prepacked columns<br />

HiTrap ANX FF (high sub), 5 × 1 mL 17-5162-01<br />

HiTrap ANX FF (high sub), 5 × 5 mL 17-5163-01<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

Technical data<br />

Composition highly cross-linked agarose, 4%<br />

Particle size 45–165 µm<br />

Ion capacity<br />

pH stability (operational) 3–13<br />

CIP stability (working) 2–14<br />

Pressure/flow spec.<br />

0.13–0.18 mmol Cl - /mL drained<br />

medium<br />

min 200 cm/h, 100 kPa,<br />

XK 50/60 column,<br />

bed height 25 cm<br />

234 www.gelifesciences.com/bioprocess

---

■ ANX Sepharose 4 Fast Flow (low sub).<br />

Pack size<br />

Code number<br />

500 mL 17-1286-01<br />

5 L 17-1286-04<br />

Regulatory support file 11-0028-06<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

0.06–0.08 mmol Cl - /mL drained<br />

medium.<br />

min 200 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

■ AVB Sepharose High Performance. See p 86<br />

Pack size<br />

Code number<br />

75 mL 28-4112-01<br />

1 L 28-4112-02<br />

Regulatory support file 11-0029-38<br />

Prepacked columns<br />

HiTrap AVB Sepharose HP, 5 × 1 mL 28-4112-11<br />

HiTrap AVB Sepharose HP, 1 × 5 mL 28-4112-12<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 34 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

NHS<br />

protein ligand with affinity for Adeno<br />

associated virus<br />

■ Benzamidine Sepharose 4 Fast Flow (high sub).<br />

See p 86<br />

Pack size<br />

Code number<br />

25 mL 17-5123-10<br />

100 mL 17-5123-01<br />

500 mL 17-5123-02<br />

5 L 17-5123-03<br />

Regulatory support file 11-0028-08<br />

Prepacked columns<br />

HiTrap Benzamidine FF (high sub), 5 × 1 mL 17-5143-01<br />

HiTrap Benzamidine FF (high sub), 2 × 1 mL 17-5143-02<br />

HiTrap Benzamidine FF (high sub), 1 × 5 mL 17-5144-01<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Ligand density<br />

Trypsin capacity<br />

pH stability (operational) 2–8<br />

CIP stability (short term) 2–9<br />

amide linkage (carbodiimide)<br />

p-aminobenzamidine<br />

> 12 µmol/mL drained medium<br />

> 35 mg trypsin/mL packed medium<br />

Pressure/flow spec. min 150 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

■ Benzamidine Sepharose 4 Fast Flow (low sub).<br />

Pack size<br />

Code number<br />

100 mL 28-4108-01<br />

5 L 28-4108-03<br />

Regulatory support file 11-0028-09<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Ligand density<br />

Trypsin capacity<br />

pH stability (operational) 2–8<br />

CIP stability (short term) 2–9<br />

Pressure/flow spec.<br />

amide linkage (carbodiimide)<br />

p-aminobenzamidine<br />

6–10 µmol/mL drained medium<br />

~ 25 mg trypsin/mL packed medium<br />

min 150 cm/h, 100 kPa,<br />

XK 50/60 column,<br />

bed height 25 cm (base matrix)<br />

■ Blue Sepharose 6 Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

50 mL 17-0948-01<br />

500 mL 17-0948-02<br />

1 L 17-0948-03<br />

5 L 17-0948-04<br />

Data file 18-1060-75<br />

Regulatory support file 11-0028-10<br />

Prepacked columns<br />

HiScreen Blue FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9782-43<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

Cibacron Blue F3G-A<br />

Ligand density<br />

~ 7 µmol Cibacron Blue/mL drained<br />

medium<br />

Coupling chemistry Triazine<br />

Binding capacity > 18 mg HSA/mL drained medium<br />

pH stability (operational) 4–12<br />

CIP stability (short term) 3–13<br />

Pressure/flow spec. base matrix 200–400 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 235

---

■ Butyl Sepharose High Performance.<br />

See p 88–89, 160<br />

Pack size<br />

Code number<br />

25 mL 17-5432-01<br />

200 mL 17-5432-02<br />

1 L 17-5432-03<br />

5 L 17-5432-04<br />

Regulatory support file 11-0029-23<br />

Prepacked columns<br />

HiTrap Butyl HP, 5 × 1 mL 28-4110-01<br />

HiTrap Butyl HP, 5 × 5 mL 28-4110-05<br />

HiScreen Butyl HP, 1 × 4.7 mL (0.77 × 10 cm) 28-9782-42<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

PreDictor RoboColumn Butyl Sepharose HP, 200 μL 28-9861-73<br />

PreDictor RoboColumn Butyl Sepharose HP, 600 μL 28-9861-95<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 34 μm median (d 50,volume<br />

)<br />

Ligand<br />

n-butyl<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

100–200 cm/h, 300 kPa,<br />

BioPilot 60/600 column,<br />

bed height 30 cm<br />

■ Butyl Sepharose 4 Fast Flow. See p 88–89, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0980-10<br />

200 mL 17-0980-01<br />

500 mL 17-0980-02<br />

5 L 17-0980-04<br />

10 L 17-0980-05<br />

Data file 18-1020-70<br />

Regulatory support file 11-0028-11<br />

Prepacked columns<br />

HiTrap Butyl FF, 5 × 1 mL 17-1357-01<br />

HiTrap Butyl FF, 5 × 5 mL 17-5197-01<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

HiPrep Butyl FF 16/10, 1 × 20 mL 28-9365-47<br />

HiScreen Butyl FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-84<br />

PreDictor RoboColumn Butyl Sepharose 4FF, 200 μL 28-9861-00<br />

PreDictor RoboColumn Butyl Sepharose 4FF, 600 μL 28-9861-89<br />

96-well filter plates<br />

PreDictor Butyl Sepharose 4 Fast Flow,<br />

6 µL, 4 × 96-well filter plates 17-0980-16<br />

PreDictor Butyl Sepharose 4 Fast Flow,<br />

50 µL, 4 × 96-well filter plates 17-0980-17<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

n-butyl<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. min 150 cm/h, 100 kPa,<br />

XK 50/60column, bed height 25 cm.<br />

Index and legal<br />

12<br />

236 www.gelifesciences.com/bioprocess

---

■ Butyl-S Sepharose 6 Fast Flow. See p 88–89, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0978-10<br />

200 mL 17-0978-02<br />

1 L 17-0978-03<br />

5 L 17-0978-04<br />

Data file 11-0026-34<br />

Regulatory support file 11-0028-44<br />

Prepacked columns<br />

HiTrap Butyl-S FF, 5 × 1 mL 17-0978-13<br />

HiTrap Butyl-S FF, 5 × 5 mL 17-0978-14<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

HiScreen Butyl-S FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-85<br />

PreDictor RoboColumn Butyl-S Sepharose 6FF,<br />

200 μL 28-9861-01<br />

PreDictor RoboColumn Butyl-S Sepharose 6FF,<br />

600 μL 28-9861-90<br />

96-well filter plates<br />

PreDictor Butyl S Sepharose 6 Fast Flow,<br />

6 µL, 4 × 96-well filter plates 17-0978-16<br />

PreDictor Butyl S Sepharose 6 Fast Flow,<br />

50 µL, 4 × 96-well filter plates 17-0978-17<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

butyl-S<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

200–400 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

■ Capto adhere. See p 81, 92, 160<br />

Pack size<br />

Code number<br />

25 mL 17-5444-10<br />

100 mL 17-5444-01<br />

1 L 17-5444-03<br />

5 L 17-5444-04<br />

10 L 17-5444-05<br />

60 L 17-5444-60<br />

Data file 28-9078-88<br />

Regulatory support file 11-0029-40<br />

Prepacked columns<br />

HiTrap Capto adhere, 5 × 1 mL 28-4058-44<br />

HiTrap Capto adhere, 5 × 5 mL 28-4058-46<br />

HiScreen Capto adhere, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-81<br />

HiTrap Capto IEX Selection Kit, 5 × 1 mL 28-9343-88<br />

PreDictor RoboColumn Capto adhere, 200 μL 28-9860-85<br />

PreDictor RoboColumn Capto adhere, 600 μL 28-9861-79<br />

ReadyToProcess Capto adhere 1, 1 L 28-9511-09<br />

ReadyToProcess Capto adhere 2.5, 2.5 L 28-9017-14<br />

ReadyToProcess Capto adhere 10, 10 L 28-9017-15<br />

ReadyToProcess Capto adhere 20, 20 L 28-9017-16<br />

96-well filter plates<br />

PreDictor Capto adhere,<br />

6 µL, 4 × 96-well filter plates 28-9258-17<br />

PreDictor Capto adhere,<br />

20 µL, 4 × 96-well filter plates 28-9258-18<br />

PreDictor Capto adhere,<br />

50 µL, 4 × 96-well filter plates 28-9258-19<br />

Technical data<br />

Ligand type<br />

multimodal strong anion<br />

exchanger<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 75 µm median (d 50,volume<br />

)<br />

Ion capacity<br />

0.09–0.12 mmol Cl - /mL medium<br />

pH stability (operational) 3–12<br />

CIP stability 2–14<br />

Pressure/flow spec.<br />

300 kPa at 600 cm/h, 1 m diameter<br />

column, 20 cm bed height<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 237

---

Index and legal<br />

■ Capto Blue. See p 82, 86<br />

Pack size<br />

Code number<br />

25 mL 17-5448-01<br />

500 mL 17-5448-02<br />

5 L 17-5448-04<br />

Data file 28-9369-60<br />

Regulatory support file 11-0029-64<br />

Prepacked columns<br />

HiScreen Capto Blue, 1 × 4.7 mL (0.77 × 10 cm) 28-9924-74<br />

Technical data<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 75 µm median (d 50,volume<br />

)<br />

Ligand<br />

Cibacron Blue F3G-A<br />

Ligand density ~ 13 umol Cibacron blue/mL drained<br />

medium<br />

Coupling chemistry Amine functional spacer<br />

Pressure/flow spec. At least 600 cm/h in a 1 m column<br />

with 20 cm bed height at 20°C<br />

using process buffers with the same<br />

viscosity as water; corresponds to a<br />

residence time of 2 min<br />

CDM Capto Blue (hs). See p 101<br />

Pack size<br />

Code number<br />

25 mL 17-5452-01<br />

500 mL 17-5452-02<br />

5 L 17-5452-04<br />

Data file 28-9369-60<br />

Regulatory support file 11-0029-64<br />

Technical data<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 75 µm median (d 50,volume<br />

)<br />

Ligand<br />

Ligand density<br />

Coupling chemistry<br />

Pressure/flow spec.<br />

Cibacron Blue F3G-A<br />

~ 18 μmol Cibacron blue/mL drained<br />

medium<br />

Amine functional spacer<br />

At least 300 cm/h in a BPG 300 column<br />

with 20 cm bed height at 20°C using<br />

process buffers with the same viscosity<br />

as water at < 2 bar (0.2 MPa)<br />

■ Capto Butyl. See p 89<br />

Pack size<br />

Code number<br />

25 mL 17-5459-01<br />

100 mL 17-5459-02<br />

1 L 17-5459-03<br />

5 L 17-5459-04<br />

Data file 28-9558-57<br />

Regulatory support file 11-0029-70<br />

Prepacked columns<br />

PreDictor RoboColumn Capto Butyl, 200 μL 28-9860-97<br />

PreDictor RoboColumn Capto Butyl, 600 μL 28-9861-83<br />

HiScreen Capto Butyl, 1 × 4.7 mL (0.77 × 10 cm) 28-9924-73<br />

96-well filter plates<br />

PreDictor Capto Butyl, 6 μL, 4 × 96-well filter plates 17-5459-16<br />

PreDictor Capto Butyl, 50 μL, 4 × 96-well filter plates 17-5459-17<br />

Technical data<br />

Composition<br />

Hydrophobic ligand<br />

highly cross-linked agarose<br />

butyl<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 3–13<br />

CIP stability 2–14<br />

Pressure/flow spec.<br />

■ Capto Core 700. See p 91<br />

Pack size<br />

~ 53 μmol/mL medium<br />

300 kPa at 600 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

Code number<br />

25 mL 17-5481-01<br />

100 mL 17-5481-02<br />

1 L 17-5481-03<br />

5 L 17-5481-04<br />

Data file 28-9983-07<br />

Regulatory support file 11-0029-89<br />

Prepacked columns<br />

HiTrap Capto Core 700, 5 × 1 mL 17-5481-51<br />

HiScreen Capto Core 700, 1 × 4.7 mL (0.77 × 10 cm) 17-5481-15<br />

Technical data<br />

Composition<br />

Ligand<br />

highly cross-linked agarose<br />

octylamine<br />

Particle size 85 µm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 3–13<br />

13 mg ovalbumin/mL medium<br />

CIP stability 2–14<br />

Pressure/flow spec. 500 cm/h in column with 20 cm bed<br />

height at < 2 bar (0.2 MPa)<br />

12<br />

238 www.gelifesciences.com/bioprocess

---

■ Capto DEAE. See p 78–81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-5443-10<br />

100 mL 17-5443-01<br />

1 L 17-5443-03<br />

5 L 17-5443-04<br />

10 L 17-5443-05<br />

60 L 17-5443-60<br />

Data file 11-0025-76<br />

Regulatory support file 11-0029-46<br />

Prepacked columns<br />

HiTrap Capto DEAE, 5 × 1 mL 28-9165-37<br />

HiTrap Capto DEAE, 5 × 5 mL 28-9165-40<br />

HiScreen Capto DEAE, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-82<br />

HiTrap Capto IEX Selection Kit, 5 × 1 mL 28-9343-88<br />

PreDictor RoboColumn Capto DEAE, 200 μL 28-9860-82<br />

PreDictor RoboColumn Capto DEAE, 600 μL 28-9861-77<br />

96-well filter plates<br />

PreDictor Capto DEAE, 2 µL, 4 × 96-well filter plates 28-9258-11<br />

PreDictor Capto DEAE, 20 µL, 4 × 96-well filter plates 28-9258-12<br />

PreDictor Capto DEAE, 50 µL, 4 × 96-well filter plates 28-9258-13<br />

Technical data<br />

Ligand type<br />

Composition<br />

weak anion exchange<br />

highly cross-linked agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

CIP stability 2–14<br />

Pressure/flow spec.<br />

0.29–0.35 mmol Cl - /mL<br />

300 kPa at 700 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

■ Capto L. See p 82, 84–86<br />

Pack size<br />

Code number<br />

25 mL 17-5478-01<br />

200 mL 17-5478-02<br />

1 L 17-5478-03<br />

5 L 17-5478-04<br />

10 L 17-5478-05<br />

Data file 29-0100-08<br />

Regulatory support file 11-0029-90<br />

Prepacked columns<br />

HiTrap Protein L, 5 × 1 mL 17-5478-51<br />

HiTrap Protein L, 1 × 5 mL 17-5478-15<br />

HiTrap Protein L, 5 × 5 mL 17-5478-55<br />

HiScreen Capto L, 1 × 4.7 mL (0.77 × 10 cm) 17-5478-14<br />

PreDictor RoboColumn Capto L, 50 μL 28-0034-20<br />

PreDictor RoboColumn Capto L, 200 μL 28-0034-21<br />

96-well filter plates<br />

PreDictor Capto L, 6 μL, 4 × 96-well plates 17-5478-30<br />

PreDictor Capto L, 20 μL, 4 × 96-well plates 17-5478-31<br />

PreDictor Capto L, 50 μL, 4 × 96-well plates 17-5478-32<br />

Technical data<br />

Composition<br />

Ligand<br />

Particle size 85 µm<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

CIP stability<br />

Pressure/flow spec.<br />

* recommended value.<br />

rigid, highly cross-linked agarose<br />

Protein L (E. coli)<br />

~ 25 mg Fab/mL medium<br />

up to 50 mM NaOH*<br />

500 cm/h in column with 20 cm bed<br />

height at < 2 bar (0.2 MPa)<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 239

---

Index and legal<br />

■ Capto MMC. See p 81, 91, 160<br />

Pack size<br />

Code number<br />

25 mL 17-5317-10<br />

100 mL 17-5317-02<br />

1 L 17-5317-03<br />

5 L 17-5317-04<br />

10 L 17-5317-05<br />

60 L 17-5317-60<br />

Data file 11-0035-45<br />

Regulatory support file 11-0029-30<br />

Prepacked columns<br />

HiTrap Capto MMC, 5 × 1 mL 11-0032-73<br />

HiTrap Capto MMC, 5 × 5 mL 11-0032-75<br />

HiScreen Capto MMC, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-80<br />

HiTrap Capto IEX Selection Kit, 5 × 1 mL 28-9343-88<br />

PreDictor RoboColumn Capto MMC, 200 μL 28-9860-84<br />

PreDictor RoboColumn Capto MMC, 600 μL 28-9861-78<br />

ReadyToProcess Capto MMC 1, 1 L 28-9511-18<br />

ReadyToProcess Capto MMC 2.5, 2.5 L 28-9291-20<br />

ReadyToProcess Capto MMC 10, 10 L 28-9291-21<br />

ReadyToProcess Capto MMC 20, 20 L 28-9291-22<br />

96-well filter plates<br />

PreDictor Capto MMC, 6 µL, 4 × 96-well filter plates 28-9258-14<br />

PreDictor Capto MMC, 20 µL, 4 × 96-well filter plates 28-9258-15<br />

PreDictor Capto MMC, 50 µL, 4 × 96-well filter plates 28-9258-16<br />

Technical data<br />

Ligand type<br />

Composition<br />

multimodal weak cation exchanger<br />

highly cross-linked agarose<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 3–12<br />

CIP stability 2–14<br />

Pressure/flow spec.<br />

0.07–0.09 mmol H + /mL medium<br />

300 kPa at 600 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

CDM Capto Octyl. See p 89, 101<br />

Pack size<br />

Code number<br />

25 mL 17-5465-01<br />

100 mL 17-5465-02<br />

1 L on request<br />

5 L on request<br />

Data file 28-9558-57<br />

96-well filter plates<br />

PreDictor Capto Octyl, 6 μL, 4 × 96-well filter plates 17-5465-16<br />

PreDictor Capto Octyl, 50 μL, 4 × 96-well filter plates 17-5465-17<br />

Technical data<br />

Composition<br />

Hydrophobic ligand<br />

highly cross-linked agarose<br />

octyl<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ligand density<br />

pH stability (operational) 3-13<br />

CIP stability 2–14<br />

Pressure/flow spec.<br />

~ 5 μmol/mL medium<br />

■ Capto Phenyl (high sub). See p 89<br />

Pack size<br />

300 kPa at 600 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

Code number<br />

25 mL 17-5451-01<br />

100 mL 17-5451-02<br />

1 L 17-5451-03<br />

5 L 17-5451-04<br />

Data file 28-9558-57<br />

Regulatory support file 11-0029-67<br />

Prepacked columns<br />

HiScreen Capto Phenyl (high sub),<br />

1 × 4.7 mL (0.77 × 10 cm) 28-9924-72<br />

PreDictor RoboColumn Capto Phenyl (high sub),<br />

200 μL 28-9860-88<br />

PreDictor RoboColumn Capto Phenyl (high sub),<br />

600 μL 28-9861-82<br />

96-well filter plates<br />

PreDictor Capto Phenyl (high sub),<br />

6 μL, 4 × 96-well filter plates 17-5451-16<br />

PreDictor Capto Phenyl (high sub),<br />

50 μL, 4 × 96-well filter plates 17-5451-17<br />

Technical data<br />

Composition<br />

Hydrophobic ligand<br />

highly cross-linked agarose<br />

phenyl<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 3–13<br />

~ 27 μmol/mL medium<br />

CIP stability 2–14<br />

Pressure/flow spec. 300 kPa at 600 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

12<br />

240 www.gelifesciences.com/bioprocess

---

■ Capto Q. See p 78–81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-5316-10<br />

100 mL 17-5316-02<br />

1 L 17-5316-03<br />

10 L 17-5316-05<br />

60 L 17-5316-60<br />

Data file 11-0025-76<br />

Regulatory support file 11-0028-45<br />

Prepacked columns<br />

HiTrap Capto Q, 5 × 1 mL 11-0013-02<br />

HiTrap Capto Q, 5 × 5 mL 11-0013-03<br />

HiScreen Capto Q, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-78<br />

HiTrap Capto IEX Selection Kit, 5 × 1 mL 28-9343-88<br />

PreDictor RoboColumn Capto Q, 200 μL 28-9860-72<br />

PreDictor RoboColumn Capto Q, 600 μL 28-9861-75<br />

ReadyToProcess Capto Q 1, 1 L 28-9510-90<br />

ReadyToProcess Capto Q 2.5, 2.5 L 28-9017-23<br />

ReadyToProcess Capto Q 10, 10 L 28-9017-24<br />

ReadyToProcess Capto Q 20, 20 L 28-9017-25<br />

96-well filter plates<br />

PreDictor Capto Q, 2 µL, 4 × 96-well filter plates 28-9257-73<br />

PreDictor Capto Q, 20 µL, 4 × 96-well filter plates 28-9258-06<br />

PreDictor Capto Q, 50 µL, 4 × 96-well filter plates 28-9258-07<br />

Technical data<br />

Ion exchanger type Quaternary ammonium strong anion<br />

with dextran coating<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

0.16–0.22 mmol Cl - /mL medium<br />

pH stability (operational) 2–12<br />

CIP stability 2–14<br />

Pressure/flow spec. 300 kPa at 700 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

■ Capto Q ImpRes. See p 78–80<br />

Pack size<br />

Code number<br />

25 mL 17-5470-10<br />

100 mL 17-5470-02<br />

1 L 17-5470-03<br />

5 L 17-5470-04<br />

Data file 28-9837-63<br />

Regulatory support file 11-0029-83<br />

Prepacked columns<br />

HiTrap Capto Q ImpRes, 5 × 1 mL 17-5470-51<br />

HiTrap Capto Q ImpRes, 5 × 5 mL 17-5470-55<br />

HiScreen Capto Q ImpRes, 1 × 4.7 mL (0.77 × 10 cm) 17-5470-15<br />

PreDictor RoboColumn Capto Q ImpRes, 200 μL 28-9969-18<br />

PreDictor RoboColumn Capto Q ImpRes, 600 μL 28-9973-91<br />

96-well filter plates<br />

PreDictor Capto Q ImpRes, 6 μL,<br />

4 × 96-well filter plates 17-5470-16<br />

PreDictor Capto Q ImpRes, 20 μL,<br />

4 × 96-well filter plates 17-5470-17<br />

Technical data<br />

Ion exchanger type<br />

Composition<br />

strong anion exchanger<br />

high-flow agarose<br />

Particle size 40 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

0.15-0.18 mmol Cl - /mL medium<br />

CIP stability 2–14<br />

Pressure/flow spec. 3 bar (300 kPa), min 220 cm/h,<br />

1 m diameter column,<br />

20 cm bed height in water<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 241

---

Index and legal<br />

■ Capto S. See p 78–81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-5441-10<br />

100 mL 17-5441-01<br />

1 L 17-5441-03<br />

5 L 17-5441-04<br />

10 L 17-5441-05<br />

60 L 17-5441-60<br />

Datafile 11-0025-76<br />

Regulatory support file 11-0029-32<br />

Prepacked columns<br />

HiTrap Capto S, 5 × 1 mL 17-5441-22<br />

HiTrap Capto S, 5 × 5 mL 17-5441-23<br />

HiTrap Capto IEX Selection Kit, 5 × 1 mL 28-9343-88<br />

HiScreen Capto S, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-79<br />

PreDictor RoboColumn Capto S, 200 μL 28-9860-81<br />

PreDictor RoboColumn Capto S, 600 μL 28-9861-76<br />

ReadyToProcess Capto S 1, 1 L 28-9510-93<br />

ReadyToProcess Capto S 2.5, 2.5 L 28-9017-29<br />

ReadyToProcess Capto S 10, 10 L 28-9017-30<br />

ReadyToProcess Capto S 20, 20 L 28-9017-31<br />

96-well filter plates<br />

PreDictor Capto S, 2 µL, 4 × 96-well filter plates 28-9258-08<br />

PreDictor Capto S, 20 µL, 4 × 96-well filter plates 28-9258-09<br />

PreDictor Capto S, 50 µL, 4 × 96-well filter plates 28-9258-10<br />

Technical data<br />

Ion exchanger type Sulfonate, strong cation exchanger<br />

with dextran coating<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Ion capacity<br />

0.11–0.14 mmol Na + /mL<br />

pH stability (operational) 4–12<br />

CIP stability 3–14<br />

Pressure/flow spec. 300 kPa at 700 cm/h, 1 m diameter<br />

column, 20 cm bed height in water<br />

■ Capto SP ImpRes See p 78–80<br />

Pack size<br />

Code number<br />

25 mL 17-5468-10<br />

100 mL 17-5468-02<br />

1 L 17-5468-03<br />

Datafile 28-9837-63<br />

Regulatory support file 11-0029-84<br />

Prepacked columns<br />

HiTrap Capto SP ImpRes, 5 × 1 mL 17-5468-51<br />

HiTrap Capto SP ImpRes, 5 × 5 mL 17-5468-55<br />

HiScreen Capto SP ImpRes, 1 × 4.7 mL (0.77 × 10 cm) 17-5468-15<br />

PreDictor RoboColumn Capto SP ImpRes, 200 μL 28-9974-49<br />

PreDictor RoboColumn Capto SP ImpRes, 600 μL 28-9974-50<br />

96-well filter plates<br />

PreDictor Capto SP ImpRes, 6 μL,<br />

4 × 96-well filter plates 17-5468-16<br />

PreDictor Capto SP ImpRes, 20 μL,<br />

4 × 96-well filter plates 17-5468-17<br />

Technical data<br />

Ion exchanger type<br />

Composition<br />

strong cation exchanger<br />

high-flow agarose<br />

Particle size 40 μm median (d 50,volume<br />

)<br />

Ion capacity<br />

pH stability (operational) 4–12<br />

CIP stability 3–14<br />

Pressure/flow spec.<br />

0.13-0.16 mmol Na + /mL<br />

3 bar (300 kPa), min 220 cm/h,<br />

1 m diameter column,<br />

20 cm bed height in water<br />

CDM Chelating Sepharose Big Beads. See p 101<br />

Pack size<br />

Code number<br />

1 L 17-5272-03<br />

10 L 17-5272-05<br />

Regulatory support file 11-0028-12<br />

Technical data<br />

Composition<br />

Particle size 100–300 µm<br />

Coupling chemistry<br />

Ligand<br />

Metal ion capacity<br />

highly cross-linked 6% agarose<br />

epoxy<br />

pH stability (operational) 3–13<br />

imino diacetic acid<br />

41–51 µmol Cu2 + /mL packed medium<br />

CIP stability (short term) 3–14<br />

Pressure/flow spec. 1200–1800 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

12<br />

242 www.gelifesciences.com/bioprocess

---

■ Chelating Sepharose Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

50 mL 17-0575-01<br />

500 mL 17-0575-02<br />

5 L 17-0575-04<br />

Data file 18-1171-41<br />

Regulatory support file 11-0028-13<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

Metal ion capacity<br />

iminodiaceticacid groups on spacer<br />

ether<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

CM Sephadex C-25. See p 80<br />

Pack size<br />

30–37 µmol Cu 2+ /mL medium<br />

base matrix 200–400 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

Code number<br />

100 g 17-0210-01<br />

500 g 17-0210-02<br />

5 kg 17-0210-03<br />

Regulatory support file 11-0028-86<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size wet (in 0.15 M NaCl), 65–235 µm<br />

pH stability (operational) 4–10<br />

CIP stability (short term) 3–13<br />

Pressure/flow spec.<br />

CM Sephadex C-50. See p 80<br />

Pack size<br />

min 120 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=5,<br />

bed height 10 cm, 5 cm i.d.<br />

Code number<br />

100 g 17-0220-01<br />

500 g 17-0220-02<br />

5 kg 17-0220-03<br />

Regulatory support file 11-0028-87<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size wet (in 0.15 M NaCl), 110–400 µm<br />

pH stability (operational) 4–10<br />

CIP stability (short term) 3–13<br />

Pressure/flow spec.<br />

min 100 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=10,<br />

bed height 10 cm, 5 cm i.d.<br />

■ CM Sepharose Fast Flow. See p 81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0719-10<br />

500 mL 17-0719-01<br />

10 L 17-0719-05<br />

60 L 17-0719-60<br />

Data file 18-1020-66<br />

Regulatory support file 11-0028-14<br />

Prepacked columns<br />

HiTrap CM FF, 5 × 1 mL 17-5056-01<br />

HiTrap CM FF, 5 × 5 mL 17-5155-01<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

HiPrep CM FF 16/10, 1 × 20 mL 28-9365-42<br />

ReadyToProcess CM Sepharose FF 1, 1 L 28-9512-08<br />

ReadyToProcess CM Sepharose FF 2.5, 2.5 L 28-9291-17<br />

ReadyToProcess CM Sepharose FF 10, 10 L 28-9291-18<br />

ReadyToProcess CM Sepharose FF 20, 20 L 28-9291-19<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

highly cross-linked 6% agarose<br />

Binding capacity 50 mg Ribonuclease/mL drained<br />

medium<br />

Ion capacity<br />

0.09–0.13 mmol H + /mL medium<br />

pH stability (operational) 4–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 300–600 cm/h, 100 kPa, XK 50/30<br />

column, bed height 15 cm<br />

■ CM Sepharose High Performance. See p 81<br />

Pack size<br />

Code number<br />

1 L 17-1277-03<br />

5 L 17-1277-04<br />

10 L 17-1277-05<br />

Regulatory support file 11-0028-15<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 34 μm median (d 50,volume<br />

)<br />

Total capacity H +<br />

pH stability (operational) 4–13<br />

0.06–0.08 mmol/mL medium<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 100–200 cm/h, 300 kPa,<br />

BioPilot 60/600 column,<br />

bed height 30 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 243

---

CNBr-activated Sepharose 4B.<br />

Pack size<br />

Code number<br />

15 g 17-0430-01<br />

250 g 17-0430-02<br />

1 kg 17-0430-03<br />

Regulatory support file 11-0028-16<br />

Technical data<br />

Composition<br />

4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

For coupling to -NH 2<br />

Activation method cyanogen bromide (CNBr) activated<br />

Coupling capacity<br />

pH stability (operational)<br />

CIP stability (short term)<br />

Pressure/flow spec.<br />

25–60 mg a-chymotrypsinogen/mL<br />

drained medium<br />

3–11, ligand dependent<br />

3–11, ligand dependent<br />

base matrix 70–140 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm, 5 cm i.d.<br />

■ CNBr-activated Sepharose 4 Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

10 g 17-0981-01<br />

250 g 17-0981-03<br />

2 kg 17-0981-05<br />

Data file 18-1113-55<br />

Regulatory support file 11-0028-16<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

For coupling to -NH 2<br />

Activation method cyanogen bromide (CNBr) activated<br />

Coupling capacity<br />

pH stability (operational)<br />

CIP stability (short term)<br />

Pressure/flow spec.<br />

13–26 mg a-chymotrypsinogen/mL<br />

drained medium<br />

3–11, ligand dependent<br />

3–11, ligand dependent<br />

base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

Con A Sepharose 4B. See p 86<br />

Pack size<br />

Code number<br />

5 mL 17-0440-03<br />

100 mL 17-0440-01<br />

500 mL 17-0440-02<br />

5 L 17-0440-04<br />

Prepacked columns<br />

HiTrap Con A 4B, 5 × 1 mL 28-9520-85<br />

HiTrap Con A 4B, 5 × 5 mL 28-9520-96<br />

Technical data<br />

Composition<br />

4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

Ligand density<br />

Coupling chemistry<br />

Concanavalin A<br />

10–16 mg Con A/mL drained medium<br />

CNBr<br />

pH stability (operational) 4–9<br />

CIP stability (short term) 4–9<br />

Pressure/flow spec.<br />

Cytodex 1. See p 31–32<br />

Pack size<br />

base matrix 70–140 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm, 5 cm i.d.<br />

Code number<br />

25 g 17-0448-01<br />

100 g 17-0448-02<br />

500 g 17-0448-03<br />

2.5 kg 17-0448-25<br />

5 kg 17-0448-04<br />

Data file 18-1060-61<br />

Regulatory support file 11-0028-70<br />

Technical data<br />

Density*<br />

1.03 g/mL in 0.9% NaCl<br />

Particle size* 190 µm median (d 50,volume<br />

)<br />

Particle size* 147–248 µm range (d 5-95,volume<br />

)<br />

Approx. area*<br />

4 400 cm 2 /g dry weight<br />

Approx. no. microcarriers 4.3 × 10 6 g/dry weight swelling*<br />

20 mL/g dry weight<br />

* In 0.9% NaCl<br />

Note: For Cytodex, size is based on median diameter at 50% of the volume of a<br />

sample of microcarriers (d 50,volume<br />

), or the range between the diameter at 5% and 95%<br />

of the volume of a sample of microcarriers (d 5–95,volume<br />

). This size is calculated from<br />

cumulative volume distributions.<br />

Index and legal<br />

12<br />

244 www.gelifesciences.com/bioprocess

---

Cytodex 3. See p 31–32<br />

Pack size<br />

Code number<br />

10 g 17-0485-01<br />

100 g 17-0485-02<br />

500 g 17-0485-03<br />

2.5 kg 17-0485-25<br />

5 kg 17-0485-04<br />

Data file 18-1060-61<br />

Regulatory support file 11-0028-72<br />

Technical data<br />

Density*<br />

1.04 g/mL in 0.9% NaCl<br />

Particle size* 175 µm median (d 50,volume<br />

)<br />

Particle size* 141–211 µm range (d 5-95,volume<br />

)<br />

Approx. area*<br />

2 700 cm 2 /g dry weight<br />

Approx. no. microcarriers 3 × 10 6 g/dry weight swelling* 15 mL/g<br />

dry weight<br />

Cytopore 2. See p 31–32<br />

Pack size<br />

Code number<br />

20 g 17-1271-01<br />

100 g 17-1271-02<br />

500 g 17-1271-03<br />

1 kg 17-1271-04<br />

Data file 18-1132-68<br />

Regulatory support file 11-0028-73<br />

Technical data<br />

Particle diameter<br />

Effective surface area<br />

Density<br />

Average diameter<br />

of pore openings<br />

Volume<br />

200–280 nm*<br />

1.1 m 2 /g dry weight<br />

1.03 g/mL*<br />

30 µm*<br />

40 mL/g dry weight<br />

* In 0.9% NaCl (data from Ashai Chemical Industry Co. Ltd., Japan)<br />

* In 0.9% NaCl<br />

Note: For Cytodex, size is based on median diameter at 50% of the volume of a<br />

sample of microcarriers (d 50,volume<br />

), or the range between the diameter at 5% and 95%<br />

of the volume of a sample of microcarriers (d 5–95,volume<br />

). This size is calculated from<br />

cumulative volume distributions.<br />

Cytoline 1. See p 31, 33<br />

Pack size<br />

Code number<br />

50 mL 17-1268-01<br />

500 mL 17-1268-02<br />

5 L 17-1268-03<br />

Data file 18-1060-65<br />

Regulatory support file 11-0028-74<br />

Technical data<br />

Sedimentation velocity<br />

Length<br />

Thickness<br />

Density<br />

120–220 cm/min<br />

1.7–2.5 mm<br />

0.4–1.1 mm<br />

1.32 g/mL<br />

Pore size 10–400 µm<br />

Surface area > 0.3 m 2 /g<br />

Cytopore 1. See p 31–32<br />

Pack size<br />

Code number<br />

20 g 17-0911-01<br />

100 g 17-0911-02<br />

500 g 17-0911-03<br />

Data file 18-1132-68<br />

Regulatory support file 11-0028-73<br />

Technical data<br />

Particle diameter<br />

Effective surface area<br />

Density<br />

Average diameter<br />

of pore openings<br />

Volume<br />

200–280 nm*<br />

1.1 m 2 /g dry weight<br />

1.03 g/mL*<br />

30 µm*<br />

40 mL/g dry weight<br />

* In 0.9% NaCl (data from Ashai Chemical Industry Co. Ltd., Japan)<br />

DEAE Sephadex A-25. See p 80<br />

Pack size<br />

Code number<br />

100 g 17-0170-01<br />

500 g 17-0170-02<br />

5 kg 17-0170-03<br />

40 kg 17-0170-07<br />

Data file 18-1117-58<br />

Regulatory support file 11-0028-17<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size wet (in 0.15 M NaCl), 45–190 µm<br />

pH stability (operational) 2–10<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec.<br />

DEAE Sephadex A-50. See p 80<br />

Pack size<br />

min 120 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=5,<br />

bed height 10 cm, 5 cm i.d.<br />

Code number<br />

100 g 17-0180-01<br />

500 g 17-0180-02<br />

5 kg 17-0180-03<br />

Data file 18-1117-58<br />

Regulatory support file 11-0028-17<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size wet (in 0.15 M NaCl), 100–370 µm<br />

pH stability (operational) 2–10<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. min 60 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=10,<br />

bed height 10 cm, 5 cm i.d.<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 245

---

Index and legal<br />

■ DEAE Sepharose Fast Flow. See p 81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0709-10<br />

500 mL 17-0709-01<br />

10 L 17-0709-05<br />

60 L 17-0709-60<br />

IEX Selection Kit 17-0939-01<br />

Data file 18-1020-66<br />

Regulatory support file 11-0028-18<br />

Prepacked columns<br />

HiTrap DEAE FF, 5 × 1 mL 17-5055-01<br />

HiTrap DEAE FF, 5 × 5 mL 17-5154-01<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

HiPrep DEAE FF 16/10, 1 × 20 mL 28-9365-41<br />

HiScreen DEAE FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9782-45<br />

ReadyToProcess DEAE Sepharose FF 1, 1 L 28-9511-26<br />

ReadyToProcess DEAE Sepharose FF 2.5, 2.5 L 28-9291-14<br />

ReadyToProcess DEAE Sepharose FF 10, 10 L 28-9291-15<br />

ReadyToProcess DEAE Sepharose FF 20, 20 L 28-9291-16<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

Binding capacity<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 2–14<br />

highly cross-linked 6% agarose<br />

110 mg HSA/mL drained medium<br />

0.11–0.16 mmol Cl - /mL medium<br />

Pressure/flow spec. 300–600 cm/h, 100 kPa, XK 50/30<br />

column, bed height 15 cm<br />

■ ECH-Lysine Sepharose 4 Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

500 mL 17-0902-02<br />

5 L 17-0902-04<br />

Regulatory support file 11-0029-28<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Ligand density<br />

NHS<br />

L-lysine<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 2–13<br />

~ 16 µmol/mL drained medium<br />

Pressure/flow spec. 150–250 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

Epoxy-activated Sepharose 6B. See p 86<br />

Pack size<br />

Code number<br />

15 g 17-0480-01<br />

250 g 17-0480-03<br />

Technical data<br />

Composition<br />

6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

For coupling to<br />

Active groups<br />

-NH 2<br />

, -OH, -SH<br />

epoxy groups on 12-atom spacer<br />

Amount of active groups 19–40 µmol epoxy groups/mL drained<br />

medium<br />

pH stability (operational) 3–13, ligand dependent<br />

CIP stability (short term) 3–13, ligand dependent<br />

Pressure/flow spec base matrix 100–200 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm, 5 cm i.d.<br />

GammaBind G Type 2.<br />

Pack size<br />

Code number<br />

1 g 17-0884-06<br />

10 g 17-0884-08<br />

50 g 17-0884-99<br />

■ Gelatin Sepharose 4 Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

1 L 17-0976-03<br />

5 L 17-0976-04<br />

Regulatory support file 11-0029-37<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

CNBr<br />

bovine gelatin derivative<br />

Ligand density<br />

~ 5 mg/mL drained medium<br />

Pressure/flow spec. 150–250 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

12<br />

246 www.gelifesciences.com/bioprocess

---

Glutathione Sepharose 4 Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

25 mL 17-5132-01<br />

100 mL 17-5132-02<br />

500 mL 17-5132-03<br />

Data file 18-1136-89<br />

Prepacked columns<br />

GSTrap FF, 5 × 1 mL 17-5130-01<br />

GSTrap FF, 2 × 1 mL 17-5130-02<br />

GSTrap FF, 100 × 1 mL* 17-5130-05<br />

GSTrap FF, 1 × 5 mL 17-5131-01<br />

GSTrap FF, 5 × 5 mL 17-5131-02<br />

GSTrap FF, 100 × 5 mL* 17-5131-05<br />

GSTPrep FF 16/10, 1 × 20 mL 28-9365-50<br />

96-well filter plates<br />

GST MultiTrap FF, 4 × 96-well filter plates 28-4055-01<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

glutathione<br />

Ligand density<br />

120–320 µmol glutathione/mL<br />

drained medium<br />

Coupling chemistry<br />

epoxy<br />

Binding capacity<br />

~ 10 mg recombinant GST/mL<br />

medium, protein dependent<br />

pH stability 3–12<br />

Pressure/flow spec.<br />

base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

*Special pack size delivered on specific customer order.<br />

■ Heparin Sepharose 6 Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

50 mL 17-0998-01<br />

250 mL 17-0998-25<br />

1 L 17-0998-03<br />

5 L 17-0998-04<br />

Data file 18-1060-76<br />

Regulatory support file 11-0028-19<br />

Prepacked columns<br />

HiPrep Heparin FF 16/10, 1 × 20 mL 28-9365-49<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

Ligand density<br />

Coupling chemistry<br />

heparin<br />

pH stability (operational) 4–12<br />

CIP stability (short term) 4–13<br />

Pressure/flow spec.<br />

~ 4 mg heparin/mL drained medium<br />

reductive amination<br />

base matrix 200–400 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

CDM IgSelect. See p 86, 101<br />

Pack size<br />

Code number<br />

25 mL 28-4113-01<br />

200 mL 28-4113-02<br />

1 L 28-4113-03<br />

Data file 28-9257-92<br />

Regulatory support file 11-0029-55<br />

Prepacked columns<br />

HiTrap, 5 × 1 mL 28-4113-11<br />

HiTrap, 1 × 5 mL 28-4113-12<br />

Technical data<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

Dynamic binding<br />

capacity<br />

Pressure/flow spec.<br />

pH stability (long term) 3–11<br />

pH stability (short term) 2–13<br />

■ IgG Sepharose 6 Fast Flow.<br />

Pack size<br />

14 kD recombinant protein produced in<br />

S. cerevisiae. Binds to Fc fragments of<br />

all human IgG subclasses.<br />

NHS<br />

17 mg/mL at 2.4 min residence time<br />

At least 600 cm/h in a 1 m column with<br />

20 cm bed height at 20°C using process<br />

buffers with the same viscosity as<br />

water at < 3 bar (0.3 MPa)<br />

Code number<br />

10 mL 17-0969-01<br />

200 mL 17-0969-02<br />

5 L 17-0969-04<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Capacity<br />

CNBr<br />

human polyclonal IgG<br />

~ 5 mg Protein A/mL drained medium<br />

pH stability (operational) 3–10<br />

Pressure/flow spec. 200–400 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

(base matrix)<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 247

---

Index and legal<br />

■ IMAC Sepharose 6 Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

25 mL 17-0921-07<br />

100 mL 17-0921-08<br />

1 L 17-0921-09<br />

5 L 17-0921-10<br />

Data file 28-4041-06<br />

Regulatory support file 11-0029-31<br />

Prepacked columns<br />

HiTrap IMAC FF, 5 × 1 mL 17-0921-02<br />

HiTrap IMAC FF, 5 × 5 mL 17-0921-04<br />

HiPrep IMAC FF 16/10, 1 × 20 mL 28-9365-52<br />

HiScreen IMAC FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9505-17<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Metal ion capacity<br />

Dynamic binding<br />

capacity<br />

~ 15 µmol Ni 2+ /mL drained medium<br />

~ 40 mg histidine-tagged protein/mL<br />

medium, protein and metal ion<br />

dependent<br />

pH stability (operational) 3–12<br />

pH stability (short term) 2–14<br />

Pressure/flow spec. base matrix 200-400 cm/h,<br />

100 kPa, XK50/60 column,<br />

bed height 25 cm<br />

■ KappaSelect. See p 85<br />

Pack size<br />

Code number<br />

25 mL 17-5458-01<br />

200 mL 17-5458-02<br />

1 L 17-5458-03<br />

5 L 17-5458-04<br />

Regulatory support file 11-0029-63<br />

Technical data<br />

Composition<br />

Highly cross-linked high-flow agarose<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ligand Recombinant protein (Mr 13 000),<br />

produced in S. cerevisiae, with affinity<br />

for the constant domain of the<br />

immunoglobulin kappa light chain<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–12<br />

Pressure/flow spec. At least 600 cm/h in a 1 m column with<br />

20 cm bed height at 20°C using process<br />

buffers with the same viscosity as<br />

water at < 3bar (0.3 Mpa)<br />

CDM LambdaFabSelect. See p 85, 101<br />

Pack size<br />

Code number<br />

25 mL 17-5482-01<br />

200 mL 17-5482-02<br />

1 L 17-5482-03<br />

5 L 17-5482-04<br />

Data file 28-9448-22<br />

Regulatory support file 11-0029-81<br />

Prepacked columns<br />

HiTrap LambdaFabSelect, 5 x 1 mL 17-5482-11<br />

HiTrap LambdaFabSelect, 1 x 5 mL 17-5482-12<br />

96-well filter plates<br />

PreDictor LambdaFabSelect, 6 µL,<br />

4 × 96-well filter plates 17-5482-13<br />

PreDictor LambdaFabSelect, 20 µL,<br />

4 × 96-well filter plates 17-5482-14<br />

PreDictor LambdaFabSelect, 50 µL,<br />

4 × 96-well filter plates 17-5482-15<br />

Technical data<br />

Composition<br />

highly cross-linked high-flow agarose<br />

Particle size 75 µm median (d 50,volume<br />

)<br />

Ligand recombinant protein (M r<br />

13 000),<br />

produced in S. cerevisiae, that binds to<br />

constant region of Fab lambda light<br />

chain<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–12<br />

Pressure/flow spec. At least 600 cm/h in a 1 m column with<br />

20 cm bed height at 20°C using buffers<br />

with the same viscosity as water at<br />

< 3 bar (0.3 MPa)<br />

■ Lentil Lectin Sepharose 4B. See p 86<br />

Pack size<br />

Code number<br />

25 mL 17-0444-01<br />

1 L 17-0444-03<br />

Regulatory support file 11-0028-92<br />

Technical data<br />

Composition<br />

4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

Ligand density<br />

Coupling chemistry<br />

lentil lectin<br />

~ 2 mg lentil lectin/mL drained medium<br />

CNBr<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 3–10<br />

Pressure/flow spec. base matrix 70–140 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm cm, 5 cm i.d.<br />

12<br />

248 www.gelifesciences.com/bioprocess

---

■ MabSelect. See p 83, 86<br />

Pack size<br />

Code number<br />

25 mL 17-5199-01<br />

200 mL 17-5199-02<br />

1 L 17-5199-03<br />

5 L 17-5199-04<br />

10 L 17-5199-06<br />

Data file 18-1149-94<br />

Regulatory support file 11-0028-20<br />

Prepacked columns<br />

HiTrap MabSelect, 5 × 1 mL 28-4082-53<br />

HiTrap MabSelect, 1 × 5 mL 28-4082-55<br />

HiTrap MabSelect, 5 × 5 mL 28-4082-56<br />

HiScreen MabSelect, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-73<br />

PreDictor RoboColumn MabSelect, 50 μL 28-9862-02<br />

PreDictor RoboColumn MabSelect, 200 μL 28-9861-06<br />

96-well filter plates<br />

PreDictor MabSelect, 6 µL, 4 × 96-well filter plates 28-9258-20<br />

PreDictor MabSelect, 20 µL, 4 × 96-well filter plates 28-9258-21<br />

PreDictor MabSelect, 50 µL, 4 × 96-well filter plates 28-9258-22<br />

Technical data<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 85 µm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

recombinant Protein A (E. coli)<br />

epoxy<br />

Dynamic binding capacity min 30 mg human IgG/mL medium at<br />

2.4 min residence time<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–12<br />

Pressure/flow spec. up to 500 cm/h, < 200 kPa, BPG 300,<br />

bed height 20 cm<br />

■ MabSelect SuRe. See p 83, 86, 92<br />

Pack size<br />

Code number<br />

25 mL 17-5438-01<br />

200 mL 17-5438-02<br />

1 L 17-5438-03<br />

5 L 17-5438-04<br />

10 L 17-5438-05<br />

Data file 11-0011-65<br />

Regulatory support file 11-0029-18<br />

Prepacked columns<br />

HiTrap MabSelect SuRe, 5 × 1 mL 11-0034-93<br />

HiTrap MabSelect SuRe, 1 × 5 mL 11-0034-94<br />

HiTrap MabSelect SuRe, 5 × 5 mL 11-0034-95<br />

HiScreen MabSelect SuRe, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-77<br />

PreDictor RoboColumn MabSelect SuRe, 50 μL 28-9862-03<br />

PreDictor RoboColumn MabSelect SuRe, 200 μL 28-9861-07<br />

ReadyToProcess MabSelect SuRe 1, 1 L 28-9511-10<br />

ReadyToProcess MabSelect SuRe 2.5, 2.5 L 28-9017-17<br />

ReadyToProcess MabSelect SuRe 10, 10 L 28-9017-18<br />

ReadyToProcess MabSelect SuRe 20, 20 L 28-9017-19<br />

96-well filter plates<br />

PreDictor MabSelect SuRe, 6 µL,<br />

4 × 96-well filter plates 28-9258-23<br />

PreDictor MabSelect SuRe, 20 µL,<br />

4 × 96-well filter plates 28-9258-24<br />

PreDictor MabSelect SuRe, 50 µL,<br />

4 × 96-well filter plates 28-9258-25<br />

Technical data<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 85 µm median (d 50,volume<br />

)<br />

Ligand<br />

alkali-stabilized Protein A-derived<br />

(E. coli)<br />

Coupling chemistry epoxy<br />

Dynamic binding capacity min 30 mg human IgG/mL medium at<br />

2.4 min residence time<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 0.1–0.5 M NaOH<br />

Pressure/flow spec. up to 500 cm/h, < 2 bar, BPG 300,<br />

bed height 20 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 249

---

■ MabSelect SuRe LX. See p 83, 86, 92<br />

Pack size<br />

Code number<br />

25 mL 17-5474-01<br />

200 mL 17-5474-02<br />

1 L 17-5474-03<br />

5 L 17-5474-04<br />

10 L 17-5474-05<br />

Data file 28-9870-62<br />

Regulatory support file 11-0029-82<br />

Prepacked columns<br />

HiScreen MabSelect SuRe LX,<br />

1 × 4.7 mL (0.77 × 10 cm) 17-5474-15<br />

PreDictor RoboColumn MabSelect SuRe LX, 200 μL 28-9974-40<br />

PreDictor RoboColumn MabSelect SuRe LX, 600 μL 28-9974-51<br />

96-well filter plates<br />

PreDictor MabSelect SuRe LX, 6 μL,<br />

4 × 96-well filter plates 17-5474-30<br />

PreDictor MabSelect SuRe LX, 20 μL,<br />

4 × 96-well filter plates 17-5474-31<br />

PreDictor MabSelect SuRe LX, 50 μL,<br />

4 × 96-well filter plates 17-5474-32<br />

Technical data<br />

Composition<br />

Rigid, highly cross-linked agarose<br />

Particle size 85 µm median (d 50,volume<br />

)<br />

Ligand<br />

alkali-tolerant Protein A-derived<br />

(E. coli)<br />

Coupling chemistry epoxy<br />

Dynamic binding capacity ~ 60 mg human IgG/mL medium at<br />

6.0 min residence time<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 0.1–0.5 M NaOH<br />

Pressure/flow spec. up to 500 cm/h, < 2 bar,<br />

AxiChrom 300, bed height 20 cm<br />

■ MabSelect Xtra. See p 83, 86<br />

Pack size<br />

Code number<br />

25 mL 17-5269-07<br />

200 mL 17-5269-02<br />

1 L 17-5269-03<br />

5 L 17-5269-04<br />

10 L 17-5269-05<br />

60 L 17-5269-06<br />

Data file 11-0011-57<br />

Regulatory support file 11-0029-17<br />

Prepacked columns<br />

HiTrap MabSelect Xtra, 5 × 1 mL 28-4082-58<br />

HiTrap MabSelect Xtra, 1 × 5 mL 28-4082-60<br />

HiTrap MabSelect Xtra, 5 × 5 mL 28-4082-61<br />

HiScreen MabSelect Xtra, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-76<br />

PreDictor RoboColumn MabSelect Xtra, 50 μL 28-9862-04<br />

PreDictor RoboColumn MabSelect Xtra, 200 μL 28-9861-08<br />

96-well filter plates<br />

PreDictor MabSelect Xtra, 6 μL,<br />

4 × 96-well filter plates 28-9432-75<br />

PreDictor MabSelect Xtra, 20 μL,<br />

4 × 96-well filter plates 28-9432-76<br />

PreDictor MabSelect Xtra, 50 μL,<br />

4 × 96-well filter plates 28-9432-77<br />

Technical data<br />

Composition<br />

highly cross-linked agarose<br />

Particle size 75 µm median (d 50,volume<br />

)<br />

Ligand<br />

recombinant Protein A (E. coli)<br />

Coupling chemistry epoxy<br />

Dynamic binding capacity<br />

~ 40 mg human IgG/mL medium at<br />

2.4 min residence time<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–12<br />

Pressure/flow spec. up to 300 cm/h, < 200 kPa, BPG 300,<br />

bed height 20 cm<br />

Index and legal<br />

12<br />

250 www.gelifesciences.com/bioprocess

---

CDM MacroCap Q. See p 78, 80, 101<br />

Pack size<br />

Code number<br />

25 mL 17-5469-01<br />

500 mL 17-5469-02<br />

5 L 17-5469-04<br />

Data file 28-4005-84<br />

Regulatory support file 11-0029-87<br />

Technical data<br />

Composition<br />

Cross-linked co-polymer of allyl dextran<br />

and N,N-methylene bisacrylamide<br />

Particle size 50 μm median (d 50,volume<br />

)<br />

Ion exchanger type Strong anion<br />

Charged group -N(CH 3<br />

) 3+<br />

Total ionic capacity 0.07 to 0.10 mmol Cl - /mL medium<br />

Recommended<br />

separation range<br />

a) proteins in excess of 150 kDa<br />

b) functionalized Dextrans or PEGs<br />

≥ 20 000 MW<br />

c) PEG-proteins containing<br />

≥ 10 000 PEG (total) per conjugate<br />

pH stability (operational) 3–11<br />

pH stability (short term) 1–12<br />

pH stability (long term) 3–10<br />

CIP stability 2–13<br />

Chemical stability all commonly used aqueous buffers,<br />

0.1 M citric acid, 0.5 M NaOH,<br />

25% ethanol, 30% propanol,<br />

30% methanol, 50% ethylene glycol,<br />

1% Tween 20, 1% SDS.<br />

Flow velocity<br />

120 cm/h in BPG 300 columns with<br />

20 cm bed height at 20°C using process<br />

buffers with the same viscosity as<br />

water at < 300 kPa.<br />

■ MacroCap SP. See p 78, 80<br />

Pack size<br />

Code number<br />

25 mL 17-5440-10<br />

100 mL 17-5440-01<br />

1 L 17-5440-02<br />

5 L 17-5440-03<br />

10 L 17-5440-05<br />

60 L 17-5440-60<br />

Data file 28-4005-84<br />

Regulatory support file 11-0029-33<br />

Technical data<br />

Composition<br />

Cross-linked co-polymer of allyl dextran<br />

and N,N-methylene bisacrylamide<br />

Particle size 50 μm median (d 50,volume<br />

)<br />

Ion exchanger type Strong cation<br />

Charged group<br />

-<br />

SO 3<br />

Total ionic capacity 0.10–0.13 mmol H + /mL medium<br />

Recommended<br />

separation range<br />

a) proteins in excess of 150 kDa<br />

b) functionalized Dextrans or PEGs<br />

≥ 20 000 MW<br />

c) PEG-proteins containing<br />

≥ 10 000 PEG (total) per conjugate<br />

pH stability (operational) 3–12<br />

pH stability (short term) 2–13<br />

pH stability (long term) 4–11<br />

CIP stability 2–13<br />

Chemical stability all commonly used aqueous buffers,<br />

0.1 M citric acid, 0.5 M NaOH,<br />

25% ethanol, 30% propanol,<br />

30% methanol, 50% ethylene glycol,<br />

1% Tween 20, 1% SDS.<br />

Flow velocity<br />

120 cm/h in BPG 300 columns with<br />

20 cm bed height at 20°C using process<br />

buffers with the same viscosity as<br />

water at < 300 kPa.<br />

■ NHS-activated Sepharose 4 Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

25 mL 17-0906-01<br />

500 mL 17-0906-02<br />

5 L 17-0906-04<br />

Data file 18-1113-53<br />

Regulatory support file 11-0028-21<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

For coupling to -NH 2<br />

Active groups<br />

NHS ester on 14-atom spacer<br />

Amount of active groups ~ 18 µmol NHS/mL drained medium<br />

pH stability (operational)<br />

CIP stability (short term)<br />

Pressure/flow spec.<br />

3–13, ligand dependent<br />

3–13, ligand dependent<br />

base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 251

---

Index and legal<br />

12<br />

■ Ni Sepharose 6 Fast Flow. See p 82, 86<br />

Pack size<br />

Code number<br />

5 mL 17-5318-06<br />

25 mL 17-5318-01<br />

100 mL 17-5318-02<br />

500 mL 17-5318-03<br />

1 L 17-5318-04<br />

5 L 17-5318-05<br />

Data file 11-0008-86<br />

Regulatory support file 11-0028-43<br />

Prepacked columns<br />

HisTrap FF, 5 × 1 mL 17-5319-01<br />

HisTrap FF, 100 × 1 mL* 17-5319-02<br />

HisTrap FF, 5 × 5 mL 17-5255-01<br />

HisTrap FF, 100 × 5 mL* 17-5255-02<br />

HisPrep FF 16/10, 1 × 20 mL 28-9365-51<br />

HisTrap FF crude, 5 × 1 mL 11-0004-58<br />

HisTrap FF crude, 100 × 1 mL* 11-0004-59<br />

HisTrap FF crude, 5 × 5 mL 17-5286-01<br />

HisTrap FF crude, 100 × 5 mL* 17-5286-02<br />

HiScreen Ni FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9782-44<br />

96-well filter plates<br />

His MultiTrap FF, 4 × 96-well filter plates 28-4009-90<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Metal ion capacity<br />

~ 15 µmol Ni 2+ /mL medium<br />

Dynamic binding capacity<br />

~ 40 mg histidine-tagged protein/<br />

mL medium, protein dependent<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. base matrix 200–400 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

*Special pack size delivered on specific customer order.<br />

■ nProtein A Sepharose 4 Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

5 mL 17-5280-01<br />

25 mL 17-5280-04<br />

200 mL 17-5280-02<br />

1 L 17-5280-03<br />

5 L 17-5280-05<br />

10 L 17-5280-06<br />

Data file 18-1125-19<br />

Regulatory support file 11-0029-19<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

Protein A from Staphylococcus aureus<br />

CNBr<br />

pH stability (operational) 3–9<br />

CIP stability (short term) 2–10<br />

Pressure/flow spec.<br />

base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

■ Octyl Sepharose 4 Fast Flow. See p 89, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0946-10<br />

200 mL 17-0946-02<br />

1 L 17-0946-03<br />

5 L 17-0946-04<br />

Regulatory support file 11-0028-22<br />

Prepacked columns<br />

HiTrap Octyl FF, 5 × 1 mL 17-1359-01<br />

HiTrap Octyl FF, 5 × 5 mL 17-5196-01<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

HiPrep Octyl FF 16/10, 1 × 20 mL 28-9365-48<br />

HiScreen Octyl FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9269-86<br />

PreDictor RoboColumn Octyl Sepharose 4FF, 200 μL 28-9861-02<br />

PreDictor RoboColumn Octyl Sepharose 4FF, 600 μL 28-9861-91<br />

96-well filter plates<br />

PreDictor Octyl Sepharose 4 Fast Flow,<br />

6 μL, 4 × 96-well filter plates 17-0946-16<br />

PreDictor Octyl Sepharose 4 Fast Flow,<br />

50 μL, 4 × 96-well filter plates 17-0946-17<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

n-octyl<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

252 www.gelifesciences.com/bioprocess

---

Oligosynt.<br />

See Solid supports for oligonucleotide synthesis p 266<br />

■ Phenyl Sepharose 6 Fast Flow (high sub).<br />

See p 89, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0973-10<br />

200 mL 17-0973-05<br />

1 L 17-0973-03<br />

5 L 17-0973-04<br />

10 L 17-0973-06<br />

60 L 17-0973-60<br />

Data file 18-1020-53<br />

Regulatory support file 11-0028-23<br />

Prepacked columns<br />

HiTrap Phenyl FF (high sub), 5 × 1 mL 17-1355-01<br />

HiTrap Phenyl FF (high sub), 5 × 5 mL 17-5193-01<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

HiPrep Phenyl FF (high sub) 16/10, 1 × 20 mL 28-9365-45<br />

HiScreen Phenyl FF (high sub),<br />

1 × 4.7 mL (0.77 × 10 cm) 28-9269-88<br />

PreDictor RoboColumn<br />

Phenyl Sepharose 6FF (high sub), 200 μL 28-9860-98<br />

PreDictor RoboColumn<br />

Phenyl Sepharose 6FF (high sub), 600 μL 28-9861-84<br />

96-well filter plates<br />

PreDictor Phenyl Sepharose 6 Fast Flow (high sub),<br />

6 μL, 4 × 96-well filter plates 17-0973-16<br />

PreDictor Phenyl Sepharose 6 Fast Flow (high sub),<br />

50 μL, 4 × 96-well filter plates 17-0973-17<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

phenyl<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

200–400 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

■ Phenyl Sepharose 6 Fast Flow (low sub).<br />

See p 89, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0965-10<br />

200 mL 17-0965-05<br />

1 L 17-0965-03<br />

5 L 17-0965-04<br />

Data file 18-1020-53<br />

Regulatory support file 11-0028-23<br />

Prepacked columns<br />

HiTrap Phenyl FF (low sub), 5 × 1 mL 17-1353-01<br />

HiTrap Phenyl FF (low sub), 5 × 5 mL 17-5194-01<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

HiPrep Phenyl FF (low sub) 16/10, 1 × 20 mL 28-9365-46<br />

HiScreen Phenyl FF (low sub),<br />

1 × 4.7 mL (0.77 × 10 cm)<br />

28-9269-89<br />

PreDictor RoboColumn<br />

Phenyl Sepharose 6FF (low sub), 200 μL 28-9860-99<br />

PreDictor RoboColumn<br />

Phenyl Sepharose 6FF (low sub), 600 μL 28-9861-88<br />

ReadyToProcess<br />

Phenyl Sepharose 6 FF (low sub) 1, 1 L 28-9511-11<br />

ReadyToProcess<br />

Phenyl Sepharose 6 FF (low sub) 2.5, 2.5 L 28-9017-35<br />

ReadyToProcess<br />

Phenyl Sepharose 6 FF (low sub) 10, 10 L 28-9017-36<br />

ReadyToProcess<br />

Phenyl Sepharose 6 FF (low sub) 20, 20 L 28-9017-37<br />

96-well filter plates<br />

PreDictor Phenyl Sepharose 6 Fast Flow (low sub),<br />

6 μL, 4 × 96-well filter plates 17-0965-16<br />

PreDictor Phenyl Sepharose 6 Fast Flow (low sub),<br />

50 μL, 4 × 96-well filter plates 17-0965-17<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 90 μm median (d 50,volume<br />

)<br />

Ligand<br />

phenyl<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 200–400 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 253

---

■ Phenyl Sepharose High Performance.<br />

See p 89, 160<br />

Pack size<br />

Code number<br />

75 mL 17-1082-01<br />

1 L 17-1082-03<br />

5 L 17-1082-04<br />

Data file 18-1020-56<br />

Regulatory support file 11-0028-24<br />

Prepacked columns<br />

HiLoad 16/10 Phenyl Sepharose HP, 1 × 20 mL 17-1085-01<br />

HiLoad 26/10 Phenyl Sepharose HP, 1 × 53 mL 17-1086-01<br />

HiTrap Phenyl HP, 5 × 1 mL 17-1351-01<br />

HiTrap Phenyl HP, 5 × 5 mL 17-5195-01<br />

HiTrap HIC Selection Kit, 7 × 1 mL 28-4110-07<br />

HiScreen Phenyl HP, 1 × 4.7 mL (0.77 × 10 cm) 28-9505-16<br />

PreDictor RoboColumn Phenyl Sepharose HP, 200 μL 28-9861-05<br />

PreDictor RoboColumn Phenyl Sepharose HP, 600 μL 28-9861-94<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 34 μm median (d 50,volume<br />

)<br />

Ligand<br />

phenyl<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Max pressure<br />

300 kPa<br />

CDM Plasminogen Removal Gel. See p 86, 101<br />

Pack size<br />

Code number<br />

1 L 28-4109-03<br />

Regulatory support file 11-0029-29<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

Ligand density<br />

epoxy<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 2–14<br />

Tranexamic acid<br />

9–13 µmol/mL drained medium<br />

Pressure/flow spec. 150–250 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

Primer Support.<br />

See Solid supports for oligonucleotide synthesis p 266<br />

Protein A. See p 82–83, 92<br />

Pack size<br />

Code number<br />

50 mg 17-0872-50<br />

1 g 17-0872-01<br />

10 g 17-0872-02<br />

CDM Procainamide Sepharose 4 Fast Flow. See p 86, 101<br />

Index and legal<br />

■ PlasmidSelect Xtra. See p 93, 160<br />

Pack size<br />

Code number<br />

PlasmidSelect Xtra Screening Kit 28-4052-69<br />

PlasmidSelect Xtra Starter Kit 28-4052-68<br />

25 mL 28-4024-01<br />

200 mL 28-4024-02<br />

1 L 28-4024-03<br />

5 L 28-4024-04<br />

Data file 28-4094-87<br />

Regulatory support file 11-0029-34<br />

Technical data<br />

Composition<br />

Particle size 24–44 µm<br />

Ligand<br />

Ligand concentration<br />

highly cross-linked 6% agarose<br />

2-mercaptopyridine<br />

3.5 mg/mL<br />

Capacity for supercoiled pDNA<br />

(6125 bp) > 2 mg/mL<br />

pH stability (operational) 3–11<br />

CIP stability (short term) 2–13<br />

Cleaning-in-place<br />

0.5 M NaOH<br />

Flow velocity for supercoiled<br />

plasmid purification<br />

< 120 cm/h, XK 16/20 column,<br />

bed height 15 cm<br />

Pack size<br />

Code number<br />

1 L 28-4111-03<br />

5 L 28-4111-04<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Coupling chemistry<br />

Ligand<br />

amide linkage (carbodiimide)<br />

procainamide<br />

Ligand density<br />

~ 23 µmol/mL drained medium<br />

Pressure/flow spec. min 150 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm (base matrix)<br />

12<br />

254 www.gelifesciences.com/bioprocess

---

■ rProtein A Sepharose 4 Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

5 mL 17-1279-01<br />

25 mL 17-1279-02<br />

200 mL 17-1279-03<br />

1 L 17-1279-04<br />

5 L 17-1279-05<br />

10 L 17-1279-06<br />

Data file 18-1113-94<br />

Regulatory support file 11-0028-35<br />

Prepacked columns<br />

HiTrap rProtein A FF, 5 × 1 mL 17-5079-01<br />

HiTrap rProtein A FF, 2 × 1 mL 17-5079-02<br />

HiTrap rProtein A FF, 100 × 1 mL* 28-9464-89<br />

HiTrap rProtein A FF, 1 × 5 mL 17-5080-01<br />

HiTrap rProtein A FF, 5 × 5 mL 17-5080-02<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

recombinant Protein A from E. coli<br />

epoxy<br />

Dynamic binding capacity min 27 mg human IgG/mL medium<br />

at 3 min residence time<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–11<br />

Pressure/flow spec. base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

*Special pack size delivered on specific customer order.<br />

■ rmp Protein A Sepharose Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

5 mL 17-5138-01<br />

25 mL 17-5138-02<br />

200 mL 17-5138-03<br />

1 L 17-5138-04<br />

5 L 17-5138-05<br />

Data file 18-1141-34<br />

Regulatory support file 11-0029-25<br />

Technical data<br />

Composition<br />

highly cross-linked 4% agarose<br />

Particle size 90 µm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

recombinant Protein A from E. coli<br />

reductive amination<br />

Dynamic binding<br />

capacity min 22 mg human IgG/mL medium at 3<br />

min residence time<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–11<br />

Pressure/flow spec. base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

Protein G.<br />

Pack size<br />

Code number<br />

5 mg 17-0619-01<br />

1 g 17-0619-09<br />

10 g 17-0619-10<br />

■ Protein G Sepharose 4 Fast Flow. See p 86<br />

Pack size<br />

Code number<br />

5 mL 17-0618-01<br />

25 mL 17-0618-02<br />

200 mL 17-0618-05<br />

1 L 17-0618-06<br />

5 L 17-0618-04<br />

Data file 18-1012-91<br />

Regulatory support file 11-0028-29<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

Ligand<br />

Ligand density<br />

Coupling chemistry<br />

highly cross-linked 4% agarose<br />

recombinant Protein G from E. coli<br />

~ 2 mg protein G/mL drained medium<br />

CNBr<br />

pH stability (operational) 3–9<br />

CIP stability (short term) 2–10<br />

Pressure/flow spec.<br />

CDM VIISelect. See p 101<br />

Pack size<br />

base matrix 150–250 cm/h,<br />

100 kPa, XK 50/60 column,<br />

bed height 25 cm<br />

Code number<br />

25 mL 17-5477-01<br />

200 mL 17-5477-02<br />

1 L 17-5477-03<br />

5 L 17-5477-04<br />

Regulatory support file 11-0029-85<br />

Technical data<br />

Composition<br />

highly cross-linked high-flow agarose<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ligand recombinant protein (Mr 14 080)<br />

produced in S. cerevisiae<br />

Ligand density<br />

~ 5.7 mg/mL of medium<br />

Binding capacity ~ 8 mg/mL of medium<br />

pH stability (operational) 3–10<br />

CIP stability (short term) 2–12<br />

Pressure/flow spec. at least 600 cm/h in a 1 m column with<br />

20 cm bed height at 20°C using buffers<br />

with the same viscosity as water at<br />

< 3 bar (0.3 MPa)<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 255

---

CDM VIIISelect. See p 86, 101<br />

Pack size<br />

Code number<br />

25 mL 17-5450-01<br />

500 mL 17-5450-02<br />

Regulatory support file 11-0029-48<br />

Technical data<br />

Composition<br />

highly cross-linked high flow agarose<br />

Particle size 75 μm median (d 50,volume<br />

)<br />

Ligand<br />

Coupling chemistry<br />

Pressure/flow spec.<br />

13 kD recombinant protein produced<br />

in S. cerevisiae. Binds to beta-domain<br />

depleted factor VIII molecules.<br />

NHS<br />

At least 300 cm/h in a BPG 300 column<br />

with 20 cm bed height at 20°C using<br />

process buffers with the same viscosity<br />

as water at < 2 bar (0.2 MPa)<br />

■ Q Sepharose Big Beads. See p 80, 160<br />

Pack size<br />

Code number<br />

1 L 17-0989-03<br />

10 L 17-0989-05<br />

60 L 17-0989-60<br />

IEX Selection Kit 17-0939-01<br />

Data file 18-1104-91<br />

Regulatory support file 11-0028-32<br />

Technical data<br />

Composition<br />

Particle size 100–300 µm<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

highly cross-linked 6% agarose<br />

0.18–0.25 mmol Cl - /mL medium<br />

1 200–1 800 cm/h, 100 kPa,<br />

XK50/60 column, bed height 25 cm<br />

■ Q Sepharose Fast Flow. See p 81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0510-10<br />

300 mL 17-0510-01<br />

5 L 17-0510-04<br />

10 L 17-0510-05<br />

60 L 17-0510-60<br />

IEX Selection Kit 17-0939-01<br />

Data file 18-1020-66<br />

Regulatory support file 11-0028-30<br />

Prepacked columns<br />

HiTrap Q FF, 5 × 1 mL 17-5053-01<br />

HiTrap Q FF, 5 × 5 mL 17-5156-01<br />

HiPrep Q FF 16/10, 1 × 20 mL 28-9365-43<br />

HiScreen Q FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9505-10<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

PreDictor RoboColumn Q Sepharose FF, 200 μL 28-9860-86<br />

PreDictor RoboColumn Q Sepharose FF, 600 μL 28-9861-80<br />

ReadyToProcess Q Sepharose FF 1, 1 L 28-9511-25<br />

ReadyToProcess Q Sepharose FF 2.5, 2.5 L 28-9290-76<br />

ReadyToProcess Q Sepharose FF 10, 10 L 28-9290-79<br />

ReadyToProcess Q Sepharose FF 20, 20 L 28-9290-82<br />

96-well filter plates<br />

PreDictor Q Sepharose Fast Flow,<br />

6 μL, 4 × 96-well filter plates 28-9432-69<br />

PreDictor Q Sepharose Fast Flow,<br />

20 μL, 4 × 96-well filter plates 28-9432-70<br />

PreDictor Q Sepharose Fast Flow,<br />

50 μL, 4 × 96-well filter plates 28-9432-71<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

Binding capacity<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

highly cross-linked 6% agarose<br />

120 mg HSA/mL drained medium<br />

0.18–0.24 mmol Cl - /mL medium<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 400–700 cm/h, 100 kPa,<br />

XK 50/30 column, bed height 15 cm.<br />

Index and legal<br />

12<br />

256 www.gelifesciences.com/bioprocess

---

■ Q Sepharose High Performance. See p 81, 160<br />

Pack size<br />

Code number<br />

75 mL 17-1014-01<br />

1 L 17-1014-03<br />

5 L 17-1014-04<br />

10 L 17-1014-05<br />

Data file 18-1172-88<br />

Regulatory support file 11-0028-31<br />

Prepacked columns<br />

HiLoad 16/10 Q Sepharose HP, 1 × 20 mL 17-1064-01<br />

HiLoad 26/10 Q Sepharose HP, 1 × 53 mL 17-1066-01<br />

HiTrap Q HP, 5 × 1 mL 17-1153-01<br />

HiTrap Q HP, 5 × 5 mL 17-1154-01<br />

HiScreen Q HP, 1 × 4.7 mL (0.77 × 10 cm) 28-9505-11<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

PreDictor RoboColumn Q Sepharose HP, 200 μL 28-9861-03<br />

PreDictor RoboColumn Q Sepharose HP, 600 μL 28-9861-92<br />

Technical data<br />

Composition<br />

cross-linked agarose<br />

Particle size 34 µm median (d 50,volume<br />

)<br />

Binding capacity<br />

Ion capacity<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec.<br />

■ Q Sepharose XL. See p 81, 160<br />

Pack size<br />

120 mg HSA/mL drained medium<br />

0.14–0.20 mmol Cl - /mL medium<br />

min 75 cm/h, 250 kPa,<br />

BioPilot 60/100 column,<br />

bed height 30 cm<br />

Code number<br />

300 mL 17-5072-01<br />

5 L 17-5072-04<br />

10 L 17-5072-05<br />

60 L 17-5072-60<br />

Data file 18-1123-82<br />

Regulatory support file 11-0028-33<br />

Prepacked columns<br />

HiTrap Q XL, 5 × 1 mL 17-5158-01<br />

HiTrap Q XL, 5 × 5 mL 17-5159-01<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

HiPrep Q XL 16/10, 1 × 20 mL 28-9365-38<br />

Technical data<br />

Composition<br />

cross-linked 6% agarose with dextran<br />

coating<br />

Particle size 45–165 µm<br />

Binding capacity > 130 mg bovine serum albumin/mL<br />

medium<br />

Ion capacity<br />

0.18–0.26 mmol Cl - /mL medium<br />

pH stability (operational) 2–12<br />

CIP stability (working) 2–14<br />

Flow rate<br />

300–500 cm/h<br />

QAE Sephadex A-25. See p 80<br />

Pack size<br />

Code number<br />

100 g 17-0190-01<br />

500 g 17-0190-02<br />

5 kg 17-0190-03<br />

Data file 18-1117-58<br />

Regulatory support file 11-0028-96<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size dry, 40–125 µm<br />

pH stability (operational) 2–10<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec.<br />

QAE Sephadex A-50. See p 80<br />

Pack size<br />

min 100 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=5,<br />

bed height 10 cm, 5 cm i.d.<br />

Code number<br />

100 g 17-0200-01<br />

5 kg 17-0200-03<br />

Data file 18-1117-58<br />

Regulatory support file 11-0028-97<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size dry, 40–125 µm<br />

pH stability (operational) 2–10<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec.<br />

min 60 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=10,<br />

bed height 10 cm, 5 cm i.d.<br />

■ Sephacryl S-100 High Resolution. See p 98–99<br />

Pack size<br />

Code number<br />

150 mL 17-0612-10<br />

750 mL 17-0612-01<br />

10 L 17-0612-05<br />

Data file 18-1060-88<br />

Regulatory support file 11-0028-36<br />

Prepacked columns<br />

HiPrep 16/60 Sephacryl S-100 HR, 1 × 120 mL 17-1165-01<br />

HiPrep 26/60 Sephacryl S-100 HR, 1 × 320 mL 17-1194-01<br />

Technical data<br />

Composition<br />

allyl dextran and N,N´methylene<br />

bisacrylamide<br />

Particle size 50 µm<br />

Fractionation range, globular<br />

proteins 1 × 10 3 to 1 × 10 5<br />

pH stability (operational) 3–11<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec.<br />

flow at 100 kPa > 125 cm/h,<br />

XK 50/30 column,<br />

bed height 15 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 257

---

Index and legal<br />

■ Sephacryl S-200 High Resolution. See p 98–99<br />

Pack size<br />

Code number<br />

150 mL 17-0584-10<br />

750 mL 17-0584-01<br />

10 L 17-0584-05<br />

60 L 17-0584-60<br />

Data file 18-1060-88<br />

Regulatory support file 11-0028-36<br />

Prepacked columns<br />

HiPrep 16/60 Sephacryl S-200 HR, 1 × 120 mL 17-1166-01<br />

HiPrep 26/60 Sephacryl S-200 HR, 1 × 320 mL 17-1195-01<br />

Technical data<br />

Composition<br />

allyl dextran and N,N´methylene<br />

bisacrylamide<br />

Particle size 50 µm<br />

Fractionation range,<br />

globular proteins 5 × 10 3 to 2.5 × 10 5<br />

pH stability (operational) 3–11<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec.<br />

flow at 100 kPa > 150 cm/h,<br />

XK 50/30 column,<br />

bed height 15 cm<br />

■ Sephacryl S-300 High Resolution. See p 98–99<br />

Pack size<br />

Code number<br />

150 mL 17-0599-10<br />

750 mL 17-0599-01<br />

10 L 17-0599-05<br />

Data file 18-1060-88<br />

Regulatory support file 11-0028-36<br />

Prepacked columns<br />

HiPrep 16/60 Sephacryl S-300 HR, 1 × 120 mL 17-1167-01<br />

HiPrep 26/60 Sephacryl S-300 HR, 1 × 320 mL 17-1196-01<br />

Technical data<br />

Composition<br />

allyl dextran and N,N´methylene<br />

bisacrylamide<br />

Particle size 50 µm<br />

Fractionation range,<br />

globular proteins 1 × 10 4 to 1.5 × 10 6<br />

pH stability (operational) 3–11<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec.<br />

flow at 100 kPa > 150 cm/h,<br />

XK 50/30 column,<br />

bed height 15 cm<br />

■ Sephacryl S-400 High Resolution. See p 98–99<br />

Pack size<br />

Code number<br />

150 mL 17-0609-10<br />

750 mL 17-0609-01<br />

10 L 17-0609-05<br />

Data file 18-1060-88<br />

Regulatory support file 11-0028-36<br />

Prepacked columns<br />

HiPrep 16/60 Sephacryl S-400 HR, 1 × 120 mL 28-9356-04<br />

HiPrep 26/60 Sephacryl S-400 HR, 1 × 320 mL 28-9356-05<br />

Technical data<br />

Composition<br />

allyl dextran and N,N´-methylene<br />

bisacrylamide<br />

Particle size 50 µm<br />

Fractionation range,<br />

globular proteins 2 × 10 4 to 8 × 10 6<br />

pH stability (operational) 3–11<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. flow at 100 kPa > 150 cm/h,<br />

XK 50/30 column, bed height 15 cm<br />

■ Sephacryl S-500 High Resolution. See p 98–99<br />

Pack size<br />

Code number<br />

150 mL 17-0613-10<br />

750 mL 17-0613-01<br />

10 L 17-0613-05<br />

Data file 18-1060-88<br />

Regulatory support file 11-0028-36<br />

Prepacked columns<br />

HiPrep 16/60 Sephacryl S-500 HR, 1 × 120 mL 28-9356-06<br />

HiPrep 26/60 Sephacryl S-500 HR, 1 × 320 mL 28-9356-07<br />

Technical data<br />

Composition<br />

allyl dextran and N,N´-methylene<br />

bisacrylamide<br />

Particle size 50 µm<br />

Fractionation range,<br />

globular proteins not determined<br />

pH stability (operational) 3–11<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. flow at 100 kPa > 125 cm/h,<br />

XK 50/30 column, bed height 15 cm<br />

12<br />

258 www.gelifesciences.com/bioprocess

---

■ Sephadex G-25 Coarse. See p 98–99<br />

Pack size<br />

Code number<br />

100 g 17-0034-01<br />

500 g 17-0034-02<br />

5 kg 17-0034-03<br />

40 kg 17-0034-07<br />

Data file 18-1115-79<br />

Regulatory support file 11-0028-38<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size<br />

dry, min 90% volume share between<br />

100–300 µm; wet (in 0.15 M NaCl),<br />

75–510 µm<br />

Fractionation range,<br />

globular proteins 1 × 10 3 to 5 × 10 3<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. 480–660 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=2,<br />

bed height 30 cm, 2.6 cm i.d.<br />

■ Sephadex G-25 Medium. See p 98–99<br />

Pack size<br />

Code number<br />

25 g 17-0033-10<br />

100 g 17-0033-01<br />

500 g 17-0033-02<br />

5 kg 17-0033-03<br />

Data file 18-1115-79<br />

Regulatory support file 11-0028-38<br />

Prepacked columns<br />

Prepacked Disposable Columns PD-10, 30 × 9.1 mL 17-0851-01<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size<br />

dry, min 90% volume share between<br />

50–150 µm; wet (in 0.15 M NaCl),<br />

40–250 µm<br />

Typical flow rate<br />

200 cm/h<br />

Fractionation range,<br />

globular proteins 1 × 10 3 to 5 × 10 3<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. 100–150 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=2,<br />

bed height 30 cm, 2.6 cm i.d.<br />

■ Sephadex G-25 Fine. See p 98–99<br />

Pack size<br />

Code number<br />

100 g 17-0032-01<br />

500 g 17-0032-02<br />

5 kg 17-0032-03<br />

Data file 18-1115-79<br />

Regulatory support file 11-0028-38<br />

Prepacked columns<br />

HiPrep 26/10 Desalting, 1 × 53 mL 17-5087-01<br />

HiPrep 26/10 Desalting, 4 × 53 mL 17-5087-02<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size<br />

dry, min 80% volume share between<br />

20–80 µm; wet (in 0.15 M NaCl),<br />

20–130 µm<br />

Typical flow rate 150 cm/h<br />

Fractionation range,<br />

globular proteins 1 × 10 3 to 5 × 10 3<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. 47–68 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=2,<br />

bed height 30 cm, 2.6 cm i.d.<br />

■ Sephadex G-25 Superfine. See p 98–99<br />

Pack size<br />

Code number<br />

100 g 17-0031-01<br />

500 g 17-0031-02<br />

5 kg 17-0031-03<br />

Data file 18-1115-79<br />

Regulatory support file 11-0028-38<br />

Prepacked columns<br />

HiTrap Desalting, 5 × 5 mL 17-1408-01<br />

HiTrap Desalting, 100 × 5 mL* 11-0003-29<br />

Technical data<br />

Composition<br />

cross-linked dextran<br />

Particle size<br />

dry, min 80% volume share between<br />

20–50 µm; wet (in 0.15 M NaCl),<br />

15–100 µm.<br />

Typical flow rate 100 cm/h<br />

Fractionation range,<br />

globular proteins 1 × 10 3 to 5 × 10 3<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. 11–26 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=2,<br />

bed height 30 cm, 2.6 cm i.d.<br />

*Special pack size delivered on specific customer order.<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 259

---

Index and legal<br />

12<br />

Sephadex LH-20. See p 98<br />

Pack size<br />

Code number<br />

25 g 17-0090-10<br />

100 g 17-0090-01<br />

500 g 17-0090-02<br />

5 kg 17-0090-03<br />

Data file 18-1107-22<br />

Regulatory support file 11-0029-00<br />

Technical data<br />

Composition<br />

hydroxypropylated, cross-linked<br />

dextran (based on Sephadex G-25)<br />

Particle size<br />

dry, min 85% volume share between<br />

30–100 µm, wet (in methanol) 25–165<br />

µm<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 2–13<br />

Pressure/flow spec. 25–45 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=2,<br />

bed height 30 cm, 2.6 cm i.d.<br />

Sepharose 4B.<br />

Pack size<br />

Code number<br />

1 L 17-0120-01<br />

10 L 17-0120-05<br />

Regulatory support file 11-0028-39<br />

Technical data<br />

Composition<br />

4% agarose<br />

Particle size 45–165 µm<br />

Fractionation range,<br />

globular proteins 6 × 10 4 to 2 × 10 7<br />

pH stability (operational) 4–9<br />

CIP stability (short term) 4–9<br />

Pressure/flow spec. 70–140 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm, column 5 cm i.d.<br />

Sepharose 6B.<br />

Pack size<br />

Code number<br />

1 L 17-0110-01<br />

10 L 17-0110-05<br />

Regulatory support file 11-0028-39<br />

Technical data<br />

Composition<br />

6% agarose<br />

Particle size 45–165 µm<br />

Fractionation range,<br />

globular proteins 1 × 10 4 to 4 × 10 6<br />

pH stability (operational) 4–9<br />

CIP stability (short term) 4–9<br />

Pressure/flow spec. 100–200 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm, 5 cm i.d.<br />

Sepharose CL-2B. See p 99<br />

Pack size<br />

Code number<br />

1 L 17-0140-01<br />

10 L 17-0140-05<br />

Regulatory support file 11-0028-40<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

cross-linked 2% agarose<br />

Fractionation range,<br />

globular proteins 7 × 10 4 to 4 × 10 7<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 60–120 cm/h,<br />

pressure drop cm H 2<br />

O/bed height=15,<br />

bed height 10 cm, 5 cm i.d.<br />

Sepharose CL-4B.<br />

Pack size<br />

Code number<br />

1 L 17-0150-01<br />

10 L 17-0150-05<br />

Regulatory support file 11-0028-40<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

cross-linked 4% agarose<br />

Fractionation range,<br />

globular proteins 6 × 10 4 to 2 × 10 7<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 80–150 cm/h,<br />

pressure drop m H 2<br />

O/bed height=15,<br />

bed height 10 cm, column 5 cm i.d.<br />

Sepharose CL-6B.<br />

Pack size<br />

Code number<br />

1 L 17-0160-01<br />

10 L 17-0160-05<br />

Regulatory support file 11-0028-40<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

cross-linked 6% agarose<br />

Fractionation range,<br />

globular proteins 1 × 10 4 to 4 × 10 6<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

Pressure/flow spec. 100–200 cm/h, pressure drop cm<br />

H 2<br />

O/bed height=15, bed height 10 cm,<br />

column 5 cm i.d.<br />

260 www.gelifesciences.com/bioprocess

---

■ Sepharose 4 Fast Flow. See p 98–99<br />

Pack size<br />

Code number<br />

1 L 17-0149-01<br />

10 L 17-0149-05<br />

Data file 18-1020-52<br />

Regulatory support file 11-0028-41<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

highly cross-linked 4% agarose<br />

Pressure/flow spec. 150–250 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm<br />

■ Sepharose 6 Fast Flow. See p 98–99<br />

Pack size<br />

Code number<br />

1 L 17-0159-01<br />

10 L 17-0159-05<br />

Data file 18-1020-52<br />

Regulatory support file 11-0028-42<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

pH stability (operational) 3–13<br />

CIP stability (short term) 2–14<br />

highly cross-linked 6% agarose<br />

Pressure/flow spec. 200–400 cm/h, 100 kPa, XK 50/60<br />

column, bed height 25 cm<br />

■ SOURCE 15ETH.<br />

Pack size<br />

Code number<br />

50 mL 17-0146-01<br />

200 mL 17-0146-02<br />

1 L 17-0146-04<br />

Data file 18-1128-86<br />

Regulatory support file 11-0028-46<br />

Prepacked columns<br />

RESOURCE ETH, 1 mL 17-1184-01<br />

RESOURCE HIC Test kit 17-1187-01<br />

Technical data<br />

Composition<br />

Particle size<br />

Typical flow rate<br />

pH stability (operational) 2–12<br />

polystyrene/divinylbenzene<br />

15 µm monosized<br />

150–900 cm/h<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec. 400 cm/h, 1000 kPa,<br />

FineLINE 100 column,<br />

bed height 10 cm, i.d. 10 cm<br />

■ SOURCE 15ISO.<br />

Pack size<br />

Code number<br />

50 mL 17-0148-01<br />

200 mL 17-0148-02<br />

1 L 17-0148-04<br />

Data file 18-1128-86<br />

Regulatory support file 11-0028-47<br />

Prepacked columns<br />

RESOURCE ISO, 1 mL 17-1185-01<br />

RESOURCE HIC Test kit 17-1187-01<br />

Technical data<br />

Composition<br />

Particle size<br />

Typical flow rate<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec.<br />

■ SOURCE 15PHE.<br />

Pack size<br />

polystyrene/divinylbenzene<br />

15 µm monosized<br />

150–900 cm/h<br />

400 cm/h, 1000 kPa,<br />

FineLINE 100 column,<br />

bed height 10 cm, i.d. 10 cm<br />

Code number<br />

50 mL 17-0147-01<br />

200 mL 17-0147-02<br />

1 L 17-0147-04<br />

5 L 17-0147-05<br />

Data file 18-1128-86<br />

Regulatory support file 11-0028-48<br />

Prepacked columns<br />

RESOURCE PHE, 1 mL 17-1186-01<br />

RESOURCE HIC Test kit 17-1187-01<br />

SOURCE 15PHE PE 4.6/100 17-5071-01<br />

Technical data<br />

Composition<br />

Particle size<br />

Typical flow rate<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec.<br />

polystyrene/divinylbenzene<br />

15 µm monosized<br />

150–900 cm/h<br />

400 cm/h, 1000 kPa,<br />

FineLINE 100 column,<br />

bed height 10 cm, i.d. 10 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 261

---

■ SOURCE 15Q. See p 79, 81<br />

Pack size<br />

Code number<br />

10 mL 17-0947-20<br />

50 mL 17-0947-01<br />

200 mL 17-0947-05<br />

500 mL 17-0947-02<br />

1 L 17-0947-03<br />

Regulatory support file 11-0028-51<br />

Prepacked columns<br />

RESOURCE Q, 1 mL 17-1177-01<br />

RESOURCE Q, 6 mL 17-1179-01<br />

SOURCE 15Q 4.6/100 PE 17-5181-01<br />

Technical data<br />

Ion exchanger type Quaternary ammonium strong anion<br />

exchanger<br />

Composition<br />

polystyrene/divinylbenzene<br />

Particle size<br />

15 µm monosized<br />

Binding capacity 45 mg BSA/mL drained medium<br />

Typical flow rate 150–900 cm/h<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec. 400 cm/h, 1000 kPa,<br />

FineLINE 100 column,<br />

bed height 10 cm, i.d. 10 cm<br />

■ SOURCE 15RPC. See p 95<br />

Pack size<br />

Code number<br />

10 mL 17-0727-20<br />

200 mL 17-0727-02<br />

500 mL 17-0727-03<br />

1 L 17-0727-04<br />

5 L 17-0727-05<br />

Regulatory support file 11-0028-49<br />

Prepacked columns<br />

RESOURCE RPC, 1 mL 17-1181-01<br />

RESOURCE RPC, 3 mL 17-1182-01<br />

SOURCE 15 RPC ST 4.6/100 17-5068-01<br />

Technical data<br />

Composition<br />

Particle size<br />

polystyrene/divinylbenzene<br />

15 µm monosized<br />

Binding capacity ~ 10 mg BSA/mL medium at 300 cm/h<br />

~ 30 mg bacitracin/mL medium at<br />

300 cm/h<br />

~ 50 mg insulin/mL medium at 300 cm/h<br />

Typical flow rate 150–900 cm/h<br />

pH stability (operational) 1–12<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec. 400 cm/h, 1000 kPa, FineLINE 100<br />

column, bed height 10 cm, i.d. 10 cm<br />

Index and legal<br />

■ SOURCE 30Q. See p 81, 160<br />

Pack size<br />

Code number<br />

50 mL 17-1275-01<br />

200 mL 17-1275-02<br />

1 L 17-1275-03<br />

5 L 17-1275-04<br />

Data file 18-1107-12<br />

Regulatory support file 11-0028-52<br />

Technical data<br />

Ion exchanger type Quaternary ammonium strong anion<br />

exchanger<br />

Composition<br />

polystyrene/divinylbenzene<br />

Particle size<br />

30 µm monosized<br />

Binding capacity 40 mg BSA/mL drained medium<br />

Typical flow rate 300–1 000 cm/h<br />

pH stability (operational) 2–12<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec. 2 000 cm/h, 1000 kPa, FineLINE 100<br />

column, bed height 10 cm, i.d. 10 cm<br />

■ SOURCE 30RPC. See p 95<br />

Pack size<br />

Code number<br />

10 mL 17-5120-20<br />

200 mL 17-5120-02<br />

500 mL 17-5120-03<br />

1 L 17-5120-04<br />

5 L 17-5120-05<br />

Data file 18-1129-73<br />

Regulatory support file 11-0028-53<br />

Technical data<br />

Composition<br />

Particle size<br />

polystyrene/divinylbenzene<br />

30 µm monosized<br />

Binding capacity ~ 14 mg BSA/mL medium at 300 cm/h<br />

~ 23 mg bacitracin/mL medium at<br />

300 cm/h<br />

~ 72 mg insulin/mL medium at 300 cm/h<br />

Typical flow rate 100–1000 cm/h<br />

pH stability (operational) 1–12<br />

CIP stability (short term) 1–14<br />

Pressure/flow spec. 2 000 cm/h, 1000 kPa, FineLINE 100<br />

column, bed height 10 cm, i.d. 10 cm<br />

12<br />

262 www.gelifesciences.com/bioprocess

---

■ SOURCE 15S. See p 79, 81<br />

Pack size<br />

Code number<br />

10 mL 17-0944-10<br />

50 mL 17-0944-01<br />

200 mL 17-0944-05<br />

500 mL 17-0944-02<br />

1 L 17-0944-03<br />

Regulatory support file 11-0028-50<br />

Prepacked columns<br />

RESOURCE S, 1 mL 17-1178-01<br />

RESOURCE S, 6 mL 17-1180-01<br />

SOURCE 15S 4.6/100 PE 17-5182-01<br />

Technical data<br />

Ion exchanger type<br />

Composition<br />

Particle size<br />

Binding capacity<br />

Typical flow rate<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 1–14<br />

Sulfonate strong cation exhanger<br />

polystyrene/divinylbenzene<br />

15 µm monosized<br />

75 mg lysozyme/mL drained medium<br />

150–900 cm/h<br />

Pressure/flow spec. 400 cm/h, 1000 kPa, FineLINE 100<br />

column, bed height 10 cm, i.d. 10 cm<br />

■ SP Sepharose Big Beads. See p 80, 160<br />

Pack size<br />

Code number<br />

1 L 17-0657-03<br />

10 L 17-0657-05<br />

60 L 17-0657-60<br />

IEX Selection Kit 17-0939-01<br />

Data file 18-1104-91<br />

Regulatory support file 11-0028-57<br />

Technical data<br />

Composition<br />

Particle size 100–300 µm<br />

Ion capacity<br />

pH stability (operational) 4–13<br />

highly cross-linked 6% agarose<br />

0.18–0.25 mmol H + /mL medium<br />

CIP stability (short term) 3–14<br />

Pressure/flow spec. 1 200–1 800 cm/h, 100 kPa,<br />

XK 50/60 column, bed height 25 cm<br />

■ SOURCE 30S. See p 81<br />

Pack size<br />

Code number<br />

50 mL 17-1273-01<br />

200 mL 17-1273-02<br />

1 L 17-1273-03<br />

5 L 17-1273-04<br />

Data file 18-1107-12<br />

Regulatory support file 11-0028-54<br />

Technical data<br />

Ion exchanger type<br />

Composition<br />

Particle size<br />

Binding capacity<br />

Typical flow rate<br />

pH stability (operational) 2–13<br />

CIP stability (short term) 1–14<br />

Sulfonate strong cation exhanger<br />

polystyrene/divinylbenzene<br />

30 µm monosized<br />

80 mg lysozyme/mL drained medium<br />

300–1 000 cm/h<br />

Pressure/flow spec. 2 000 cm/h, 1000 kPa, FineLINE 100<br />

column, bed height 10 cm, i.d. 10 cm<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 263

---

■ SP Sepharose Fast Flow. See p 81, 160<br />

Pack size<br />

Code number<br />

25 mL 17-0729-10<br />

300 mL 17-0729-01<br />

5 L 17-0729-04<br />

10 L 17-0729-05<br />

60 L 17-0729-60<br />

IEX Selection Kit 17-0939-01<br />

Data file 18-1020-66<br />

Regulatory support file 11-0028-55<br />

Prepacked columns<br />

HiTrap SP FF, 5 × 1 mL 17-5054-01<br />

HiTrap SP FF, 5 × 5 mL 17-5157-01<br />

HiScreen SP FF, 1 × 4.7 mL (0.77 × 10 cm) 28-9505-13<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

PreDictor RoboColumn SP Sepharose FF, 200 μL 28-9861-04<br />

PreDictor RoboColumn SP Sepharose FF, 600 μL 28-9861-93<br />

HiPrep SP FF 16/10, 1 × 20 mL 28-9365-44<br />

ReadyToProcess SP Sepharose FF 1, 1 L 28-9510-97<br />

ReadyToProcess SP Sepharose FF 2.5, 2.5 L 28-9291-05<br />

ReadyToProcess SP Sepharose FF 10, 10 L 28-9291-06<br />

ReadyToProcess SP Sepharose FF 20, 20 L 28-9291-07<br />

96-well filter plates<br />

PreDictor SP Sepharose Fast Flow,<br />

6 µL, 4 × 96-well filter plates 28-9432-72<br />

PreDictor SP Sepharose Fast Flow,<br />

20 µL, 4 × 96-well filter plates 28-9432-73<br />

PreDictor SP Sepharose Fast Flow,<br />

50 µL, 4 × 96-well filter plates 28-9432-74<br />

Technical data<br />

Composition<br />

Particle size 45–165 µm<br />

Binding capacity<br />

Ion capacity<br />

pH stability (operational) 4–13<br />

highly cross-linked 6% agarose<br />

120 mg BSA/mL drained medium<br />

0.18–0.25 mmol H + /mL medium<br />

CIP stability (short term) 3–14<br />

Pressure/flow spec. 400–700 cm/h, 100 kPa,<br />

XK 50/30 column, bed height 15 cm<br />

■ SP Sepharose High Performance. See p 81, 160<br />

Pack size<br />

Code number<br />

75 mL 17-1087-01<br />

1 L 17-1087-03<br />

5 L 17-1087-04<br />

10 L 17-1087-05<br />

60 L 17-1087-08<br />

Data file 18-1172-88<br />

Regulatory support file 11-0028-56<br />

Prepacked columns<br />

HiLoad 16/10 SP Sepharose HP, 1 × 20 mL 17-1137-01<br />

HiLoad 26/10 SP Sepharose HP, 1 × 53 mL 17-1138-01<br />

HiTrap SP HP, 5 × 1 mL 17-1151-01<br />

HiTrap SP HP, 5 × 5 mL 17-1152-01<br />

HiScreen SP HP, 1 × 4.7 mL (0.77 × 10 cm) 28-9505-15<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

PreDictor RoboColumn SP Sepharose HP, 200 μL 28-9861-04<br />

PreDictor RoboColumn SP Sepharose HP, 600 μL 28-9861-93<br />

Technical data<br />

Composition<br />

highly cross-linked 6% agarose<br />

Particle size 34 µm median (d 50,volume<br />

)<br />

Binding capacity<br />

Ion capacity<br />

pH stability (operational) 4–13<br />

CIP stability (short term) 3–14<br />

Pressure/flow spec.<br />

55 mg Ribonuclease/mL drained medium<br />

0.15–0.20 mmol H + /mL medium<br />

min 100 cm/h, 250 kPa,<br />

BioPilot 60/100 column,<br />

bed height 30 cm<br />

Index and legal<br />

12<br />

264 www.gelifesciences.com/bioprocess

---

■ SP Sepharose XL. See p 81, 160<br />

Pack size<br />

Code number<br />

300 mL 17-5073-01<br />

5 L 17-5073-04<br />

60 L 17-5073-60<br />

Data file 18-1123-82<br />

Regulatory support file 11-0028-58<br />

Prepacked columns<br />

HiTrap SP XL, 5 × 1 mL 17-5160-01<br />

HiTrap SP XL, 5 × 5 mL 17-5161-01<br />

HiTrap IEX Selection Kit, 7 × 1 mL 17-6002-33<br />

HiPrep SP XL 16/10, 1 × 20 mL 28-9365-40<br />

Technical data<br />

Composition<br />

cross-linked 6% agarose with dextran<br />

coating<br />

Particle size 45–165 µm<br />

Binding capacity > 160 mg lysozyme/mL medium<br />

Ion capacity<br />

0.18–0.25 mmol H + /mL medium<br />

pH stability (operational) 4–13<br />

CIP stability (working) 3–14<br />

Flow rate<br />

300–500 cm/h<br />

■ Superdex 30 prep grade. See p 98–99<br />

Pack size<br />

Code number<br />

25 mL 17-0905-10<br />

150 mL 17-0905-01<br />

1 L 17-0905-03<br />

5 L 17-0905-04<br />

Data file 18-1020-92<br />

Regulatory support file 11-0028-67<br />

Prepacked columns<br />

HiLoad 16/600 Superdex 30 pg, 1 × 120 mL 28-9893-31<br />

HiLoad 26/600 Superdex 30 pg, 1 × 320 mL 28-9893-32<br />

Technical data<br />

Composition<br />

composite of cross-linked agarose and<br />

dextran<br />

Particle size 34 µm<br />

Fractionation range,<br />

globular proteins up to 1 × 10 4<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 1–14<br />

Max pressure<br />

300 kPa<br />

■ Superdex 75 prep grade. See p 98–99<br />

Pack size<br />

Code number<br />

25 mL 17-1044-10<br />

150 mL 17-1044-01<br />

1 L 17-1044-02<br />

5 L 17-1044-04<br />

Data file 18-1020-92<br />

Regulatory support file 11-0028-66<br />

Prepacked columns<br />

HiLoad 16/600 Superdex 75 pg, 1 × 120 mL 28-9893-33<br />

HiLoad 26/600 Superdex 75 pg, 1 × 320 mL 28-9893-34<br />

Technical data<br />

Composition<br />

composite of cross-linked agarose and<br />

dextran<br />

Particle size 34 µm<br />

Fractionation range,<br />

globular proteins 3 × 10 3 to 7 × 10 4<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 1–14<br />

Max pressure<br />

300 kPa<br />

■ Superdex 200 prep grade. See p 98–99<br />

Pack size<br />

Code number<br />

25 mL 17-1043-10<br />

150 mL 17-1043-01<br />

1 L 17-1043-02<br />

5 L 17-1043-04<br />

10 L 17-1043-05<br />

60 L 17-1043-06<br />

Data file 18-1020-92<br />

Regulatory support file 11-0028-66<br />

Prepacked columns<br />

HiLoad 16/600 Superdex 200 pg, 1 × 120 mL 28-9893-35<br />

HiLoad 26/600 Superdex 200 pg, 1 × 320 mL 28-9893-36<br />

Technical data<br />

Composition<br />

composite of cross-linked agarose and<br />

dextran<br />

Particle size 34 µm<br />

Fractionation range,<br />

globular proteins 1 × 10 4 to 6 × 10 5<br />

Flow rate<br />

30–60 cm/h<br />

pH stability (operational) 3–12<br />

CIP stability (short term) 1–14<br />

Max pressure<br />

300 kPa<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 265

---

Solid supports for oligonucleotide synthesis.<br />

Oligosynt, disposable columns with<br />

Primer Support 200. See p 215<br />

<strong>Product</strong><br />

Code number<br />

Oligosynt dA<br />

15 µmol 17-5210-01<br />

30 µmol 17-5210-02<br />

120 µmol 17-5210-03<br />

Oligosynt dC<br />

15 µmol 17-5211-01<br />

30 µmol 17-5211-02<br />

120 µmol 17-5211-03<br />

Oligosynt dG<br />

15 µmol 17-5212-01<br />

30 µmol 17-5212-02<br />

120 µmol 17-5212-03<br />

Oligosynt T<br />

15 µmol 17-5213-01<br />

30 µmol 17-5213-02<br />

120 µmol 17-5213-03<br />

Technical data<br />

Composition<br />

spherical, porous and monodispersed<br />

divinylbenzene cross-linked polystyrene<br />

particles<br />

Particle size<br />

30 µm (retains size in all oligonucleotide<br />

synthesis reagents)<br />

Swelling volume in<br />

acetonitrile<br />

4.8 mL/g<br />

Particle size distribution Max 5% CV<br />

Storage 4°C to 30°C<br />

Degree of nucleoside<br />

substitution<br />

40 ± 4 μmol/g<br />

Primer Support 5G. See p 214<br />

<strong>Product</strong><br />

Code number<br />

DNA 350<br />

Primer Support 5G dA 350, 1 mmol 28-9964-25<br />

Primer Support 5G dA 350, 10 mmol 28-9964-30<br />

Primer Support 5G dC 350, 1 mmol 28-9964-26<br />

Primer Support 5G dC 350, 10 mmol 28-9964-31<br />

Primer Support 5G dG 350, 1 mmol 28-9964-27<br />

Primer Support 5G dG 350, 10 mmol 28-9964-32<br />

Primer Support 5G T 350, 1 mmol 28-9964-28<br />

Primer Support 5G T 350, 10 mmol 28-9964-33<br />

Primer Support 5G Unylinker 350, 1 mmol 28-9964-29<br />

Primer Support 5G Unylinker 350, 10 mmol 28-9964-34<br />

RNA 300<br />

Primer Support 5G ribo A 300, 1 mmol 28-9964-40<br />

Primer Support 5G ribo A 300, 10 mmol 28-9964-44<br />

Primer Support 5G ribo C 300, 1 mmol 28-9964-41<br />

Primer Support 5G ribo C 300, 10 mmol 28-9964-45<br />

Primer Support 5G ribo G 300, 1 mmol 28-9964-42<br />

Primer Support 5G ribo G 300, 10 mmol 28-9964-46<br />

Primer Support 5G ribo U 300, 1 mmol 28-9964-43<br />

Primer Support 5G ribo U 300, 10 mmol 28-9964-47<br />

Primer Support 5G Universal 300, 1 mmol 28-9964-39<br />

Primer Support 5G Universal 300, 10 mmol 28-9964-48<br />

Primer Support 5G T 300, 1 mmol 29-0146-19<br />

Primer Support 5G T 300, 10 mmol 29-0146-20<br />

Technical data<br />

Composition<br />

porous and polydispersed<br />

divinylbenzene cross-linked<br />

polystyrene particles<br />

Particle size<br />

35–75 µm (200–400 mesh)<br />

Matrix<br />

cross-linked polystyrene/<br />

divinylbenzene<br />

Recommended column<br />

packing volume<br />

111 mg/mL (9 mL/g)<br />

Swelling volume in acetonitrile 3.5 mL/g<br />

Swelling volume in toluene 7.5 mL/g<br />

Storage 4°C to 30°C<br />

Degree of nucleoside substitution up to 400 μmol/g<br />

Max recommended bed height 10 cm<br />

Index and legal<br />

12<br />

266 www.gelifesciences.com/bioprocess

---

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 267

---

Terms and conditions of sale /<br />

Trademarks / Licensing information<br />

Unless otherwise agreed in writing all goods and services are sold subject to the following terms and conditions.<br />

Any use of commercially available software is subject to <strong>GE</strong> <strong>Healthcare</strong> Standard Software End-User License<br />

Agreement for <strong>Life</strong> <strong>Sciences</strong> Software <strong>Product</strong>s.<br />

In no event shall the products be used for in vivo applications. Any warranty granted by <strong>GE</strong> <strong>Healthcare</strong> shall be<br />

deemed void if any goods covered by such warranty are used for any purpose not permitted hereunder.<br />

For the latest information on our terms and conditions of sale, trademarks, patent and licensing please go to<br />

our website www.gelifesciences.com<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> AB.<br />

© 2012 General Electric Company – All rights reserved.<br />

Terms and conditions of sale<br />

Index and legal<br />

12<br />

1. General<br />

1.1 In these Terms and Conditions:<br />

The Buyer means the person, firm, company or other organization who or<br />

which has ordered <strong>Product</strong>s and/or Services from <strong>GE</strong>HC;<br />

<strong>GE</strong>HC means the <strong>GE</strong> <strong>Healthcare</strong> group company referred to in the<br />

final written offer, quotation or order acknowledgement or, if none, the<br />

<strong>GE</strong> <strong>Healthcare</strong> company making the supply;<br />

The Contract means the contract for the sale and purchase of<br />

<strong>Product</strong>s and/or Services between <strong>GE</strong>HC and the Buyer as may be<br />

further evidenced by <strong>GE</strong>HC’s final written offer, quotation or order<br />

acknowledgement and no prior proposals, statements, representations or<br />

conditions will be binding on either party;<br />

The Equipment means all electronic equipment, hardware and other<br />

electronic or mechanical items agreed to be supplied by <strong>GE</strong>HC, excluding<br />

any consumables and spare parts sold separately;<br />

The Goods means all items agreed to be supplied by <strong>GE</strong>HC other than the<br />

Equipment and Software;<br />

The <strong>Product</strong>s means any Goods, Equipment or Software agreed to be<br />

supplied by <strong>GE</strong>HC; and<br />

The Services means all advice given and services performed by <strong>GE</strong>HC; and<br />

The Software means any firmware, software or data compilations<br />

(i) identified in the Contract or (ii) provided to Buyer by <strong>GE</strong>HC in connection<br />

with installation or operation of the Equipment. For the avoidance of<br />

doubt, Software shall not include any “open source” firmware, software<br />

or data compilations, as any such “open source” firmware, software or<br />

data compilations will be subject to the terms and conditions set out in the<br />

relevant “open source” license.<br />

1.2 These Terms and Conditions shall be incorporated into the Contract<br />

and shall apply to the exclusion of any conditions of the Buyer. These<br />

Terms and Conditions may not be varied or waived except with the<br />

express written agreement of <strong>GE</strong>HC. The failure of <strong>GE</strong>HC to enforce its<br />

rights under the Contract at any time, for any period of time, shall not be<br />

construed as a waiver of any such rights.<br />

2. Prices and Quotations<br />

The price of the <strong>Product</strong>s and/or Services will be <strong>GE</strong>HC‘s quoted price,<br />

inclusive of any duties, but exclusive of value added or other taxes. All<br />

quotations issued by <strong>GE</strong>HC for the supply of <strong>Product</strong>s and/or Services<br />

shall remain open for acceptance for the period stated in the quotation<br />

or, if none is stated, for sixty (60) days. In all other cases, prices payable<br />

are those currently in effect in <strong>GE</strong>HC´s then current pricelist, which may<br />

include charges for handling, freight, packaging, insurance and minimum<br />

orders.<br />

3. Payment<br />

3.1 Unless otherwise agreed in writing, payment in full shall be made to<br />

<strong>GE</strong>HC in the currency invoiced, no later than thirty (30) days from the date<br />

of invoice.<br />

3.2 In the event of late payment, <strong>GE</strong>HC reserves the right:<br />

(i) to suspend deliveries and/or cancel any of its outstanding obligations;<br />

and<br />

(ii) to charge interest at the lower of (a) an annual rate equal to twelve<br />

(12) % and (b) any applicable maximum statutory rate on all unpaid<br />

amounts calculated on a day to day basis until the actual date of<br />

payment.<br />

4. Changes and Returns<br />

4.1 <strong>GE</strong>HC reserves the right, subject to prior written notice, to make any<br />

change in the specification of the <strong>Product</strong>s, which does not materially<br />

affect the installation, performance or price thereof.<br />

4.2 <strong>Product</strong>s may only be returned with prior authorization from <strong>GE</strong>HC.<br />

268 www.gelifesciences.com/bioprocess

---

5. Delivery/Installation/Acceptance<br />

5.1 Any term of delivery shall be construed according the latest edition of<br />

Incoterms. If no other term of delivery has been specified in the Contract<br />

the <strong>Product</strong>s will be delivered CIP to Buyer’s premises or to the agreed<br />

destination.<br />

5.2 Partial deliveries shall be permitted. If the Buyer fails to accept delivery<br />

of the <strong>Product</strong>s within a reasonable period after receiving notice from<br />

<strong>GE</strong>HC that they are ready for delivery, <strong>GE</strong>HC may dispose of or store the<br />

<strong>Product</strong>s at the Buyer’s expense.<br />

5.3 <strong>GE</strong>HC will use all reasonable endeavours to avoid delay in delivery on<br />

the notified delivery dates. Failure to deliver by the specified date will not<br />

be a sufficient cause for cancellation, nor will <strong>GE</strong>HC be liable for any loss<br />

or damage due to delay in delivery.<br />

5.4 The Buyer shall notify <strong>GE</strong>HC in writing within five (5) working days<br />

of delivery of any short delivery or defects reasonably discoverable on<br />

careful examination. <strong>GE</strong>HC’s sole obligation shall be, at its option, to<br />

replace or repair any defective <strong>Product</strong>s or refund the purchase price of<br />

any undelivered <strong>Product</strong>s.<br />

5.5 Where delivery of any <strong>Product</strong> requires an export license or other<br />

authorization before shipment, <strong>GE</strong>HC shall not be responsible for<br />

any delay in delivery due to delay in, or refusal of, such license or<br />

authorization.<br />

5.6 Where the Equipment requires installation, the Buyer shall be<br />

responsible at its own cost for making the place where the Equipment will<br />

be located ready for installation in accordance with <strong>GE</strong>HC’s instructions.<br />

Installation will not begin unless such responsibilities are completed.<br />

5.7 Following installation, and where applicable, <strong>GE</strong>HC will proceed with<br />

final testing using <strong>GE</strong>HC’s published performance specifications and<br />

using its standard instruments and procedures. Upon the satisfactory<br />

completion of such final testing demonstrating compliance with the above<br />

specifications (with any permitted variations/tolerances) <strong>GE</strong>HC may issue<br />

a Test Certificate which shall be conclusive evidence of such compliance<br />

and thereupon installation of the Equipment shall be deemed to be<br />

complete and in compliance with <strong>GE</strong>HC’s obligations under the Contract.<br />

In any event Buyer agrees that the Equipment is accepted (i) seven (7)<br />

days after the date on which <strong>GE</strong>HC notifies Buyer that final testing was<br />

successfully completed, or issues the Test Certificate or (ii) on the date<br />

Buyer first uses the Equipment for operational use, whichever is earlier.<br />

5.8 Buyer, at its reasonable request, shall be entitled to be present at and<br />

to witness the testing and shall not be entitled to raise any objection to<br />

testing carried out, or to the results thereof, if Buyer failed to attend when<br />

advised that testing was to take place.<br />

5.9 Where <strong>Product</strong>s are supplied by <strong>GE</strong>HC in returnable containers,<br />

these must be returned at the Buyer’s expense and in good condition, if<br />

requested by <strong>GE</strong>HC. Title to these containers shall remain with <strong>GE</strong>HC at<br />

all times, but they shall be held at the risk of the Buyer until returned to<br />

<strong>GE</strong>HC. Failure by the Buyer to comply with the above provision shall entitle<br />

<strong>GE</strong>HC to invoice the Buyer for the full replacement value of the containers.<br />

6. Risk and Title<br />

6.1 The risks of loss of and damage to the <strong>Product</strong>s shall transfer to<br />

Buyer in accordance with agreed delivery term. Full title to the Goods and<br />

Equipment shall pass to the Buyer on full payment.<br />

6.2 In relation to any Equipment used for clinical or diagnostic purposes,<br />

the Buyer shall keep adequate written records of the identity of any person<br />

or entity to whom the Equipment is transferred and of the location of such<br />

Equipment and shall procure that any purchaser of such Equipment is<br />

subject to the same requirement in respect of any onward sales.<br />

7. Services<br />

7.1 Where <strong>GE</strong>HC is to provide Services, the Buyer shall ensure that<br />

adequate and safe facilities exist at its premises and that <strong>GE</strong>HC is properly<br />

notified of any relevant regulations.<br />

7.2 If the Buyer has purchased a <strong>Product</strong> or Service including remote<br />

access support, the Buyer shall permit <strong>GE</strong>HC to connect to the<br />

<strong>Product</strong>s by remote access as may be beneficial to the performance of<br />

maintenance or repair activities as part of <strong>GE</strong>HC’s warranty obligations or<br />

otherwise. This may include automatic software downloads and proactive<br />

monitoring and access to performance data related to the products, to<br />

gather and use products- and resource usage data in various ways such<br />

as product development, quality initiatives, benchmarking and reporting<br />

services. The data collected by <strong>GE</strong>HC will be used, during and after the<br />

term of this agreement, in accordance with all applicable laws and<br />

regulations and in a manner that will maintain confidentiality.<br />

8. Restricted Use<br />

8.1 With respect to certain <strong>Product</strong>s, use restrictions are a condition<br />

of the purchase which Buyer must satisfy by strictly abiding by the<br />

restriction as set forth in <strong>GE</strong>HC’s catalogue and/or on the <strong>Product</strong> and/or<br />

accompanying documentation. Buyer is solely liable to ensure compliance<br />

with any regulatory requirements related to the Buyer’s use of the<br />

<strong>Product</strong>s. Any warranty granted by <strong>GE</strong>HC to the Buyer shall be deemed<br />

void if any <strong>Product</strong>s covered by such warranty are used for any purpose<br />

not permitted hereunder. In addition, the Buyer shall indemnify <strong>GE</strong>HC<br />

and hold <strong>GE</strong>HC harmless from and against any and all claims, damages,<br />

losses, costs, expenses and other liability of whatever nature that <strong>GE</strong>HC<br />

suffers or incurs by reason of any such unintended use.<br />

8.2 With respect to <strong>Product</strong>s regulatory approved for clinical and medical<br />

treatment and diagnostic use, any decisions relating to such treatment and<br />

use shall be at the risk of the Buyer and the respective healthcare providers.<br />

9. General Warranty<br />

9.1 Section 9.2-9.5 shall apply in the event no other specific warranty<br />

has been agreed in the Contract. As regards any <strong>Product</strong>s covered by a<br />

warranty issued by a third party manufacturer, such warranty terms shall<br />

apply to the exclusion of Section 9.2-9.5.<br />

9.2. Goods - <strong>GE</strong>HC warrants that its Goods meet <strong>GE</strong>HC’s specifications at<br />

the time of delivery. All warranty claims on Goods must be made in writing<br />

within ninety (90) days of receipt of the Goods. <strong>GE</strong>HC’s sole liability and<br />

Buyer’s exclusive remedy for a breach of this warranty is limited to repair,<br />

replacement or refund at the sole option of <strong>GE</strong>HC.<br />

9.3 Equipment - <strong>GE</strong>HC’s Equipment of its own manufacture is warranted<br />

from date of delivery or <strong>GE</strong>HC completing any agreed installation works,<br />

if later, to be free of defects in workmanship or materials under normal<br />

usage for a period of one (1) year and any claim shall be submitted in<br />

writing within such period. <strong>GE</strong>HC’s sole liability and Buyer’s exclusive<br />

remedy for a breach of this warranty is limited to repair, replacement or<br />

refund at the sole option of <strong>GE</strong>HC. Such repairs or replacement will not<br />

extend the warranty period.<br />

9.4 Software – <strong>GE</strong>HC warrants, for a period which is the longer of:<br />

(i) three (3) months from the date of delivery or;<br />

(ii) in the event the Software is intended to be installed and run on <strong>GE</strong>HC’s<br />

Equipment of its own manufacture, twelve (12) months from the date<br />

of delivery,<br />

that the Software substantially conforms to its published specifications<br />

and that the media on which the Software resides will be free from defects<br />

in materials and workmanship under normal use and any claim shall be<br />

submitted in writing within such period. <strong>GE</strong>HC does not warrant that the<br />

Software is error free or that Buyer will be able to operate the Software<br />

without problems or interruptions. <strong>GE</strong>HC´s sole liability and Buyer’s<br />

exclusive remedy in the event of breach of this warranty is limited to<br />

repair, replacement or refund, at the sole option of <strong>GE</strong>HC.<br />

9.5 Services - <strong>GE</strong>HC warrants that all Services will be carried out with<br />

reasonable care and skill. <strong>GE</strong>HC’s sole liability for breach of this warranty<br />

shall be at its option to give credit for or re-perform the Services in<br />

question. This warranty shall only extend for a period of ninety (90) days<br />

after the completion of the Services and any claim shall be submitted in<br />

writing within such period.<br />

9.6 To the maximum extent permitted by applicable law <strong>GE</strong>HC hereby<br />

expressly disclaims, and Buyer hereby expressly waives, any warranty<br />

regarding results obtained through the use of the <strong>Product</strong>s, including<br />

without limitation any claim of inaccurate, invalid, or incomplete results.<br />

All other warranties, representations, terms and conditions (statutory,<br />

express, implied or otherwise) as to quality, condition, description,<br />

merchantability, fitness for purpose or non-infringement (except for the<br />

implied warranty of title) are hereby expressly excluded.<br />

9.7 Unless expressly agreed, <strong>GE</strong>HC is not obliged to carry out dismantling<br />

or re-installation of any <strong>Product</strong> in connection with any warranty claims.<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 269

---

Index and legal<br />

12<br />

10. Limitation of Liability<br />

10.1 <strong>GE</strong>HC shall have no liability under the warranties contained in Section<br />

9 in respect of any defect in the <strong>Product</strong>s arising from: specifications or<br />

materials supplied by the Buyer; fair wear and tear; wilful damage or<br />

negligence of the Buyer or its employees or agents; abnormal working<br />

conditions at the Buyer’s premises; failure to follow <strong>GE</strong>HC’s use restrictions<br />

or instructions (whether oral or in writing); misuse or alteration or repair<br />

of the <strong>Product</strong>s without <strong>GE</strong>HC’s approval; or if the Buyer is in breach of its<br />

payment obligations under this Contract.<br />

10.2 Subject to any express obligation to indemnify, neither party shall be<br />

liable for any indirect or consequential, or punitive damages of any kind<br />

from any cause arising out of the sale, installation, use or inability to use<br />

any <strong>Product</strong> or Service, nor for, without limitation, loss of profits, goodwill<br />

or business interruption.<br />

10.3 The total liability of <strong>GE</strong>HC arising under or in connection with the<br />

Contract, including for any breach of contractual obligations and/or any<br />

misrepresentation, misstatement or tortious act or omission (including<br />

without limitation, negligence and liability for infringement of any third<br />

party intellectual property rights) shall be limited to damages in an<br />

amount equal to the amount paid to <strong>GE</strong>HC under the Contract.<br />

10.4 The exclusion of liability in these Terms and Conditions shall only<br />

apply to the extent allowed according to applicable law.<br />

11. Intellectual Property Rights<br />

11.1 Where the Buyer supplies designs, drawings, and specifications<br />

to <strong>GE</strong>HC to enable it to manufacture non-standard or custom made<br />

<strong>Product</strong>s, the Buyer warrants that such manufacture will not infringe the<br />

intellectual property rights of any third party.<br />

11.2 All intellectual property rights in the <strong>Product</strong>s and/or Services shall at<br />

all times remain vested in <strong>GE</strong>HC or its licensors.<br />

12. Health and Safety<br />

The Buyer shall ensure that:<br />

(i) the <strong>Product</strong>s (provided such <strong>Product</strong>s comply with its specifications)<br />

are suitable and safe for the Buyer’s intended use;<br />

(ii) the <strong>Product</strong>s are handled in a safe manner.<br />

(iii) containers, packaging, labelling, equipment and vehicles, where<br />

provided by the Buyer, comply with all relevant national and<br />

international safety regulations.<br />

13. Indemnities<br />

Except where a claim arises as a direct result of the negligence or breach<br />

of contract of <strong>GE</strong>HC, the Buyer shall indemnify <strong>GE</strong>HC in respect of any<br />

claim which may be made against <strong>GE</strong>HC:<br />

(i) arising in connection with the Buyer’s unintended use of the <strong>Product</strong>s;<br />

(ii) alleging that the Buyer´s use of the <strong>Product</strong>s infringes the intellectual<br />

property rights of any third party.<br />

14. Insolvency<br />

In the event that the Buyer becomes insolvent or applies for bankruptcy<br />

or, being a company, goes into liquidation (other than for the purposes of<br />

reconstruction or amalgamation), <strong>GE</strong>HC shall be entitled immediately to<br />

terminate the Contract without notice and without prejudice to any other<br />

rights of <strong>GE</strong>HC hereunder.<br />

15. Force Majeure<br />

15.1 A party shall not be liable in respect of the non-performance of any<br />

of its obligations to the extent such performance is prevented by any<br />

circumstances beyond its reasonable control including but not limited to,<br />

strikes, lock outs or labour disputes of any kind (whether relating to its own<br />

employees or others), fire, flood, explosion, natural catastrophe, military<br />

operations, blockade, sabotage, revolution, riot, civil commotion, war or<br />

civil war, acts or threats of terrorism, plant breakdown, computer or other<br />

equipment failure and inability to obtain equipment.<br />

15.2 If an event of force majeure exceeds one (1) month a Party may<br />

cancel the Contract without liability.<br />

16. Software License<br />

Unless a separate software license agreement has been concluded<br />

concerning the Software, the Buyer is hereby granted a non‐exclusive<br />

license to use the Software solely in object code format and solely for its<br />

own internal business purposes subject to the terms contained herein.<br />

The Buyer shall not (i) use the Software for purposes other than those<br />

for which it was designed; (ii) use the Software in connection with other<br />

manufacturers‘ products unless such connectivity is authorized in the<br />

<strong>Product</strong> documentation; (iii) grant, assign, transfer, or otherwise make<br />

available to third parties any right whatsoever in the Software; (iv) disclose<br />

to third parties any information contained in the Software; (v) copy or<br />

reproduce the Software (except for one copy for back-up purposes or as<br />

may otherwise be permitted by applicable law); (vi) alter or modify the<br />

Software; or (vii) reverse engineer, decompile, disassemble or create any<br />

derivative works based upon the Software except as expressly permitted<br />

by mandatory law.<br />

17. Export control<br />

The Buyer undertakes not to re-export the <strong>Product</strong>s without the requisite<br />

export license from the relevant body of the United Nations or other similar<br />

international organization, the United States Government, the country of<br />

origin or the original country of export. The requirement to obtain a license<br />

may vary depending on the country of destination, the end user, the end<br />

use and other factors. Upon request from <strong>GE</strong>HC the Buyer shall furnish<br />

<strong>GE</strong>HC with copies of all documents relating to such re-export.<br />

18. Waste Electrical and Electronic Equipment (WEEE)<br />

18. 1 Where the Buyer sells, disposes of or otherwise transfers the<br />

Equipment to any third party and where this would unreasonably increase<br />

the cost of the collection, treatment or recycling of the Equipment for<br />

<strong>GE</strong>HC under applicable WEEE legislation, Buyer shall be liable to <strong>GE</strong>HC and<br />

indemnify <strong>GE</strong>HC for such increased costs.<br />

18.2 Should the Equipment that Buyer acquires from <strong>GE</strong>HC be Equipment,<br />

which is intended to replace on a ‘like for like’-basis, any item of Buyer’s<br />

existing equipment (e.g. the new Equipment is of an equivalent type or<br />

is fulfilling the same function as Buyer’s existing equipment) Buyer must<br />

in respect of such existing equipment have clearly indicated to <strong>GE</strong>HC<br />

the following: the brand, type, age, condition, current use and the exact<br />

location and all other relevant information. In the event Buyer has not<br />

complied with such obligations, <strong>GE</strong>HC may charge Buyer such reasonable<br />

additional fees to reflect any related obligations it may have under<br />

national legislation regarding the recycling, reuse and/or disposal of such<br />

existing equipment and related costs it may incur.<br />

18.3 Unless the relevant mandatory national legislation provides<br />

otherwise, or unless otherwise agreed in writing, <strong>GE</strong>HC´s obligation<br />

does not include without limitation, creation of physical access to the<br />

equipment; de-installation; decoupling; disinfecting; craning/lifting;<br />

transportation to a ground level loading area or -ramp; packing; or any<br />

related similar activities; and Buyer agrees to perform such activities at its<br />

own cost as and when required.<br />

19. Governing Law<br />

This Contract shall be governed by and construed in accordance with the<br />

substantive laws of the country or state where the <strong>GE</strong> <strong>Healthcare</strong> group<br />

company (or relevant branch) office referred to in the Contract is situated<br />

and the parties hereby submit to the non-exclusive jurisdiction of the<br />

courts of that country or state.<br />

20. <strong>Product</strong>-Specific Terms and Conditions<br />

Additional terms and conditions govern the sale of certain <strong>Product</strong>s<br />

and Services. These additional terms and conditions are available from<br />

the sales offices of <strong>GE</strong>HC and shall take precedence in the event of any<br />

inconsistency with these Terms and Conditions.<br />

21. Translations and Local Variations<br />

Translations of these terms and conditions are available from the sales<br />

offices of <strong>GE</strong>HC. In some territories, local variations to these Terms and<br />

Conditions may apply. If so, such variations shall take precedence in the<br />

event of any inconsistency with these Terms and Conditions.<br />

270 www.gelifesciences.com/bioprocess

---

Trademarks<br />

<strong>GE</strong> <strong>Healthcare</strong> trademarks<br />

ÄKTA, ÄKTAcrossflow, ÄKTAexplorer, ÄKTApilot, ÄKTAprime, ÄKTAprocess,<br />

ÄKTApurifier, AxiChrom, Biacore, BioPilot, <strong>BioProcess</strong>, BPG, Capto, Cellbag,<br />

Chromaflow, Cytodex, Cytoline, Cytopore, Downstream, Drop Design,<br />

FineLINE, GammaBind, Grandstand, GSTrap, GSTPrep, GraviTrap, HiLoad,<br />

HiPrep, HiScale, HiScreen, HisPrep, HisTrap, HiTrap, Kvick, Kvick Flow,<br />

Kvick Lab, Kvick Start, MabSelect, MabSelect Xtra, MabSelect SuRe,<br />

MacroCap, Media Wand, MidGee, MultiTrap, OligoProcess, Oligosynt,<br />

Primer Support, ReadyCircuit, ReadyMate, ReadyToProcess, RESOURCE,<br />

Sephacryl, Sephadex, Sepharose, SOURCE, Superdex, Superose, Tricorn,<br />

ULTA, UNICORN, UniFlux, WAVE Bioreactor, WAVE Mixer, WAVEPOD, and<br />

Xampler are trademarks of <strong>GE</strong> <strong>Healthcare</strong> companies.<br />

<strong>GE</strong>, imagination at work, and the <strong>GE</strong> monogram are trademarks of General<br />

Electric Company.<br />

Trademarks owned by other companies<br />

Other trademarks, registered trademarks, product names, and company<br />

names or logos displayed in the catalogue are the property of their<br />

respective owners.<br />

Licensing information<br />

ÄKTA oligopilot and OligoPilot 400<br />

ÄKTA oligopilot and OligoPilot 400 are covered by US patent number<br />

5,807,525 and equivalent patents and patent applications in other<br />

countries. Post-synthesis procedures for selective deprotection of<br />

oligonucleotides on solid supports is covered by US patent number<br />

6,887,990 and equivalent patents and patent applications in other<br />

countries, and a license thereto is only given when synthesis of<br />

oligonucleotides is performed on <strong>GE</strong> <strong>Healthcare</strong> instruments. No other<br />

license is granted to the purchaser either directly or by implication,<br />

estoppel or otherwise.<br />

ÄKTA ready High Flow Kit and ÄKTA ready Low Flow Kit<br />

The use of ÄKTA ready High Flow Kit and Low Flow Kit may require a<br />

license under the following US patents and their equivalents in other<br />

countries: US patent numbers 6,712,963 and 7,052,603 (assignee: SciLog,<br />

Inc.). A free, non-transferable license limited to using these products under<br />

above mentioned patents accompanies the purchase of the product from<br />

any <strong>GE</strong> <strong>Healthcare</strong> company and its licensed distributors.<br />

Disposable Aseptic Connector<br />

This product is sold under licence from Johnson & Boley Holdings, LLC.<br />

under US patent number 6,679,529.<br />

GST Gene Fusion Vectors<br />

A license for commercial use of GST Gene Fusion Vectors under US<br />

patent 5,654,176 and equivalent patents and patent applications in other<br />

countries must be obtained from Millipore Corp (formerly Chemicon<br />

International Inc.).<br />

IMAC Sepharose products, Ni Sepharose products and Fe Sepharose<br />

products<br />

These products are sold under license from Sigma-Aldrich under patent<br />

number EP 1277616 (Metal chelating compositions) and equivalent<br />

patents and patent applications in other countries.<br />

KappaSelect<br />

KappaSelect incorporates BAC BV's proprietary ligand technology, which<br />

has been exclusively licensed to <strong>GE</strong> <strong>Healthcare</strong> for affinity separation.<br />

Other uses of this product may require a separate license from BAC BV,<br />

Huizerstraatweg 28, 1411 GP Naarden, The Netherlands.<br />

OligoProcess<br />

OligoProcess is covered by US patent numbers 5,807,525 and 5,641,459,<br />

and equivalent patents and patent applications in other countries. Postsynthesis<br />

procedures for selective deprotection of oligonucleotides on<br />

solid supports is covered by US patent number 6,887,990 and equivalent<br />

patents and patent applications in other countries, and a license thereto<br />

is only given when synthesis of oligonucleotides is performed on <strong>GE</strong><br />

<strong>Healthcare</strong> instruments. No other license is granted to the purchaser<br />

either directly or by implication, estoppel or otherwise.<br />

Plasminogen Removal Gel<br />

The Plasminogen Removal Gel is subject to EP 1390485 and its foreign<br />

equivalents, and other intellectual property rights owned by OMRIX<br />

Biopharmaceuticals S.A, Belgium (“OMRIX”). Any customer wishing to<br />

use Plasminogen Removal Gel for any purpose falling under any valid<br />

claims of the said patent rights other than for research purposes needs<br />

prior to such use to (a) contact OMRIX directly and (b) sign a license<br />

agreement with OMRIX.<br />

Primer Support 200<br />

Primer Support 200 is covered by US patent number 6,335,438 and<br />

equivalent patents and patent applications in other countries.<br />

Butyl-S Sepharose 6 Fast Flow<br />

Separating Miraculin with this product is subject to US patent number<br />

5,886,155. Licenses are available from BioResources International, Inc., of<br />

Somerset, N.J., U.S.A.<br />

IMAC Sepharose 6 Fast Flow, Chelating Sepharose Fast Flow and<br />

Ni Sepharose 6 Fast Flow (Histidine-tagged protein purification,<br />

Bioprocess products)<br />

US patent numbers 5,284,933 and 5,310,663, and equivalent patents and<br />

patent applications in other countries (assignee: Hoffman La Roche, Inc)<br />

relate to the purification and preparation of fusion proteins and affinity<br />

peptides comprising at least two adjacent histidine residues (commonly<br />

known as the histidine-tag technology).<br />

Any customer that wishes to use Chelating Sepharose Fast Flow, Ni<br />

Sepharose 6 Fast Flow or IMAC Sepharose 6 Fast Flow for non-research/<br />

commercial applications under these patents is requested to contact<br />

Hoffman-La Roche AG, Corporate licensing, attention Dr Andreas Maurer,<br />

CH-4070 Basel, Switzerland, telephone +41 61 687 2548, fax +41 61 687<br />

2113, for the purpose of obtaining a license.<br />

ReadyMate<br />

ReadyMate is covered by US patent No 6,679,529 B2 owned by Johnson &<br />

Boley Holdings, LLC and licensed to <strong>GE</strong> <strong>Healthcare</strong> companies.<br />

VIIISelect<br />

VIIISelect incorporates BAC BV´s proprietary ligand technology, which has<br />

been exclusively licensed to <strong>GE</strong> <strong>Healthcare</strong> in the field of purification of<br />

beta domain depleted recombinant factor VIII. Other use of this product<br />

may require a separate license from BAC BV, Huizerstraatweg 28, 1411 GP<br />

Naarden, The Netherlands.<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 271

---

Alphabetical index<br />

Index and legal<br />

A<br />

A–Z of media and chemicals 234<br />

ActiCHO Media System 30<br />

Affinity chromatography 82<br />

Affinity media – <strong>Product</strong> application guide 86<br />

6-AKS Sepharose 4 Fast Flow 86, 101, 234<br />

ÄKTA avant system 140<br />

ÄKTAcrossflow system 194<br />

ÄKTA oligopilot plus 211<br />

ÄKTApilot system 141<br />

ÄKTAprocess system 142<br />

ÄKTA ready system 71<br />

Alpha-1 Antitrypsin Select 101, 234<br />

Amino Sepharose 6 Fast Flow 86, 101, 234<br />

Anion exchanger groups 77<br />

Antibody fragments 85<br />

ANX Sepharose 4 Fast Flow (high sub) 81, 160, 234<br />

ANX Sepharose 4 Fast Flow (low sub) 235<br />

Application notes 231<br />

Application services - Fast Trak 220<br />

AVB Sepharose High Performance 86, 235<br />

AxiChrom columns 106<br />

B<br />

Benzamidine Sepharose 4 Fast Flow (high sub) 86, 235<br />

Benzamidine Sepharose 4 Fast Flow (low sub) 235<br />

Biacore systems 202<br />

Biacore C 204<br />

Biacore system validation support 205<br />

Biacore T200 203<br />

<strong>BioProcess</strong> Media 76<br />

Blue Sepharose 6 Fast Flow 82, 86, 235<br />

Books<br />

Handbook of Process Chromatography 231<br />

Protein Purification Principles 231<br />

BPG columns 114<br />

Butyl Sepharose 4 Fast Flow 88–89, 160, 236<br />

Butyl Sepharose High Performance 88–89, 160, 236<br />

Butyl-S Sepharose 6 Fast Flow 88–89, 160, 237<br />

C<br />

Capto media 78, 91<br />

Capto adhere 81, 92, 160, 237<br />

Capto Blue 82, 86, 238<br />

Capto Blue (hs) 101, 238<br />

Capto Butyl 89, 238<br />

Capto Core 700 91, 238<br />

Capto DEAE 78–81, 160, 239<br />

Capto L 82, 84–86, 239<br />

Capto MMC 81, 91, 160, 240<br />

Capto Octyl 89, 101, 240<br />

Capto Phenyl (high sub) 89, 240<br />

Capto, PreDictor 96-well filter plates 155<br />

Capto, Prepacked columns 157<br />

Capto Q 78–81, 160, 241<br />

Capto Q ImpRes 78–80, 241<br />

Capto S 78–81, 160, 242<br />

Capto, Selection kits 160<br />

Capto SP ImpRes 78–80, 242<br />

Cassettes and holders<br />

See Cross flow filtration<br />

Cation exchanger groups 77<br />

CBS<br />

See Customized <strong>BioProcess</strong> Solutions<br />

CDM<br />

See Custom Designed Media<br />

CELL1 - Fast Trak course 222<br />

Cellbag bioreactors 45<br />

Cell culture 26<br />

Media, sera and reagents 28<br />

ActiCHO Media System 30<br />

Microcarrier 31<br />

Cytodex 31<br />

Cytoline 31<br />

Cytopore 31<br />

Change Control Notifications 205, 226<br />

Chelating Sepharose Big Beads 101, 242<br />

Chelating Sepharose Fast Flow 82, 86, 243<br />

Chromaflow columns 110<br />

Chromatography columns 102<br />

Chromatography media 74, 229, 234<br />

Chromatography media toolbox 92<br />

Chromatography systems 138<br />

12<br />

272 www.gelifesciences.com/bioprocess

---

CM Sephadex C-25 80, 243<br />

CM Sephadex C-50 80, 243<br />

CM Sepharose Fast Flow 81, 160, 243<br />

CM Sepharose High Performance 81, 243<br />

CNBr-activated Sepharose 4B 244<br />

CNBr-activated Sepharose 4 Fast Flow 82, 86, 244<br />

COL1 - Fast Trak course 222<br />

Columns for oligonucleotide synthesis 213<br />

Columns for process chromatography 104<br />

AxiChrom 106<br />

BPG 114<br />

Chromaflow 110<br />

Custom products 134<br />

FineLINE 126<br />

HiScale 132<br />

INdEX 122<br />

Columns, prepacked<br />

HiLoad 97–99, 158–159<br />

HiPrep 97–99<br />

HiScreen 79, 157–159<br />

HiTrap 79, 81, 88, 158–160<br />

Columns, ReadyToProcess<br />

See ReadyToProcess<br />

Column support 228<br />

Con A Sepharose 4B 86, 244<br />

Connectors for process-scale columns 130–131<br />

Courses - Fast Trak 222<br />

Cross flow filtration 170<br />

Kvick Flow cassette holder 176<br />

Kvick Flow cassettes 173<br />

Kvick Lab cassette holder 175<br />

Kvick Lab cassettes 172<br />

Kvick Lab packet holder 174<br />

Kvick Lab packets 172<br />

Kvick Lab SCU cassettes 171<br />

Kvick Start cassettes 170<br />

MaxCell process scale hollow fiber cartridges 185<br />

MidGee cross flow cartridges 178<br />

MidGee Hoop cross flow cartridges 179<br />

Pilot scale hollow fiber cartridges 181<br />

ProCell hollow fiber cartridges 187<br />

Process scale hollow fiber cartridges 183<br />

Start AXM and AXH cartridges 177<br />

Steam-in-place hollow fiber cartridges 188<br />

Xampler laboratory cartridges 180<br />

Cross flow filtration vs. normal flow filtration 167<br />

Custom Designed Media (CDM) 81, 100<br />

Customized <strong>BioProcess</strong> Solutions (CBS) 145<br />

Customized filtration hardware 199<br />

Custom-packed columns 161<br />

Custom-packed laboratory columns 134<br />

Custom Primer Support 215<br />

Custom ReadyCircuit assemblies 56<br />

Cytodex 1 31–32, 244<br />

Cytodex 3 31–32, 245<br />

Cytoline 1 31, 33, 245<br />

Cytopore 1 31–32, 245<br />

Cytopore 2 31–32, 245<br />

D<br />

DAC, ReadyMate<br />

See ReadyMate Connectors<br />

Data files 231<br />

DEAE Sephadex A-25 80, 245<br />

DEAE Sephadex A-50 80, 245<br />

DEAE Sepharose Fast Flow 81, 160, 246<br />

DeltaV software 145<br />

DEV1 - Fast Trak course 222<br />

DEV2 - Fast Trak course 222<br />

DEV4 - Fast Trak course 222<br />

Differential scanning calorimetry (DSC) 207<br />

Disposable Aseptic Connectors, ReadyMate 67<br />

Downstream magazine See Upstream and Downstream<br />

DSC<br />

See Differential scanning calorimetry<br />

E<br />

ECH-Lysine Sepharose 4 Fast Flow 86, 246<br />

Epoxy-activated Sepharose 6B 86, 246<br />

eSYS1 - Fast Trak course 221<br />

eSYS6 - Fast Trak course 221<br />

F<br />

Fast Trak 220<br />

Filtration hardware 194<br />

ÄKTAcrossflow system 194<br />

Customized filtration hardware 199<br />

Grandstand pilot/process systems 197<br />

UniFlux systems 195<br />

Filtration products 164<br />

FineLINE columns 126<br />

Flow-through technology, oligosynthesis 212<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 273

---

G<br />

GammaBind G Type 2 246<br />

Gelatin Sepharose 4 Fast Flow 86, 246<br />

Gel Filtration 96<br />

Application guide 99<br />

Selection guide 97<br />

Glutathione Sepharose 4 Fast Flow 86, 247<br />

GrandStand pilot/process systems 197<br />

GxP services 205<br />

K<br />

KappaSelect 85, 248<br />

Kvick Flow cassette holder 176<br />

Kvick Flow cassettes 173<br />

Kvick Lab cassette holder 175<br />

Kvick Lab cassettes 172<br />

Kvick Lab packet holder 174<br />

Kvick Lab packets 172<br />

Kvick Lab SCU cassettes 171<br />

Kvick Start cassettes 170<br />

Index and legal<br />

H<br />

Handbooks 230<br />

Heparin Sepharose 6 Fast Flow 82, 86, 247<br />

HIC See Hydrophobic interaction chromatography<br />

High-throughput process development 153<br />

HiLoad columns 97–99, 158–159<br />

HiPrep columns 97–99<br />

HiScale columns 132<br />

HiScreen columns 79, 157–159<br />

HiTrap Capto IEX Selection Kit 79, 81, 159–160<br />

HiTrap columns 79, 81, 88, 158–160<br />

HiTrap HIC Selection Kit 88, 158, 160<br />

HiTrap IEX Selection Kit 79, 81, 159–160<br />

Hollow fiber cartridges<br />

See ReadyToProcess<br />

Hollow fiber cartridges<br />

See Cross flow filtration<br />

HTPD<br />

See High-throughput process development<br />

HTPD1 - Fast Trak course 222<br />

Hydrophobic interaction chromatography (HIC) 87<br />

Map of HIC media 89<br />

Selection guide 88<br />

I<br />

IC<br />

See Inline conditioning<br />

IEX<br />

See Ion exchange chromatography<br />

IEX Selection Kit 160<br />

IgG Sepharose 6 Fast Flow 247<br />

IgSelect 86, 101, 247<br />

IMAC media 82<br />

Chelating Sepharose Fast Flow 82, 86, 243<br />

IMAC Sepharose 6 Fast Flow 82, 86, 248<br />

Ni Sepharose 6 Fast Flow 82, 86, 252<br />

INdEX columns 122<br />

Inline conditioning (IC) 144<br />

Ion exchange chromatography (IEX) 77<br />

Selection guide 79<br />

L<br />

Label-free interaction analyses 202<br />

LambdaFabSelect 85, 101, 248<br />

Lentil Lectin Sepharose 4B 86, 248<br />

Licensing information 271<br />

Literature 230<br />

Application notes 231<br />

Books 231<br />

Data files 231<br />

Posters 231<br />

Technique handbooks 230<br />

Upstream and Downstream magazine 230<br />

M<br />

MAB1 - Fast Trak course 222<br />

MAbs<br />

See Monoclonal antibodies<br />

MabSelect media 83<br />

MabSelect 83, 85–86, 249<br />

MabSelect, PreDictor 96-well filter plates 155<br />

MabSelect, Prepacked columns 157–158<br />

MabSelect SuRe 83, 86, 92, 249<br />

MabSelect SuRe LX 83, 86, 92, 250<br />

MabSelect Xtra 83, 86, 250<br />

MacroCap Q 78, 80, 101, 251<br />

MacroCap SP 78, 80, 251<br />

Manufacturing Solutions<br />

Column packing 136<br />

Inline conditioning (IC) 144<br />

Media Wand 136<br />

Slurry tanks 137<br />

MaxCell process scale hollow fiber cartridges 185<br />

Media, chromatography 74, 229, 234<br />

Media safety stock 76, 229<br />

Media, Selection kits<br />

See Selection kits<br />

12<br />

274 www.gelifesciences.com/bioprocess

---

Media selection strategy 76<br />

Media toolbox 92<br />

Media Wand 136<br />

MEM1 - Fast Trak course 222<br />

MicroCal systems 206<br />

MicroCal VP-Capillary DSC system 207<br />

Microcarrier cell culture 31<br />

Selection guide 31<br />

Microfiltration 166<br />

MidGee cross flow cartridges 178<br />

MidGee Hoop cross flow cartridges 179<br />

Monoclonal antibodies (MAbs) 82, 92<br />

MAbs purification toolbox 92<br />

Multimodal Chromatography 90<br />

N<br />

NHS-activated Sepharose 4 Fast Flow 82, 86, 251<br />

Ni Sepharose 6 Fast Flow 82, 86, 252<br />

Normal flow capsule filters<br />

See ReadyToProcess<br />

Normal flow filtration 189<br />

ULTA Prime CG 191<br />

ULTA Prime GF 192<br />

ULTA Prime PP 193<br />

ULTA Pure HC 190<br />

ULTA Pure SG 189<br />

Normal flow filtration vs. cross flow filtration 167<br />

nProtein A Sepharose 4 Fast Flow 86, 252<br />

O<br />

Octyl Sepharose 4 Fast Flow 88–89, 160, 252<br />

Oligonucleotide synthesis 210<br />

ÄKTA oligopilot plus 211<br />

Custom Primer Support 215<br />

Flow-through technology 212<br />

Oligonucleotide synthesis columns 213<br />

Oligonucleotide synthesizers 211<br />

OligoPilot 400 211<br />

OligoProcess 212<br />

Oligosynt prepacked disposable columns 215, 266<br />

Primer Support 5G 214, 266<br />

Solid supports 214<br />

Online regulatory and technical support 226<br />

Online technical support 227<br />

Online training 221<br />

OPC Connectivity 148<br />

P<br />

PAA products 28–30<br />

Packing stations, Chromaflow columns 113<br />

Phenyl Sepharose 6 Fast Flow (high sub) 88–89, 160, 253<br />

Phenyl Sepharose 6 Fast Flow (low sub) 88–89, 160, 253<br />

Phenyl Sepharose High Performance 88–89, 160, 254<br />

Pilot scale hollow fiber cartridges 181<br />

PlasmidSelect Xtra 93, 160, 254<br />

PlasmidSelect Xtra Screening Kit 159–160<br />

PlasmidSelect Xtra Starter Kit 159–160<br />

Plasminogen Removal Gel 86, 101, 254<br />

Posters 231<br />

Powder media 29<br />

Pre-activated media 82<br />

PreDictor 96-well filter plates 154<br />

PreDictor RoboColumn 156<br />

Prepacked columns, examples 158<br />

Primer Support 5G 214, 266<br />

Procainamide Sepharose 4 Fast Flow 86, 101, 254<br />

ProCell hollow fiber cartridges 187<br />

Process scale hollow fiber cartridges 183<br />

<strong>Product</strong> highlights 16<br />

<strong>Product</strong>s for process development 150<br />

Protein A 82–83, 92, 254<br />

Protein G 255<br />

Protein G Sepharose 4 Fast Flow 86, 255<br />

Protein interaction and stability analysis 200<br />

Biacore C 204<br />

Biacore system validation support 205<br />

Biacore T200 203<br />

MicroCal VP-Capillary DSC system 207<br />

Q<br />

QAE Sephadex A-25 80, 257<br />

QAE Sephadex A-50 80, 257<br />

Q Sepharose Big Beads 80, 160, 256<br />

Q Sepharose Fast Flow 81, 160, 256<br />

Q Sepharose High Performance 81, 160, 257<br />

Q Sepharose XL 81, 160, 257<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 275

---

Index and legal<br />

R<br />

ReadyCircuit bags 54<br />

ReadyKart mobile processing station 63<br />

ReadyMate Connectors 67<br />

ReadyToProcess 34<br />

Cellbag bioreactors 45<br />

Chromatography 70<br />

ÄKTA ready system 71<br />

Columns 72<br />

Connectivity 66<br />

ReadyMate Connectors 67<br />

Sterile Tube Fuser 68<br />

Tube Sealer 69<br />

ReadyToProcess platform 36<br />

Single-use fluid management and filtration 52<br />

Custom ReadyCircuit assemblies 56<br />

Hollow fiber cartridges 57<br />

ReadyCircuit bags 54<br />

ReadyKart mobile processing station 63<br />

Sensor assemblies 55<br />

Tube assemblies 54<br />

ULTA normal flow filter capsules 60<br />

UNICORN DAQ software 47<br />

WAVE Bioreactor systems 38<br />

WAVE Bioreactor 2/10 system 44<br />

WAVE Bioreactor 20/50 system 43<br />

WAVE Bioreactor 200 system 42<br />

WAVE Bioreactor 500/1000 system 41<br />

WAVE Mixer 50<br />

WAVEPOD II Integrated Controller 48<br />

Regulatory support files 226<br />

Reversed phase chromatography (RPC) 94<br />

rmp Protein A Sepharose Fast Flow 86, 255<br />

RPC<br />

See Reversed phase chromatography<br />

rProtein A Sepharose 4 Fast Flow 86, 255<br />

S<br />

SAMS<br />

See Smart Asset Management Services<br />

Security of supply 76, 229<br />

Selection kits<br />

HiTrap Capto IEX Selection Kit 160<br />

HiTrap HIC Selection Kit 160<br />

HiTrap IEX Selection Kit 160<br />

IEX Selection Kit 160<br />

PlasmidSelect Xtra Screening Kit 159–160<br />

PlasmidSelect Xtra Starter Kit 159–160<br />

Sephacryl High Resolution 98<br />

Sephacryl S-100 High Resolution 98–99, 257<br />

Sephacryl S-200 High Resolution 98–99, 258<br />

Sephacryl S-300 High Resolution 98–99, 258<br />

Sephacryl S-400 High Resolution 98–99, 258<br />

Sephacryl S-500 High Resolution 98–99, 258<br />

Sephadex 78–80<br />

Sephadex G-25 Coarse 98–99, 259<br />

Sephadex G-25 Fine 98–99, 259<br />

Sephadex G-25 Medium 98–99, 259<br />

Sephadex G-25 Superfine 98–99, 259<br />

Sephadex LH-20 98, 260<br />

Sepharose<br />

Sepharose 4B 260<br />

Sepharose 4 Fast Flow 98–99, 261<br />

Sepharose 6B 260<br />

Sepharose 6 Fast Flow 98–99, 261<br />

Sepharose CL-2B 99, 260<br />

Sepharose CL-4B 260<br />

Sepharose CL-6B 260<br />

Sepharose Fast Flow 89, 97–98<br />

Sepharose High Performance 89<br />

Service and support 216<br />

Fast Trak 220<br />

Literature 230<br />

Online regulatory and technical support 226<br />

Security of supply 229<br />

Service agreements 218<br />

Smart Asset Management Services (SAMS) 219<br />

System and column support 228<br />

Validation Services 224<br />

Single-use fluid management and filtration 52<br />

Slurry tanks 137<br />

Smart Asset Management Services (SAMS) 219<br />

Solid supports, oligosynthesis 214<br />

SOURCE 78, 81, 126<br />

SOURCE 15ETH 261<br />

SOURCE 15ISO 261<br />

SOURCE 15PHE 261<br />

SOURCE 15Q 79, 81, 262<br />

SOURCE 15RPC 95, 262<br />

SOURCE 15S 79, 81, 263<br />

SOURCE 30Q 81, 262<br />

SOURCE 30RPC 95, 262<br />

SOURCE 30S 81, 263<br />

SP Sepharose Big Beads 80, 160, 263<br />

SP Sepharose Fast Flow 81, 160, 264<br />

12<br />

276 www.gelifesciences.com/bioprocess

---

SP Sepharose High Performance 81, 160, 264<br />

SP Sepharose XL 81, 160, 265<br />

Start AXM and AXH cartridges 177<br />

Steam-in-place hollow fiber cartridges 188<br />

Sterile Tube Fuser 68<br />

SUM1 - Fast Trak course 222<br />

Superdex 30 prep grade 98–99, 265<br />

Superdex 75 prep grade 98–99, 265<br />

Superdex 200 prep grade 98–99, 265<br />

Supports, oligonucleotide synthesis 214<br />

SYS2 - Fast Trak course 222<br />

SYS3 - Fast Trak course 222<br />

System and column support 228<br />

System control - UNICORN 146<br />

Systems for chromatography 138<br />

ÄKTA avant 140<br />

ÄKTApilot 141<br />

ÄKTAprocess 142<br />

Customized <strong>BioProcess</strong> Solutions (CBS) 145<br />

Inline conditioning (IC) 144<br />

Systems for method and process development 162<br />

ÄKTA avant 162<br />

ÄKTApilot 162<br />

V<br />

VIISelect 101, 255<br />

Validation Services 224<br />

VIIISelect 86, 101, 256<br />

VWS1 - Fast Trak course 222<br />

W<br />

WAV1 - Fast Trak course 222<br />

WAVE Bioreactor systems 38<br />

WAVE Bioreactor 2/10 system 44<br />

WAVE Bioreactor 20/50 system 43<br />

WAVE Bioreactor 200 system 42<br />

WAVE Bioreactor 500/1000 system 41<br />

WAVE Mixer 50<br />

WAVEPOD II Integrated Controller 48<br />

X<br />

Xampler laboratory cartridges 180<br />

T<br />

Technical support online 105, 227<br />

Technique handbooks 230<br />

Terms and conditions of sale 268<br />

Trademarks 271<br />

Training programs 221<br />

Tube Sealer 69<br />

U<br />

ULTA Prime CG 191<br />

ULTA Prime GF 192<br />

ULTA Prime PP 193<br />

ULTA Pure HC 190<br />

ULTA Pure SG 189<br />

Ultrafiltration 166<br />

UNICORN control 146<br />

UNICORN DAQ software 47<br />

UniFlux systems 195<br />

Upstream and Downstream magazine 230<br />

Index and legal<br />

12<br />

www.gelifesciences.com/bioprocess 277

---

Notes

---

Notes

---

Notes

---

<strong>GE</strong> <strong>Healthcare</strong><br />

<strong>Life</strong> <strong>Sciences</strong><br />

For local office contact information, visit<br />

www.gelifesciences.com/contact<br />

www.gelifesciences.com/bioprocess<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> AB<br />

Björkgatan 30<br />

751 84 Uppsala<br />

Sweden<br />

imagination at work<br />

© 2012 General Electric Company – All rights reserved.<br />

First published Mar. 2012.<br />

<strong>GE</strong> <strong>Healthcare</strong> UK Ltd.<br />

Amersham Place<br />

Little Chalfont<br />

Buckinghamshire, HP7 9NA<br />

UK<br />

<strong>GE</strong> <strong>Healthcare</strong> Europe GmbH<br />

Munzinger Strasse 5<br />

D-79111 Freiburg<br />

Germany<br />

<strong>GE</strong> <strong>Healthcare</strong> Bio-<strong>Sciences</strong> Corp.<br />

800 Centennial Avenue<br />

P.O. Box 1327, Piscataway<br />

NJ 08855-1327<br />

USA<br />

<strong>GE</strong> <strong>Healthcare</strong> Japan Corporation<br />

Sanken Bldg., 3-25-1, Hyakunincho<br />

Shinjuku-ku, Tokyo 169-0073<br />

Japan<br />

29-0133-03 AB 03/2012